Patent application title:

Mycobacterial diagnostics

Publication number:

-

Publication date:
Application number:

10/137,113

Filed date:

2002-04-30

βœ… Patent granted

Patent number:

US 7,074,559 B2

Grant date:

2006-07-11

PCT filing:

-

PCT publication:

-

Examiner:

Rodney P Swartz

Adjusted expiration:

2022-10-26

Abstract:

The present invention provides nucleic acid molecules unique to M. paratuberculosis. The invention also provides the polypeptides encoded by the M. paratuberculosis-specific nucleic acid molecules of the invention, and antibodies having specific binding affinity for the polypeptides encoded by the M. paratuberculosis-specific nucleic acid molecules. The invention further provides for methods of detecting M. paratuberculosis in a sample using nucleic acid molecules, polypeptides, and antibodies of the invention. The invention additionally provides methods of preventing a M. paratuberculosis infection in an animal.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/68 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids

G01N1/30 IPC

Sampling; Preparing specimens for investigation; Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. , Staining; Impregnating Fixation; Dehydration; Multistep processes for preparing samples of tissue, cell or nucleic acid material and the like for analysis

C07H21/04 IPC

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical

Description

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims priority under 35 U.S.C. Β§119(e) of U.S. provisional application Ser. No. 60/362,396, filed Mar. 6, 2002.

FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

The U.S. Government may have certain rights in this invention pursuant to USDA Grant Nos. 00-35201-9200, 58-3625-0-137, and 00-02215.

TECHNICAL FIELD

This invention relates to detection of bacteria, and more particularly to detection of Mycobacterium avium subsp. paratuberculosis.

BACKGROUND

The disorder known as Johne's disease was first described in 1895. Today, Mycobacterium avium subsp. paratuberculosis (M. paratuberculosis), the causative agent of Johne's disease, is widely distributed both nationally and internationally in domestic ruminants such as cattle, sheep, goats, as well as wildlife such as rabbits, deer, antelopes, and bison. In 1996, the National Animal Health Monitoring System conducted a survey of dairy farms using serological analysis to determine the prevalence of Johne's disease in the U.S. The results of that study showed an estimated 20–40% of surveyed herds have some level of M. paratuberculosis. Furthermore, it is estimated that annual losses in the U.S. from M. paratuberculosis in cattle herds may exceed $220 million.

The pathogenesis of M. paratuberculosis has been recently reviewed by Harris and Barletta (2001, Clin. Microbiol. Rev., 14:489–512). Cattle become infected with M. paratuberculosis as calves but often do not develop clinical signs until 2 to 5 years of age. The primary route of infection is through ingestion of fecal material, milk or colostrum containing M. paratuberculosis microorganisms. M cells likely serve as the port of entry for M. paratuberculosis into the lymphatic system similar to other intracellular pathogens such as salmonella. M. paratuberculosis survive and may even replicate within macrophages in the wall of the intestine and in regional lymph nodes. After an incubation period of several years, extensive granulomatous inflammation occurs in the terminal small intestine, which leads to malabsorption and protein-losing enteropathy. Cattle shed minimal amounts of M. paratuberculosis in their feces during the subclinical phase of infection, and yet over time, this shedding can lead to significant contamination of the environment and an insidious spread of infection throughout the herd before the animal is diagnosed. During the clinical phase of infection, fecal shedding of the pathogen is high and can exceed 1010 organisms/g of feces. The terminal clinical stage of disease is characterized by chronic diarrhea, rapid weight loss, diffuse edema, decreased milk production, and infertility. Although transmission of M. paratuberculosis occurs primarily through the fecal-oral route, it has also been isolated from reproductive organs of infected males and females.

SUMMARY

The present invention provides nucleic acid molecules unique to M. paratuberculosis. The invention also provides polypeptides encoded by the M. paratuberculosis-specific nucleic acid molecules of the invention, and antibodies having specific binding affinity for the polypeptides encoded by the M. paratuberculosis-specific nucleic acid molecules. The invention further provides for methods of detecting M. paratuberculosis in a sample using nucleic acid molecules, polypeptides, or antibodies of the invention. The invention additionally provides for methods of preventing a M. paratuberculosis infection in an animal.

In one aspect, the invention provides an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 969 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:1, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Homo sapiens, Pseudomonas aeruginosa, Streptomyces viridochromogenes, Mus musculus, Felis catus, and Xanthomonas campestris.

For example, a nucleic acid of the invention can have the sequence shown in SEQ ID NO:1. A nucleic acid of the invention can have at least 75% sequence identity to SEQ ID NO:1 (e.g., SEQ ID NO:102). A nucleic acid of the invention can have at least 80% sequence identity to SEQ ID NO:1 (e.g., SEQ ID NO:10). A nucleic acid of the invention can have at least 85% sequence identity to SEQ ID NO:1 (e.g., SEQ ID NO:104). A nucleic acid of the invention can have at least 90% sequence identity to SEQ ID NO:1 (e.g., SEQ ID NO:105). A nucleic acid of the invention can have at least 95% sequence identity to SEQ ID NO:1 (e.g., SEQ ID NO:106). A nucleic acid of the invention can have at least 99% sequence identity to SEQ ID NO:1 (e.g., SEQ ID NO:107).

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 576 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:2, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Thermotoga maritima, Homo sapiens, Thermotoga neapolitana, Pseudomonas aeruginosa, Deinococcus radiodurans, Streptomyces coelicolor, Oryza sativa, Rhizobium leguminosarum, Frankia alni, and Mesorhizobium loti.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 522 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:3, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Halobacterium NRC-1, Oryza sativa, Glycine max, Streptomyces coelicolor, and Mus musculus.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 582 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:4, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Oryza sativa, Caenorhabditis elegans, Leishmania mexicana, Drosophila melangaster, Homo sapiens, Zea mays, Halobacterium NRC-1, Pseudomonas aeruginosa, Ralstonia solanacearum, and Streptomyces coelicolor.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 311 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:5, or the complement of the molecule, wherein any molecule that are 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Homo sapiens, Streptomyces coelicolor, Ictalurid herpesvirus, Mesorhizobium loti, and Oryza sativa.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 576 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:6, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Pseudomonas aeruginosa, Ralstonia solanacearum, Arabidopsis thaliana, Pseudomonas fluorescens, Homo sapiens, and Mesorhizobium loti.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 474 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:7, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Homo sapiens, Pantoea agglomerans, Rattus norvegicus, Erwinia uredovora, Escherichia coli, and Pantoea ananatis.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 558 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:8, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Neisseria meningitides, Homo sapiens, Streptomyces coelicolor, Arabidopsis thaliana, Escherichia coli, Pseudomonas aeruginosa, Streptomyces hygroscopicus var. ascomyceticus, Ralstonia solanacearum, Deinococcus radiodurans, Rhizobium meliloti, Rickettsia typhi, Streptomyces sp., and Mus musculus.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 321 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:9, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Mycobacterium tuberculosis, Homo sapiens, Streptomyces coelicolor, Drosophila melanogaster, Ralstonia solanacearum, Mesorhizobium loti, and Pseudomonas cruciviae.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 2508 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:10, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Sinorhizobium meliloti, Xanthomonas albilineans, Halobacterium NRC-1, Ralstonia solanacearum, Deinococcus radiodurans, Halobacterium salinarium, Micromonospora griseorubida, Pseudomonas paucimobilis, and Streptomyces lividans.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 264 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:11, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Caulobacter crescentus, Brucella melitensis, Pyrobaculum aerophilum, Mycobacterium tuberculosis, Sinorhizobium meliloti, and Mycobacterium leprae.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 1110 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:12, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Mesorhizobium loti, Bacillus halodurans, Ralstonia solanacearum, Homo sapiens, Drosophila melanogaster, and Rhizobium meliloti.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 672 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:13, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of a Mycobacterium sp. other than M. paratuberculosis.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 372 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:14, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Brucella melitensis, Streptomyces coelicolor, Drosophila melanogaster, Mycobacterium tuberculosis, Trypanosoma rangeli, Trypanosoma minasense, Trypanosoma leeuwenhoeki, and Brassica napus.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 600 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:15, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Ralstonia solanacearum, Sinorhizobium meliloti, Homo sapiens, Mesorhizobium loti, Oryza sativa, Drosophila melanogaster, Rhizobium leguminosarum, Xylella fastidiosa, Deinococcus radiodurans, Achromobacter cycloclastes, and Candida cylindracea.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 540 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:16, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Streptomyces lavendulae, Xylella fastidiosa, Streptococcus pneumoniae, Mycobacterium tuberculosis, Pseudomonas aeruginosa, Ralstonia solanacearum, Sinorhizobium meliloti, Sus scrofa, Mycobacterium leprae, and Streptomyces coelicolor.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 291 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:17, or the complement of the molecule, wherein any molecule that is 10 to 25 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Pseudomonas sp., Homo sapiens, Pseudomonas aeruginosa, Thauera aromatica, Oryza sativa, Ralstonia solanacearum, Rhizobium leguminosarum, Streptomyces coelicolor, Brucella melitensis, Drosophila melanogaster, Deinococcus radiodurans, Streptomyces noursei, Rhizobium meliloti, Synechococcus elongatus, and Mesorhizobium loti.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 225 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:18, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Rhodobacter capsulatus, Agrobacterium tumefaciens, Mycobacterium smeginatis, Pseudomonas aeruginosa, Ralstonia solanacearum, and Drosophila virilis.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 441 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:19, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Homo sapiens, Mus musculus, Leishmania malor, Pseudomonas aeruginosa, and Botrytis cinerea.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 726 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:20, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Oryza sativa, Caulobacter crescentus, Rhodobacter sphaeroides, Streptomyces coelicolor, Spermatozopsis similis, Homo sapiens, Sus scrofa, and Giardia intestinalis.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 426 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:21, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Streptomyces coelicolor, Homo sapiens, Triticum aestivum, Oryza sativa, Brucella melitensis, Caulobacter crescentus, Pseudomonas aeruginosa, Ralstonia solanacearum, Bovine herpesvirus, and Mesorhizobium loti.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 279 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:22, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Pseudomonas aeruginosa, Oryza sativa, Streptomyces sp., Streptomyces peucetius, Rhizobium sp., Mycobacterium tuberculosis, Caulobacter crescentus, Ralstonia solanacearum, Haloferax volcanii, Mycobacterium leprae, and Streptomyces coelicolor.

In another aspect of the invention, there is provided an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of 10 nucleotides to 4415 nucleotides, the molecule having at least 75% sequence identity to SEQ ID NO:23, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Ralstonia solanacearum, Sinorhizobium meliloti, Homo sapiens, Mesorhizobium loti, Oryza sativa, Drosophila melanogaster, Rhizobium leguminosarum, Xylella fastidiosa, Deinococcus radiodurans, Achromobacter cycloclastes, Candida cylindracea, Streptomyces lavendulae, Streptococcus pneumoniae, Mycobacterium tuberculosis, Pseudomonas aeruginosa, Sus scrofa, Mycobacterium leprae, Streptomyces coelicolor, Pseudomonas sp., Thauera aromatica, Brucella melitensis, Streptomyces noursei, Rhizobium meliloti, Synechococcus elongates, Rhodobacter capsulatus, Agrobacterium tumefaciens, Mycobacterium smegmatis, Drosophila virilis, Mus musculus, Leishmania major, Botrytis cinerea, Caulobacter crescentus, Rhodobacter sphaeroides, Spermatozopsis similes, Giardia intestinalis, Triticum aestivum, Bovine herpesvirus, Streptomyces sp., Streptomyces peucetius, Rhizobium sp., and Haloferax volcanii.

Generally, the invention provides an isolated nucleic acid, wherein the nucleic acid comprises a nucleic acid molecule of at least 10 nucleotides, the molecule having at least 75% sequence identity to a sequence selected from the group consisting of SEQ ID NOs:1–23, or the complement of the molecule, wherein any molecule that is 10 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of Ralstonia solanacearum, Sinorhizobium meliloti, Homo sapiens, Mesorhizobium loti, Oryza sativa, Drosophila melanogaster, Rhizobium leguminosarum, Xylella fastidiosa, Deinococcus radiodurans, Achromobacter cycloclastes, Candida cylindracea, Streptomyces lavendulae, Streptococcus pneumoniae, Mycobacterium tuberculosis, Pseudomonas aeruginosa, Sus scrofa, Mycobacterium leprae, Streptomyces coelicolor, Pseudomonas sp., Thauera aromatica, Brucella melitensis, Streptomyces noursei, Rhizobium meliloti, Synechococcus elongates, Rhodobacter capsulatus, Agrobacterium tumefaciens, Mycobacterium smegmatis, Drosophila virilis, Mus musculus, Leishmania major, Botrytis cinerea, Caulobacter crescentus, Rhodobacter sphaeroides, Spermatozopsis similes, Giardia intestinalis, Triticum aestivum, Bovine herpesvirus, Streptomyces sp., Streptomyces peucetius, Rhizobium sp., Haloferax volcanii, Streptomyces viridochromogenes, Felis catus, Xanthomonas campestris, Thermotoga maritime, Thermotoga neapolitana, Frankia alni, Halobacterium NRC-1, Glycine max, Leishmania tarentolae, Neisseria meningitides, Escherichia coli, Caenorhabditis elegans, Leishmania mexicana, Zea mays, Ictalurid herpesvirus, Rattus norvegicus, Arabidopsis thaliana, Pseudomonasfluorescens, Pantoea agglomerans, Erwinia uredovora, Pantoea ananatis, Streptomyces hygroscopicus, Rickettsia typhi, Pseudomonas cruciviae, Xanthomonas albilineans, Halobacterium salinarium, Micronzonospora griseorubida, Pseudomonas paucimobilis, Streptomyces lividans, Pyrobaculum aerophilum, Sinorhizobium meliloti, Mesorhizobium loti, Bacillus halodurans, Trypanosoma rangeli, Trypanosoma minasense, Trypanosoma leeuwenhoeki, and Brassica napus.

In another aspect, the invention provides for vectors comprising a nucleic acid of the invention. Host cells comprising such a vector are further provided by the invention.

In yet another aspect, the invention provides for isolated polypeptides encoded by the nucleic acids of the invention. For example, the nucleic acid molecule having the sequence of SEQ ID NO:1 can encode a polypeptide having an amino acid sequence of SEQ ID NO:24; the nucleic acid molecule having the sequence of SEQ ID NO:2 can encode a polypeptide having an amino acid sequence of SEQ ID NO:25; the nucleic acid molecule having the sequence of SEQ ID NO:3 can encode a polypeptide having an amino acid sequence of SEQ ID NO:26; the nucleic acid molecule having the sequence of SEQ ID NO:4 can encode a polypeptide having an amino acid sequence of SEQ ID NO:27; the nucleic acid molecule having the sequence of SEQ ID NO:5 can encode a polypeptide having an amino acid sequence of SEQ ID NO:28; the nucleic acid molecule having the sequence of SEQ ID NO:6 can encode a polypeptide having an amino acid sequence of SEQ ID NO:29; the nucleic acid molecule having the sequence of SEQ ID NO:7 can encode a polypeptide having an amino acid sequence of SEQ ID NO:30; the nucleic acid molecule having the sequence of SEQ ID NO:8 can encode a polypeptide having an amino acid sequence of SEQ ID NO:31; the nucleic acid molecule having the sequence of SEQ ID NO:9 can encode a polypeptide having an amino acid sequence of SEQ ID NO:32; the nucleic acid molecule having the sequence of SEQ ID NO:10 can encode a polypeptide having an amino acid sequence of SEQ ID NO:33; the nucleic acid molecule having the sequence of SEQ ID NO:11 can encode a polypeptide having an amino acid sequence of SEQ ID NO:34; the nucleic acid molecule having the sequence of SEQ ID NO:12 can encode a polypeptide having an amino acid sequence of SEQ ID NO:35; the nucleic acid molecule having the sequence of SEQ ID NO:13 can encode a polypeptide having an amino acid sequence of SEQ ID NO:36; the nucleic acid molecule having the sequence of SEQ ID NO:14 can encode a polypeptide having an amino acid sequence of SEQ ID NO:37; the nucleic acid molecule having the sequence of SEQ ID NO:15 can encode a polypeptide having an amino acid sequence of SEQ ID NO:38; the nucleic acid molecule having the sequence of SEQ ID NO:16 can encode a polypeptide having an amino acid sequence of SEQ ID NO:39; the nucleic acid molecule having the sequence of SEQ ID NO:17 can encode a polypeptide having an amino acid sequence of SEQ ID NO:40; the nucleic acid molecule having the sequence of SEQ ID NO:18 can encode a polypeptide having an amino acid sequence of SEQ ID NO:41; the nucleic acid molecule having the sequence of SEQ ID NO:19 can encode a polypeptide having an amino acid sequence of SEQ ID NO:42; the nucleic acid molecule having the sequence of SEQ ID NO:20 can encode a polypeptide having an amino acid sequence of SEQ ID NO:43; the nucleic acid molecule having the sequence of SEQ ID NO:21 can encode a polypeptide having an amino acid sequence of SEQ ID NO:44; and the nucleic acid molecule having the sequence of SEQ ID NO:22 can encode a polypeptide having an amino acid sequence of SEQ ID NO:45.

In another aspect, the invention provides articles of manufacture that include one or more polypeptides of the invention. In still another aspect of the invention, there are provided antibodies that have specific binding affinity for a polypeptide of the invention.

In another aspect, the invention provides for methods for detecting the presence or absence of M. paratuberculosis in a biological sample. Such methods include contacting the biological sample with one or more of the nucleic acids of the invention (e.g., SEQ ID NOs:1–23) under standard amplification conditions, wherein an amplification product is produced if M. paratuberculosis nucleic acid is present in the biological sample; and detecting the presence or absence of the amplification product. Generally, the presence of the amplification product indicates the presence of M. paratuberculosis in the biological sample, and the absence of the amplification product indicates the absence of M. paratuberculosis in the biological sample. Representative animals from which the biological sample can be derived include a cow, a sheep, a goat, a rabbit, a deer, an antelope, or a bison. Representative biological samples include a fecal sample and a milk sample. Further, representative nucleic acids that can be used in the above-described methods include those having the sequence of SEQ ID NO:46–101.

In another aspect, the invention provides methods for detecting the presence or absence of M. paratuberculosis in a biological sample. Such methods include contacting the biological sample with one or more of the nucleic acids of the invention (e.g., SEQ ID NOs:1–23) under hybridization conditions, wherein a hybridization complex is produced if M. paratuberculosis nucleic acid molecules are present in the biological sample; and detecting the presence or absence of the hybridization complex. Generally, the presence of the hybridization complex indicates the presence of M. paratuberculosis in the biological sample, and the absence of the hybridization complex indicates the absence of M. paratuberculosis in the biological sample. Typically, nucleic acids present in the biological sample are electrophoretically separated. Such electrophoretically separated nucleic acids can be attached to a solid support. Representative solid supports include nylon membranes and nitrocellulose membranes. Further, one or more nucleic acids can be labeled. Representative biological samples include a fecal sample, a milk sample, and a blood sample.

In another aspect, the invention provides methods for detecting the presence or absence of M. paratuberculosis in a biological sample. Such methods include contacting the biological sample with a polypeptide of the invention (e.g., SEQ ID NOs:24–45), wherein a polypeptide-antibody complex is produced if an antibody having specific binding affinity for the polypeptide is present in the sample; and detecting the presence or absence of the polypeptide-antibody complex. Typically, the presence of the polypeptide-antibody complex indicates the presence of M. paratuberculosis in the biological sample, and the absence of the polypeptide-antibody complex indicates the absence of M. paratuberculosis in the biological sample. Polypeptides used in the above-described method can be attached to a solid support. Further, representative biological samples include a blood sample and a milk sample.

In yet another aspect, the invention provides for methods for detecting the presence or absence of M. paratuberculosis in a biological sample. Such methods include contacting the biological sample with an antibody of the invention (e.g., an antibody having specific binding affinity for a polypeptide having an amino acid sequence of SEQ ID NOs:24–45), wherein an antibody-polypeptide complex is produced if a polypeptide is present in the biological sample for which the antibody has specific binding affinity, and detecting the presence or absence of the antibody-polypeptide complex. Generally, the presence of the antibody-polypeptide complex indicates the presence of M. paratuberculosis in the biological sample, and the absence of the antibody-polypeptide complex indicates the absence of M. paratuberculosis in the biological sample. Antibodies used in the above-described methods can be bound to a solid support. Representative biological samples that can be used in the above-described methods include a blood sample and a milk sample.

In still another aspect of the invention, there are provided methods of preventing infection by M. paratuberculosis in an animal. Such methods include administering a compound to the animal, wherein the compound comprises a polypeptide of the invention (e.g., SEQ ID NOs:24–45). Alternatively, such methods include administering a compound to the animal, wherein the compound comprises a nucleic acid of the invention (e.g., a nucleic acid comprising a nucleic acid molecule having at least 75% sequence identity to SEQ ID NOs:1–23). Typically, the compound immunizes the animal against M. paratuberculosis.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the drawings and detailed description, and from the claims.

DESCRIPTION OF DRAWINGS

FIG. 1 is a sequence alignment schematic showing positions of predicted coding sequences relative to assembled contig fragments. Alignments of contig 1614 and a trimmed fragment of the 94-kb contig 1398 are shown along with each predicted coding sequence listed in Table 4. Note that the core region of genes 250 to 257 is well separated from neighboring coding regions. The integrase gene upstream of gene 250 is also designated gene 249.

FIG. 2 shows the sequences of M. paratuberculosis-specific nucleic acid molecules (SEQ ID NOS:1–23).

FIG. 3 shows the polypeptide sequences (SEQ ID NOs:24–45) encoded by M. paratuberculosis-specific nucleic acids. An * indicates a stop codon.

FIG. 4 shows representative nucleic acid molecules having 75%, 80%, 85%, 90%, 95%, and 99% sequence identity to SEQ ID NO:1 (SEQ ID NOs:102–107, respectively).

Like reference symbols in the various drawings indicate like elements.

DETAILED DESCRIPTION

The close genetic relationship between M. paratuberculosis and M. avium has made difficult the identification of nucleic acids and polypeptides specific to M. paratuberculosis that can be used with high sensitivity and specificity to detect M. paratuberculosis. The present invention provides nucleic acid molecules that are unique to M. paratuberculosis. The invention also provides the M. paratuberculosis-specific polypeptides encoded by the nucleic acid molecules of the invention, and antibodies having specific binding affinity for the M. paratuberculosis-specific polypeptides. The nucleic acid molecules, polypeptides, and antibodies of the invention can be used in methods of the invention to detect M. paratuberculosis in a sample. The invention additionally provides methods of preventing a M. paratuberculosis infection in an animal.

Isolated M. paratuberculosis-specific Nucleic Acid Molecules

The present invention is based, in part, on the identification of nucleic acid molecules that are unique to M. paratuberculosis. These nucleic acid molecules are herein referred to as β€œM. paratuberculosis-specific” nucleic acid molecules. Particular nucleic acid molecules of the invention include the sequences shown in SEQ ID NOs:1–23. As used herein, the term β€œnucleic acid molecule” can include DNA molecules and RNA molecules and analogs of the DNA or RNA molecule generated using nucleotide analogs. A nucleic acid molecule of the invention can be single-stranded or double-stranded, and the strandedness will depend upon its intended use.

The invention further encompasses nucleic acid molecules that differ from the nucleotide sequence of SEQ ID NOs:1–23. Nucleic acid molecules of the invention include molecules that are at least 10 nucleotides in length and that have at least 75% sequence identity (e.g., at least 80%, 85%, 90%, 95%, or 99% sequence identity) to any of SEQ ID NOs:1–23. The full-length sizes of each of the novel M. paratuberculosis-specific nucleic acid molecules having the sequences shown in SEQ ID NOs:1–23 are indicated in Table 1. Nucleic acid molecules that differ in sequence from the nucleic acid sequences shown in SEQ ID NOs:1–23 can be generated by standard techniques, such as site-directed mutagenesis or PCR-mediated mutagenesis. In addition, nucleotide changes can be introduced randomly along all or part of the M. paratuberculosis-specific nucleic acid molecule, such as by saturation mutagenesis. Alternatively, nucleotide changes can be introduced into a sequence by chemically synthesizing a nucleic acid molecule having such changes.

TABLE 1
Sizes of M. paratuberculosis-specific nucleic acid
molecules and polypeptides
Nucleic Acid SEQ Polypeptide SEQ
Gene (bp) ID NO: (amino acids) ID NO:
10 969 1 322 24
11 576 2 191 25
38 522 3 173 26
56 582 4 193 27
57 311 5 103 28
128 576 6 191 29
135 474 7 157 30
159 558 8 185 31
217 321 9 106 32
218 2508 10 835 33
219 264 11 87 34
228 1110 12 369 35
240 672 13 223 36
241 372 14 123 37
250 600 15 199 38
251 540 16 179 39
252 291 17 96 40
253 225 18 74 41
254 441 19 146 42
255 726 20 241 43
256 426 21 141 44
257 279 22 87 45

In calculating percent sequence identity, two sequences are aligned and the number of identical matches of nucleotides or amino acid residues between the two sequences is determined. The number of identical matches is divided by the length of the aligned region (i.e., the number of aligned nucleotides or amino acid residues) and multiplied by 100 to arrive at a percent sequence identity value. It will be appreciated that the length of the aligned region can be a portion of one or both sequences up to the full-length size of the shortest sequence. It will be appreciated that a single sequence can align differently with other sequences and hence, can have different percent sequence identity values over each aligned region. It is noted that the percent identity value is usually rounded to the nearest integer. For example, 78.1%, 78.2%, 78.3%, and 78.4% are rounded down to 78%, while 78.5%, 78.6%, 78.7%, 78.8%, and 78.9% are rounded up to 79%. It is also noted that the length of the aligned region is always an integer.

The alignment of two or more sequences to determine percent sequence identity is performed using the algorithm described by Altschul et al. (1997, Nucleic Acids Res., 25:3389–3402) as incorporated into BLAST (basic local alignment search tool) programs, available at ncbi.nlm.nih.gov on the World Wide Web. BLAST searches can be performed to determine percent sequence identity between a M. paratuberculosis-specific nucleic acid molecule of the invention and any other sequence or portion thereof aligned using the Altschul et al. algorithm. BLASTN is the program used to align and compare the identity between nucleic acid sequences, while BLASTP is the program used to align and compare the identity between amino acid sequences. When utilizing BLAST programs to calculate the percent identity between a sequence of the invention and another sequence, the default parameters of the respective programs are used. Sequence analysis of the M. paratuberculosis-specific nucleic acid sequences as performed herein used BLAST version 2.2.2 (updated on Dec. 14, 2001).

The sequences of representative nucleic acids of the invention having 75%, 80%, 85%, 90%, 95%, and 99% sequence identity to SEQ ID NO:1 are shown in FIG. 4 (SEQ ID NOs:102–107, respectively). Such sequences can be generated using a computer or by hand. The nucleic acid sequences shown in SEQ ID NOs:102–107 were generated by hand by randomly changing 25 nucleotides out of every 100 nucleotides of SEQ ID NO:1, 2 out of every 10, 15 out of every 100, 1 out of every 10, 5 out of every 100, or 1 nucleotide out of every 100 nucleotides of SEQ ID NO:1, respectively. By β€œchanging,” it is meant that the nucleotide at a particular position is replaced randomly with one of the other three nucleotides. It is apparent to those of ordinary skill in the art that any nucleic acid molecule within the scope of the invention can be generated using the same method described herein (i.e., by similarly changing nucleotides within the sequence of SEQ ID NOs:1–23).

Nucleic acid molecules of the invention between about 10 and about 30 nucleotides in length will, in combination with an appropriate second nucleic acid molecule (e.g., an oligonucleotide primer) and under standard amplification conditions, generate an amplification product in the presence of M. paratuberculosis nucleic acid but will not generate an amplification product in the presence of nucleic acid from an organism other than M. paratuberculosis. As used herein, β€œstandard amplification conditions” refer to the basic components of an amplification reaction mix, and cycling conditions that include multiple cycles of denaturing the template nucleic acid, annealing the oligonucleotide primers to the template nucleic acid, and extension of the primers by the polymerase to produce an amplification product (see, for example, U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188. The basic components of an amplification reaction mix generally include, for example, about 10–25 nmole of each of the four deoxynucleoside triphosphates, (e.g., dATP, dCTP, dTTP, and dGTP, or analogs thereof), 10–100 pmol of primers, template nucleic acid, and a polymerase enzyme. The reaction components are generally suspended in a buffered aqueous solution having a pH of between about 7 and about 9. The aqueous buffer can further include one or more co-factors (e.g., Mg2+, K+) required by the polymerase. Additional components such as DMSO are optional. Template nucleic acid is typically denatured at a temperature of at least about 90Β° C., and extension from primers is typically performed at a temperature of at least about 72Β° C.

The annealing temperature can be used to control the specificity of amplification. The temperature at which primers anneal to template nucleic acid must be below the Tm of each of the primers, but high enough to avoid non-specific annealing of primers to the template nucleic acid. The Tm is the temperature at which half of the DNA duplexes have separated into single strands, and can be predicted for an oligonucleotide primer using the formula provided in section 11.46 of Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). Non-specific amplification products are detected as bands on a gel that are not the size expected for the correct amplification product. The annealing temperature used in amplification reactions described herein to demonstrate that the claimed nucleic acid molecules are M. paratuberculosis-specific was 55Β° C. and 60Β° C. for nucleic acids isolated from bacteria or from a biological sample, respectively. It can be appreciated by those of skill in the art that appropriate positive and negative controls should be performed with every set of amplification reactions to avoid uncertainties related to contamination and/or non-specific annealing of oligonucleotide primers and extension therefrom.

An appropriate second nucleic acid molecule is generally an oligonucleotide primer that can act in combination with a nucleic acid molecule of the invention, specifically for example a 10 to 30 nucleotide-long nucleic acid molecule of the invention, under appropriate amplification conditions to generate an amplification product in the presence of M. paratuberculosis nucleic acid. In order for a second nucleic acid molecule to act in combination with a nucleic acid molecule of the invention to generate an amplification product, the two molecules must anneal to opposite strands of the template nucleic acid, and should be an appropriate distance from one another such that the polymerase can effectively polymerize across the region and such that the amplification product can be readily detected using, for example, electrophoresis. Oligonucleotide primers can be designed using, for example, a computer program such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) to assist in designing primers that have similar melting temperatures. Typically, oligonucleotide primers can be 10 to 50 nucleotides in length (e.g., 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, or 50 nucleotides in length). Representative pairs of oligonucleotide primers that were used to amplify each of the M. paratuberculosis-specific nucleic acid molecules of the invention are shown in Tables 3 and 6 (SEQ ID NOs:46–101). Alternatively, the nucleic acid molecules having the sequences shown in SEQ ID NOs:1–23 can be used to design a pair of oligonucleotide primers. Oligonucleotides of the invention can be obtained by restriction enzyme digestion of M. paratuberculosis-specific nucleic acid molecules or can be prepared by standard chemical synthesis and other known techniques.

As used herein, an organism other than M. paratuberculosis refers to any organism that is not M. paratuberculosis. Generally, only relevant organisms are used in amplification reactions to examine the specificity of a 10 to 30 nucleotide-long nucleic acid molecule of the invention. Particularly relevant organisms include, without limitation, Ralstonia solanacearum, Sinorhizobium meliloti, Homo sapiens, Mesorhizobium loti, Oryza sativa, Drosophila melanogaster, Rhizobium leguminosarum, Xylella fastidiosa, Deinococcus radiodurans, Achromobacter cycloclastes, Candida cylindracea, Streptomyces lavendulae, Streptococcus pneumoniae, Mycobacterium tuberculosis, Pseudomonas aeruginosa, Sus scrofa, Mycobacterium leprae, Streptomyces coelicolor, Pseudomonas sp. (e.g., strain CA-10), Thauera aromatica, Brucella melitensis, Streptomyces noursei, Rhizobium meliloti, Synechococcus elongates, Rhodobacter capsulatus, Agrobacterium tumefaciens, Mycobacterium smegmatis, Drosophila virilis, Mus musculus, Leishmania major, Botrytis cinerea, Caulobacter crescentus, Rhodobacter sphaeroides, Spermatozopsis similes, Giardia intestinalis, Triticum aestivum, Bovine herpesvirus, Streptomyces sp. (e.g., strain MA-6548), Streptomyces peucetius, Rhizobium sp. (e.g., strain NGR-234), Haloferax volcanii, Streptomyces viridochromogenes, Felis catus, Xanthomonas campestris, Thermotoga maritime, Thermotoga neapolitana, Frankia alni, Halobacterium NRC-1 (ATCC Accession No. 700922), Glycine max, Leishmania tarentolae, Neisseria meningitides, Escherichia coli, Caenorhabditis elegans, Leishmania mexicana, Zea mays, Ictalurid herpesvirus, Rattus norvegicus, Arabidopsis thaliana, Pseudomonas fluorescens, Pantoea agglomerans, Erwinia uredovora, Pantoea ananatis, Streptomyces hygroscopicus, Rickettsia typhi, Pseudomonas cruciviae, Xanthomonas albilineans, Halobacterium salinarium, Micromonospora griseorubida, Pseudomonas paucimobilis, Streptomyces lividans, Pyrobaculum aerophilum, Sinorhizobium meliloti, Mesorhizobium loti, Bacillus halodurans, Trypanosoma rangeli, Trypanosoma minasense, Trypanosoma leeuwenhoeki, and Brassica napus. A 10 to 30 nucleotide-long nucleic acid molecule of the invention in combination with an appropriate second oligonucleotide primer will not generate an amplification product from nucleic acid of one or more of these other organisms.

As used herein, an β€œisolated” nucleic acid molecule is a nucleic acid molecule that is separated from other nucleic acid molecules that are usually associated with the isolated nucleic acid molecule. Thus, an β€œisolated” nucleic acid molecule includes, without limitation, a nucleic acid molecule that is free of sequences that naturally flank one or both ends of the nucleic acid in the genome of the organism from which the isolated nucleic acid is derived (e.g., a cDNA or genomic DNA fragment produced by PCR or restriction endonuclease digestion). Such an isolated nucleic acid molecule is generally introduced into a vector (e.g., a cloning vector, or an expression vector) for convenience of manipulation or to generate a fusion nucleic acid molecule. In addition, an isolated nucleic acid molecule can include an engineered nucleic acid molecule such as a recombinant or a synthetic nucleic acid molecule. A nucleic acid molecule existing among hundreds to millions of other nucleic acid molecules within, for example, a nucleic acid library (e.g., a cDNA, or genomic library) or a portion of a gel (e.g., agarose, or polyacrylamine) containing restriction-digested genomic DNA is not to be considered an isolated nucleic acid.

Isolated nucleic acid molecules of the invention can be obtained using techniques routine in the art. For example, isolated nucleic acids within the scope of the invention can be obtained using any method including, without limitation, recombinant nucleic acid technology, and/or the polymerase chain reaction (PCR). General PCR techniques are described, for example in PCR Primer: A Laboratory Manual, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, 1995. Recombinant nucleic acid techniques include, for example, restriction enzyme digestion and ligation, which can be used to isolate a nucleic acid molecule of the invention. Isolated nucleic acids of the invention also can be chemically synthesized, either as a single nucleic acid molecule or as a series of oligonucleotides. In addition, isolated nucleic acid molecules of the invention also can be obtained by mutagenesis. For example, and isolated nucleic acid that shares identity with an art known ECE sequence can be mutated using common molecular cloning techniques (e.g., site-directed mutagenesis). Possible mutations include, without limitation, deletions, insertions, substitutions, and combinations thereof.

Vectors containing M. paratuberculosis-specific nucleic acid molecules also are provided by the invention. Vectors, including expression vectors, suitable for use in the present invention are commercially available and/or produced by recombinant DNA technology methods routine in the art. A vector containing a M. paratuberculosis-specific nucleic acid molecule can have elements necessary for expression operably linked to such a M. paratuberculosis-specific nucleic acid, and further can include sequences such as those encoding a selectable marker (e.g., an antibiotic resistance gene), and/or those that can be used in purification of a M. paratuberculosis-specific polypeptide (e.g., 6Γ—His tag).

Elements necessary for expression include nucleic acid sequences that direct and regulate expression of nucleic acid coding sequences. One example of an element necessary for expression is a promoter sequence, for example, a M. paratuberculosis-specific promoter (e.g., from the same coding sequence being expressed or from a different coding sequence) or a non-M. paratuberculosis-specific promoter. Elements necessary for expression also can include introns, enhancer sequences, response elements, or inducible elements that modulate expression of a M. paratuberculosis-specific nucleic acid. Elements necessary for expression can be of bacterial, yeast, insect, mammalian, or viral origin and vectors can contain a combination of elements from different origins. Elements necessary for expression are described, for example, in Goeddel, 1990, Gene Expression Technology: Methods in Enzymology, 185, Academic Press, San Diego, Calif. As used herein, operably linked means that a promoter and/or other regulatory element(s) are positioned in a vector relative to a M. paratuberculosis-specific nucleic acid in such a way as to direct or regulate expression of the M. paratuberculosis-specific nucleic acid. Many methods for introducing nucleic acids into cells, both in vivo and in vitro, are well known to those skilled in the art and include, without limitation, calcium phosphate precipitation, electroporation, heat shock, lipofection, microinjection, and viral-mediated nucleic acid transfer.

Another aspect of the invention pertains to host cells into which a vector of the invention, e.g., an expression vector, or an isolated nucleic acid molecule of the invention has been introduced. The term β€œhost cell” refers not only to the particular cell but also to the progeny or potential progeny of such a cell. A host cell can be any prokaryotic or eukaryotic cell. For example, M. paratuberculosis-specific nucleic acids can be expressed in bacterial cells such as E. coli, or in insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art.

Vectors containing nucleic acid molecules unique to M. paratuberculosis were deposited with the American Type Culture Collection (ATCC), 10801 University Boulevard Manassas, Va. 20110, on Apr. 3, 2002, and assigned Accession Numbers PTA-4199, and PTA-4200. Each deposit will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. This deposit was made merely as a convenience for those of skill in the art and is not an admission that a deposit is required under 35 U.S.C. Β§112.

Purified M. paratuberculosis Polypeptides

One aspect of the invention pertains to purified M. paratuberculosis-specific polypeptides, as well as polypeptide fragments. A β€œM. paratuberculosis-specific polypeptide” refers to a polypeptide encoded by a nucleic acid molecule that is unique to M. paratuberculosis (e.g., M. paratuberculosis-specific nucleic acid molecules, for example, those having the sequence shown in SEQ ID NOs:1–23). Predicted amino acid sequences encoded by novel M. paratuberculosis-specific nucleic acids of the invention are shown in SEQ ID NOs:24–45.

The term β€œpurified” polypeptide as used herein refers to a polypeptide that has been separated or purified from cellular components that naturally accompany it. Typically, the polypeptide is considered β€œpurified” when it is at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, or 99%) by dry weight, free from the proteins and naturally occurring molecules with which it is naturally associated. Since a polypeptide that is chemically synthesized is, by nature, separated from the components that naturally accompany it, a synthetic polypeptide is β€œpurified.”

M. paratuberculosis-specific polypeptides can be purified from natural sources (e.g., a biological sample) by known methods such as DEAE ion exchange, gel filtration, and hydroxyapatite chromatography. A purified M. paratuberculosis-specific polypeptide also can be obtained by expressing a M. paratuberculosis-specific nucleic acid in an expression vector, for example. In addition, a purified M. paratuberculosis-specific polypeptide can be obtained by chemical synthesis. The extent of purity of a M. paratuberculosis-specific polypeptide can be measured using any appropriate method, e.g., column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

In addition to naturally-occurring M. paratuberculosis-specific polypeptides, the skilled artisan will further appreciate that changes can be introduced into a nucleic acid molecule (e.g., those having the sequence shown in SEQ ID NOs:1–23) as discussed herein, thereby leading to changes in the amino acid sequence of the encoded polypeptide. For example, changes can be introduced into M. paratuberculosis-specific nucleic acid coding sequences leading to conservative and/or non-conservative amino acid substitutions at one or more amino acid residues. A β€œconservative amino acid substitution” is one in which one amino acid residue is replaced with a different amino acid residue having a similar side chain. Similarity between amino acid residues has been assessed in the art. For example, Dayhoff et al. (1978, in Atlas of Protein Sequence and Structure, Vol. 5, Suppl. 3, pp 345–352) provides frequency tables for amino acid substitutions that can be employed as a measure of amino acid similarity. A non-conservative substitution is one in which an amino acid residue is replaced with an amino acid residue that does not have a similar side chain.

The invention also provides for chimeric or fusion polypeptides. As used herein, a β€œchimeric” or β€œfusion” polypeptide includes a M. paratuberculosis-specific polypeptide operatively linked to a heterologous polypeptide. 4) A heterologous polypeptide can be at either the N-terminus or C-terminus of the M. paratuberculosis-specific polypeptide. Within a chimeric or fusion polypeptide, the term β€œoperatively linked” is intended to indicate that the two polypeptides are encoded in-frame relative to one another. In a fusion polypeptide, the heterologous polypeptide generally has a desired property such as the ability to purify the fusion polypeptide (e.g., by affinity purification). A chimeric or fusion polypeptide of the invention can be produced by standard recombinant DNA techniques, and can use commercially available vectors.

A polypeptide commonly used in a fusion polypeptide for purification is glutathione S-transferase (GST), although numerous other polypeptides are available and can be used. In addition, a proteolytic cleavage site can be introduced at the junction between a M. paratuberculosis-specific polypeptide and a non-M. paratuberculosis-specific polypeptide to enable separation of the two polypeptides subsequent to purification of the fusion polypeptide. Enzymes that cleave such proteolytic sites include Factor Xa, thrombin, or enterokinase. Representative expression vectors encoding a heterologous polypeptide that can be used in affinity purification of a M. paratuberculosis polypeptide include pGEX (Pharmacia Biotech Inc; Smith & Johnson, 1988, Gene, 67:31–40), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.).

Anti-M. paratuberculosis-specific Antibodies

Another aspect of the invention relates to anti-M. paratuberculosis-specific antibodies. The term β€œanti-M. paratuberculosis-specific antibodies” as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules that have specific binding affinity for a M. paratuberculosis-specific polypeptide. The invention provides polyclonal and monoclonal antibodies that have specific binding affinity for M. paratuberculosis-specific polypeptides. The sequences of numerous M. paratuberculosis-specific polypeptides that can be used to generate anti-M. paratuberculosis-specific antibodies are disclosed herein (e.g., SEQ ID NOs:24–45). Examples of immunologically active portions of immunoglobulin molecules include F(ab) and F(abβ€²)2 fragments, which can be generated by treating an immunoglobulin molecule with an enzyme such as pepsin. As used herein, an antibody that has β€œspecific binding affinity” for a M. paratuberculosis-specific polypeptide is an antibody that binds a M. paratuberculosis-specific polypeptide but does not bind a non-M. paratuberculosis-specific polypeptides. A non-M. paratuberculosis-specific polypeptide as used herein refers to a polypeptide that may or may not be found in M. paratuberculosis, but is found in at least one other organism besides M. paratuberculosis.

A purified M. paratuberculosis-specific polypeptide or a fragment thereof can be used as an immunogen to generate polyclonal or monoclonal antibodies that have specific binding affinity for M. paratuberculosis-specific polypeptides. Such antibodies can be generated using standard techniques as described herein. Full-length M. paratuberculosis-specific polypeptides (see Table 1) or, alternatively, antigenic fragments of M. paratuberculosis-specific polypeptides can be used as immunogens. An antigenic fragment of a M. paratuberculosis-specific polypeptide usually includes at least 8 (e.g., 10, 15, 20, or 30) amino acid residues of a M. paratuberculosis-specific polypeptide (e.g., having the sequence shown in SEQ ID NOs:23–45), and encompasses an epitope of a M. paratuberculosis-specific polypeptide such that an antibody (e.g., polyclonal or monoclonal) raised against the antigenic fragment has specific binding affinity for a M. paratuberculosis-specific polypeptide.

Antibodies are typically prepared by first immunizing a suitable animal (e.g., a rabbit, a goat, a mouse or another mammal) with an immunogenic preparation. An appropriate immunogenic preparation can contain, for example, a recombinantly expressed or chemically synthesized M. paratuberculosis-specific polypeptide, of a fragment thereof. The preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar immunostimulatory agent. Immunization of a suitable animal with an immunogenic M. paratuberculosis-specific polypeptide preparation induces a polyclonal anti-M. paratuberculosis-specific antibody response.

The titer of the anti-M. paratuberculosis-specific antibody in the immunized animal can be monitored over time by standard techniques, such as with an enzyme-linked immunosorbent assay (ELISA) using immobilized M. paratuberculosis-specific polypeptides. If desired, the antibody molecules directed against M. paratuberculosis-specific polypeptides can be isolated from the animal (e.g., from the blood) and further purified by well-known techniques such as protein A chromatography to obtain the IgG fraction.

At an appropriate time after immunization, e.g., when the anti-M. paratuberculosis-specific antibody titers are highest, antibody-producing cells can be obtained from the animal and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler & Milstein (1975, Nature, 256:495–497), the human B cell hybridoma technique (Kozbor et al., 1983, Immunol. Today, 4:72), or the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77–96). The technology for producing various monoclonal antibody hybridomas is well known (see, generally, Current Protocols in Immunology, 1994, Coligan et al. (Eds.), John Wiley & Sons, Inc., New York, N.Y.). Briefly, an immortal cell line (e.g., a myeloma cell line) is fused to lymphocytes (e.g., splenocytes) from an animal immunized with an immunogenic M. paratuberculosis-specific polypeptide as described above, and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that has specific binding affinity for the M. paratuberculosis-specific polypeptide.

Any of the well-known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the purpose of generating an anti-M. paratuberculosis-specific monoclonal antibody (see, e.g., Current Protocols in Immunology, supra; Galfre et al., 1977, Nature, 266:55052; R. H. Kenneth, in Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Corp., New York, N.Y., 1980; and Lemer, 1981, Yale J. Biol. Med., 54:387–402). Moreover, the ordinary skilled worker will appreciate that there are many variations of such methods that also would be useful. Typically, the immortal cell line is derived from the same species as the lymphocytes. For example, murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation with an immortalized mouse cell line, e.g., a myeloma cell line that is sensitive to culture medium containing hypoxanthine, aminopterin and thymidine (β€œHAT medium”). Any of a number of ATCC-available myeloma cell lines can be used as a fusion partner according to standard techniques, e.g., the P3-NS1/1-Ag4–1, P3-x63-Ag8.653 or Sp2/O-Ag14 myeloma lines. Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol (PEG). Hybridoma cells resulting from the fusion are then selected using HAT medium. Hybridoma cells producing a monoclonal antibody are detected by screening the hybridoma culture supernatants for antibodies that bind M. paratuberculosis-specific polypeptides, e.g., using a standard ELISA assay.

As an alternative to preparing monoclonal antibody-secreting hybridomas, an anti-M. paratuberculosis-specific monoclonal antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with M. paratuberculosis-specific polypeptides. Immunoglobulin library members that have specific binding affinity for M. paratuberculosis-specific polypeptides can be isolated from such libraries. Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene SurfZAP Phage Display Kit, Catalog No. 240612). Additionally, examples of methods and reagents particularly amenable for use in generating and screening antibody display libraries can be found in, for example, U.S. Pat. No. 5,223,409; PCT Publication No. WO 92/20791; PCT Publication No. WO 93/01288; Hay et al., 1992, Hum. Antibod. Hybridomas, 3:81–85; Griffiths et al., 1993, EMBO J., 12:725–734; and references therein.

Additionally, recombinant anti-M. paratuberculosis-specific antibodies, such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, are within the scope of the invention. Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in PCT Publication No. WO 87/02671; European Patent (EP) Application 184,187; U.S. Pat. No. 4,816,567; Better et al., 1988, Science, 240:1041–1043; Shaw et al., 1988, J. Natl. Cancer Inst., 80:1553–1559); U.S. Pat. No. 5,225,539; Verhoeyan et al., 1988, Science, 239:1534; Beidler et al., 1988, J. Immunol., 141:4053–4060; and references therein.

An anti-M. paratuberculosis-specific antibody (e.g., a monoclonal antibody) can be used to isolate M. paratuberculosis-specific polypeptides by standard techniques, such as affinity chromatography or immunoprecipitation. An anti-M. paratuberculosis-specific antibody can facilitate the purification of natural M. paratuberculosis-specific polypeptides from cells and of recombinantly-produced M. paratuberculosis-specific polypeptides expressed in host cells. Moreover, an anti-M. paratuberculosis-specific antibody can be used to detect M. paratuberculosis-specific polypeptides (e.g., in a cellular lysate or cell supernatant) in order to evaluate the presence or absence of the M. paratuberculosis-specific polypeptides. Anti-M. paratuberculosis-specific antibodies can be used diagnostically to detect M. paratuberculosis-specific polypeptides, and hence, M. paratuberculosis, in a biological sample, e.g., to determine the infection status of an animal, or to determine the efficacy of a given treatment regimen.

Methods of Detecting M. paratuberculosis

The M. paratuberculosis-specific nucleic acid molecules and polypeptides, and the anti-M. paratuberculosis-specific antibodies described herein can be used in diagnostic assays for the detection of M. paratuberculosis. Diagnostic assays for determining the presence or absence of M. paratuberculosis are performed using a biological sample (e.g., fecal, blood, milk) to determine whether an animal has been exposed to or is infected with M. paratuberculosis. An exemplary method for detecting the presence or absence of M. paratuberculosis in a biological sample involves obtaining a biological sample from an animal and contacting the biological sample with an appropriate agent capable of detecting M. paratuberculosis-specific nucleic acids or polypeptides, or anti-M. paratuberculosis-specific antibodies.

The term β€œbiological sample” is intended to include cells and biological fluids obtained from an animal. In one embodiment, a biological sample contains polypeptides from the animal. Alternatively, the biological sample can contain nucleic acid molecules from the animal, or the biological sample can contain antibodies from the animal. It should be understood that any biological sample in which M. paratuberculosis-specific nucleic acids or polypeptides, or anti-M. paratuberculosis-specific antibodies may be present can be utilized in the methods described herein.

In one embodiment, an agent for detecting the presence or absence of M. paratuberculosis in a biological sample is an isolated M. paratuberculosis-specific nucleic acid molecule of the invention. The presence of M. paratuberculosis-specific nucleic acids in a sample indicates the presence of M. paratuberculosis in the sample. Methods for detecting nucleic acids include, for example, PCR and nucleic acid hybridizations (e.g., Southern blot, Northern blot, or in situ hybridizations). Specifically, an agent can be one or more oligonucleotides (e.g., oligonucleotide primers) capable of amplifying M. paratuberculosis-specific nucleic acids using PCR. PCR methods generally include the steps of collecting a biological sample from an animal, isolating nucleic acid (e.g., DNA, RNA, or both) from the sample, and contacting the nucleic acid with one or more oligonucleotide primers that hybridize(s) with specificity to M. paratuberculosis-specific nucleic acid under conditions such that amplification of the M. paratuberculosis-specific nucleic acid occurs if M. paratuberculosis is present. In the presence of M. paratuberculosis, an amplification product corresponding to the M. paratuberculosis-specific nucleic acid is produced. Conditions for amplification of a nucleic acid and detection of an amplification product are known to those of skill in the art (see, e.g., PCR Primer: A Laboratory Manual, 1995, Dieffenbach & Dveksler, Eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; and U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188). Modifications to the original PCR also have been developed. For example, anchor PCR, RACE PCR, or ligation chain reaction (LCR) are additional PCR methods known in the art (see, e.g., Landegran et al., 1988, Science, 241:1077–1080; and Nakazawaet al., 1994, Proc. Natl. Acad. Sci. USA, 91:360–364).

Alternatively, an agent for detecting M. paratuberculosis-specific nucleic acids can be a labeled oligonucleotide probe capable of hybridizing to M. paratuberculosis-specific nucleic acids on a Southern blot. An oligonucleotide probe can be, for example, a M. paratuberculosis-specific nucleic acid molecule such as a nucleic acid molecule having the sequence shown in SEQ ID NO:1–22, or a fragment thereof. In the presence of M. paratuberculosis, a hybridization complex is produced between M. paratuberculosis nucleic acid and the oligonucleotide probe. Hybridization between nucleic acid molecules is discussed in detail in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Sections 7.37–7.57, 9.47–9.57, 11.7–11.8, and 11.45–11.57).

For oligonucleotide probes less than about 100 nucleotides, Sambrook et al. discloses suitable Southern blot conditions in Sections 11.45–11.46. The Tm between a sequence that is less than 100 nucleotides in length and a second sequence can be calculated using the formula provided in Section 11.46. Sambrook et al. additionally discloses prehybridization and hybridization conditions for a Southern blot that uses oligonucleotide probes greater than about 100 nucleotides (see Sections 9.47–9.52). Hybridizations with an oligonucleotide greater than 100 nucleotides generally are performed 15–25Β° C. below the Tm. The Tm between a sequence greater than 100 nucleotides in length and a second sequence can be calculated using the formula provided in Sections 9.50–9.51 of Sambrook et al. Additionally, Sambrook et al. recommends the conditions indicated in Section 9.54 for washing a Southern blot that has been probed with an oligonucleotide greater than about 100 nucleotides.

The conditions under which membranes containing nucleic acids are prehybridized and hybridized, as well as the conditions under which membranes containing nucleic acids are washed to remove excess and non-specifically bound probe can play a significant role in the stringency of the hybridization. Such hybridizations can be performed, where appropriate, under moderate or high stringency conditions. Such conditions are described, for example, in Sambrook et al. section 11.45–11.46. For example, washing conditions can be made more stringent by decreasing the salt concentration in the wash solutions and/or by increasing the temperature at which the washes are performed. In addition, interpreting the amount of hybridization can be affected, for example, by the specific activity of the labeled oligonucleotide probe, by the number of probe-binding sites on the template nucleic acid to which the probe has hybridized, and by the amount of exposure of an autoradiograph or other detection medium.

It will be readily appreciated by those of ordinary skill in the art that although any number of hybridization and washing conditions can be used to examine hybridization of a probe nucleic acid molecule to immobilized target nucleic acids, it is more important to examine hybridization of a probe to target nucleic acids, for example, from M. paratuberculosis and at least one organism other than M. paratuberculosis, under identical hybridization, washing, and exposure conditions. Preferably, the target nucleic acids (e.g., nucleic acids from M. paratuberculosis and at least one organism other than M. paratuberculosis) are on the same membrane. Representative Southern blot conditions are described in Example 3.

A nucleic acid molecule is deemed to hybridize to M. paratuberculosis nucleic acids but not to nucleic acids from an organism other than M. paratuberculosis if hybridization to nucleic acid from M. paratuberculosis is at least 5-fold (e.g., at least 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 50-fold, or 100-fold) greater than hybridization to nucleic acid from an organism other than M. paratuberculosis. The amount of hybridization can be quantitated directly on a membrane or from an autoradiograph using, for example, a PhosphorImager or a Densitometer (Molecular Dynamics, Sunnyvale, Calif.). It can be appreciated that useful primers and probes of the invention include primers and probes that anneal and hybridize, respectively, to nucleic acids of organisms other than M. paratuberculosis provided that such nucleic acids are not typically present in the relevant test animals. For example, the fact that a particular primer or probe anneals or hybridizes, respectively, to human nucleic acid does not diminish the value of that primer or probe for detecting the presence or absence of M. paratuberculosis in ruminants, since ruminants typically are not contaminated with human nucleic acid.

In addition, anti-M. paratuberculosis-specific antibodies provided by the invention can be used as agents to detect the presence or absence of M. paratuberculosis-specific polypeptides in a biological sample. The presence of M. paratuberculosis-specific polypeptides is an indication of the presence of M. paratuberculosis in the sample. Techniques for detecting M. paratuberculosis-specific polypeptides include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence. An antibody of the invention can be polyclonal or monoclonal, and usually is detectably labeled. An antibody having specific binding affinity for a M. paratuberculosis-specific polypeptide can be generated using methods described herein. The antibody can be attached to a solid support such as a microtiter plate using methods known in the art (see, for example, Leahy et al., 1992, BioTechniques, 13:738–743). In the presence of M. paratuberculosis, an antibody-polypeptide complex is formed.

In addition, M. paratuberculosis-specific polypeptides of the invention can be used as an agent to detect the presence or absence of anti-M. paratuberculosis-specific antibodies in a biological sample. The presence of anti-M. paratuberculosis-specific antibodies in a sample indicates that the animal from which the sample was obtained mounted an immune response toward M. paratuberculosis. Given the etiology of M. paratuberculosis in its host animals, an animal that has detectable levels of anti-M. paratuberculosis-specific antibodies is likely infected with M. paratuberculosis. Alternatively, an animal that is positive for anti-M. paratuberculosis-specific antibodies may have resisted infection following a previous exposure to M. paratuberculosis, or may possess maternally-transmitted anti-M. paratuberculosis-specific antibodies. Techniques for detecting anti-M. paratuberculosis-specific antibodies in a biological sample include ELISAs, Western blots, immunoprecipitations, and immunofluorescence. A M. paratuberculosis-specific polypeptide can be attached to a solid support such as a microtiter plate by known methods (Leahy et al., supra). In the presence of M. paratuberculosis, a polypeptide-antibody complex is formed.

Detection of an amplification product, a hybridization complex, an antibody-polypeptide complex, or a polypeptide-antibody complex is usually accomplished by detectably labeling the respective agent. The term β€œlabeled” with regard to an agent (e.g., an oligonucleotide, a polypeptide, or an antibody) is intended to encompass direct labeling of the agent by coupling (i.e., physically linking) a detectable substance to the agent, as well as indirect labeling of the agent by reactivity with another reagent that is directly labeled with a detectable substance. Detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, Ξ²-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125I, 131I, 35S or 3H. Examples of indirect labeling include using a fluorescently labeled secondary antibody to detect an appropriate agent (e.g., a primary antibody), or end-labeling an agent with biotin such that it can be detected with fluorescently labeled streptavidin.

In another embodiment, the methods further involve obtaining a biological sample from an animal known to be infected with M. paratuberculosis (positive control) and a non-infected (negative control) animal, contacting the control samples with an agent capable of detecting M. paratuberculosis-specific nucleic acids or polypeptides, or anti-M. paratuberculosis-specific antibodies, such that the presence or absence of M. paratuberculosis-specific nucleic acids or polypeptides, or anti-M. paratuberculosis-specific antibodies in the samples is determined. The presence or absence of M. paratuberculosis-specific nucleic acids or polypeptides, or anti-M. paratuberculosis-specific antibodies in the control samples should correlate with the presence and absence of M. paratuberculosis in the positive and negative control samples, respectively.

Methods of Preventing a M. paratuberculosis Infection

In one aspect, the invention provides methods for preventing a disease or condition associated with infection by M. paratuberculosis (e.g., Johne's disease) in an animal by administering a compound to the animal that immunizes the animal against M. paratuberculosis infection. Animals at risk for M. paratuberculosis infection can be administered the compound prior to the manifestation of symptoms that are characteristic of a M. paratuberculosis infection, such that a M. paratuberculosis infection is prevented or delayed in its progression.

In one embodiment, a compound that immunizes an animal can be a M. paratuberculosis-specific polypeptide. The sequences of M. paratuberculosis-specific polypeptides are disclosed herein (e.g., SEQ ID NOs:24–45) and can be produced using methods described herein. An M. paratuberculosis-specific polypeptide can be a fusion polypeptide, for example a M. paratuberculosis-specific polypeptide-immunoglobulin fusion polypeptide in which all or part of a M. paratuberculosis-specific polypeptide is fused to sequences derived from a member of the immunoglobulin family. An M. paratuberculosis-specific polypeptide or fusion polypeptide of the invention can be used as an immunogen to elicit anti-M. paratuberculosis-specific antibodies in an animal, thereby immunizing the animal.

In another embodiment, a compound that immunizes an animal can be a M. paratuberculosis-specific nucleic acid molecule. A M. paratuberculosis-specific nucleic acid molecule used to immunize an animal can include one of the M. paratuberculosis-specific nucleic acid molecules having the sequence shown in SEQ ID NOs:1–23. M. paratuberculosis-specific nucleic acid coding sequences (e.g., full-length or otherwise) can be introduced into an appropriate expression vector such that a M. paratuberculosis-specific polypeptide or fusion polypeptide is produced in the animal upon appropriate expression of the expression vector. Expression of the M. paratuberculosis-specific nucleic acid molecule and production of a M. paratuberculosis-specific polypeptide in an animal thereby elicits an immune response in the animal and thereby immunizes the animal.

Compounds that can be used in immunogenic compositions of the invention (e.g., M. paratuberculosis-specific nucleic acid molecules or M. paratuberculosis-specific polypeptides) can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the nucleic acid molecule or polypeptide, and a pharmaceutically acceptable carrier. As used herein, β€œpharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and anti-fungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., ingestion or inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermnal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution (e.g., phosphate buffered saline (PBS)), fixed oils, a polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), glycerine, or other synthetic solvents; antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol or sorbitol, and sodium chloride in the composition. Prolonged administration of the injectable compositions can be brought about by including an agent that delays absorption. Such agents include, for example, aluminum monostearate and gelatin. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Oral compositions generally include an inert diluent or an edible carrier. Oral compositions can be liquid, or can be enclosed in gelatin capsules or compressed into tablets. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of an oral composition. Tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose; a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.

It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for an animal to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The dosage unit forms of the invention are dependent upon the amount of a compound necessary to immunize the animal. The amount of a compound necessary to immunize an animal can be formulated in a single dose, or can be formulated in multiple dosage units. Immunization of an animal may require a one-time dose, or may require repeated doses.

For polypeptide vaccines, the dose typically is from about 0.1 mg/kg to about 100 mg/kg of body weight (generally, about 0.5 mg/kg to about 5 mg/kg). Modifications such as lipidation (Cruikshank et al., 1997, J. Acquired Immune Deficiency Syndromes and Human Retrovirology, 14:193) can be used to stabilize polypeptides and to enhance uptake and tissue penetration. For nucleic acid vaccines, the dose administered will depend on the level of expression of the expression vector. Preferably, the amount of vector that produces an amount of a M. paratuberculosis-specific polypeptide from about 0.1 mg/kg to about 100 mg/kg of body weight is administered to an animal.

Articles of Manufacture of the Invention

The invention encompasses articles of manufacture (e.g., kits) for detecting the presence of M. paratuberculosis-specific nucleic acids or polypeptides, or anti-M. paratuberculosis-specific antibodies in a biological sample (a test sample). Such kits can be used to determine if an animal has been exposed to, or is infected with, M. paratuberculosis. For example, a kit of the invention can include an agent capable of detecting M. paratuberculosis-specific nucleic acids or polypeptides, or anti-M. paratuberculosis-specific antibodies in a biological sample (e.g., a M. paratuberculosis-specific oligonucleotide, an anti-M. paratuberculosis-specific antibody, or a M. paratuberculosis-specific polypeptide, respectively).

For antibody-based kits to detect M. paratuberculosis-specific polypeptides, the kit can include, for example, a first antibody (e.g., attached to a solid support) that has specific binding affinity for a M. paratuberculosis-specific polypeptide and, optionally, a second antibody which binds to M. paratuberculosis-specific polypeptides or to the first antibody and is detectably labeled. For oligonucleotide-based kits to detect M. paratuberculosis-specific nucleic acids, the kit may comprise, for example, one or more oligonucleotides. For example, a kit of the invention can include a detectably labeled oligonucleotide probe that hybridizes to a M. paratuberculosis-specific nucleic acid molecule or a pair of oligonucleotide primers for amplifying a M. paratuberculosis-specific nucleic acid molecule. Such oligonucleotides provided in a kit of the invention can be detectably labeled or, alternatively, the components necessary for detectably labeling an oligonucleotide can be provided in the kit. Polypeptide-based kits for detecting anti-M. paratuberculosis-specific antibodies in a biological sample can contain a M. paratuberculosis-specific polypeptide as disclosed herein (e.g., attached to a solid support) and, optionally, an antibody which binds to M. paratuberculosis-specific polypeptides or to an anti-M. paratuberculosis-specific antibody and is detectably labeled.

Kits can include additional reagents (e.g., buffers, co-factors, or enzymes) as well as reagents for detecting the agent (e.g., labels or other detection molecules), as well as instructions for using such agents and reagents to detect the presence or absence of M. paratuberculosis-specific nucleic acids or polypeptides, or anti-M. paratuberculosis-specific antibodies. The kit can also contain a control sample or a series of control samples that can be assayed and compared to the biological sample. Each component of the kit is usually enclosed within an individual container and all of the various containers are within a single package.

The invention also encompasses articles of manufacture (e.g., vaccines) for preventing M. paratuberculosis infection in an animal. Articles of manufacture of the invention can include pharmaceutical compositions containing either a M. paratuberculosis-specific nucleic acid molecule or a M. paratuberculosis-specific polypeptide. Such nucleic acid molecules or polypeptides are formulated for administration as described herein, and are packaged appropriately for the intended route of administration. Pharmaceutical compositions of the invention further can include instructions for administration.

The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.

EXAMPLES

Example 1

Mycobacterial Strains

Mycobacteria used in this study are listed in Table 2. All mycobacteria were cultured in Middlebrook 7H9 media with 0.05% Tween 80 and oleic acid albumin dextrose complex (Becton Dickinson Microbiology, Sparks, Md.). Cultures containing M. paratuberculosis isolates were supplemented with 2 mg/L ferric mycobactin J (Allied Monitor Inc., Fayette, Mo.). All growth flasks were incubated at 37Β° C. without shaking.

TABLE 2
Mycobacterial strains used
Isolatea Sourceb Origin Additional Information
M. avium subsp.
paratuberculosis
ATCC 19698 ATCC Bovine Isolated from ileum in 1974; type
strain
1434 NADC Ovine
1045 NADC Bovine Isolated from a Holstein lymph node
in 1984
1112 NADC Bovine Isolated from an Angus lymph
node in 1984
1018 NADC Bovine Isolated from a Holstein lymph node
in 1983
KAY NADC Bovine Isolated from a Holstein ileum
in 1993
K-10 NADC Bovine Isolated from a Wisconsin dairy herd
in 1990
1010 NADC Bovine
1113 NADC Bovine
M. avium subsp. avium
236 NADC Bovine
WP21 CP (Sep. 5, 2001) NADC Avian Mycobactin J independent, isolated
from a wood pigeon
6004 CP (Oct. 16, 2001) NADC Chicken ATCC 35719; TMC 801
1015 UMN Deer
1161 UMN Avian
1282 UMN Human
1285 UMN Human
M. phlei NADC
M. smegmatis NADC
M. intracellulare NADC Porcine TMC 1472, 35773; M. avium-M.
intracellulare-M. scrofulaceum
complex 6
M. fortuitum NADC
M. bovis
BCG Pasteur ATCC ATCC 35734; TMC 1011
(Aug. 11, 2001)
95 1398 (1998–1999) NADC Deer Isolated from a Colorado feedlot
M. tuberculosis Human
TB 14323
aDates of isolation (month/day/year) are in parentheses;
bATCC, American Type Culture Collection; NADC, National Animal Disease Center: UMN, University of Minnesota

Example 2

Annotation of M. paratuberculosis Contigs Greater than 10 kb

The sequencing and assembly strategies used herein for M. paratuberculosis were as described for Pasteurella multocida (see May et al., 2001, Proc. Nati. Acad. Sci. USA, 98:3460–5). For these studies, assembled M. paratuberculosis contig fragments greater than 10 kb were chosen. Predicted coding sequences were identified using ARTEMIS software and TB-parse, a program used to identify coding sequences in the M. tuberculosis genome (Cole et al., 1998, Nature, 393:537–44). The results were compared and verified manually in ARTEMIS. A putative ribosome-binding site (RBS) was also evaluated for each coding sequence. The presence of an AG-rich sequence approximately 30-bp upstream of the start codon was scored as a putative RBS sequence. Similarities were identified with BLASTP analysis by using GenBank and a local database constructed by the Computational Biology Center at the University of Minnesota (see, for example, cbc.umn.edu on the World Wide Web).

ARTEMIS and ACT are finded by the Wellcome Trust's Beowulf Genomics initiative and are available free on the internet at http://www.sanger.ac.uk/Software/. Sequence alignments between M. paratuberculosis and M. avium were compared and visualized with ACT software. M. avium is being sequenced by The Institute for Genomic Research (TIGR; http://www.tigr.org/cgi-bin/BlastSearch/blast.cgi?organism=mβ€”avium). Sequence alignments to produce figures or schematic illustrations were performed with AssemblyLIGNβ„’ software (Accelrys, Princeton, N.J.).

The nucleotide sequence of each M. paratuberculosis gene described in this study was deposited in the GenBank/EMBL Nucleotide Sequence Data Library under separate accession numbers AF445420 through AF445446.

Example 3

DNA Hybridizations

Genomic DNA was extracted from several species of mycobacteria using a modified method from that described by Whipple et al. (Whipple et al., 1987, J. Clin. Microbial., 25:1511–15). Briefly, one liter of Middlebrook 7H9 cultured mycobacteria was incubated at 37Β° C. until an OD540 of between 0.50 and 0.56 was reached. D-Cycloserine was added to the media at a final concentration of 0.5 mg/ml and incubated an additional 24 h. Mycobacteria were harvested by centrifuigation at 8,000 rpm for 15 min and the pellet was resuspended in 11 ml of Qiagen buffer B1 containing 1 mg/ml Qiagen RNase A. Lipase was added (450,000 Units, Sigma Catalog No L4384) to digest mycobacterial cell wall lipids. Following incubation for 2 h at 37Β° C., 20 mg of lysozyme was added and incubation proceeded for an additional 3 h at 37Β° C. 500 ΞΌl of Qiagen proteinase K (20 mg/ml) was added and incubated for 1.5 h at 37Β° C. Qiagen buffer B2 (4 ml) was added and the slurry mixed and incubated 16 h at 50Β° C. The remaining cellular debris was removed by centrifugation at 10,000 rpm for 20 min. The supernatant was poured over a pre-equilibrated Qiagen 500/G genomic tip. The loaded column was washed and processed according to the instructions of the manufacturer. PstI restricted DNA fragments were separated on a 1% agarose gel. DNA-containing gels were depurinated, denatured, and neutralized as described by Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Second Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). DNA was transferred by capillary action to BrightStar-Plus membranes (Ambion, Austin, Tex.) and probes were labeled using [Ξ±-32P]dCTP (ICN, Cost Mesa, Calif.) by random priming. Hybridization was performed in a AUTOBLOT hybridization oven (Bellco Biotechnology, Vineland, N.J.) at 45Β° C. for 16 h in ExpressHyb hybridization solution (Clontech, Palo Alto, Calif.). Probed blots were washed sequentially with solutions increasing in stringency as follows: 2 washes at room temp in 2Γ—SSC, 0.1% SDS; 2 washes at room temp in 0.2Γ—SSC, 0.1% SDS; and 2 washes at room temp in 0.16Γ—SSC, 0.1% SDS. Detection was by autoradiography at room temp using BioMax MR film (Kodak, Rochester, N.Y.) with a Kodak intensifying screen for less than 16 hours.

Example 4

PCR Amplification

Oligonucleotide primers listed in Table 3 were designed using the M. paratuberculosis-specific nucleic acid sequences identified herein. PCR amplification of M. paratuberculosis-specific nucleic acid molecules was performed as follows. A PCR master mix was generated that contained (each in final concentration) 1Γ— AmpliTaq Gold buffer (erkin-Elmer), 5% dimethylsufoxide (DMSO, Sigma), 20 mM each nucleotide (Roche Biochemicals), 10 ng genomic DNA, and 1 Unit of AmpliTaq Gold DNA polymerase (Perkin-Elmer). Primers were added to individual PCR tubes containing 25 ΞΌl of master mix. The PCR reaction conditions were as follows: a 5 min denaturing step at 94Β° C., followed by 35 cycles of: 94Β° C. for 45 sec, 55Β° C. for 1 min, and 72Β° C. for 2 min. At the end of 35 cycles, there was a 7 min incubation at 72Β° C. and a hold at 4Β° C. High fidelity Pwo polymerase (Boehringer Ingelheim Pharmaceutical Inc., Ridgefield, Conn.) was used in amplifications to generate probes used in Southern hybridization experiments. All other amplifications used Taq DNA polymerase (Roche Molecular Biochemicals, Indianapolis, Ind.).

TABLE 3
PCR primers used
Gene Primer 1 SEQ NO NO: Primer 2 SEQ ID NO:
10 CGGCGGATCAGCATCTAC 46 CACCTCATCGTGGCCAGGTT 47
11 ACCGAACACGAGTGGAGCA 48 CAGACTCTGACCGACGTCAT 49
38 GCATTTCGGCTCCCACGGTG 50 TACGTCGGTTCGGCGCGCAT 51
56 ATGAACACTTCTTCCTCTCTA 52 CATATCGCGGTGATCCTGAC 53
57 ATGGCCACCAACGACGACCA 54 CGCGGCCGTCGGGCCGGCTG 55
135 GCAGGCGTTTGCGTTCTTG 56 CGAGGTCCGAAATAGCGTAG 57
159 ATGCGTTTCGCCCTCCCGAC 58 TCACGCCTTGATTTCGTCCT 59
217 TGGCCGAACGCGGACTGTTC 60 TAGGAATCCGCGTCGACGAT 61
218 CAAGGTTCGTGACGGTATCG 62 TGACCCCAGCAGGTATGGC 63
219 CATCTACTGAGCGCCGTTTG 64 CACGCCGCCACCCCGTCCCG 65
228 GCAAGGTGGGCTTTGAAG 66 TGCGTGGGAGGATAAGGC 67
240 TTGGCACTGGCGTTTATG 68 ACATCGGGAACACAGGTCTC 69
241 ATCCTCCGGTTTGGCGGGAA 70 ACAGAGGTCGATCGGGTCG 71
250 CAGTCGGCCGGCGAAACGCC 72 CGCGGCGAAATCGAACGC 73
251 CACGTGCTGTCCCCATCGGC 74 CTACGTCTTCGTGACCAAAG 75
252 TGACCACCGACAACCCCACG 76 CATGAGGGCTGTCCCTCTCC 77
253 TTGACCGCGTTGACGGCGTT 78 CAGCGGTCCGCGCTCTTCGC 79
254 TGGGCAGCCCGGTGTCCCG 80 CACGCGCTCCTTTCAGCCTT 81
255 CAGTCACCCCGCGGCCGGTA 82 TCTACTGACCCGCAGATCGAA 83
256 TGGCCGTCAAGGACCAGAAC 84 CATGACCCTGCCGGCGTCCC 85
257 TGGCATTGGATCGCGTCGGA 86 TCAAACCCGGCGAGTTCTTC 87
aPrimers are shown in the 5β€² to 3β€² directions

Primers used to amplify the #7 sequence for a probe in Southern hybridizations were 5β€²-ATC AGG CTG ACG GGA TTG CCC-3β€² (SEQ ID NO:88) and 5β€²-TCA ACG AGT GCA CGG GAA CC-3β€² (SEQ ID NO:89).

Example 5

Twenty-seven M. paratuberculosis Predicted Coding Sequences are not Present in M. avium

Sequencing the complete genome of M. paratuberculosis K-10, a field isolate recovered from a cow with clinical Johne's disease, is currently underway. See, for example, cbc.umn.edu/ResearchProjects/AGAC/Mptb/Mptbhome.html on the World Wide Web. The genome size is estimated to be >5 Mb based on assembled sequence data, and by July, 2001, 2.65 Mb were contained in contig fragments greater than 10 kb. Those contigs that are above 10 kb were annotated using ARTEMIS and represent 48% of the total genome. The average size of the annotated contigs is 25 kb with one contig over 70 kb. Each gene within the annotated contig set was also checked manually and confirmed by TB-parse. These contigs were aligned with M. avium sequence data generated at TIGR. TIGR has 612 contigs that total 5,867,714 bp in the Jul. 8, 2001 data set.

M. avium and M. paratuberculosis display a high degree of similarity at the nucleotide level as well as local gene order conservation. An analysis of an 11-kb region surrounding the origin of replication for each of these genomes shows 98% sequence identity at the nucleotide level. The sequence similarity between orthologs in M. paratuberculosis and M. avium was greater than between M. paratuberculosis and other mycobacterial species. A more global comparison shows that these strong nucleotide identities are present throughout both genomes. Despite this strong genetic similarity, a total of 27 genes from the annotated M. paratuberculosis contigs were identified that did not align with the unfinished M. avium genome by computerized alignments. Of these, three contained weak similarity to proteins in other mycobacterial species or proteins in GenBank. This left 24 genes that have no significant similarity to any known proteins. Since only about half of the M. paratuberculosis genome was used in these analyses, a complete genome analysis may reveal an estimated 50 unique M. paratuberculosis genes.

Some M. paratuberculosis sequences that did not align with M. avium sequences, either in silico or experimentally, contain similarity to other mycobacterial species. One such sequence, designated #7, was tested by PCR and Southern hybridization with two M. avium isolates and two M. paratuberculosis strains. An amplified PCR fragment was produced only with M. paratuberculosis genomic DNA as template. Likewise, DNA hybridization on Southern blots detected only M. paratuberculosis sequences, not M. avium. However, BLASTP analysis of the #7 sequence revealed strong similarity to hypothetical proteins in the M. tuberculosis genome.

Example 6

PCR Analysis

PCR amplification was performed on several mycobacterial species, strains and isolates to experimentally determine the specificity for 26 of the 27 sequences (Table 4). Gene 128 was not included in these analyses because it had the lowest expect value (highest similarity to a sequence in GenBank) of the 27 sequences by BLASTP analysis. These data show that primers designed from all 26 M. paratuberculosis-specific genes from isolate K-10 could produce an amplified product in all 10 M. paratuberculosis strains or isolates tested. In addition, despite an absence of any homologous sequences in public databases, PCR products of the correct size were obtained for five genes using template from other mycobacterial species. Following this analysis a core group of 21 genes remained that are present only in M. paratuberculosis (Table 4).

TABLE 4
PCR analysis of M. paratuberculosis predicted coding sequences
Gene Number
Strain 56 57 159 217 218 228 240 250 251 252 253 254 255 256 257
M. paratuberculosis
ATCC19698 + + + + + + + + + + + + + + +
1434 + + + + + + + + + + + + + + +
1045 + + + + + + + + + + + + + + +
1112 + + + + + + + + + + + + + + +
1018 + + + + + + + + + + + + + + +
Kay + + + + + + + + + + + + + + +
K-10 + + + + + + + + + + + + + + +
1010 + + + + + + + + + + + + + + +
1113 + + + + + + + + + + + + + + +
M avium
#236 β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
WP21 β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
TMC801 β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
1015 β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
1161 β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
1282 β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
1285 β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
M. phlei β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
M. smegmatis β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
M. intracellulare β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
M. fortuitum β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
M. bovis BCG β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
M. bovis 95-1398 β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
M. tuberculosis β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
Gene Number
Strain 10 11 38 48 49 50 93 134 135 219 241
M. paratuberculosis
ATCC19698 + + + + + + + + + + +
1434 + + + + + + + + + + +
1045 + + + + + + + + + + +
1112 + + + + + + + + + + +
1018 + + + + + + + + + + +
Kay + + + + + + + + + + +
K-10 + + + + + + + + + + +
1010 + + + + + + + + + + +
1113 + + + + + + + + + + +
M. avium
#236 β€” β€” β€” β€” β€” β€” + + β€” β€” β€”
WP21 β€” β€” β€” + + + + + β€” β€” β€”
TMC8O1 β€” β€” β€” + + + + + β€” β€” β€”
1015 β€” β€” β€” + + + + + β€” β€” β€”
1161 β€” β€” β€” + + + + + β€” β€” β€”
1282 β€” β€” β€” β€” β€” β€” + + β€” β€” β€”
1285 β€” β€” β€” β€” β€” β€” + + β€” β€” β€”
M. phlei β€” β€” β€” β€” β€” β€” β€” + β€” β€” β€”
M. smegmatis β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
M. intracellulare β€” β€” β€” + + + + β€” β€” β€” β€”
M. fortuitum β€” β€” β€” β€” β€” β€” β€” β€” β€” β€” β€”
M. bovis BCG β€” β€” β€” β€” + β€” β€” β€” β€” β€” β€”
M. bovis 95-1398 β€” β€” β€” β€” + β€” β€” β€” β€” β€” β€”
M. tuberculosis β€” β€” β€” β€” + β€” β€” β€” β€” β€” β€”
β€œ+” indicates that an amplification product of the correct size was detected by ethidium bromide staining.
β€œβˆ’β€ indicates that no amplification product was detected by ethidium bromide staining.

Example 7

Sequence Analysis of an M. paratuberculosis-Specific Eight Gene Cluster

Eight genes were present on contig fragment 1614. These eight genes are arranged in tandem, span a total of 4.4 kb at the end of the 1614 contig (FIG. 1), and are present only in M. paratuberculosis (Table 4). 1408-bp upstream of gene 250 is an integrase gene that contains similarity to other mycobacteriophage integrases. This 4.4-kb segment (designated #481 (SEQ ID NO:23)) contains genes 250–257 and is located at the end of the 46-kb contig 1614. The sequences represented by #481 were found to align with the 94-kb contig 1398 present in a different contig assembly data set (FIG. 1). The #481 sequence aligned near the center of the 94-kb contig, essentially at position 35 to 45 kb. A trimmed portion of the 1398 contig is shown in the alignment in FIG. 1. The results of this analysis further extended the region of M. paratuberculosis-specific nucleic acid sequence to a 9.4-kb region, which does not align with M. avium sequence in silico.

A TBLASTX analysis was performed on the 9.4-kb sequence (designated contig 1398-trimmed in FIG. 1). The results of these analyses revealed that, while no sequences aligned with M. avium, the ends of contig 1398-trimmed align with sequences in M. tuberculosis. This leaves a core sequence of eight ORFs within the #481 sequence that are present only in M. paratuberculosis. This core sequence is flanked by 1408 bp of non-coding sequence downstream and 1092-bp of non-coding sequence upstream (FIG. 1). Therefore, this novel core sequence is well separated from other predicted open reading frames.

Example 8

Southern Hybridization Analysis Shows that the #481 Sequence is Specific to M. paratuberculosis

To confirm experimentally that #481 is present only in M. paratuberculosis, three arbitrarily chosen genes of the #481 sequence (251, 253, and 255) were radiolabeled and used as probes in DNA hybridization with several mycobacterial species including M. fortuitum, M. bovis, M. intracellulare, M. avium, and M. paratuberculosis. Following Southern blotting, only a M. paratuberculosis fragment greater than 9.5 kb was detected by each of the three probes.

Example 9

Characteristics of M. paratuberculosis-specific Polypeptides

The characteristics of M. paratuberculosis-specific polypeptides shown in Table 5 were obtained using MacVector sequence analysis software (Oxford Molecular).

TABLE 5
Characteristics of M. paratuberculosis-specific polypeptides
Gene pI MW (Da)
10 5.29 36,380
11 5.12 21,826
38 9.51 18,730
56 9.32 21,116
57 3.90 10,417
128 9.96 20,772
135 11.58 17,018
159 11.47 20,655
217 10.49 11,567
218 11.05 91,530
219 12.05 10,004
228 12.30 40,817
240 9.14 24,949
241 9.17 13,509
250 4.40 21,434
251 5.54 19,500
252 3.87 9,687
253 11.50 7,881
254 8.38 16,262
255 7.36 25,851
256 7.17 15,120
257 5.48 9,358

Example 10

Expression of M. paratuberculosis Genes in E. coli

To confirm coding predictions of novel M. paratuberculosis genes and assess their immunogenicity, coding sequences were amplified from the genome by PCR and cloned into the pMAL-c2 E. coli expression plasmid. These proteins were expressed as a fusion with E. coli maltose binding protein (MBP) to enable affinity purification on an amylase resin column. An immunoblot was probed with a monoclonal antibody that binds MBP, which identified each fusion protein. A duplicate immunoblot was probed with polyclonal sera from a rabbit immunized with a heat-killed preparation of M. paratuberculosis. Only the fusion protein containing the M. paratuberculosis specific polypeptide produced from gene 253 was detected by the rabbit sera, indicating that the polypeptide encoded by gene 253 was produced by M. paratuberculosis. The MBP protein was not detected by the polyclonal sera.

Example 11

The psp-1 Gene Product is Recognized by Sera From Cattle With Johne's Disease

The polypeptide produced from gene 253 was termed psp-1 (paratuberculosis-specific protein). To determine if psp-1 is recognized during infection of cattle, the purified MBP/psp-1 fusion was evaluated further by immunoblot with sera from cattle with overt signs of Johne's disease. Sera from all three Johne's cows examined recognized the MBP/psp-1 fusion protein but did not recognize MBP alone. Another M. paratuberculosis-MBP fusion protein using gene 251 was also evaluated in this experiment, but the fusion protein produced therefrom was only weakly detected.

Immunoblot analysis of psp-1 was further expanded to include additional sera from Johne's cattles as well as control cattle housed at NADC and a local Iowa diary herd. The polypeptide designated psp-1 was not detected by sera from 7 control cows, but was detected by 14 of 16 Johne's cows tested.

Example 12

Expression of M. paratuberculosis Coding Sequences

Coding sequences within M. paratuberculosis-specific DNA fragments are cloned into E. coli expression vectors (e.g., containing a sequence encoding a 6Γ—His tag). Heterologously expressed mycobacterial proteins are affinity purified from E. coli lysates by a polyhistidine tag. These purified proteins are then evaluated serologically with a panel of sera from infected and control cows to determine if the protein is recognized by sera from infected animals.

Specifically, each open reading frame identified as unique to M. paratuberculosis is amplified from genomic DNA, cloned into the pCRT7 expression vector (Invitrogen), and transformed into E. coli DH5-Ξ±. Each of the constructs are verified by DNA sequence analysis. The level of expression of the gene of interest is evaluated by loading the recombinant E. coli lysates onto SDS-PAGE gels and staining them in Coomassie blue. Expressed proteins are purified from E. coli lysates using the vector-encoded polyhistidine tag that has affinity for metal ions. Column purification using TALON metal resin (Clontech) is used. The fusion alone is used as a negative control. Comparisons of the reactivity of a collection of cattle antisera with the fusion proteins are conducted using a slot-blotting device (BioRad). Lysates of recombinant E. coli are loaded onto preparative 12% (w/v) polyacrylamide gels and transferred to nitrocellulose. After blocking, these filters are placed into the slot-blot device. Individual cattle antisera, each diluted 1:200, is added to independent slots. The rest of the procedure is carried out using standard immunoblot protocols. Protein G-peroxidase diluted 1:25,000 or anti-bovine IgG-peroxidase diluted 1:20,000 are used for detection of bound antibody.

Example 13

Production of Monoclonal and Polyclonal Antibodies Against M. paratuberculosis-specific Polypeptides

All expressed and purified M. paratuberculosis-specific polypeptides are used to immunize both BALB/c mice and New Zealand white rabbits. Standard immunization regimens are used in each instance. TiterMax or Freund's incomplete serve as the adjuvant. Splenic lymphocytes from the immunized mice are hybridized with myeloma cells for the production of monoclonal antibodies. ELISA is the method used to assay secreting hybridomas for reactivity to purified antigens. Hybridomas in positive wells are cloned and expanded using standard methods. Rabbit antisera is collected following boost injections of isolated polypeptide until a sufficient titer is obtained.

Example 14

ELISA Assays

Improvement in the specificity of the ELISA test for detection of animals with Johne's disease has always been a major goal. The only test commercially available in the US is a direct test that uses a protoplasmic antigen preparation (Dubash et al., 1995, J. Vet. Diag. Invest., 7:347–51; Collins & Sockett, 1993, J. Am. Vet. Med. Assoc., 203:1456–63). Efforts to amplify antigen/antibody reactions focus on the use of an indirect biotin/avidin system. The purified M. paratuberculosis-specific polypeptide to be evaluated is diluted in PBS and added to 96-well microtiter plates. Plates with bound polypeptide are blocked in PBS containing 1% gelatin and then washed three times with PBS containing 0.05% Tween. Test cattle sera is diluted 1:400 in PBS, added to individual wells, and processed as a standard ELISA. Mouse anti-bovine IgM or mouse anti-bovine IgG is the second antibody in these assays. Results show that the use of a biotinylated second antibody followed by streptavidin/alkaline phosphatase and enzyme detection enhances test sensitivity 8 to 16-fold (based on antibody titers) as compared to the standard direct ELISA.

The method described herein using a M. paratuberculosis-specific polypeptide is compared to the commercially-available direct ELISA by determining antibody titers of sera from clinically affected animals. Sera selected for these evaluations will include samples from both clinical and subclinical animals at NADC and from a nearby diary herd (State Center, Iowa) shown to have Johne's disease. For all evaluations, it is necessary to include samples from known negative animals to assess specificity. In addition, because of potential cross-reactivity that may be encountered with other bacteria, especially other mycobacteria, sera from animals known to be naturally or experimentally infected with other mycobacterial, particularly M. avium, are included. These controls determine whether the ELISA test detects only M. paratuberculosis-infected cattle.

Example 15

Use of Antibodies Against M. paratuberculosis-specific Polypeptides in Immunohistochemical Diagnosis of Infected Bovine Tissues

Histopathologic analysis of tissues from infected animals is a rapid method of detecting M. paratuberculosis. Biopsy tissue or tissue samples taken at necropsy are stained for acid-fastness to determine the presence of M. paratuberculosis. However, this method is non-specific and does not distinguish among mycobacterial species. Therefore, bovine tissues from M. paratuberculosis-, M. bovis-, M. avium-infected and uninfected animals are tested by histopathologic analysis using high-titer antibodies directed at M. paratuberculosis-specific polypeptides. Briefly, samples from the ileum and mesenteric lymph node of cows are fixed in buffered formalin, processed routinely, and embedded in paraffin wax. 6 ΞΌm cut sections are stained with hematoxylin and eosin or Ziehl-Neelsen by conventional methods. Replicate unstained sections will be prepared for immunohistochemistry. Sections that are immunostained are deparaffinized, rehydrated and blocked using routine methods (Stabel et al., 1996, J. Vet. Diagn. Invest., 8:469–73). Blocked sections are incubated with M. paratuberculosis-specific antibodies developed in the above-described studies. Depending on the nature of the primary antibody, either goat anti-rabbit biotinylated antibody or goat anti-mouse biotinylated antibody is added followed by washing instreptavidin-alkaline phosphatase solution. The tissue is stained with chromogen, and Histomark Red. Results are visualized under a bright-field microscope. Staining intensities are quantitatively compared among the different infected and uninfected tissues.

Example 16

Detection of M. paratuberculosis by PCR Amplification

Detection of M. paratuberculosis using oligonucleotide primers complementary to M. paratuberculosis-specific genes 93, 135, 218, 228, 240, and 251 or oligonucleotide primers complementary to IS900 nucleic acid sequences was examined by PCR. IS900 primer sequences were as follows: 5β€²-AAT CAA CTC CAG CAG CGC GGC CTC G-3β€² (SEQ ID NO:108) and 5β€²-CCG CTA ATT GAG AGA TGC GAT TGG-3β€² (SEQ ID NO:109). Fourteen fecal samples were processed from cattle in various stages of shedding. The bacterial load being shed by each animal was determined by culture on 7H10 slants.

To detect M. paratuberculosis by amplification of nucleic acids from a biological sample, a PCR master mix was generated similar to that described in Example 4 with the addition to the master mix of 10 mM MgCl. The PCR reaction conditions for amplification of nucleic acids from a biological sample were as follows: a 10 min denaturing step at 94Β° C., followed by 50 cycles of: 94Β° C. for 59 sec, 60Β° C. for 30 sec, and 72Β° C. for 1 min. At the end of 50 cycles, there was a 10 min incubation at 72Β° C. followed by a hold at 4Β° C.

Results of the PCR assays are as follows. Seven cattle identified as shedding heavily were all positive for M. paratuberculosis nucleic acid using either IS900 or MP228 primers. Out of 5 cattle identified as medium shedders, primers directed toward IS900 detected M. paratuberculosis nucleic acid in 1 animal, while primers directed toward MP228 detected M. paratuberculosis-specific nucleic acid in 2 animals. Out of 2 cattle identified as low shedders, primers directed toward IS900 detected M. paratuberculosis nucleic acid in 1 animal, while MP228 primers didn't detect M. paratuberculosis-specific nucleic acid in any animal. In titrations of M. paratuberculosis genomic DNA (isolate K-10), IS900 nucleic acids were detectable in 1 fg of nucleic acid, while each of the M. paratuberculosis-specific nucleic acids were detectable in 10 fg of nucleic acid.

TABLE 6
Primers used in PCR amplifications
SEQ ID
Primer Name Primer sequence NO: Gene
MP93F 5β€²-TTGCTGCGGGAAGGTTGCC-3β€² 90 93
MP93B 5β€²-CGAGAACGAGATGTGCGTCAG-3β€² 91
MP135F 5β€²-GCAGGCGTTTGCGTTCTTG-3β€² 92 135
MP135B 5β€²-CGAGGTCCGAAATAGCGTAGG-3β€² 93
MP218F 5β€²-CCAAGGTTCGTGACGGTATCG-3β€² 94 218
MP218B 5β€²-TGACCCCAGCAGGTATGGC-3β€² 95
MP228F 5β€²-GCAAGGTGGGCTTTGAAG-3β€² 96 228
MP228B 5β€²-TGCGTGGGAGGATAAGGC-3β€² 97
MP240F 5β€²-TTGGCACTGGCGTTTATG-3β€² 98 240
MP240B 5β€²-ACATCGGGAACACAGGTCTC-3β€² 99
MP251F 5β€²-ATGCCTACGGTTCGGTGC-3β€² 100 251
MLP251B 5β€²-AAGACAGCGTCAGCCAGC-3β€² 101

OTHER EMBODIMENTS

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

What is claimed is:

1. A method for detecting the presence or absence of M. paratuberculosis in a biological sample, comprising the steps of:

contacting said biological sample with an isolated nucleic acid under standard amplification conditions, wherein said nucleic acid comprises a nucleic acid molecule, wherein said nucleic acid molecule is at least 19 nucleotides in length, wherein said nucleic acid molecule has at least 75% sequence identity to an aligned portion of SEQ ID NO:23 or the complement of SEQ ID NO:23, wherein an amplification product is produced if M. paratuberculosis nucleic acid is present in said biological sample; and

detecting the presence or absence of said amplification product,

wherein the presence of said amplification product indicates the presence of M. paratuberculosis in the biological sample, and wherein the absence of said amplification product indicates the absence of M. paratuberculosis in the biological sample.

2. The method of claim 1, wherein said biological sample is obtained from a cow, a sheep, a goat, a rabbit, a deer, an antelope, or a bison.

3. The method of claim 1, wherein said biological sample is a fecal sample, a blood sample, or a milk sample.

4. The method of claim 1, wherein said nucleic acid comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs:72–87, 100, and 101.

5. The method of claim 1, wherein said detecting comprises electrophoretically separating said amplification product.

6. The method of claim 1, wherein said nucleic acid is labeled.

7. The method of claim 1, wherein said nucleic acid molecule has 75% sequence identity to SEQ ID NO:23.

8. The method of claim 1, wherein said nucleic acid molecule has 80% sequence identity to SEQ ID NO:23.

9. The method of claim 1, wherein said nucleic acid molecule has 85% sequence identity to SEQ ID NO:23.

10. The method of claim 1, wherein said nucleic acid molecule has 90% sequence identity to SEQ ID NO:23.

11. The method of claim 1, wherein said nucleic acid molecule has 95% sequence identity to SEQ ID NO:23.

12. The method of claim 1, wherein said nucleic acid molecule has 99% sequence identity to SEQ ID NO:23.

13. The method of claim 1, wherein said nucleic acid molecule comprises gene 250 (SEQ ID NO:15).

14. The method of claim 1, wherein said nucleic acid molecule comprises gene 251 (SEQ ID NO:16).

15. The method of claim 1, wherein said nucleic acid molecule comprises gene 252 (SEQ ID NO:17).

16. The method of claim 1, wherein said nucleic acid molecule comprises gene 253 (SEQ ID NO:18).

17. The method of claim 1, wherein said nucleic acid molecule comprises gene 254 (SEQ ID NO:19).

18. The method of claim 1, wherein said nucleic acid molecule comprises gene 255 (SEQ ID NO:20).

19. The method of claim 1, wherein said nucleic acid molecule comprises gene 256 (SEQ ID NO:2 1).

20. The method of claim 1, wherein said nucleic acid molecule comprises gene 257 (SEQ ID NO:22).

21. The method of claim 1, wherein any of said molecules that are 19 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of M. phlei, M. smegmatis, M. intracellulare, M. fortuitum, M. bovis, and M. tuberculosis.

22. A method for detecting the presence or absence of M. paratuberculosis in a biological sample, comprising the steps of:

contacting said biological sample with an isolated nucleic acid under hybridization conditions, wherein said nucleic acid comprises a nucleic acid molecule, wherein said nucleic acid molecule is at least 19 nucleotides in length, wherein said nucleic acid molecule has at least 75% sequence identity to an aligned portion of SEQ ID NO:23 or the complement of SEQ ID NO:23, wherein a hybridization complex is produced if M. paratuberculosis nucleic acid is present in said biological sample; and

detecting the presence or absence of said hybridization complex,

wherein the presence of said hybridization complex indicates the presence of M. paratuberculosis in said biological sample, and wherein the absence of said hybridization complex indicates the absence of M. paratuberculosis in said biological sample.

23. The method of claim 22, wherein nucleic acids present in said biological sample are electrophoretically separated.

24. The method of claim 23, wherein said electrophoretically separated nucleic acids are attached to a solid support.

25. The method of claim 24, wherein said solid support is a nylon membrane or a nitrocellulose membrane.

26. The method of claim 22, wherein said nucleic acid is labeled.

27. The method of claim 22, wherein said biological sample is selected from the group consisting of a fecal sample, a milk sample, and a blood sample.

28. The method of claim 22, wherein said biological sample is obtained from a cow, a sheep, a goat, a rabbit, a deer, an antelope, or a bison.

29. The method of claim 22, wherein said nucleic acid molecule has 75% sequence identity to SEQ ID NO:23.

30. The method of claim 22, wherein said nucleic acid molecule has 80% sequence identity to SEQ ID NO:23.

31. The method of claim 22, wherein said nucleic acid molecule has 85% sequence identity to SEQ ID NO:23.

32. The method of claim 22, wherein said nucleic acid molecule has 90% sequence identity to SEQ ID NO:23.

33. The method of claim 22, wherein said nucleic acid molecule has 95% sequence identity to SEQ ID NO:23.

34. The method of claim 22, wherein said nucleic acid molecule has 99% sequence identity to SEQ ID NO:23.

35. The method of claim 22, wherein said nucleic acid molecule comprises gene 250 (SEQ ID NO:15).

36. The method of claim 22, wherein said nucleic acid molecule comprises gene 251 (SEQ ID NO:16).

37. The method of claim 22, wherein said nucleic acid molecule comprises gene 252 (SEQ ID NO:17).

38. The method of claim 22, wherein said nucleic acid molecule comprises gene 253 (SEQ ID NO:18).

39. The method of claim 22, wherein said nucleic acid molecule comprises gene 254 (SEQ ID NO:19).

40. The method of claim 22, wherein said nucleic acid molecule comprises gene 255 (SEQ ID NO:20).

41. The method of claim 22, wherein said nucleic acid molecule comprises gene 256 (SEQ ID NO:21).

42. The method of claim 22, wherein said nucleic acid molecule comprises gene 257 (SEQ ID NO:22).

43. The method of claim 22, wherein any of said molecules that are 19 to 30 nucleotides in length, in combination with an appropriate second nucleic acid molecule, under standard amplification conditions, generates an amplification product from M. paratuberculosis nucleic acid but does not generate an amplification product from nucleic acid of any of the organisms selected from the group consisting of M. phlei, M. smegmatis, M. intracellulare, M. fortuitum, M. bovis, and M. tuberculosis.