-
2006-05-02
10/060,425
2002-01-30
US 7,037,695 B2
2006-05-02
-
-
Manjunath Rao | Yong Pak
2023-03-03
The present invention relates to a method of assaying modulators of the interaction between Wolframin protein and its identified cellular binding partner.
Get notified when new applications in this technology area are published.
C12N9/00 IPC
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes
C12N15/00 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
C12N1/20 IPC
Microorganisms, e.g. protozoa; Compositions thereof ; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor Bacteria; Culture media therefor
C12Q1/00 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions
C07H21/04 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
This application claims the benefit of the following provisional application: application Ser. No. 60/266,385 filed Feb. 2, 2001 under 35 U.S.C 119(e)(1).
The present invention relates generally to the field of molecular biology. More particularly, the present invention relates to methods of assaying modulators of the interaction between Wolframin protein and a cellular binding partner which we have identified.
Wolfram's Syndrome and Wolframin
Wolfram Syndrome (WFS) or DIDMOAD (MIM222300) is an autosomal recessive disorder most frequently characterized by Diabetes Insipidis, juvenile Diabetes Mellitus, bilateral Optic Atrophy and sensoneural Deafness (Strom et al., Hum. Mol. Genetics. 7(13) 2021, 1998). Minimally, individuals presenting this syndrome have diabetes mellitus and optic atrophy, however, diabetes insipidous sensorineuronal deafness, urinary tract atony, ataxia, peripheral neuropathy, mental retardation and psychiatric illness also are observed in the vast majority of patients. A range of psychiatric conditions also have been associated with WFS, including dementia, psychosis, affective disorder, major depressive disorder, suicide and assaultive behavior. (Owen, Mol. Psychiatry, 3, 12, 1998; Swift et al., Am. J. Psychiatry, 148, 775, 1991).
Recently, WFS was linked to markers on chromosome 4p. On the basis of meiotic recombinant and disease associated haplotypes, the WFS1 gene was identified as Wolframin (WFS1). This gene codes for a predicted transmembrane protein (Wolframin protein) which is expressed in a variety of tissues including the brain and pancreas. The human transmembrane protein was described in 1998 (Strom et al., supra and Inoue et al. Nature Genetics 20, 121, 1998). The 890 amino acid protein corresponds to a predicted molecular weight of 100 kDa.
Loss of function mutations in both alleles of this gene are associated with the disease characteristics of WFS (Inoue et al., supra; Strom et al., supra). While the homozygous loss of function mutations in the WFS1 gene have been associated with WFS, individuals that are blood relatives of individuals manifesting WFS have a 26 fold greater predisposition to psychiatric illness, including depression and depressive disorders, than those individuals that are not genetically related to individuals suffering with WFS. The odds ratio reported, 26, estimates the risk of psychiatric hospitalization (for paraonoid delusions, progressive dementia, attempted suicides, hallucinations and violent and assaultive behavior, but most notably for depression) for a Wolfram syndrome gene carrier compared to a non-carrier. Given this estimate and the estimate that Wofram syndrome heterozygotes are 1% of the population, carriers of the gene maybe constitute approximately 25% of all persons hospitalized with similar psychiatric difficulties. (Swift et al., Mol. Psychiatry, 3, 86â91, 1998).
Wolframin protein by virtue of the convincing genetic evidence presented above is associated with a variety of health problems including diabetes insipidis, diabetes mellitus, and depression. While treatment of all diseases associated with Wolframin protein dysfunction are problematic, the treatment of depression poses particular difficulties. Numerous compounds have been developed to treat depression including for example serotonin re-uptake inhibitors (SSRI), such as sertraline (registered trademark ZOLOFT, Pfizer), fluoxetine (PROZACâEli Lilly), paroxetine (PAXILâSmith Kline Beecham) and fluvoxamine (LWOX); tricyclic antidepressants such as ELAVIL (Merck, Sharpe and Dohme), aminoketone antidepressants such as bupropion, and lithium, a metal used to treat bipolar disorder. However, these drugs are very potent, often generating problematic side effects such as lethargy, clouded thinking and a lack of ability to concentrate. A pressing need exists therefore for the identification of new molecular targets and assays employing those targets as methods of identifying compounds useful in the treatment of depression and other Wolframin protein associated diseases. The heretofore undisclosed assays detailed below address this need by providing for the assessment of small molecule modulators of the functional characteristics of the Wolframin protein.
U.S. Patents
The invention provides a method for identifying agents that modulate the propensity of a Wolframin protein polypeptide to associate with a carboxypeptidase E binding partner polypeptide comprising: (a) contacting said Wolframin protein polypeptide and said carboxypeptidase E binding partner polypeptide in the presence and absence of a test agent; (b) and determining the propensity of said Wolframin protein polypeptide to associate with a said binding carboxypeptidase E partner polypeptide in the presence and absence of the test agent; and (c) comparing the propensity of said Wolframin protein polypeptide to associate with said carboxypeptidase E binding partner polypeptide in the presence of the test agent with the propensity of said Wolframin protein polypeptide to associate with a said carboxypeptidase E binding partner polypeptide in the absence of the test agent.
The invention further provides a method of identifying agents which modulate the propensity of a Wolframin protein polypeptide to associate with a carboxypeptidase E binding partner polypeptide comprising the steps of: (a) contacting a cell with a test compound, wherein the cell comprises: i) a first fusion protein comprising a DNA binding domain and a Wolframin protein polypeptide ii) a second fusion protein comprising a transcriptional activating domain and a carboxypeptidase E protein or carboxypeptidase E protein fragment; wherein the interaction of the Wolframin protein polypeptide with the carboxypeptidase E protein or carboxypeptidase E protein fragment reconstitutes a sequence specific transcriptional activating factor; and iii) a reporter gene comprising a DNA sequence to which the DNA binding domain of the first fusion protein specifically binds; and (b) measuring the expression of the reporter gene, wherein a test compound that changes the level of expression of the reporter gene would be a potential drug for modulating Wolframin activity.
The invention further provides a method of identifying agents which modulate the propensity of a Wolframin protein polypeptide to associate with a carboxypeptidase E binding partner polypeptide comprising the steps of: (a) contacting a cell with a test compound, wherein the cell comprises: i) a first fusion protein comprising a transcriptional activating domain and a Wolframin protein polypeptide ii) a second fusion protein comprising a DNA binding domain and a carboxypeptidase E protein or carboxypeptidase E protein fragment; wherein the interaction of the Wolframin protein polypeptide with the carboxypeptidase E protein or carboxypeptidase E protein fragment reconstitutes a sequence specific transcriptional activating factor; and iii) a reporter gene comprising a DNA sequence to which the DNA binding domain of the first fusion protein specifically binds; and
(b) measuring the expression of the reporter gene; wherein a test compound that changes the level of expression of the reporter gene would be a potential drug for modulating Wolframin activity.
An agent that increases the propensity for Wolframin to associate with its binding partner is a potential drug for increasing Wolframin protein activity. A test compound that decreases the propensity for Wolframin to associate with its binding partner is a potential drug for decreasing Wolframin protein activity.
Because of the multiplicity neuroendocrine disturbances in patients presenting with Wolframin syndrome and those heterozygous for an altered Wolframin protein locus it has been postulated that Wolframin protein somehow plays a role in the processing of preprohormones. (Gabreels et al. J. Clin. Endocrinol Matab. 83(11) 4026-33 (1998).
We have recently made the exciting discovery that Wolframin protein associates with carboxypeptidase E in vivo and that the interaction has physiologic significance. Carboxypeptidase E, known also as carboxypeptidase H and enkephalin convertase, is involved in the processing of various bioactive peptides including peptide hormones and neurotransmitters (Fricker, in Peptide Biosynthesis and Processing) Fricker, ed. (pages 199â230 CRC Press, Boca Raton, Fla.) (1991). Many peptide hormones and neurotransmitters are initially produced as precursors that are enzymatically processed into bioactive peptides (Fricker J. Cell Biochem. 38:279â289 (1988)). Initially, prohormone convertases cleave the prohormone precursor at multiple basic amino acid cleavage sites (Varlamov et al. J. Biochem. 271:13981-13986) (1996). In general the site of proteolysis can be described by the consensus site (basic)Xn(basic), where X is any amino acid(s) other than Cys and n is 0, 2, 4 or 6. In general the prohormone convertases cleave at the C terminal side of the basic residues. A carboxypeptidase (principally CPE) then removes the basic amino acids from the C terminus of the peptide to generate either the bioactive product or a precursor to form the C-terminal amide group. This process is important for the production of bioactive peptides in many tissues. Carboxypeptidase E is present in many tissues where peptide biosynthesis occurs including brain, pituitary, and adrenal medulla (Fricker, J. Cell. Biochem., supra). The activity is localized to secretory granules where carboxypeptidase E exists in membrane and soluble forms (Manser et al. Biochem. J. 267:517â525 (1990)). Carboxypeptidase E does not appear to contain a transmembrane-spanning helical region, which suggests that carboxypeptidase E is membrane bound through another mechanism.
A mouse model of carboxypeptidase E dysfunction (Cpefat/Cpefat) has been described (Che et al. PNAS 98, 9971â9976 (2001)). In Cpefat/Cpefat mice a point mutation in carboxypeptidase E (Ser202âPro) leads to inactivation of the enzyme and degradation of carboxypeptidase E. The absence of carboxypeptidase activity causes the accumulation of C-terminally extended insulins, enkephalins, and other neuroendocrine peptides. Most of the identified peptides in brain arose from six proteins; proopiomelanocortin (POMC), proenkephalin, chromogranin B, secretogranin II, provasoppressin, and proSAAS. Current theories of the pathology of depression suggests that it results from dysfunctional adaptive responses to stress resulting in reduced neuronal plasticity and the atrophy and death of neurons in the hippocampus and prefrontal cortex. Neuropeptides play a crucial role in the adaptation and plasticity of neurons in response to stress and any impairment of the processing or secretion of these survival factors could result in predisposition to depression. (Duman R S et al. Biol. Psychiatry 46, 1181-91 (1999)). Increasing neuropeptide secretion in response to stress could restore neural plasticity by increase cell survival and function.
Recently interest has been generated by the proposal that carboxypeptidase E serves as a sorting receptor in neuroendocrine cells. The hypothesis is that carboxypeptidase E might control entry into secretory granules in a manner that is entirely independent of its enzymatic activity. The receptor like properties of carboxypeptidase E were largely inferred by identification its binding to the N terminus of POMC and by competitive displacement of this interaction by several regulated secretory proteins (proinsulin, proenkephalin and chromogranin A) but not by constitutive secretory proteins. (Cool et al. Cell, 88, 73â83, (1997)).
Our own experiments have specifically validated the functional relevance of the Wolframin protein, carboxypeptidase E interaction. It is known that membrane depolarization of PC12 cells results in carboxypeptidase E secretion. When Rat PC-12 cells were transfected with expression vectors encoding a Wolframin mutant polypeptide truncated at amino acid 136 regulated secretion of carboxypeptidase E was abolished.
We have also shown via immunohistochemical staining with antisera directed against Wolframin protein and carboxypeptidase E and in situ mRNA localization in rat brain slices that both proteins are found in common regions including the hippocampus, hypothalamus, amygdala and substantial nigra. When confocal miscroscopy is performed with labeled antisera directed to carboxypeptidase E and Wolframin protein we have demonstrated colocalization of the two proteins. Punctate staining suggesting localization in the endoplasmic reticulum (ER).
We have also used antisera to Wolframin protein to compare staining patterns in the hippocampus of depressed vs. normal human autopsy brains. Similar staining was observed in the neurons of both control and depressed brains, but staining of astrocytes was observed in 2 of 3 depressed brains, but in none of 3 controls. This suggests a disregulation of Wolframin localization in the hippocampus of depressed individuals. Because these patients were not known to harbor Wolframin protein mutations it suggests that depression might be ameliorated even in those having an unaltered Wolframin protein gene, by enhancing the interaction between Wolframin protein and carboxypeptidase E. The methods of the invention therefore encompass the use of both wild-type as well as mutant wolframin proteins.
General Definitions
The term âaboutâ is used herein when describing fragments of a polypeptide chain. In this context âaboutâ includes the particularly recited range and ranges larger or smaller by several, a few, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid residues at either extreme or at both extremes. By way of example, there may be mentioned polypeptides which comprise âaboutâ the first 100 amino terminal amino acids of a reference sequence. Such a polypeptide would comprise a polypeptide which has deleted several, a few, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid residues from the amino terminus and contains either plus or minus several, a few, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid residues at the carboxy terminus.
âCarboxypeptidase Eâ as used herein means a polypeptide species 99%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55% or at least 50% identity and/or homology over its entire length to the polypeptide set out in SEQ ID NO: 4. A preferred embodiment is a polypeptide species having at least 75% sequence identity with SEQ ID NO:4.
Percent amino acid sequence âidentityâ with respect to the polypeptide of SEQ ID NO: 4 is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the carboxypeptidase E sequence after aligning both sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. The term âcarboxypeptidase Eâ or âcarboxypeptidase E polypeptideâ is intended to encompass âcarboxypeptidase E binding partner polypeptidesâ as described below. When percent identity is calculated for âcarboxypeptidase E binding partner polypeptidesâ that are shorter than the full length of SEQ ID NO:4 it is done so without regard to the unmatched amino acids not encompassed within the fragment.
Percent sequence âhomologyâ with respect to the polypeptide of SEQ ID NO: 4 is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the carboxypeptidase E sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and also considering any conservative substitutions as part of the sequence identity. Percent homology is calculated as the percentage of amino acid residues in the smaller of two sequences which align with identical amino acid residue in the sequence being compared, when four gaps in a length of 100 amino acids may be introduced to maximize alignment [Dayhoff, in Atlas of Protein Sequence and Structure, Vol. 5, p. 124, National Biochemical Research Foundation, Washington, D.C. (1972), incorporated herein by reference]. The term âCarboxypeptidase Eâ as defined herein therefore, encompasses species homologs, sometimes referred to as âorthologs,â of the human protein. The rat, murine, alysia, and lophius orthologs are exemplified herein and are represented as SEQ ID NOS: 12, 14, 15 and 17 respectively. It should be noted that the carboxypeptidase E amino acid sequence is highly conserved and that most known orthologs share considerable sequence homology with the human protein. The rat, murine, alysia, and lophius orthologs of carboxypeptidase E have approximately 96%, 96%, 95%, and 76% identity respectively with the human amino acid sequence. (The alysia sequence is found in the databases in only its mature form but presumably exists as a longer sequence as well) The bovine sequence has been reported at Genbank accession number X04411 and appears to be the same as that reported for alysia at SEQ ID NO:15. However this bovine sequence differs considerably from the bovine sequence reported in WO0023784 and U.S. Pat. No. 6,248,527.
Because of the conserved nature of carboxypeptidase E polypeptides and nucleic acids an ordinarily skilled artisan has little difficulty in generating human or orthologous carboxypeptidase E. A preferred method is the polymerase chain reaction (PCR) of a template comprising a nucleic acid encoding the desired fragment and subsequent expression in a host cell. However, other methods including the purification of naturally occurring protein in tissue or cultured cells is contemplated.
The coding regions of polynucleotides encoding the human, rat, mouse and lophius carboxypeptidase E proteins are disclosed herein as SEQ ID NOS: 3, 11, 13, 16,. It should be noted that the rat, mouse and lophius encoding cDNA's are approximately 88, 88 and 70% identical to the human sequence. The ordinarily skilled artisan recognizes that because the polynucleotides encoding Wolframin protein are so conserved other orthologous species are easily obtainable either by designing suitable PCR primers from completely conserved areas or by the use of degenerate oligonucleotides.
The term âcarboxypeptidase E binding partner polypeptideâ as used herein means at least 50 contiguous amino acids, preferably at least 100 contiguous amino acids, more preferably at least 150 contiguous amino acids, and most preferably at least 200 or more contiguous amino acids of carboxypeptidase E (as defined above). wherein the fragment is capable of interacting with a Wolframin protein polypeptide and where the interaction is sufficiently strong to permit measurement of the association. It should be noted that by definition the term âcarboxypeptidase E binding partner polypeptideâ encompasses full length âcarboxypeptidase Eâ (as defined above). The term âcarboxypeptidase E binding partner polypeptideâ includes polypeptides having the preprosequence, prosequence, and also mature forms of carboxypeptidase E as described by Song and Fricker, Biochem. J. 323, 265â271 (1997). Representative embodiments reflecting processing at the N terminus include fragments of SEQ ID NO:4, 12, 14, which include amino acid residues 28â476, 28â280, 43â280 and 43â476. Other embodiments would include the mature alysia sequence (SEQ ID NO:15) and residues 21â258, 21â454 of the lophius sequence (The lophius sequence appear not to contain a prosequence). Methods of assessing the propensity of a polypeptide to associate with another polypeptide are well known in the art and illustrative examples are discussed. As a convenience âcarboxypeptidase E binding partner polypeptideâ may be referred to as a âbinding partner polypeptideâ in this specification.
The ordinarily skilled artisan recognizes that any given âcarboxypeptidase E binding partner polypeptideâ can be derived from either the human protein as exemplified by SEQ ID NO:4 or orthologs of the human protein as exemplified by SEQ ID NOS: 12, 14, 15 or 17. Because of the conserved nature of carboxypeptidase E polypeptides and nucleic acids an ordinarily skilled artisan has little difficulty in generating human or orthologous carboxypeptidase E binding partner polypeptides. A preferred method is the polymerase chain reaction (PCR) of a template comprising a nucleic acid encoding the desired fragment. The ordinarily skilled artisan recognizes that because the nucleic acids encoding carboxypeptidase E proteins are so conserved other orthologous species are easily obtainable either by designing PCR primers from completely conserved areas or by the use of degenerate oligonucleotides.
The term âconservativeâ amino acid substitution or change as used within this invention is meant to refer to amino acid substitutions which substitute functionally equivalent amino acids. Conservative amino acid changes result in silent changes in the amino acid sequence of the resulting protein. For example, one or more amino acids of a similar polarity act as functional equivalents and result in a silent alteration within the amino acid sequence of the protein. Conservative amino acid substitution have been defined as the amino acid substitutions set forth in Table 1 on page 240 of Taylor, W. R., (1986) J. Mol. Biol. 188:233â258. The largest sets of conservative amino acid substitutions include:
In addition, structurally similar amino acids can substitute for some of the specific amino acids. Groups of structurally similar amino acids include: (Ile, Leu, and Val); (Phe and Tyr); (Lys and Arg); (Gin and Asn); (Asp and Glu); and (Gly, and Ala). Exemplary conservative amino acid substitutions are preferably made in accordance with the following: Gly or Ser for Ala; Lys for Arg; Gln or His for Asn; Glu for Asp; Ser for Cys; Asn for Gln; Asp for Glu; Ala or Pro for Gly; Asn or Gln for His; Leu or Val for Ile; Ile or Val for Leu; Arg, Gln, or Glu for Met; Met, Leu or Tyr for Phe; Thr for Ser; Ser for Thr; Tyr for Trp; Trp or Phe for Tyr; Ile or Leu for Val.
As used herein, the term âcontactingâ means bringing together, either directly or indirectly, a test agent into physical proximity to a polypeptide used in the invention. Additionally âcontactingâ may mean bringing a polypeptide of the invention into physical proximity with another polypeptide used in the the invention. In the context of whole cell assays it specifically contemplated that âcontactingâ may include growing the cells in the presence of a test agent or may mean simply exposing the cell to the test agent in a transient fashion.
As used herein, âDNA-binding domainâ means an amino acid sequence that binds specifically to a particular DNA sequence. The site where the DNA-binding domain binds is known as a DNA binding site.
âIsolatedâ as used herein and as understood in the art, whether referring to âisolatedâ polynucleotides or polypeptides, is taken to mean separated from the original cellular environment in which the polypeptide or nucleic acid is normally found. As used herein therefore, by way of example only, a protein expressed by recombinant means in a cell type in which it does not naturally occur is âisolatedâ. By way of example, a protein species, whether expressed in a naturally occurring cell or not, when purified to any extent is âisolatedâ.
As used hereinafter âpolynucleotideâ generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. âPolynucleotidesâ include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, âpolynucleotideâ refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term âpolynucleotideâ also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. âModifiedâ bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications may be made to DNA and RNA; thus, âpolynucleotideâ embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. âpolynucleotideâ also embraces relatively short polynucleotides, often referred to as oligonucleotides.
As used hereinafter âpolypeptideâ refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres. âPolypeptideâ refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. âPolypeptidesâ include amino acid sequences modified either by natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art. Glycosylated and non-glycosylated form of polypeptides are embraced by this definition.
By âreporter geneâ is meant a gene whose expression may be assayed; such genes include without limitation, beta-glucuronidase (GUS), luciferase, chloramphenicol transacetylase (CAT), and beta-galactosidase.
âSynthesizedâ or âsyntheticâ as used herein and understood in the art, refers to polynucleotides or polypeptides produced by purely chemical, as opposed to enzymatic, methods. âWhollyâ synthesized DNA or polypeptide sequences are therefore produced entirely by chemical means, and âpartiallyâ synthesized or synthetic DNAs or polypeptides embrace those wherein only portions of the resulting DNA or polypeptide were produced by chemical means.
The term âtest agentâ means any means identifiable natural or synthetic chemical or molecule, including, but not limited to a small molecule, peptide, protein, sugar, nucleotide, or nucleic acid which is assessed for its ability to modulate the propensity of a Wolframin protein polypeptide to associate with a carboxypeptidase E binding partner polypeptide.
As used herein, âtranscriptional activation domainâ means an amino acid sequence which when in proximity to transcriptional regulatory DNA elements of a target gene, activates gene transcription.
âWoframin proteinâ or âWoframin protein polypeptideâ as used herein means a polypeptide species having at least 99%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55% or at least 50% identity and/or homology over its entire length to the polypeptide set out in SEQ ID NO: 2 wherein the polypeptide species is capable of interacting with a carboxypeptidase E binding partner polypeptide and where the interaction is sufficiently strong to permit measurement of the interaction. While the term âWolframin proteinâ or Wolframin protein polypeptide is intended to encompass fragments it also includes within its definition âfull length Wolframin proteinâ which has been described by Strom et al., Hum. Mol. Genetics. 7(13) 2021, 1998 and A preferred embodiment is a polypeptide species having at least 80% sequence identity with SEQ ID NO:2. Another preferred embodiment is a polypeptide species having at least 85% sequence identity with SEQ ID NO:2.
Percent amino acid sequence âidentityâ with respect to the polypeptide of SEQ ID NO: 2 is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the Wolframin protein sequence after aligning both sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. The term âWolframin proteinâ or Woframin protein polypeptide is intended to encompass Wolframin protein fragments as described below. When percent identity is calculated for a Wolframin protein fragment it is done so without regard to the unmatched amino acids not encompassed within the fragment.
Percent sequence âhomologyâ with respect to the polypeptide of SEQ ID NO: 2 is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the Wolframin protein sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and also considering any conservative substitutions as part of the sequence identity. Percent homology is calculated as the percentage of amino acid residues in the smaller of two sequences which align with identical amino acid residue in the sequence being compared, when four gaps in a length of 100 amino acids may be introduced to maximize alignment [Dayhoff, in Atlas of Protein Sequence and Structure, Vol. 5, p. 124, National Biochemical Research Foundation, Washington, D.C. (1972), incorporated herein by reference].
The term âWolframin proteinâ as defined herein therefore, encompasses species homologs, sometimes referred to as âorthologs,â of the human protein. The rat and murine orthologs are exemplified herein and are represented as SEQ ID NOS: 8 and 10 respectively. It should be noted that Wolframin protein is highly conserved and that known orthologs share considerable sequence homology with the human protein. By way of example the rat and mouse Wolframin proteins have approximately 86% identity with the human amino acid sequence.
Because of the conserved nature of Wolframin proteins and nucleic acids an ordinarily skilled artisan has little difficulty in generating human or orthologous Wolframin proteins. A preferred method is the polymerase chain reaction (PCR) of a template comprising a nucleic acid encoding the desired fragment and subsequent expression in a host cell. However, other methods including the purification of naturally occuring protein in tissue or cultured cells is contemplated.
The coding regions of polynucleotides encoding the human, rat and mouse Wolframin proteins are disclosed herein as SEQ ID NOS: 1, 7 and 9. It should be noted that the rat and mouse encoding cDNA's are approximately 84% identical to the human sequence. The ordinarily skilled artisan recognizes that because the polynucleotides encoding Wolframin protein are so conserved other orthologous species are easily obtainable either by designing suitable PCR primers from completely conserved areas or by the use of degenerate oligonucleotides.
The mutations listed in Table 1 below have been derived from samples derived from patients exhibiting either symptoms of DIDMOAD if in the homozygous state or depression or anxiety if in the heterozygous state. However, it is to be appreciated that such mutations may not be causative of a disease state. That is, other mutations in such patients outside the coding region may cause loss of Wolframin function (in promoter or regulatory regions for example). The invention is intended to make use of Wolframin protein mutants either heretofore described or newly discovered exhibiting wild type activity or as well as those resulting in modification of the functional characteristics of the protein. One goal of the present invention is to find compounds which alleviate the symptoms of Wolframin disease when such a treatment is possible (i.e. the patient makes a Wolframin protein with altered characteristics as opposed to complete loss absence of a protein) as well as finding compounds which enhance the natural function of wild type Wolframin protein
| TABLE 1 |
| Summary of Published Mutations in WS patients |
| resulting in Amino Acid Changes |
| Type of | Nucleotide | AA | ||
| Mutation | Exon | Change | Change | Reference |
| Missense | 5 | G to A | E169K | Hardy et al |
| Mutations | 8 | C to T | P724L | Inoue et al |
| 8 | G to T | G695V | Inoue et al | |
| 8 | C to T | PS04L | Inoue et al | |
| 8 | A to G | Y869C | Strom et al | |
| 8 | G to C | G437A | Hardy et al | |
| 8 | C to A | C736S | Hardy et al | |
| 8 | C to T | P885L | Hardy et al | |
| 8 | C to T | P292S | Hardy et al | |
| 8 | T to C | C690R | Hardy et al | |
| 8 | A to G | R456H | Inoue et al | |
| 8 | G to A | H611R | Inoue et al | |
| 8 | T to G | M312R | Torres et al | |
| 8 | G to A | M518I | Torres et al | |
| 8 | G to A | G786S | Torres et al | |
| 8 | G to A | D866N | Torres et al | |
| 8 | C to T | R558C | Torres et al | |
| 8 | C to T | R772C | Torres et al | |
| 8 | C to T | A602V | Torres et al | |
| 8 | G to A | V871M | Torres et al | |
| 8 | G to A | G576S | Torres et al | |
| 8 | C to T | R818C | Torres et al | |
| 8 | C to G | L432V | Torres et al | |
| 8 | G to A | A559T | Torres et al | |
| 8 | A to G | D771G | Torres et al | |
| 8 | G to A | V441M | Torres et al | |
| 8 | G to A | C426Y | Torres et al | |
| 8 | G to A | A559T | Torres et al | |
| 8 | G to A | A586T | Torres et al | |
| 8 | G to A | E717K | Torresetal | |
| Inframe | 8 | 15 bp deletion | del508YVYLL | Inoue et al |
| deletions/ | 8 | 9 bp deletion | del480 | Strom et al |
| insertions | 8 | 24 bp insertion | ins721 | Strom et al |
| 8 | 6 bp deletion | del567LE | Hardy et al | |
| 8 | 3 bp deletion | del415V | Hardy et al | |
| 8 | 3 bp deletion | del354F | Hardy et al | |
| Nonsense | 4 | C to T | Glu136X | Strom et al |
| Mutations | 6 | C to T | Q226X | Inoue et al |
| 8 | G to A | W648X | Hardy et al | |
| 8 | C to T | Q366X | Strom et al | |
| 8 | C to T | Q819X | Strom et al | |
| 8 | C to T | Q520X | Strom et al | |
| 8 | G to A | Trp478X | Hardy et al | |
| 8 | C to T | Gln668X | Hardy et al | |
| 8 | C to A | Tyr302X | Hardy et al | |
| 8 | C to T | Gln667X | Hardy et al | |
| 8 | G to T | Glu273X | Hardy et al | |
| 8 | G to T | Glu752X | Hardy et al | |
| Frameshift | 5 | 1-bp deletion | del200fs | Strom et al |
| insertion/deletion | 8 | 2-bp deletion | del882fs/ter937 | Inoue et al |
| 8 | 7-hp insertion | ins483fs/ter544 | Inoue et al | |
| 8 | 2-hp deletion | del508fs | Strom et al | |
| 8 | 1-hp deletion | del517fs/terS21 | Hardy et al | |
| 8 | 14-hp deletion | del537fs | Hardy et al | |
| 8 | 1-hp deletion | del812fs/ter861 | Hardy et al | |
| 8 | 4-hp deletion | readthrough/ | Hardy et al | |
| 949 | ||||
| Splicing mutation | 4 | G to A | 5Ⲡsplice signal | Strom et al |
The invention provides methods of assessing Wolframin protein function and thus provides a rapid means of assessing the functionality of naturally occurring as well as non-naturally occurring Wolframin protein mutants.
It is specifically contemplated that the invention makes use of both âWolframin protein fragmentsâ and full length species of Wolframin protein. The term âWolframin proteinâ encompasses Wolframin protein fragments. The term âWolframin protein fragmentâ as used herein means at least 50 contiguous amino acids, at least 100 contiguous amino acids, at least 150 contiguous amino acids, at least 200 contiguous amino acids, at least 250 contiguous amino acids, or at least 300 or more contiguous amino acids of Wolframin protein, wherein the fragment is capable of interacting with a carboxypeptidase E binding partner polypeptide and where the interaction is sufficiently strong to permit measurement of the association.
It is recognized that a fragment lacking transmembrane domains is often particularly useful when dealing with a protein such as Wolframin protein because of its ease of handling and enhanced solubility characteristics. Transmembrane regions can be identified by computer programs well known in the art. Two such programs are exemplified by TMHMM (Sonnhammer 1998) and TMPRED (Parodi 1994).
The transmembrane helices predicted by TMHMM and the consensus method of TMPRED are located in the following regions of the human WFS 1:
TM# TMHMM TMPRED(consensus)
| TM # | TMHMM | TMPRED (consensus) |
| I | 311â333 | 307â326 |
| II | 340â362 | 332â356 |
| III | 405â423 | 402â421 |
| IV | 430â448 | 427â446 |
| V | 463â481 | 462â481 |
| VI | 494â516 | 495â516 |
| VII | 531â549 | 531â555 |
| VIII | 562â584 | 564â588 |
| IX | 588â610 | 594â613 |
| X | 630â652 | 629â651 |
| XI | 871â890 | |
A fragment lacking transmembrane domains therefore is easily designed for the human sequence as well as orthologs. Such a fragment would contain about the first 313 amino terminal amino acids. Another embodiment contains about the first 242 amino terminal amino acids. Another embodiment contains about the first 135 amino acids. Methods of assessing the propensity of a polypeptide to associate with another polypeptide are well known in the art and illustrative examples are discussed. A âWolframin protein fragmentâ may comprise either wild type contiguous amino acids or may encompass one or more mutated amino acids and contiguous amino acids derived from the Wolframin protein sequence as exemplified by âWolframin protein mutantsâ.
The ordinarily skilled artisan recognizes that any given âWolframin protein fragmentâ can be derived from either the human protein as exemplified by SEQ ID NO:2 or orthologs of the human protein as exemplified by SEQ ID NO:8 and 10. Because of the conserved nature of Wolframin proteins and nucleic acids an ordinarily skilled artisan has little difficulty in generating fragments of human or orthologous Wolframin proteins. A preferred method is the polymerase chain reaction (PCR) of a template comprising a nucleic acid encoding the desired fragment. The ordinarily skilled artisan recognizes that because the nucleic acids encoding Wolframin protein are so conserved other orthologous fragment species are easily obtainable either by designing PCR primers from completely conserved areas or by the use of degenerate oligonucleotides.
Wolframin protein is likely to physically bind to a binding partner polypeptide either in a direct manner or via a bridging molecule to mediate its effects within the cell. Thus, assays which monitor Wolframin binding partner binding are of value in screening for Wolframin protein modulators. Administration of an efficacious dose of an agent capable of specifically modulating the interaction between Wolframin protein and its natural binding partner can be used as a therapeutic or prophylactic method for treating pathological conditions (e.g., major depression, bipolar disorder, general anxiety disorder, obsessive compulsive disorder, panic disorder, diabetes insipidus, diabetes mellitus, optic atrophy and deafness) It is specifically contemplated that agents found by these methods and other methods hereinafter described will be useful for modulating the interaction of Wolframin point mutants with carboxypeptidase E as well as modulating the interaction of the wild type protein with carboxypeptidase E.
As noted above we have identified carboxypeptidase E as a binding partner for the Wolframin protein. The identity of specific proteins which interact with full length Wolframin protein or a Wolframin protein fragment could have been assessed in a variety of ways. To determine the identity of proteins that associate with Wolframin protein, we chose a yeast two-hybrid procedure with a Wolframin protein fragment as the âbaitâ and a cDNA library or an brain cDNA library as the âpreyâ. While we performed such experiments to determine the identity of at least one binding partner of Wolframin protein, it should be recognized that once an interaction is determined a cell expressing both interacting species can then form the basis for a screening system to assess the ability of compounds to modulate the strength of the interaction.
The construction of yeast two-hybrid systems is generally known. This approach identifies protein-protein interactions in vivo through reconstitution of a transcriptional activator (Fields and Song (1989) Nature 340: 245). In the typical yeast 2-hybrid system, protein A is expressed as a fusion protein with the DNA binding domain of Gal4 or lexA and protein B is expressed as a fusion protein with an activation domain, typically a region of acidic amino acids derived from Gal4 or VP16. An interaction between proteins A and B reconstitutes a transactivation function that is observed by expression of a reporter gene (e.g., LacZ, HIS3, URA3). The expression of the reporter gene is regulated by the placement of Gal4 binding sites or lexA operator sites upstream of the reporter coding region.
Typically, the two hybrid method is used to identify novel polypeptide sequences which interact with known protein (Silver S C and Hunt S W (1993) Mol. Biol. Rep. 17: 155; Durfee et al. (1993) Genes Devel. 7; 555; Yang et al. (1992) Science 257: 680; Luban et al. (1993) Cell 73: 1067; Hardy et al. (1992) Genes Devel. 6; 801; Bartel et al. (1993) Biotechniques 14: 920; and Vojtek et al. (1993) Cell 74: 205). As applied to the present case, the two-hybrid system permits identification of polypeptide peptide sequences which interact with Wolframin protein, and are therefore, potential Wolframin binding partners.
Yeast comprising (1) an expression cassette encoding a GALA or lexA DNA binding domain (or GAL4 or lexA activator domain) fused to a binding fragment of Wolframin protein capable of binding to a partner protein (2) an expression cassette encoding a GAL4 DNA activator domain (or GALA or lexA binding domain, respectively) fused to a member of a cDNA library or a binding fragment of a DNA polymerase capable of binding to a mammalian DNA Wolframin protein polypeptide, and (3) a reporter gene (e.g., beta-galactosidase) comprising a cis-linked GAL4 or lexA transcriptional response element can be used for agent screening. Such yeast are incubated with a test agent and expression of the reporter gene (e.g., beta-galactosidase) is determined; the capacity of the agent to inhibit expression of the reporter gene as compared to a control culture identifies whether the candidate agent is a Wolframin modulating agent.
Yeast two-hybrid systems may be used to screen a mammalian (typically human) cDNA expression library, wherein human cDNA is fused to a GAL4 or lexA DNA binding domain or activator domain, and a Wolframin polypeptide sequence or fragment is fused to a GAL4 or lexA activator domain or DNA binding domain, respectively. Such a yeast two-hybrid system can screen for cDNAs that encode proteins which bind to Wolframin protein sequences (binding partner polypeptides). For example, a cDNA library can be produced from mRNA from a embryonic or other suitable cell type. Such a cDNA library cloned in a yeast two-hybrid expression system (Chien et al. (1991) Proc. Natl. Acad. Sci. (U.S.A.) 88: 9578) can be used to identify cDNAs which encode proteins that interact with Wolframin protein and thereby produce expression of the GALA or lexA-dependent reporter gene.
Example 1 outlined below details the methodology used to determine that carboxypeptidase E is a binding partner for Wolframin protein.
Once carboxypeptidase E was identified as a binding partner, we appreciated that cells expressing the interacting proteins in a two hybrid format can themselves form the basis of a screen The invention therefore provides hybrid screening assays and related host organisms (typically unicellular organisms) which harbor a mammalian Wolframin protein two-hybrid system, typically in the form of polynucleotides encoding a first hybrid protein, a second hybrid protein, and a reporter gene, wherein said polynucleotide(s) are either stably replicated or introduced for transient expression. In one embodiment, the host organism is a yeast cell (e.g., Saccharomyces cervisiae) in which the reporter gene transcriptional regulatory sequence comprises a Gal4-responsive promoter. This high throughput system is detailed in Example 2.
Additional methodology can be performed to eliminate the likelihood of artifacts in the screening process and is detailed below in Example 3.
Many DNA binding domains and transcriptional activating domains can be used in this invention including without limitation the DNA binding domains of GAL4, LexA, and the human estrogen receptor paired with the acidic transcriptional activating domains of GALA or the herpes virus simplex protein VP16 (See, e.g.,. Hannon et al., Genes Dev. 7, 2378, 1993; Zervos et al., Cell 72, 223, 1993; A. B. Vojtek et al., Cell 74, 205, 1993; Harper et al., Cell 75, 805, 1993; Douarin et al., Nucl. Acids Res. 23, 876, 1995). A number of plasmids known in the art can be constructed to contain the coding sequences for the fusion proteins using standard laboratory techniques for manipulating DNA. Suitable detectable reporter genes include the E. coli lacZ gene, whose expression may be measured colorimetrically (see, e.g., Fields and Song, supra), and yeast selectable genes such as HIS3 (Harper et al., supra; Vojtek et al., supra; Hannon et al, supra) or URA3 (Le Douarin et al., supra). Methods for transforming cells are also well known in the art. See, e.g., A. Hinnen et al., Proc. Natl. Acad. Sci. U.S.A. 75, 1929â1933, 1978. The test compound may comprise part of the cell culture medium or it may be added separately. The tester cell need not be a yeast cell, but may be a bacterial, other fungal, or mammalian cell.
A two-hybrid system useful in bacteria is based on a methodology developed by Dove et al. of Harvard Medical School (1997), Nature 386: 627â630 and Dove, S. L. and Hochschild, A., (1998) Genes & Development 12:745â754). The method can be purchased in kit form from Stratagene and is designated the âBacterioMatch⢠two-hybrid systemâ. The system is also based on transcriptional activation: A protein of interest (the bait) is fused to the full-length bacteriophage Îť cI protein (Îť cI), containing the amino-terminal DNA-binding domain and the carboxyl-terminal dimerization domain. The corresponding target protein is fused to the N-terminal domain of the a-subunit of RNA polymerase. The bait is tethered to the 1 operator sequence upstream of the reporter promoter through the DNA-binding domain of Îť cI. When the bait and target interact, they recruit and stabilize the binding of RNA polymerase close to the promoter and activate the transcription of a reporter gene, which in our case is the AmpR gene. A second reporter gene, β-galactosidase, is expressed from the same activatable promoter, providing an additional mechanism to validate the bait and target interaction.
Mammalian two hybrid systems have been described. Representative systems are described in U.S. Pat. Nos. 6,316,223 and 6,251,676 (herein incorporated by reference). A mammalian two hybrid system can also be purchased as a kit (Stratagene's Mammalian Two-Hybrid assay kit) which is based on methodology developed by Dang et al. (1991) Mol. Cell Biol. 11:954â962. In this kit the protein of interest, or bait, is expressed as a fusion protein with the GALA DNA binding domain, and the target protein is expressed with the NF-ÎşK activation domain. If the bait and target proteins interact, the activation domain is brought together with the DNA binding domain with subsequent transcriptional activation of the luciferase reporter gene.
It will be appreciated that in-vivo systems can be used to assess a protein-protein interaction like that between a Wolframin protein and its binding partner other than those making use of a DNA binding domain and a transcriptional activation domain. By way of non-limiting example U.S. Pat. No. 5,776,689 (herein incorporated by reference) entitled âProtein Recruitment Systemâ describes a system wherein Protein-protein interactions in the cytoplasm are detected by recruitment of the human Sos gene product (hSos) to the membrane of the cell where it activates the Ras pathway. A commercial system, the âCytoTrap⢠systemâ (Stratagene), uses a unique yeast strain which contains a temperature-sensitive mutation in the cdc25 gene, the yeast homologue for hSos. This protein, a guanyl nucleotide exchange factor, is essential for activation of the Ras pathway and ultimately for the survival and growth of the cell. The mutation in the cdc25 protein is temperature sensitive; the cells can grow at 25° C. but not at 37° C. This cdc25 mutation can be complemented by the hSos gene product to allow growth at 37°, providing that the hSos protein is localized to the membrane via a protein-protein interaction.
Example 1, 2 and 3 discussed above are presented below.
Vector Construction
The DNA encoding amino acids 1 through 306 of human Wolframin fragment was amplified by PCR from the human WFS 1 DNA sequence using primers designed to create an EcoR1 site on the 5Ⲡend of the sequence and a Not1 site on the 3Ⲡend of the sequence. The forward primer used was 5â˛GATCGAATTCATGGACTCCAACAC-TGCTC3Ⲡcorresponding to bases 1 through 19 of the WFS1 sequence, and the reverse primer used was 5â˛GATCGCGGCCGCCATGTCAATCAGGTACTC3Ⲡcorresponding to bases 900 through 918 of the WFS1 sequence. Primers were synthesized by Sigma/Genosys Corp., The Woodlands, Tex. PCR reactions were assembled using the components of the Expand Hi-Fi PCR System⢠(Roche Molecular Biochemicals, Indianapolis, Ind.). The following cycling program was executed: Pre-soak at (94° for 3 min.) followed by 25 cycles of [(94° for 45 sec.) then (55° C. for 1 min.) then (72° for 45 sec.)]. The resulting 918 bp PCR product was purified using a Qiagen rapid spin column (Qiagen Inc., Valencia, Calif.), and digested with the restriction enzymes EcoR1 and Not1 (New England Biolabs, Beverly, Mass.). The digested PCR product was then ligated into the yeast two hybrid expression vector pLexA (Clonetech Labs, Palo Alto, Calif.) to create an in-frame fusion with the DNA binding domain encoded by the plasmid. The accuracy of the resulting construct, pLexA-WFS, was confirmed by DNA sequence analysis.
Yeast Two Hybrid Screening
The yeast host strain EGY48 was transformed with the β-galactosidase reporter plasmid p8op-lacZ and pLexA-WFS. Yeast carrying both plasmids were selected by growth on yeast minimal medium lacking the nutrients uracil and histidine. The resulting yeast strain, EGY48[(p8op-lacZ)( pLexA-WFS)] was then transformed with a human brain cDNA library constructed in the yeast two hybrid vector pB42AD (Clonetech Labs, Palo Alto, Calif.). Transformants were selected on yeast minimal media lacking the nutrients uracil, histadine and tryptophan. Interactions between the WFS fusion protein and clones represented in the human brain library were detected by selection on yeast minimal medium lacking glucose, but containing galactose and rafinose as a carbon source, the β-galactosidase indicator X-gal, and lacking the nutrients uracil, histadine, tryptophan and leucine. A positive interaction is indicated by the growth of the colony in medium lacking leucine, and a blue color reaction. Leucine+, blue colonies were selected. Plasmids were recovered by selected colonies using the Zymoprep kit from Zymo Research, Orange, Calif. The library plasmid encoding fusion protein in the vector pB42AD was transformed to the E.coli host strain KC8 and selection on medium lacking tryptophan. The DNA sequence of the fusion protein was determined.
Results
One of the plasmids identified from this screen as encoding a protein which would interact with the N-terminal 306 amino acids of Wolframin protein was found to encode a portion of the peptidase carboxypeptidase-E. The clone consisted of the carboxypeptidase-E sequence between base pairs 232 and 840 (amino acids to 78 to 280). Additional experimentation has shown that putting a stop codon at position 136 (a clone containing only the first 135 amino terminal amino acids of Wolframin protein) is sufficient to mediate an interaction with the same carboxypeptidase E binding partner polypeptide. It is to be appreciated that even shorter fragments (and obviously longer ones as well) likely are capable of mediating this interaction.
Carboxypeptidase-E (also known as carboxypeptidase-H or enkephalin convertase) is an exopeptidase that cleaves neuropeptides with C-terminal basic amino acids, producing an active form of the peptide. It also functions as a sorting receptor for hormones and neuropeptides in the regulated secretory pathway. Mutations in Wolframin may affect its interaction with carboxypeptidase E. This could subsequently affect carboxypeptidase E function in the sorting and processing of secreted proteins (including vasopressin, POMC, BDNF and insulin).
To develop a high throughput screen based on the two-hybrid system, a procedure is devised similar to that described in U.S. Pat. No. 6,127,521 to quantitate protein-protein interaction mediated by a small molecule. Since protein-protein interaction in the two-hybrid system stimulates transcription of the lacZ reporter gene, the assay utilizes a substrate of beta-galactosidase (the lacZ gene product lacZ gene product) which when cleaved produces a chemiluminescent signal that can be quantitated. This assay can be performed in microtiter plates, allowing thousands of compounds to be screened per week.
The assay includes the following steps:
Such an assay can yield different classes of modulator compounds including (i) agonist compounds, those that enhance the interaction between a Wolframin protein and carboxypeptidase E, (ii) antagonist compounds, or those that diminish the strength of the interaction between Wolframin protein and carboxypeptidase E.
The protein interactions mediated by the test compounds and measured in this assay can be correlated with antidepressant activity in animal models well known in the art or confirmed by biochemical assays to directly assess the interaction of Woframin protein and carboxypeptidase E.
Using the quantitative chemiluminescence assay described above, the interaction of Wolframin protein and carboxypeptidase E can be analyzed in the presence and absence of potential modulator compounds. Interaction between Wolframin protein and carboxypeptidase E can be measured as a function of drug concentration.
Ideally the basal levels of beta-galactosidase in the negative controls are 0.1 per cent or less of the maximum levels detected in the yeast strain containing the Wolframin protein and carboxypeptidase E constructs.
A decrease in the level of beta-galactosidase in the cell in the presence of a compound relative to a parallel sample incubated in the absence of compound indicates the compound is an antagonist. An increase in the level beta-galactosidase in the cell in the presence of a compound relative to a parallel sample incubated in the absence of compound indicates the compound is an agonist.
In order to identify negative modulators of the interaction between Woframin protein and carboxypeptidase E the counterselection/ cycloheximide sensitivity method of Young et al. can be utilized. Young, K et al. Nature Biotechnology 16 946â950 (1998). This method has the advantage of eliminating artifactual elimination of compounds which demonstrate some toxicity at high doses, but desireable effects at lower concentrations.
In this method the the negative selection marker CHY2 is cloned such that its expression is controlled by the LexA operator. Expression of this reporter gene confers toxicity in particular yeast backgrounds when the cells are incubated on cyclohexamide plates. When this yeast strain also expresses wolframin in the pLexA vector and the carboxypeptidase e in the pB42AD vector, the interaction of wolframin and carboxypeptidase E will result in the expression of the CHY2 gene resulting inhibition of cell growth in the presence of cyclohexamide. These yeast are plated on agar media containing cyclohexamide and compounds to be screened spotted on the plates. Any compound which disrupts the wolframin:carboxypeptidase E interaction will result in inhibition of CHY2 expression and allow cell growth. This agar diffusion format provides an inherent compound titration gradient upon a single point compound application. Thus compounds which demonstrate some toxicity at high doses, but desireable effects at lower concentrations are not discarded as false negatives.
In designing assays to assess the association of Wolframin protein with carboxypeptidase E it is often desirable to obtain isolated preparations of both polypeptides. Obtaining isolated samples of Wolframin and Carboxypeptidase E are both easily accomplished by the ordinarily skilled artisan.
Isolated Wolframin protein can be obtained in several different ways; by purification from membrane extracts from normal cells or tissues, or from cells that have been genetically engineered to overexpress Wolframin protein by conventional purification procedures. Alternatively, fragments of Wolframin protein can be recombinantly expressed and purified. Generally it is anticipated that the Wolframin protein will be found primarily embedded in the membranes fraction of cells which express it. However it is appreciated that DNA constructs which encode Wolframin protein fragments lacking transmembrane domains would likely find their way to the cytosol. Wolframin protein can be isolated by way of non-limiting example by any of the methods below.
Separation of Wolframin protein and succeeding purification may be conducted utilizing means which have been commonly used for the purification of membrane proteins. For example, a method wherein a cell membranes are solubilized using detergents followed by purification with various chromatographic means is a known technique which may be employed in the present invention.
Purification of Wolframin polypeptide or Wolframin protein fragments can be accomplished using a variety of techniques. If the polypeptide has been synthesized such that it contains a tag such as Hexahistidine (Wolframin protein/hexaHis) or other small peptide such as FLAG (Eastman Kodak Co., New Haven, Conn.) or myc (Invitrogen, Carlsbad, Calif.) at either its carboxyl or amino terminus, it may essentially be purified in a one-step process by passing the solution through an affinity column where the column matrix has a high affinity for the tag or for the polypeptide directly (i.e., a monoclonal antibody specifically recognizing wolframin protein). For example, polyhistidine binds with great affinity and specificity to nickel, thus an affinity column of nickel (such as the Qiagen Registered TM nickel columns) can be used for purification of Wolframin/polyHis. (See for example, Ausubel et al., eds., Current Protocols in Molecular Biology, Section 10.11.8, John Wiley & Sons, New York [1993]).
Even if the Wolframin protein is prepared without a label or tag to facilitate purification. The Wolframin protein or Wolframin protein fragments of the invention may be purified by immunoaffinity chromatography. To accomplish this, antibodies specific for the Wolframin protein must be prepared by means well known in the art. Antibodies generated against the Wolframin protein are prepared by administering the polypeptides or epitope-bearing fragments, analogues or cells to an animal, preferably a nonhuman, using routine protocols. By way of example, both the N-terminal (aa2-242) and C-terminal hydrophilic (aa 651-864) domains of Wolframin protein and been cloned and expressed in E.coli as 6X-His fusion proteins. These fusion proteins have been purified and used to produce rabbit antisera to Wolframin protein. Western blotting demonstrated that these antisera recognize Wolframin protein when overexpressed in tissue culture, and could also be used to immuneprecipitate a protein of the expected molecular weight from rat hippocampus. For preparation of monoclonal antibodies, any technique known in the art that provides antibodies produced by continuous cell line cultures can be used. Examples include various techniques, such as those in Kohler, G. and Milstein, C., Nature 256: 495â497 (1975); Kozbor et al., Immunology Today 4: 72 (1983); Cole et al., pg. 77â96 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. (1985).
Where the Wolframin protein or Wolframn protein fragment is prepared without a tag attached, and no antibodies are available, other well known procedures for purification can be used. Such procedures include, without limitation, ion exchange chromatography, affinity chromatography, molecular sieve chromatography, HPLC, native gel electrophoresis in combination with gel elution, and preparative isoelectric focusing (âIsoprimeâmachine/technique, Hoefer Scientific). In some cases, two or more of these techniques may be combined to achieve increased purity.
Isolated Carboxypeptidase E binding partner polypeptides or can be obtained in several different ways; by purification from membrane extracts or culture media from normal cells or tissues, or from cells that have been genetically engineered to overexpress Carboxypeptidase E binding partner polypeptides by conventional purification procedures. Alternatively, Carboxypeptidase E binding partner polypeptides can be recombinantly expressed and purified. The discussion above with regard to the isolation of Wolframin protein that has been tagged or by immunoaffinity is applicable to the isolation of Carboxypeptidase E binding partner polypeptides as well.
Carboxypeptidase E has been purified to apparent homogeneity in at least one published procedure. (Fricker et al. J Biol. Chem. 258:10950 (1983)). Soluble and membrane associated forms have similar enzymatic and physical properties (Fricker, J. Cell. Biochem., supra). The published procedure relies on successive chromatography steps over DEAE cellulose, ConA Sepharose and a Sepharose-6B p-aminobenzoyl-L-arginine affinity column. Column fractions were assayed using an assay which utilizes a solubility change incurred when a water soluble substrate is converted to a chloroform soluble product. In a typical assay, 25 Îźl of the fraction is combined with 225 Îźl of 0.1M NaAc pH5.5,0.01% Triton X-100, and 0.2mM dansyl-Phe-Ala-Arg. After incubation at 37° C. for 1 hour, the reaction was terminated by acidification with 10 Îźl of 1N HCl. Reaction products are quantitated by measuring fluorescence (360 nm excitation, 510 nm emission wavelength) following extraction into chloroform (Fricker, L D. (1995) Methods Neurosci. 23, 237â250).
The amino terminal 242 amino acid polypeptide of the human WFS1 protein was cloned in the pProEX HT vector (Life Technologies, Rockville, Md.) and transfected into E.coli strain BL21. Three liters of prewarmed LB medium containing 100 Îźg/ml ampicillin was inoculated with 300 ml of an overnight culture. The culture was grown at 37° C. while shaking at 250 rpm, until the Abs600 nm reached 0.6. Expression was induced by addition of IPTG to a final concentration of 0.6 mM. The cultures were grown for an additional three hours at 37° C. while shaking at 250 rpm. Cells were harvested by centrifugation at 6,000Ăg for 15 minutes at 4° C. Cells were resuspended in lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) to a final volume of 35 ml. Cells were lysed at 15,000 psi using a French Pressure Cell Press (Spectronic Instruments, Rochester, N.Y.). Cell debris was removed by centrifugation at 100,000Ăg for 60 minutes at 4° C. in a model L8-M ultracentrifuge and a SW-28 rotor (Beckman Instruments, Palo Alto, Calif.). The cleared supernatant was incubated with 5 ml of a nickel-nitrilotriacetic acid (Ni-NTA) agarose overnight at 4° C. with gentle mixing. The slurry was loaded into a column and the packed Ni-NTA agarose was washed with 100 ml of wash buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0). The column was then washed sequentially with 20 ml of wash buffer containing 50 mM, 100 mM and 250 mM imidazole. Bound polypeptide was eluted with 20 ml of was buffer containing 500 mM imidazole. The eluted polypeptide was dialyzed extensively in Dulbecco's phosphate buffered saline (PBS, Life Technologies, Gaithersburg, Md.) and then concentrated 10-fold. Typical yield was 1 mg of polypeptide per one liter of culture. It will be appreciated that a similar protocol could be designed to produce a Wolframin protein fragment polypeptide of virtually any length which is capable of stable expression within the expressing cell.
Design of In-Vitro Assays
An in vitro assay is then designed that would detect the binding between the full length Wolframin protein polypeptide or a Wolframin protein fragment and a carboxypeptidase E binding partner polypeptide. For this purpose an easy detection system should be available for at least one of the partners in the complex; such a detection system could be based on antibodies, or on labeling one of the proteins with a marker molecule or radioactivity. The subsequent use of this assay would be to screen a compound collection for substances that would modulate the interaction between a carboxypeptidase E binding partner polypeptide and Wolframin protein.
In solution assays, methods of the invention comprise the steps of (a) contacting a Wolframin protein polypeptide with one or more candidate inhibitor compounds and (b) identifying the compounds that modulate the Wolframin protein polypeptide association with a carboxypeptidase E binding partner polypeptide Agents that modulate (i.e., increase, decrease) Wolframin protein polypeptide association with other proteins or expression may be identified by incubating a putative modulator with a cell expressing a Wolframin protein polypeptide and determining the effect of the putative modulator on Wolframin protein activity or expression. Modulators of Wolframin protein activity will be therapeutically useful in treatment of diseases and physiological conditions in which normal or aberrant Wolframin protein activity is involved.
Binding assays often take one of two forms: immobilized Wolframin protein polypeptide(s) can be used to bind labeled binding partner polypeptide(s), or conversely, immobilized binding partner polypeptide(s) can be used to bind labeled Wolframin protein polypeptides. In each case, the labeled polypeptide is contacted with the immobilized polypeptide under conditions that permit specific binding of the polypeptides(s) to form a complex in the absence of added agent. Particular aqueous conditions may be selected by the practitioner according to conventional methods. For general guidance, the following buffered aqueous conditions may be used: 10â250 mM NaCl, 5â50 mM Tris HCl, pH 5â8, with optional addition of divalent cation(s) and/or metal chelators and/or nonionic detergents and/or membrane fractions. Additions, deletions, modifications (such as pH) and substitutions (such as KCl substituting for NaCl or buffer substitution) may be made to these basic conditions. Modifications can be made to the basic binding reaction conditions so long as specific binding of Wolframin protein polypeptide(s) to carboxypeptidase E binding partner polypeptide occurs in the control reaction(s). In such reactions, at least one polypeptide species typically is labeled with a detectable marker. Suitable labeling includes, but is not limited to, radiolabeling by incorporation of a radiolabeled amino acid (e.g., 14C-labeled leucine, 3H-labeled glycine, 35S-labeled methionine), radiolabeling by post-translational radioiodination with 125I or 131I (e.g., Bolton-Hunter reaction and chloramine T), labeling by post-translational phosphorylation with 32P (e.g., phosphorylase and inorganic radiolabeled phosphate) fluorescent labeling by incorporation of a fluorescent label (e.g., fluorescein or rhodamine), or labeling by other conventional methods known in the art. In embodiments where one of the polypeptide species is immobilized by linkage to a substrate, the other polypeptide is generally labeled with a detectable marker.
Additionally, in some embodiments a Wolframin protein or a carboxypeptidase E binding partner polypeptide may be used in combination with an accessory protein (e.g., a protein which forms a complex with the polypeptide in vivo). It is typically preferred that different labels are used for each polypeptide species, so that binding of individual and/or heterodimeric and/or multimeric complexes can be readily distinguished. For example but not by way of limitation, a Wolframin protein polypeptide is labeled with fluorescein and an accessory polypeptide is labeled with a fluorescent marker that fluoresces with either a different excitation wavelength or emission wavelength, or both. Alternatively, double-label scintillation counting is used, wherein a Wolframin protein polypeptide is labeled with one isotope (e.g., 3H) and a binding partner polypeptide species is labeled with a different isotope (e.g., 14C) that can be distinguished by scintillation counting using standard discrimination techniques.
Labeled polypeptide(s) are contacted with immobilized polypeptide(s) under aqueous conditions as described herein. The time and temperature of incubation of a binding reaction is optionally varied, with the selected conditions permitting specific binding to occur in a control reaction where no agent is present. Preferable embodiments employ a reaction temperature of about at least 15 degrees Centigrade, more preferably 30 to 42 degrees Centigrade, and a time of incubation of approximately at least 15 seconds, although longer incubation periods, from 30 seconds to a minute to several minutes or more, are preferable so that, in some embodiments, a binding equilibrium is attained. Binding kinetics and the thermodynamic stability of bound Wolframin protein:binding partner complexes determine the latitude available for varying the time, temperature, salt, pH, and other reaction conditions. However, for any particular embodiment, desired binding reaction conditions can be calibrated readily by the practitioner using conventional methods in the art, which may include binding analysis using Scatchard analysis, Hill analysis, and other standard analytic methods (Proteins, Structures and Molecular Principles, (1984) Creighton (ed.), W. H. Freeman and Company, New York).
Specific binding of labeled Wolframin protein or a carboxypeptidase E binding partner polypeptide to immobilized Wolframin protein or a carboxypeptidase E binding partner polypeptide polypeptide, respectively, is determined by including unlabeled competitor protein(s) (e.g., albumin). Similarly, specific binding of labeled Wolframin protein or binding partner polypeptide to immobilized binding partner or Wolframin protein polypeptide, respectively, is determined by including unlabeled competitor protein(s) (e.g., albumin). After a binding reaction is completed, labeled polypeptide(s) specifically bound to immobilized polypeptide is detected. For example and not by way of limitation, after a suitable incubation period for binding, the aqueous phase containing non-immobilized protein is removed and the substrate containing the immobilized polypeptide species and any labeled protein bound to it is washed with a suitable buffer, optionally containing unlabeled blocking agent(s), and the wash buffer(s) removed. After washing, the amount of detectable label remaining specifically bound to the immobilized polypeptide is determined (e.g., by optical, enzymatic, autoradiographic, or other radiochemical methods).
In some embodiments, addition of unlabeled blocking agents that inhibit non-specific binding are included. Examples of such blocking agents include, but are not limited to, the following: calf thymus DNA, salmon sperm DNA, yeast RNA, mixed sequence (random or pseudorandom sequence) oligonucleotides of various lengths, bovine serum albumin, nonionic detergents (NP-40, Tween, Triton X-100, etc.), nonfat dry milk proteins, Denhardt's reagent, polyvinylpyrrolidone, Ficoll, and other blocking agents. Practitioners may, in their discretion, select blocking agents at suitable concentrations to be included in binding assays; however, reaction conditions are selected so as to permit specific binding between a Wolframin protein polypeptide and a binding partner polypeptide in a control binding reaction. Blocking agents are included to inhibit nonspecific binding of labeled protein to immobilized protein and/or to inhibit nonspecific binding of labeled polypeptide to the immobilization substrate.
In embodiments where a polypeptide is immobilized, covalent or noncovalent linkage to a substrate may be used. Covalent linkage chemistries include, but are not limited to, well-characterized methods known in the art (Kadonaga and Tjian (1986) Proc. Natl. Acad. Sci. (U.S.A.) 83: 5889). One example, not for limitation, is covalent linkage to a substrate derivatized with cyanogen bromide (such as CNBr-derivatized Sepharose 4B). It may be desirable to use a spacer to reduce potential steric hindrance from the substrate. Noncovalent bonding of proteins to a substrate include, but are not limited to, bonding of the protein to a charged surface (e.g., on a bead) and binding with specific antibodies.
In one class of embodiments, parallel binding reactions are conducted, wherein one set of reactions serves as control and at least one other set of reactions include various quantities of agents, mixtures of agents, or biological extracts, that are being tested for the capacity to inhibit binding of a Wolframin protein polypeptide to a binding partner polypeptide or disrupt, modulate, inhibit, or potentiate the activity of either or both. Agents which, when added to a binding reaction, inhibit formation of Wolframin protein:binding partner complexes are thereby identified as Wolframin protein inhibitors; Agents which, when added to a binding reaction, enhance formation of Wolframin protein:binding partner complexes are thereby identified as Wolframin protein potentiators (e.g., Wolframin protein agonists;).
In a preferred embodiment, several binding reactions are monitored simultaneously, e.g., using a format which permits simultaneous analysis of several samples (microtiter plates, etc.). In a preferred embodiment, the assays are automated, e.g., using robotics for pipetting samples into microtiter plates.
One means for detecting binding of a Wolframin protein polypeptide to a binding partner polypeptide is to immobilize the Wolframin protein polypeptide, such as by covalent or noncovalent chemical linkage to a solid support, and to contact the immobilized Wolframin protein polypeptide with a binding partner polypeptide that has been labeled with a detectable marker (e.g., by incorporation of radiolabeled amino acid, by epitope tagging and reporting with a fluorescent-labelled anti-epitope tag antibody, and the like). Such contacting is typically performed in aqueous conditions which permit binding of a Wolframin protein polypeptide to a binding partner polypeptide. Binding of the labeled binding partner polypeptide to the immobilized Wolframin protein is measured by determining the extent to which the labeled binding partner polypeptide is immobilized as a result of a specific binding interaction. Such specific binding may be reversible, or may be optionally irreversible if a cross-linking agent is added in appropriate experimental conditions. Agents that inhibit or augment the formation of bound complexes as compared to a control binding reaction lacking agent are thereby identified as Wolframin protein-modulating agents and are candidate therapeutic agents.
Binding assays often take one of two forms: immobilized Wolframin protein polypeptide(s) can be used to bind labeled binding partner polypeptide(s), or conversely, immobilized binding partner polypeptide(s) can be used to bind labeled Wolframin protein polypeptides. In each case, the labeled polypeptide is contacted with the immobilized polypeptide under conditions that permit specific binding of the polypeptides(s) to form a complex in the absence of added agent. Particular aqueous conditions may be selected by the practitioner according to conventional methods. For general guidance, the following buffered aqueous conditions may be used: 10â250 mM NaCl, 5â50 mM Tris HCl, pH 5â8, with optional addition of divalent cation(s) and/or metal chelators and/or nonionic detergents and/or membrane fractions. Additions, deletions, modifications (such as pH) and substitutions (such as KCl substituting for NaCl or buffer substitution) may be made to these basic conditions. Modifications can be made to the basic binding reaction conditions so long as specific binding of Wolframin protein polypeptide(s) to binding partner polypeptides occurs in the control reaction(s). In such reactions, at least one polypeptide species typically is labeled with a detectable marker. Suitable labeling includes, but is not limited to, radiolabeling by incorporation of a radiolabeled amino acid (e.g., 14C-labeled leucine, 3H-labeled glycine, 35S-labeled methionine), radiolabeling by post-translational radioiodination with 125I or 131I (e.g., Bolton-Hunter reaction and chloramine T), labeling by post-translational phosphorylation with 32P (e.g., phosphorylase and inorganic radiolabeled phosphate) fluorescent labeling by incorporation of a fluorescent label (e.g., fluorescein or rhodamine), or labeling by other conventional methods known in the art. In embodiments where one of the polypeptide species is immobilized by linkage to a substrate, the other polypeptide is generally labeled with a detectable marker. Additionally, in some embodiments a Wolframin protein or binding partner polypeptide may be used in combination with an accessory protein (e.g., a protein which forms a complex with the polypeptide in vivo). It is typically preferred that different labels are used for each polypeptide species, so that binding of individual and/or heterodimeric and/or multimeric complexes can be readily distinguished. For example but not by way of limitation, a Wolframin protein polypeptide is labeled with fluorescein and an accessory polypeptide is labeled with a fluorescent marker that fluoresces with either a different excitation wavelength or emission wavelength, or both. Alternatively, double-label scintillation counting is used, wherein a Wolframin protein polypeptide is labeled with one isotope (e.g., 3H) and a binding partner polypeptide species is labeled with a different isotope (e.g., 14C) that can be distinguished by scintillation counting using standard discrimination techniques.
Labeled polypeptide(s) are contacted with immobilized polypeptide(s) under aqueous conditions as described herein. The time and temperature of incubation of a binding reaction is optionally varied, with the selected conditions permitting specific binding to occur in a control reaction where no agent is present. Preferable embodiments employ a reaction temperature of about at least 15 degrees Centigrade, more preferably 30 to 42 degrees Centigrade, and a time of incubation of approximately at least 15 seconds, although longer incubation periods, from 30 seconds to a minute to several minutes or more, are preferable so that, in some embodiments, a binding equilibrium is attained. Binding kinetics and the thermodynamic stability of bound Wolframin protein:binding partner complexes determine the latitude available for varying the time, temperature, salt, pH, and other reaction conditions. However, for any particular embodiment, desired binding reaction conditions can be calibrated readily by the practitioner using conventional methods in the art, which may include binding analysis using Scatchard analysis, Hill analysis, and other standard analytic methods (Proteins, Structures and Molecular Principles, (1984) Creighton (ed.), W. H. Freeman and Company, New York).
Specific binding of labeled Wolframin protein or binding partner polypeptide to immobilized Wolframin protein or binding partner polypeptide, respectively, is determined by including unlabeled competitor protein(s) (e.g., albumin). Similarly, specific binding of labeled Wolframin protein or binding partner polypeptide to immobilized binding partner or Wolframin protein polypeptide, respectively, is determined by including unlabeled competitor protein(s) (e.g., albumin). After a binding reaction is completed, labeled polypeptide(s) specifically bound to immobilized polypeptide is detected. For example and not by way of limitation, after a suitable incubation period for binding, the aqueous phase containing non-immobilized protein is removed and the substrate containing the immobilized polypeptide species and any labeled protein bound to it is washed with a suitable buffer, optionally containing unlabeled blocking agent(s), and the wash buffer(s) removed. After washing, the amount of detectable label remaining specifically bound to the immobilized polypeptide is determined (e.g., by optical, enzymatic, autoradiographic, or other radiochemical methods).
In some embodiments, addition of unlabeled blocking agents that inhibit non-specific binding are included. Examples of such blocking agents include, but are not limited to, the following: calf thymus DNA, salmon sperm DNA, yeast RNA, mixed sequence (random or pseudorandom sequence) oligonucleotides of various lengths, bovine serum albumin, nonionic detergents (NP-40, Tween, Triton X-100, etc.), nonfat dry milk proteins, Denhardt's reagent, polyvinylpyrrolidone, Ficoll, and other blocking agents. Practitioners may, in their discretion, select blocking agents at suitable concentrations to be included in binding assays; however, reaction conditions are selected so as to permit specific binding between a Wolframin protein polypeptide and a binding partner polypeptide in a control binding reaction. Blocking agents are included to inhibit nonspecific binding of labeled protein to immobilized protein and/or to inhibit nonspecific binding of labeled polypeptide to the immobilization substrate.
In one class of embodiments, parallel binding reactions are conducted, wherein one set of reactions serves as control and at least one other set of reactions include various quantities of agents, mixtures of agents, or biological extracts, that are being tested for the capacity to inhibit binding of a Wolframin protein polypeptide to a carboxypeptidase E binding partner polypeptide or disrupt, modulate, inhibit, or potentiate the activity of either or both. Agents which, when added to a binding reaction, inhibit formation of Wolframin protein:binding partner complexes are thereby identified as Wolframin protein inhibitors; Agents which, when added to a binding reaction, enhance formation of Wolframin protein:binding partner complexes are thereby identified as Wolframin protein potentiators (e.g., Wolframin protein agonists;)
In a preferred embodiment, several binding reactions are monitored simultaneously, e.g., using a format which permits simultaneous analysis of several samples (microtiter plates, etc.). In a preferred embodiment, the assays are automated, e.g., using robotics for pipetting samples into microtiter plates.
One means for detecting binding of a Wolframin protein polypeptide to a binding partner polypeptide is to immobilize the Wolframin protein polypeptide, such as by covalent or noncovalent chemical linkage to a solid support, and to contact the immobilized Wolframin protein polypeptide with a binding partner polypeptide that has been labeled with a detectable marker (e.g., by incorporation of radiolabeled amino acid, by epitope tagging and reporting with a fluorescent-labelled anti-epitope tag antibody, and the like). Such contacting is typically performed in aqueous conditions which permit binding of a Wolframin protein polypeptide to a carboxypeptidase E binding partner polypeptide. Binding of the labeled a carboxypeptidase E binding partner polypeptide polypeptide to the immobilized Wolframin protein is measured by determining the extent to which the labeled binding partner polypeptide is immobilized as a result of a specific binding interaction. Such specific binding may be reversible, or may be optionally irreversible if a cross-linking agent is added in appropriate experimental conditions. Agents that inhibit or augment the formation of bound complexes as compared to a control binding reaction lacking agent are thereby identified as Wolframin protein-modulating agents and are candidate therapeutic agents.
Additional features and variations of the invention will be apparent to those skilled in the art from the entirety of this application, including the detailed description, and all such features are intended as aspects of the invention. Likewise, features of the invention described herein can be re-combined into additional embodiments that also are intended as aspects of the invention, irrespective of whether the combination of features is specifically mentioned above as an aspect or embodiment of the invention. Also, only such limitations which are described herein as critical to the invention should be viewed as such; variations of the invention lacking limitations which have not been described herein as critical are intended as aspects of the invention. It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples.
Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the invention.
The entire disclosure of all publications cited herein are hereby incorporated by reference.
1. A method for identifying agents that increase binding between a Wolframin protein polypeptide, comprising an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:8, and SEQ ID NO: 10, and a carboxypeptidase E binding partner polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO 12, SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO:17 comprising:
(a) contacting said Wolframin protein polypeptide and said carboxypeptidase E binding partner polypeptide in the presence and absence of a test agent;
(b) determining binding between said Wolframin protein polypeptide and said binding partner polypeptide in the presence and absence of the test agent; and
(c) comparing binding between said Wolframin protein polypeptide and said carboxypeptidase E binding partner polypeptide in the presence and absence of the test agent to determine whether binding between said Wolframin protein polypeptide and a said carboxypeptidase E binding partner polypeptide is increased in the presence of the test agent.
2. A method according to claim 1, wherein the Wolframin protein polypeptide is expressed in a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes said polypeptide.
3. A method according to claim 1, wherein the carboxypeptidase E binding partner polypeptide is expressed in a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes said polypeptide.
4. A method according to claim 1, wherein both the Wolframin protein polypeptide and the carboxypeptidase E binding partner polypeptide are expressed in a cell transformed or transfected with a polynucleotide comprising a nucleotide sequence that encodes said polypeptide, wherein said contacting step further comprises growing the cell in the presence of the test agent.