-
2009-12-29
10/348,074
2003-01-17
US 7,638,334 B2
2009-12-29
-
-
Robert M Kelly
2023-01-17
Inhibitors of mismatch repair can be used to generate hypermutable cells and organisms. By inhibiting this process in cells, new cell lines and varieties with novel and useful properties can be prepared more efficiently than by relying on the natural rate of homologous recombination. These methods are useful for generating targeted loci that can alter the expression profiles of target genes as well as tag exons of a gene with a reporter marker to facilitate the monitoring of a given gene product when the host is grown under different conditions or exposed to biological and chemical entities.
Get notified when new applications in this technology area are published.
C12N15/87 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
C12N1/12 IPC
Microorganisms, e.g. protozoa; Compositions thereof ; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor Unicellular algae; Culture media therefor
C12N15/74 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
A01N63/00 IPC
Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
A01N65/00 IPC
Biocides, pest repellants or attractants, or plant growth regulators containing material from algae, lichens, bryophyta, multi-cellular fungi or plants, or extracts thereof
A61K48/00 IPC
Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
A01N43/04 IPC
Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with one or more oxygen or sulfur atoms as the only ring hetero atoms with one hetero atom
A61K31/70 IPC
Medicinal preparations containing organic active ingredients Carbohydrates; Sugars; Derivatives thereof
This Application claims the benefit of U.S. Provisional Application No. 60/349,565, filed Jan. 18, 2002, the disclosure of which is incorporated herein by reference in its entirety.
The invention is related to the area of homologous recombination in eukaryotic cells for studying gene function, gene expression, and generating over-producer clones for high protein production. In particular it is related to the field of therapeutic target discovery, pharmacologic compound screening and protein manufacturing.
The use of specific gene targeting in eukaryotic cell-based model systems provides an effective and selective strategy for studying the function of a particular gene in response to biological or chemical molecules as well as for model systems to produce biochemicals for therapeutic use. In particular is the use of homologous recombination to: (1) inactivate gene function to study downstream functions; (2) introduce reporter gene molecules into targeted loci to facilitate the screening of gene expression in response to biomolecules and/or pharmaceutical compounds; (3) generate stable, steady-state expression of target genes via the introduction of constitutively active heterologous promoter elements or through chromosomal site-specific gene amplification.
Standard methods for introducing targeting genes to a locus of interest are known by those skilled in the art. Gene targeting in prokaryotes and lower organisms has been well established, and methods for in vivo gene targeting in animal models have also been described (de Wind N. et al. (1995) “Inactivation of the mouse Msh2 gene results in mismatch repair deficiency, methylation tolerance, hyperrecombination, and predisposition to cancer” Cell 82:321-300).
The generation of knockouts in somatic cells, however, is more problematic due to low efficiency of transfection and endogenous biochemical activities that monitor for DNA strand exchange. Work done by Waldman et al. (Waldman, T., Kinzler, K. W., and Vogelstein, B. (1995) Cancer Res. 55:5187-5190) demonstrated the ability to generate somatic cell knockouts in a human cell line called HCT116 at relatively high rate. In the described studies, the authors used a targeting vector containing the neomycin (neo) resistance gene to knockout a locus of interest. Using this cell line the authors reported 37% of the neo resistant clones tested were found to contain a targeting vector within the homologous locus in the genome of the host.
Similar studies using other cell lines by these authors have been less successful. While the reason(s) for the lack or significant reduction in the frequency of recombination in somatic cell lines are not clear, some factors, such as the degree of transfection as well as the differences that may occur within the intracellular milieu of the host may play critical roles with regard to recombination efficiency. In the studies performed by Waldman et al., the cell line that the authors used was inherently defective for mismatch repair (MMR), a process involved in monitoring homologous recombination (de Wind N. et al. (1995) Cell 82:321-300). One proposed method for the high degree of recombination in this line was the lack of MMR, which has been implicated as a critical biochemical pathway for monitoring recombination (Reile, T E et al. WO 97/05268; Rayssigguier, C., et al. (1989) Nature 342:396-401; Selva, E., et al. (1995) Genetics 139:1175-1188; U.S. Pat. No. 5,965,415 to Radman). Indeed, studies using mammalian and prokaryotic cells defective for MMR have previously demonstrated the increased chromosomal recombination with DNA fragments having up to 30% difference in sequence identity.
Nevertheless, homologous recombination in mammalian somatic cell lines has been and remains problematic due to the low efficiency of recombination. Although it is believed by many skilled in the art that low rate of homologous recombination may be overcome by the blockade of MMR (Reile, T E et al. WO 97/05268; Rayssigguier, C., et al. (1989) Nature 342:396-401; Selva, E., et al. (1995) Genetics 139:1175-1188; U.S. Pat. No. 5,965,415 to Radman; Beth Elliott and Maria Jasin, “Repair of Double-Strand Breaks by Homologous Recombination in Mismatch Repair-Defective Mammalian Cells” (2001) Mol. Cell Biol., 21:2671-2682) these methods teach the use of using MMR defective unicellular organisms to increase homologous recombination. A significant bottleneck to this approach is the need to clone large segments of homologous DNA from the target locus. Moreover, while it has been reported that short oligonucleotides are capable of homologously recombining at site-specific regions of the genome (Igoucheva O, Alexeev V, Yoon K., (2001) “Targeted gene correction by small single-stranded oligonucleotides in mammalian cells” Gene Ther. 8:391-399), the ability to integrate larger fragments with short terminal regions of homology remains elusive. In fact, recent studies by Inbar et al. (Inbar O, Liefshitz B, Bitan G, Kupiec M., (2000) “The Relationship between Homology Length and Crossing Over during the Repair of a Broken Chromosome” J. Biol. Chem. 275:30833-30838) demonstrated that fragments that contained only 123 bps of homologous sequence were not sufficient to induce homologous exchange of large DNA fragments in yeast. It has not been heretofore demonstrated that larger DNA fragments, such as those containing regulated or constitutively active promoter elements, gene inserts or reporter genes could be integrated into the exon of a locus in somatic mammalian cell lines with short, homologous terminal ends, such as fragments of only 20-120 nucleotides.
The ability to generate site-directed “knock-ins” in eukaryotic cells, in particular mammalian cells, used for drug screening or development of custom cell lines for constitutive gene expression is of great value for pharmaceutical drug product development as well as for compound screening. Compounds can be of a low molecular weight, a complex macromolecule or protein. The compound can be targeted to a gene of interest whose expression is altered either positively or negatively by directly or indirectly affecting the activity of promoter and/or enhancer elements that are involved in regulating the expression of a specific gene locus. One method taught in this application is the “knock-in” of constitutively active promoter elements (such as but not limited to viral promoters, i.e. SV40 early or late promoters, CMV, LTR, etc. or promoters from constitutively expressed housekeeping genes such as the elongation factor or actin) into a desired locus. The ability to direct constitutive gene expression from a host organisms genome may lead to the establishment of cell lines such as but not limited to those that overproduce therapeutic targets for drug binding studies, gene function studies as well as lines that overproduce therapeutic proteins for product manufacturing applications.
It is an object of the present invention to teach the process of rapidly generating gene-targeting fragments for eukaryotic cells, in particular somatic mammalian cells that can result in the site-specific chromosomal targeting of regulatory sequences that can alter endogenous gene expression of a given locus for function studies and gene product production. In addition, it is another object of the invention to teach the process of rapidly generating gene targeting fragments for eukaryotic cells that are capable of targeting a single exon of a chromosomal locus with a marker that can be used for monitoring gene expression to elucidate gene function with respect to disease and to monitor gene expression of a given locus in response to biological and pharmacological agents. It is another object of the invention to teach the process of generating locus-specific targeting fragments containing the dihydrofolate reductase (DHFR) gene for rapid, site-specific chromosomal integration and site-specific gene amplification as a tool for enhancing protein production for development and/or manufacturing applications.
The invention provides methods for introducing a locus specific targeting fragment into the genome of a cell through homologous recombination comprising: inhibiting endogenous mismatch repair of the cell; introducing a locus specific targeting fragment into the cell; wherein the locus specific targeting fragment is a polynucleotide comprising at least one promoter, a selectable marker and 5′ and 3′ flanking regions of about 20 to about 120 nucleotides; wherein the 5′ and 3′ flanking regions are homologous to a selected portion of the genome of the cell; and wherein the locus specific targeting fragment integrates into the genome of the cell by homologous recombination.
The invention also provides methods for genetically altering a cell to overproduce a selected polypeptide comprising: inhibiting endogenous mismatch repair of the cell; introducing a locus specific targeting fragment into the cell; wherein the locus specific targeting fragment is a polynucleotide comprising at least one promoter sequence, a selectable marker and 5′ and 3′ flanking regions of about 20 to about 120 nucleotides, wherein the 5′ and 3′ flanking regions are homologous to a selected portion of the genome of the cell, and wherein the locus specific targeting fragment integrates into the genome of the cell by homologous recombination; and selecting the cell that overproduces the selected polypeptide.
The invention also provides methods for tagging an exon of a cell for screening gene expression in response to biochemical or pharmaceutical compounds comprising: inhibiting endogenous mismatch repair of the cell; and introducing a locus specific targeting fragment into the cell; wherein the locus specific targeting fragment is a polynucleotide comprising a reporter element, a selectable marker and 5′ and 3′ flanking regions of about 20 to about 120 nucleotides, wherein the 5′ and 3′ flanking regions are homologous to a selected portion of the genome of the cell; wherein the locus specific targeting fragment integrates within a targeted gene's exon by homologous recombination; and wherein the cells containing genes with tagged exons are used for screening gene expression in response to biochemical or pharmaceutical compounds.
The invention also provides methods for tagging a specific chromosomal site for locus-specific gene amplification comprising: inhibiting endogenous mismatch repair of the cell; and introducing a locus specific targeting fragment into the cell; wherein the locus specific targeting fragment is a polynucleotide comprising, operatively linked: a dihydrofolate reductase gene, a promoter, and 5′ and 3′ flanking regions of about 20 to about 120 nucleotides, wherein the 5′ and 3′ flanking regions are homologous to a selected portion of the genome of the cell; wherein the locus specific targeting fragment integrates into the genome of the cell by homologous recombination; and wherein the specific chromosomal site is tagged for locus specific gene amplification.
In some embodiments of the method of the invention, the method further comprises restoring mismatch repair activity of the cell.
In some embodiments of the methods of the invention, the promoter may be a CMV promoter, an SV40 promoter, elongation factor, LTR sequence, a pIND promoter sequence, a tetracycline promoter sequence, or a MMTV promoter sequence.
In some embodiments of the methods of the invention, the selectable marker may be a hygromycin resistance gene, a neomycin resistance gene or a zeocin resistance gene.
In some embodiments of the methods of the invention, the 5′ and 3′ flanking regions are about 30 to about 100 nucleotides in length. In other embodiments of the methods of the invention, the 5′ and 3′ flanking regions are about 40 to about 90 nucleotides in length. In other embodiments of the methods of the invention, the 5′ and 3′ flanking regions are about 50 to about 80 nucleotides in length. In other embodiments of the methods of the invention, the 5′ and 3′ flanking regions are about 50 to about 70 nucleotides in length.
In some embodiments of the methods of the invention, the cell may be a vertebrate cell, an invertebrate cell, a mammalian cell, a reptilian cell, a fungal cell, or a yeast cell.
In some embodiments of the methods of the invention, the 5′ and 3′ flanking regions are homologous to a 5′ flanking region of a selected chromosomal locus of the cell.
In some embodiments of the methods of the invention, the mismatch repair is inhibited by introducing into the cell a dominant negative allele of a mismatch repair gene. In other embodiments, mismatch repair is inhibited using a chemical inhibitor of mismatch repair. In embodiments using a dominant negative allele of a mismatch repair gene, the allele may be a dominant negative form of a PMS2 (SEQ ID NO:2 and SEQ ID NO:4), PMS1 (SEQ ID NO:6), MSH2 (SEQ ID NO:8), MSH6 (SEQ ID NO:41), MLH1 (SEQ ID NO:10), PMSR2 (SEQ ID NO:43), or a PMSR3 (also known as PMSL9) (SEQ ID NO:45). In some embodiments, the dominant negative form of the PMS2 gene is a PMS2-134 gene (SEQ ID NO:12), a PMSR2 gene (SEQ ID NO:43), or a PMSR3 gene (SEQ ID NO:45).
Some embodiments of the method may comprise a polynucleotide that also comprises a reporter element, including, but not limited to a form of luciferase or a green fluorescent protein. In some embodiments, the reporter element is fused in frame to the selectable marker.
In some embodiments, the locus specific targeting fragment further comprises a selectable marker and a second promoter operatively linked to the selectable marker.
The invention also provides locus specific targeting fragments comprising: a dihydrofolate reductase gene operatively linked to a promoter, and 5′ and 3′ flanking regions of about 20 to about 120 nucleotides wherein the 5′ and 3′ flanking sequences are homologous to a selected portion of a genome of a cell.
The invention also provides locus specific targeting fragments comprising: a reporter element, a selectable marker operatively linked to a promoter, and 5′ and 3′ flanking regions of about 20 to about 120 nucleotides.
The invention also provides locus specific targeting fragments comprising: at least one promoter sequence, a selectable marker and 5′ and 3′ flanking regions of about 20 to about 120 nucleotides.
In some embodiments of the compositions of the invention, the locus specific targeting fragment further comprises a selectable marker operatively linked to a second promoter sequence. The compositions may further comprise an IRES sequence between two protein encoding sequences such as between a dihydrofolate reductase gene and a selectable marker, for example.
In some embodiments the 5′ and 3′ flanking regions of the locus specific targeting sequence are about 30 to about 100 nucleotides in length. In other embodiments the 5′ and 3′ flanking regions of the locus specific targeting sequence are about 40 to about 90 nucleotides in length. In other embodiments the 5′ and 3′ flanking regions of the locus specific targeting sequence are about 50 to about 80 nucleotides in length. In other embodiments the 5′ and 3′ flanking regions of the locus specific targeting sequence are about 50 to about 70 nucleotides in length.
The invention also provides methods for producing a locus specific targeting fragment comprising amplifying a nucleic acid construct comprising a promoter and a selectable marker with a 5′ and 3′ primer in a polymerase chain reaction, wherein the 5′ primer comprises about 20 to about 120 nucleotides that are homologous to a portion of the genome of a cell positioned 5′ of a target locus, and wherein the 3′ primer comprises about 20 to about 120 nucleotides that are homologous to a portion of the genome of a cell positioned 3′ of the target locus.
In some embodiments of the method of the invention, the nucleic acid construct further comprises a second protein encoding sequence operatively linked to a second promoter. In some embodiments, the second protein encoding sequences is a dihydrofolate reductase sequence.
In some embodiments, the method further comprises the step of selecting the cells based on resistance to methotrexate. In some embodiments, the locus specific targeting fragment further comprises an operatively positioned locus control region.
The invention also provides methods for introducing a locus specific targeting fragment into the genome of a cell through homologous recombination comprising: introducing a locus specific targeting fragment into a mismatch repair-deficient cell; wherein the locus specific targeting fragment is a polynucleotide comprising a nucleic acid sequence to be incorporated into the genome of the mismatch repair deficient cell; wherein the polynucleotide comprises portions of about 20 to about 120 nucleotides, each flanking the 5′ and 3′ portion of the nucleic acid sequence to be incorporated into the genome; wherein the 5′ and 3′ flanking regions are homologous to a selected portion of the genome of the cell; and wherein the locus specific targeting fragment integrates into the genome of the mismatch repair deficient cell by homologous recombination.
The invention described herein is directed to the use of a process for the rapid generation of locus specific targeting fragments (LSTFs) that are capable of integrating within a given locus, to regulate the expression of a specific gene locus in a host cells for product manufacturing, studying gene function, and/or expression profiling gene expression under homeostatic, pathogenic, or environmentally altered conditions. Promoter targeted eukaryotic cell lines are generated by using 50-150 nucleotide (nt) primers whereby the 3′ termini of each primer (last 30 nts) are specific for the 5′ and 3′ end of a plasmid cassette containing a expression element (i.e., constitutive promoter) juxtaposed to a constitutively expressed, selectable marker gene (i.e., neomycin-, hygromycin-resistant, etc., gene). The 5′ sequence (20 to 120 nts) of each primer preferably contains 100% homology to the chromosomal target area of interest. In the case of generating tagged exons within a targeted locus, a similar method is employed as above, except that the cassette contains a reporter element such as, but not limited to, firefly luciferase (shown by nucleic acid sequence, SEQ ID NO:35, and amino acid sequence, SEQ ID NO:34), green fluorescent protein (shown by nucleic acid sequence, SEQ ID NO:37, and amino acid sequence, SEQ ID NO:36), bacterial luciferases; Renilla luciferase (shown by nucleic acid sequence, SEQ ID NO:39, and amino acid sequence, SEQ ID NO:38), a bifunctional ruc-gfp chimera (comprising a cDNA for Renilla luciferase (ruc) in-frame with a cDNA encoding the “humanized” GFP (gfp) from Aequorea (Wang et al. (2002) Mol. Genet. Genomics 268(2):160-168)), and the like, fused in-frame to a selectable marker for selection. Finally, LSTFs can be used to deliver a DNA fragment encoding a constitutively expressed dihydrofolate reductase gene (DHFR) juxtaposed to a constitutively expressed selection marker into a specific chromosomal site. Upon integration of the DHFR-LSTF, cells can be chemically selected for locus amplification via drug resistance using methods know by those skilled in the art, which in turn will result in amplification of a gene locus and potentially over expression of its encoded gene product.
The homologous recombination of small overlapping DNA regions is difficult to achieve, however, it is taught by this application that the use of inhibiting mismatch repair (MMR) in eukaryotic somatic cells increases the efficiency of homologous recombination that allows for the rapid generation of recombination using homologous regions as short as 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 120 nucleotides in length. In some embodiments, the homologous regions are as short as about 25 to about 115 nucleotides in length. In other embodiments, the homologous regions are as short as about 30 to about 110 nucleotides in length. In other embodiments, the homologous regions are as short as about 35 to about 105 nucleotides in length. In other embodiments, the homologous regions are as short as about 40 to about 100 nucleotides in length. In other embodiments, the homologous regions are as short as about 45 to about 95 nucleotides in length. In other embodiments, the homologous regions are as short as about 50 to about 90 nucleotides in length. In other embodiments, the homologous regions are about 50 to about 85 nucleotides in length. In other embodiments, the homologous regions are about 50 to about 80 nucleotides in length. In other embodiments, the homologous regions are about 50 to about 75 nucleotides in length. In other embodiments, the homologous regions are about 50 to about 70 nucleotides in length.
The inhibition of MMR in such hosts can be achieved by using dominant negative mutant MMR genes as described (Nicolaides, N. C. et al. (1998) “A naturally occurring hPMS2 mutation can confer a dominant negative mutator phenotype” Mol. Cell. Biol. 18:1635-1641; U.S. Pat. No. 6,146,894 to Nicolaides et al.) or through the use of chemicals that can inhibit MMR of a host organism. Once the targeting vector is introduced, MMR is restored by removal of the dominant negative allele or removal of the MMR inhibitor and hosts are selected for integrated fragments by selection of the appropriate marker gene.
The use of somatic eukaryotic cells containing knocked-in expression control elements or exon-tags, or DHFR amplification units as taught by this application, will facilitate studies on elucidating unknown gene function by the ability to over express genomic loci at will under a variety of experimental growth conditions in the presence or absence of exogenous biological or pharmacological factors. Moreover, the use of such an approach to specifically tag a gene's exon will facilitate the profile of gene expression under certain growth conditions in wild type and pathogenic cells grown in the presence or absence of biological or pharmaceutical factors. Finally, the ability to specifically amplify chromosomal regions can facilitate enhanced protein production in a given host organism for discovery, development, and/or manufacturing or a given gene product.
The invention described herein is directed to the creation of genetically modified eukaryotic cells, in particular, somatic mammalian cells containing targeted loci with regulated or constitutively active expression elements for the use in uncovering gene function or polypeptide production as well as the use of targeting vectors that can tag an exon of a locus which can subsequently be monitored in response to biological or pharmaceutical molecules. The ability to generate such cells are facilitated by the use of targeting cassettes containing elements that are rapidly modified to target a given locus via PCR-mediated synthesis using locus specific primers containing 20-120 nts, specifically 50-70 nts, of homologous sequence to the chromosomal target site in combination with the use of agents that can block the endogenous MMR of the host during DNA integration to increase recombination efficiency of short homologous sequences (Nicholas Nicolaides, personal observation).
The present invention describes the facilitated synthesis of gene targeting fragments for controlling gene expression from the chromosomal site within eukaryotic cells as well as the use of exon-tagging fragments to study gene expression in the presence of biological or pharmaceutical agents. The advantages of the present invention are further described in the examples and figures described herein.
The present invention provides methods for generating somatic eukaryotic cells with altered gene expression profiles via homologous recombination in vivo, whereby gene expression is altered by the integration of DNA sequences containing constitutive promoter elements and a selectable marker. One method for generating such a cell line is through the use of DNA fragments containing 20-120 nts of homologous terminal sequences that are specific for a gene locus of interest in cells devoid of MMR.
The invention also provides methods for generating somatic eukaryotic cells containing genes with a tagged exon, whereby the cell is generated via the integration of DNA sequences containing reporter elements fused to a selectable marker. One method for generating such a cell line is through the use of DNA fragments containing 20-120 nts of homologous terminal sequence to a specific gene locus of interest in cells devoid of MMR.
The invention also provides methods for generating genetically engineered somatic cell lines that over produce polypeptides through the use of promoter targeting fragments to chromosomal loci.
The invention also provides methods for generating genetically engineered somatic cell lines that have a chromosomal site-specific integration of a constitutively expressed DHFR gene through the use of locus targeting fragments to chromosomal loci for selection of amplified loci through chemical-induced gene amplification using methods known by those skilled in the art.
In some embodiments, the invention provides methods for generating genetically altered cell lines that overproduce polypeptides for function studies. In other embodiments, the invention provides methods for generating genetically altered cell lines that overproduce polypeptides for production purposes. In other embodiments, the invention provides methods for generating genetically altered cell lines with genes whose exons are tagged for screening purposes.
In some embodiments, the invention provides methods of enhancing the frequency of homologous recombination of a DNA fragment within a specific chromosomal locus in eukaryotic cells by blocking the MMR activity of the somatic cell host.
In some embodiments, the invention provides methods of creating targeted eukaryotic cell lines with chromosomal loci containing DHFR expression vector for locus-specific gene amplification.
These and other objects of the invention are provided by one or more of the embodiments described below.
In one embodiment of the invention, a method for making a somatic eukaryotic cell line MMR defective, followed by the introduction of a locus specific targeting fragment that results in the constitutive expression of a chromosomal locus is provided. A polynucleotide encoding a dominant negative allele of a MMR gene is introduced into a target cell. The cell becomes hypermutable as a result of the introduction of the gene. A targeting fragment is generated by PCR using primers containing sequences homologous to the chromosomal locus of interest. The fragment is introduced into the host by transfection. Cell pools are then selected for clones with integrated fragments. Selected clones are further analyzed by any number of means to assess expression and/or genome integration of a specific site. Upon confirmation of site-desired integration, MMR is restored in clones and the cells are useful for functional studies or for generating high levels of protein for product development and/or manufacturing applications.
In another embodiment of the invention, a cell line with a targeted exon is provided. A somatic eukaryotic cell line is rendered MMR defective by introduction of a dominant negative MMR gene allele, followed by the introduction of a targeting fragment containing a reporter gene fused to a selectable marker that results in the tagging of an endogenous gene's exon is provided. A polynucleotide encoding a dominant negative allele of a MMR gene is introduced into a target cell. The cell becomes hypermutable as a result of the introduction of the gene. A targeting fragment is generated by PCR using primers containing sequences homologous to the chromosomal locus of interest. The fragment is introduced into the host by transfection. Cell pools are then selected for clones with integrated fragments. Selected clones are further analyzed by any number of means to assess expression and/or genome integration of a specific site. Upon confirmation of site-desired integration, MMR is restored in clones and the cells are useful for functional studies to profile endogenous gene expression in the presence or absence of biological or pharmacological factors.
Yet in another embodiment of the invention, a cell line with a targeted locus is provided. A somatic eukaryotic cell line is rendered MMR defective by introduction of a dominant negative MMR gene allele, followed by the introduction of a targeting fragment containing a DHFR gene and a selectable marker that results in the specific tagging of a chromosomal site is described. A polynucleotide encoding a dominant negative allele of a MMR gene is introduced into a target cell. The cell becomes hypermutable as a result of the introduction of the gene. A targeting fragment is generated by PCR using primers containing sequences homologous to the chromosomal locus of interest. The fragment is introduced into the host by transfection. Cell pools are then selected for clones with integrated fragments. Selected clones are further analyzed by any number of means to assess expression and/or genome integration of a specific site. Upon confirmation of site-desired integration, cells are selected for methotrexate (MTX) resistance. MTX-resistant cells are then analyzed for chromosomal site amplification using any means useful to those skilled in the art such as but not limited to genomic analysis by southern blot, RNA expression analysis or protein expression analysis. Upon successful amplification, MMR is restored in clones and the cells are useful for functional studies to profile endogenous gene expression in the presence or absence of biological or pharmacological factors as well as for production strains.
These and other embodiments of the invention provide the art with methods that can rapidly generate gene targeted eukaryotic cells whereby the locus of interest can have altered expression profiles to study gene function and/or enhanced production levels for manufacturing. Moreover, the invention provides the art with methods to tag an exon of a gene that is useful for monitoring gene expression within a given host.
FIG. 1 shows a schematic diagram of promoter locus-specific targeting fragments (LSTF) and the genomic organization of a target gene. Primer Set A indicates the primer position of the oligonucleotides used to generate the LSTF for each gene that is useful for genome analysis. Primer Set B indicates the primer position of oligonucleotides used to analyze each target gene to confirm locus specific integration. The box below each gene represents the LSTF, where the shaded areas represent the areas of homology to the target gene, whereby the homologous region is 50-70 nts in length. The black boxes in the gene diagram represents exons that are numbered with respect to homology to the target gene whereby sensitive RT-PCR can be used to assay for fusion spliced cDNAs consisting of CMV leader sequence located 3′ to the CMV promoter elements. The targeting cassette is used for generating constitutive expression from a eukaryotic host's genome.
FIG. 2 shows expression of β-globin in HEK293 cells transfected with LSTFs. RT-PCR analysis of RNA extracted from 293PMS134 cells transfected with mock LSTF or Hyg-CMV β-globin LSTF. Reverse transcriptase PCR was carried out using equal amounts of total RNA from each cell line and a 5′ primer located in the leader sequence downstream of the CMV promoter (SEQ ID NO:21) and a 3′ primer located in the coding region of the beta-globin gene (SEQ ID NO:25). PCR reactions were electrophoresed on 2% agarose gels, ethidium bromide stained and visualized using a UV light box. The arrow indicates a product of the expected molecular weight.
FIG. 3A shows the sequence of the fusion gene hygromycin-green fluorescence binding protein for exon tagging of somatic cells (SEQ ID NO:46). The sequence in bold encodes for the hygromycin resistance gene, while the sequence in normal font encodes the green fluorescence binding protein.
FIG. 3B shows the sequence of the fusion gene hygromycin-luciferase for exon tagging of somatic cells (SEQ ID NO:47). The sequence in bold encodes for the hygromycin resistance gene, while the sequence in normal font encodes the luciferase protein.
FIG. 4 shows a schematic diagram of exon locus-specific targeting fragments (LSTF) and the genomic organization of a target gene. The LSTF contains a selectable marker gene (i.e., hygromycin, neomycin, zeocin, etc.) that is in frame with a reporter gene, (i.e., luciferase, Green Fluorescent Protein, etc.). Primer Set A indicates the primer position of oligonucleotides used to analyze each target gene to confirm locus specific integration where the 5′ primer is located in the exon preceding the targeted exon and the 3′ primer is located proximal to the site of integration. The box below each gene represents the LSTF, where the shaded areas represent the areas of homology to the target gene, whereby the homologous region is 50-70 nts in length. The black boxes in the gene diagrams represent exons whereby RT-PCR can be used to assay for fusion of spliced cDNAs consisting of the selectable marker-reporter cDNA within the targeted gene's encoded transcript.
Various definitions are provided herein. Most words and terms have the meaning that would be attributed to those words by one skilled in the art. Words or terms specifically defined herein have the meaning provided in the context of the present invention as a whole and as are typically understood by those skilled in the art. Any conflict between an art-understood definition of a word or term and a definition of the word or term as specifically taught herein shall be resolved in favor of the latter. Headings used herein are for convenience and are not to be construed as limiting.
As used herein, “MMR” refers to mismatch repair.
As used herein, “inhibitor of mismatch repair” refers to an agent that interferes with at least one function of the mismatch repair system of a cell and thereby renders the cell more susceptible to mutation.
As used herein, “hypermutable” refers to a state in which a cell in vitro or in vivo is made more susceptible to mutation through a loss or impairment of the mismatch repair system.
As used herein, “agents,” “chemicals,” and “inhibitors” when used in connection with inhibition of MMR refers to chemicals, oligonucleotides, analogs of natural substrates, and the like that interfere with normal function of MMR.
The term “gene” is used herein to denote a DNA segment encoding a polypeptide, and includes genomic DNA (with or without intervening sequences), cDNA, and synthetic DNA. Genes may include non-coding sequences, including promoter elements.
As used herein, “operably linked”, when referring to DNA segments, indicates that the segments are arranged so that they function in concert for their intended purposes, e.g., transcription initiates in the promoter and proceeds through the coding segment to the terminator.
As used herein, the term “promoter” is used herein for its art-recognized meaning to denote a portion of a gene containing DNA sequences that provide for the binding of RNA polymerase and initiation of transcription. Promoter sequences are commonly, but not always, found in the 5′ non-coding regions of genes.
As used herein, the term “promoter elements” is used to denote sequences within promoters that function in the initiation of transcription and which are often characterized by consensus nucleotide sequences. Promoter elements include RNA polymerase binding sites; TATA sequences; CAAT sequences; differentiation-specific elements (DSEs; McGehee et al. (1993) Mol. Endocrinol. 7:551-560; cyclic AMP response elements (CREs); serum response elements (SREs; Treisman (1990) Seminars in Cancer Biol. 1:47-58); glucocorticoid response elements (GREs); and binding sites for other transcription factors, such as CRE/ATF (O'Reilly et al. (1992) J. Biol. Chem. 267:19938-19943), AP2 (Ye et al. (1994) J. Biol. Chem. 269:25728-25734), SP1, cAMP response element binding protein (CREB; Loeken (1993) Gene Expr. 3:253-264) and octamer factors. See, in general, Watson et al. eds., MOLECULAR BIOLOGY OF THE GENE, 4TH ED., The Benjamin/Cummings Publishing Company, Inc., Menlo Park, Calif., 1987; and Lemaigre and Rousseau, (1994) Biochem. J. 303:1-14.
“Transcription regulatory elements” are promoter-associated DNA sequences that bind regulatory molecules, resulting in the modulation of the frequency with which transcription is initiated. Transcription regulatory elements can be classified as enhancers or suppressors of transcription.
As used herein, the term “reporter gene” is used herein to denote a gene that, when expressed in a cell, produces a quantifiable phenotypic change in the cell. Preferred reporter genes include genes encoding enzymes. Particularly preferred enzymes are luciferase, β-galactosidase, and chloramphenicol acetyltransferase. Assays for these enzymes are known in the art. See, for example, Seed and Sheen (1988) Gene 67:271-277; Todaka et al. (1994) J. Biol. Chem. 269:29265-29270; Guarente et al. (1981) Proc. Natl. Acad. Sci. USA 78:2199-2203; Mellon et al. (1989) Proc. Natl. Acad. Sci. USA 86:4887-4891; and Brasier et al. (1989) BioTechniques 7:1116-1122, which are incorporated herein by reference in their entirety. Reporter genes, assay kits, and other materials are available commercially from suppliers such as Promega Corp. (Madison, Wis.) and GIBCO BRL (Gaithersburg, Md.).
The inventors have discovered a method for developing a rapid method for knocking in DNA fragments into target loci of interest to regulate gene expression and/or function as well as the ability to rapidly tag an exon of a gene to study expression as well as for enhancing chromosomal site-specific gene amplification. The process entails the use of targeting cassettes that are generated via PCR using primers containing 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 120 nucleotides of sequence with homology to a particular chromosomal locus. Each promoter expression cassette contains DNA elements that can produce constitutive-, inducible- or suppressed-expression, which are juxtaposed to a constitutively expressed selectable marker (See FIG. 1). Each exon-tag cassette contains DNA sequences encoding for reporter elements that can be monitored using a number of detection methods such as but not limited to green fluorescent protein, luciferase, etc., which is fused in-frame to a selectable marker (See FIG. 4). Each DHFR expression cassette contains DNA elements that constitutively express DHFR which are juxtaposed to a constitutively active selectable marker. In all cases, targeting fragments are generated and transfected into eukaryotic cell hosts.
Enhanced site-specific homologous recombination of LSTFs is facilitated in each target cell by suppressing the endogenous MMR of the host via the expression of a dominant negative MMR gene mutants or through exposure to chemical inhibitors as described (Nicolaides, N. C. et al. (1998) “A naturally occurring hPMS2 mutation can confer a dominant negative mutator phenotype” Mol. Cell. Biol. 18:1635-1641; U.S. Pat. No. 6,146,894 to Nicolaides et al.; Lipkin et al. (2000) “MLH3: a DNA mismatch repair gene associated with mammalian microsatellite instability” Nat. Genet. 24:27-35).
In one aspect of the invention, the methods taught here are useful for the generation of cells that over express or suppress the expression of a gene(s) to elucidate gene function. Such cells may be used as tools to identify compounds that can alter the activity of a given gene product and/or induced pathway in comparison to parental lines. The cell host may be derived from a variety of sources, for example, normal or pathogenic tissues or organisms. The targeting fragment may be used, for example, to prevent, inhibit or terminate expression of a particular gene to elucidate its function, if any, in a particular disease-associated pathway. Moreover, such cell lines may now be used to screen compound libraries to identify molecules that act as agonists or antagonists for pharmaceutical product development. One such example is the ability to over express orphan G coupled receptors (GCR) in a cell line and expose the line to compound libraries to identify ligands or agonists. The ability to over express a GCR from the genome via enhanced promoter activity or chromosomal specific amplification is more beneficial than cloning and establishing stable transgenes, which in many instances produce very low or no expressed product. Finally, the ability to generate cell lines that can over produce a secreted or endogenous gene product from a host's genome enhances their use for biological product manufacturing thus bypassing the need for introducing multiple plasmid copies into host cell lines and establishing stable expression.
In another aspect of the invention, the methods are useful for the generation of cells with endogenous genes containing a tagged exon for monitoring gene expression profiles. Such cells may be used as tools to monitor physiological activity in the presence or absence of exogenous factors in comparison to control lines. The cell host may be derived from, for example, normal or pathogenic organisms to study the expression profile of disease associated genes under normal or stimulated conditions. Pharmacological studies can be performed in untreated cultures or in cultures treated with biological or chemical factors to screen for therapeutic molecules. The cell lines produced by the method of the invention containing tagged exons are also useful for monitoring compound toxicity and efficacy of modulating gene expression.
Reporter elements may be included in the constructs of the invention. Reporter elements include assayable proteins which can be detected and/or quantified. Examples o f reporter genes include, but are not limited to luciferases, such as those known in the art, and may include firefly luciferase (amino acid, SEQ ID NO:34, nucleic acid SEQ ID NO:35); bacterial luciferases, and Renilla luciferase (amino acid, SEQ ID NO:38, nucleic acid SEQ ID NO:39) and green fluorecence protein (amino acid, SEQ ID NO:36, nucleic acid SEQ ID NO:37). Other reporter elements include genes encoding enzymes, which convert a substrate that is subsequently detected. Examples include, but are not limited to β-galactosidase, and chloramphenicol acetyl transferase.
The reporter gene may be visualized in a variety of assays including both in vivo and in vitro assays. For example, but not by way of limitation, reporter genes can be visualized by positron emission tomography (PET), single photon emission computed tomography (SPECT), magnetic resonance imaging (MRI), and flurorescence with wild-type and mutant green fluorescent protein and luciferase (see Ray et al. (2001) “Monitoring gene therapy with reporter gene imaging” Semin. Nucl. Med. 31 (4):312-320).
For example, in living animals it has been shown that Renilla luciferase reporter gene could be used and detected to follow gene expression in vivo (Bhaumik and Gambhir (2002) Proc. Natl. Acad. Sci. USA 99(1):377-382). In this study, a highly sensitive cooled charge-coupled device (CCD) camera provided images of photon counting. Such a device is suitable for use in the present invention, and is available from Xenogen (In Vivo Imaging System “IVIS”). A description of the protocols used to image the reporter gene is known in the art (Bhaumik and Gambhir (2002) Proc. Natl. Acad. Sci. USA 99(1):377-382) and are suitable for use in the present invention as assays to monitor expression of reporter genes.
In another example, a bifunctional molecule comprising Renilla luciferase and Green Fluorescent Protein may be used as a reporter gene to monitor the integration and/or expression of the LSTF construct. In a study describing the bifunctional construct, a ruc-gfp fusion gene construct was created by fusing cDNAs for Renilla luciferase (ruc) and “humanized” GFP (gfp) from Aequorea in frame, and the construct was subsequently expressed in mammalian cells. The transformed cells exhibited both Renilla luciferase activity in the presence of the substrate, coelenterazine, and GFP fluorescence upon excitation with UV light. In animal experiments, the light emission from the fusion construct was detected externally in the organs and tissues of live animals (Wang et al. (2002) Mol. Genet. Genomics 268(2):160-168). Such a bifunctional construct is suitable for use in the present invention as a reporter gene.
In another embodiment of the invention, proteins expressed from LSTFs may be visualized in vitro or in vivo using labeled antibodies, or fragments thereof (such as Fab or F(ab′)2 fragments) which specifically bind to the protein of interest. Antibodies may be labeled using any means known in the art that allow visualization or assaying. Such labels include, but are not limited to fluorescent conjugates, and radioactive conjugates. Fluorescent conjugates include luciferases, green fluorescent protein and derivatives, rhodamine, and fluorescein. Radioactive compounds include those containing 131I, 111In, 123I, 99mTc, 32P, 125I, 3H, and 14C. The antibody or fragments thereof can be labeled with such reagents using techniques known in the art (see, for example, Wensel and Meares, Radioimmunoimaging and Radioimmunotherapy, Esevier, New York (1983); D. Colcher et al. (1986) “Use of Monoclonal Antibodies as Radiopharmaceuticals for the Localization of Human Carcinoma Xenografts in Athymic Mice” Meth. Enzymol. 121:802-816).
In yet another embodiment, signaling mechanisms that may be affected by proteins expressed by LSTFs may be monitored or assayed for functionality. In a non-limiting example, calcium flux may be measured in cells expressing receptors that affect calcium flux upon stimulation. Examples of protocols that measure calcium mobilization are the FLIPR® Calcium Assay Kit, and various protocols using the calcium binding, fluorescent dye, Fluo-3 AM. The protocols are known to those of skill in the art and may be used to measure calcium mobilization in cells expressing various proteins (such as G-protein coupled receptors, for example) which have been expressed from an LSTF.
The LSTF of the invention may be constructed to include a variety of genetic elements, depending on the application of the LSTF. For example, in some embodiments, a LSTF may include a promoter operatively linked to a selectable marker. In other embodiments, the LSTF may include a promoter operatively linked to a selectable marker and a second protein encoding sequence operatively linked to a second promoter. In constructs with more than one protein encoding sequence, an internal ribosome entry site (IRES) may also be included. An IRES element is a regulatory element found in some viral sequences and some cellular RNAs that enhances translation of a second gene product in a bicistronic eukaryotic expression cassette (Kaufman et al. (1991) Nucl. Acids Res. 19:4485). An IRES element may be engineered between two of the coding sequences of the LSTFs of the invention. In other embodiments in which it is not necessary that a protein sequence is expressed, a promoter is not required. In such embodiments (e.g., embodiments in which exons are tagged) it is sufficient that a nucleic acid sequence is present on the construct which may be detectable through molecular analysis. In embodiments in which chromosomal loci are targeted for amplification, constructs include a promoter operatively linked to a dihydrofolate reductase encoding sequence, preferably with a second promoter operatively linked to a selectable marker.
A selectable marker may be a gene conferring drug-resistance to the cell. Non-limiting examples of such drug resistance selectable markers are genes for neomycin resistance, hygromycin resistance and zeocin resistance.
In some embodiments of the invention, a locus control region (LCR) may be incorporated. An LCR is position and orientation dependent and may be used in a tissue specific manner. An LCR may be used in the LSTF of the invention in conjunction with a promoter in embodiments used for overproduction of protein. In a non-limiting example of use of an LCR, an LCR specific for lymphocytes may be used to produce high levels of antibodies in B cells using LSTFs that integrate through homologous recombination in the immunoglobulin locus. LCRs are known by persons skilled in the art.
The constructs are amplified in a polymerase chain reaction (PCR) using 5′ and 3′ primers that have been designed to include nucleic acid sequence that is homologous to a selected portion of the genome of a cell that is targeted for homologous recombination. For the 5′ primer, which anneals to the (−) strand of the DNA in the PCR amplification, the 5′ -most sequence of the 5′ primer (about 20-120 nucleotides (nts)) is homologous to the selected portion of the genome targeted for homologous recombination. The 3′ most portion of the 5′ primer comprises nucleotides that are homologous to the 5′ portion of the construct to be amplified. For the 3′ primer, which anneals to the (+) strand of the DNA in the PCR reaction, the 5′ -most sequence of about 20-120 nucleotides (nts) is homologous to the selected portion of the genome targeted for homologous recombination. The 3′ most portion of the 3′ primer comprises nucleotides that are homologous to the 3′ portion of the construct to be amplified. The PCR reaction conditions are not particularly limited. PCR reactions and variations for optimization are well known in the are and routine optimization of the reactions, including choice of buffers, polymerases, additives, etc., are in the purview of the skilled artisan.
According to one aspect of the invention, a polynucleotide encoding for a dominant negative form of a MMR protein is introduced into a cell. The gene can be any dominant negative allele encoding a protein, which is part of a MMR complex. The dominant negative allele can be naturally occurring, or made in the laboratory. The dominant negative allele may be, for example a PMS2 allele and homologs thereof that confer a dominant negative phenotype. For example, the allele may be a PMS2-134 allele, a PMSR2 allele or a PMSR3 allele. The polynucleotide can be in the form of genomic DNA, cDNA, RNA, or a chemically synthesized polynucleotide.
The polynucleotide can be cloned into an expression vector containing a constitutively active promoter segment (such as but not limited to CMV, SV40, Elongation Factor (EF) or LTR sequences) or to inducible promoter sequences such as the steroid inducible pIND vector (Invitrogen), tetracycline, or mouse mammary tumor virus (MMTV), where the expression of the dominant negative MMR gene can be regulated. The polynucleotide can be introduced into the cell by transfection. As used herein, a “promoter” is a DNA sequence that encompasses binding sites for trans-acting transcription factors. Promoters, when positioned 5′ of protein encoding sequences form a basic transcriptional unit.
According to another aspect of the invention, a targeting fragment containing 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 120 nts of 5′ and 3′ homologous sequence is transfected into MMR deficient cell hosts, the cell is grown and screened for clones containing chromosomes whereby the targeting fragment has been integrated. MMR defective cells may be of human, primates, mammals, rodent, fish, plant, fungal, yeast or of the prokaryotic kingdom.
Transfection is any process whereby a polynucleotide is introduced into a cell. The process of transfection can be carried out in a living animal, e.g., using a vector for gene therapy, or it can be carried out in vitro, e.g., using a suspension of one or more isolated cells in culture. The cell can be any type of eukaryotic cell, including, for example, cells isolated from humans or other primates, mammals or other vertebrates, invertebrates, and single celled organisms such as protozoa, yeast, or bacteria.
In general, transfection will be carried out using a suspension of cells, or a single cell, but other methods can also be applied as long as a sufficient fraction of the treated cells or tissue incorporates the polynucleotide so as to allow transfected cells to be grown and utilized. Techniques for transfection are well known. Available techniques for introducing polynucleotides include but are not limited to electroporation (Potter et al. (1988) Proc. Natl. Acad. Sci. USA 81:7161), transduction, cell fusion, the use of calcium chloride Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring Harbor Press, New York, 2000) or calcium phosphate precipitation (Wigler et al. ( 1980) Proc. Natl. Acad. Sci. USA 77:3567), polyethylene-induced fusion of bacterial protoplasts with mammalian cells (Schaffner et al. (1980) Proc. Natl. Acad. Sci. USA 77:2163), and packaging of the polynucleotide together with lipid for fusion with the cells of interest (e.g., using Lipofectin® Reagent and Lipofectamine® Reagent (Gibco BRL, Gaithersburg, Md.). Once a cell has been transfected with the targeting fragment containing a selectable marker, the cell can be grown and reproduced in culture. If the transfection is stable, such that the selectable marker gene is expressed at a consistent level for many cell generations, then a cell line results. Upon chromosomal integration, MMR is restored in the host cell, and the genetic stability of the host is restored.
An isolated cell includes cells obtained from a tissue of humans, animals, plants or fungi by mechanically separating out individual cells and transferring them to a suitable cell culture medium, either with or without pretreatment of the tissue with enzymes, e.g., collagenase or trypsin. Such isolated cells are typically cultured in the absence of other types of cells. Cells selected for the introduction of a targeting fragment may be derived from a eukaryotic organism in the form of a primary cell culture or an immortalized cell line, or may be derived from suspensions of single-celled organisms.
Integration of the targeting fragment can be detected by analyzing the chromosomal locus of interest for alterations in the genotype of the cells or whole organisms, for example by examining the sequence of genomic DNA, cDNA, RNA, or polypeptides associated with the gene of interest. Integration can also be detected by screening for the expression levels of the targeted locus for altered expression profiles, or chimeric transcripts through biochemical methods or nucleic acid monitoring. Techniques for analyzing nucleic acids and proteins are well known in the art. Techniques include, but are not limited to Southern analysis, northern analysis, PCR, reverse transcriptase-PCR (rt-PCR), restriction digest mapping, western blot, enzyme-linked immunosorbent assays (ELISA), radioimmunoassay, immunoprecipitation, and well-known variations of these techniques.
Examples of mismatch repair proteins that can be used for dominant negative MMR inhibitors and nucleic acid sequences include the following: mouse PMS2 protein (SEQ ID NO:1); mouse PMS2 cDNA) (SEQ ID NO:2); human PMS2 protein (SEQ ID NO:3); human PMS2 cDNA (SEQ ID NO:4); human PMS1 protein (SEQ ID NO:5); human PMS1 cDNA (SEQ ID NO:6); human MSH2 protein (SEQ ID NO:7); human MSH2 cDNA (SEQ ID NO:8); human MLH1 cDNA (SEQ ID NO:10); human MLH1 cDNA (SEQ ID NO:9); human PMS2-134 protein (SEQ ID NO:11); human PMS2-134 cDNA (SEQ ID NO:12); human MSH6 protein (SEQ ID NO:40); human MSH6 cDNA (SEQ ID NO:41); human PMSR2 protein (SEQ ID NO:42); human PMSR2 cDNA (SEQ ID NO:43); human PMSR3 protein (SEQ ID NO:44); and human PMSR3 cDNA (SEQ ID NO:45).
The LSTFs of the invention may also be used to insert nucleic acid sequences through homologous recombination in cells that are naturally deficient in mismatch repair. Furthermore, cells may be rendered deficient in mismatch repair before, after or simultaneously with the introduction of the LSTFs.
The invention also employ chemical inhibitors of mismatch repair, such as described in WO 02/054856 Morphotek Inc. “Chemical Inhibitors of Mismatch Repair,” which is specifically incorporated herein in it entirety. Chemicals that block MMR, and thereby render cells hypermutable, efficiently introduce mutations in cells and genes of interest as well as facilitate homologous recombination in treated cells. In addition to destabilizing the genome of cells exposed to chemicals that inhibit MMR activity may be done transiently, allowing cells to become hypermutable, and removing the chemical exposure after the desired effect (e.g., a mutation in a gene of interest) is achieved. The chemicals that inhibit MMR activity that are suitable for use in the invention include, but are not limited to, anthracene derivatives, nonhydrolyzable ATP analogs, ATPase inhibitors, antisense oligonucleotides that specifically anneal to polynucleotides encoding mismatch repair proteins, DNA polymerase inhibitors, and exonuclease inhibitors.
Examples of ATP analogs that are useful in blocking MMR activity include, but are not limited to, nonhydrolyzable forms of ATP such as AMP-PNP and ATP[gamma]S block the MMR activity (Galio et al. (1999) Nucl. Acids Res. 27:2325-2331; Allen et al. (1997) EMBO J. 16:4467-4476; Bjornson et al. (2000) Biochem. 39:3176-3183).
Examples of nuclease inhibitors that are useful in blocking MMR activity include, but are not limited to analogs of N-ethylmaleimide, an endonuclease inhibitor (Huang et al. (1995) Arch. Biochem. Biophys. 316:485), heterodimeric adenine-chain-acridine compounds, exonulcease III inhibitors (Belmont et al. (2000) Bioorg Med Chem Lett (2000) 10:293-295), as well as antibiotic compounds such as heliquinomycin, which have helicase inhibitory activity (Chino et al. (1998) J. Antibiot. (Tokyo) 51:480-486).
Examples of DNA polymerase inhibitors that are useful in blocking MMR activity include, but are not limited to, analogs of actinomycin D (Martin et al. (1990) J. Immunol. 145:1859), aphidicolin (Kuwakado et al. (1993) Biochem. Pharmacol. 46:1909) 1-(2′-Deoxy-2′-fluoro-beta-L-arabinofuranosyl)-5-methyluracil (L-FMAU) (Kukhanova et al. (1998) Biochem Pharmacol 55:1181-1187), and 2′,3′-dideoxyribonucleoside 5′-triphosphates (ddNTPs) (Ono et al. (1984) Biomed. Pharmacother. 38:382-389).
In yet another aspect of the invention, antisense oligonucleotides are administered to cells to disrupt at least one function of the mismatch repair process. The antisense polynucleotides hybridize to MMR polynucleotides. Both full-length and antisense polynucleotide frgaments are suitable for use. “Antisense polynucleotide fragments” of the invention include, but are not limited to polynuclotides that specifically hybridize to an MMR encoding RNA (as determined by sequence comparison of nucleotides encoding the MMR to nucleotides encoding other known molecules). Identification of sequences that are substantially unique to MMR-encoding polynucleotides can be ascertained by analysis of any publicly available sequence database and/or with any commercially available sequence comparison programs. Antisense molecules may be generated by any means including, but not limited to chemical synthesis, expression in an in vitro transcription reaction, through expression in a transformed cell comprising a vector that may be transcribed to produce antisense molecules, through restriction digestion and isolation, through the polymerase chain reaction, and the like.
Those of skill in the art recognize that the antisense oligonucleotides that inhibit mismatch repair activity may be predicted using any MMR genes. Specifically, antisense nucleic acid molecules comprise a sequence complementary to at least about 10, 15, 25, 50, 100, 250 or 500 nucleotides or an entire MMR encoding sequence. Preferably, the antisense oligonucleotides comprise a sequence complementary to about 15 consecutive nucleotides of the coding strand of the MMR encoding sequence.
In one embodiment, an antisense nucleic acid molecule is antisense to a “coding region” of the coding strand of a nucleotide sequence encoding an MMR protein. The coding strand may also include regulatory regions of the MMR sequence. The term “coding region” refers to the region of the nucleotide sequence comprising codons which are translated into amino acid residues (e.g., the protein coding region of human PMS2 corresponds to the coding region). In another embodiment, the antisense nucleic acid molecule is antisense to a “noncoding region” of the coding strand of a nucleotide sequence encoding an MMR protein. The term “noncoding region” refers to 5′ and 3′ sequences which flank the coding region that are not translated into amino acids (i.e., also referred to as 5′ and 3′ untranslated regions (UTR)).
Preferably, antisense oligonucleotides are directed to regulatory regions of a nucleotide sequence encoding an MMR protein, or mRNA corresponding thereto, including, but not limited to, the initiation codon, TATA box, enhancer sequences, and the like. Given the coding strand sequences provided herein, antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick or Hoogsteen base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of an MMR mRNA, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or noncoding region of an MMR mRNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of an MMR mRNA. An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
As used herein the term “anthracene” refers to the compound anthracene. However, when referred to in the general sense, such as “anthracenes,” “an anthracene” or “the anthracene,” such terms denote any compound that contains the fused triphenyl core structure of anthracene, i.e.,
regardless of extent of substitution.
In certain preferred embodiments of the invention, the anthracene has the formula:
wherein R1-R10 are independently hydrogen, hydroxyl, amino, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl,O-alkynyl, S-alkynyl, N-alkynyl, aryl, substituted aryl, aryloxy, substituted aryloxy, heteroaryl, substituted heteroaryl, aralkyloxy, arylalkyl, alkylaryl, alkylaryloxy, arylsulfonyl, alkylsulfonyl, alkoxycarbonyl, aryloxycarbonyl, guanidino, carboxy, an alcohol, an amino acid, sulfonate, alkyl sulfonate, CN, NO2, an aldehyde group, an ester, an ether, a crown ether, a ketone, an organosulfur compound, an organometallic group, a carboxylic acid, an organosilicon or a carbohydrate that optionally contains one or more alkylated hydroxyl groups;
wherein said heteroalkyl, heteroaryl, and substituted heteroaryl contain at least one heteroatom that is oxygen, sulfur, a metal atom, phosphorus, silicon or nitrogen;
wherein said substituents of said substituted alkyl, substituted alkenyl, substituted alkynyl, substituted aryl, and substituted heteroaryl are halogen, CN, NO2, lower alkyl, aryl, heteroaryl, aralkyl, aralkyloxy, guanidino, alkoxycarbonyl, alkoxy, hydroxy, carboxy and amino; and
wherein said amino groups optionally substituted with an acyl group, or 1 to 3 aryl or lower alkyl groups; or wherein any two of R1-R10 can together form a polyether;
or wherein any two of R1-R10 can, together with the intervening carbon atoms of the anthracene core, form a crown ether.
As used herein, “alkyl” refers to a hydrocarbon containing from 1 to about 20 carbon atoms. Alkyl groups may straight, branched, cyclic, or combinations thereof. Alkyl groups thus include, by way of illustration only, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, cyclopentyl, cyclopentylmethyl, cyclohexyl, cyclohexylmethyl, and the like. Also included within the definition of “alkyl” are fused and/or polycyclic aliphatic cyclic ring systems such as, for example, adamantane. As used herein the term “alkenyl” denotes an alkyl group having at least one carbon-carbon double bond. As used herein the term “alkynyl” denotes an alkyl group having at least one carbon-carbon triple bond.
In some preferred embodiments, the alkyl, alkenyl, alkynyl, aryl, aryloxy, and heteroaryl substituent groups described above may bear one or more further substituent groups; that is, they may be “substituted”. In some preferred embodiments these substituent groups can include halogens (for example fluorine, chlorine, bromine and iodine), CN, NO2, lower alkyl groups, aryl groups, heteroaryl groups, aralkyl groups, aralkyloxy groups, guanidino, alkoxycarbonyl, alkoxy, hydroxy, carboxy and amino groups. In addition, the alkyl and aryl portions of aralkyloxy, arylalkyl, arylsulfonyl, alkylsulfonyl, alkoxycarbonyl, and aryloxycarbonyl groups also can bear such substituent groups. Thus, by way of example only, substituted alkyl groups include, for example, alkyl groups fluoro-, chloro-, bromo- and iodoalkyl groups, aminoalkyl groups, and hydroxyalkyl groups, such as hydroxymethyl, hydroxyethyl, hydroxypropyl, hydroxybutyl, and the like. In some preferred embodiments such hydroxyalkyl groups contain from 1 to about 20 carbons.
As used herein the term “aryl” means a group having 5 to about 20 carbon atoms and which contains at least one aromatic ring, such as phenyl, biphenyl and naphthyl. Preferred aryl groups include unsubstituted or substituted phenyl and naphthyl groups. The term “aryloxy” denotes an aryl group that is bound through an oxygen atom, for example a phenoxy group.
In general, the prefix “hetero” denotes the presence of at least one hetero (i.e., non-carbon) atom, which is in some preferred embodiments independently one to three O, N, S, P, Si or metal atoms. Thus, the term “heteroaryl” denotes an aryl group in which one or more ring carbon atom is replaced by such a heteroatom. Preferred heteroaryl groups include pyridyl, pyrimidyl, pyrrolyl, furyl, thienyl, and imidazolyl groups.
The term “aralkyl” (or “arylalkyl”) is intended to denote a group having from 6 to 15 carbons, consisting of an alkyl group that bears an aryl group. Examples of aralkyl groups include benzyl, phenethyl, benzhydryl and naphthylmethyl groups.
The term “alkylaryl” (or “alkaryl”) is intended to denote a group having from 6 to 15 carbons, consisting of an aryl group that bears an alkyl group. Examples of aralkyl groups include methylphenyl, ethylphenyl and methylnaphthyl groups.
The term “arylsulfonyl” denotes an aryl group attached through a sulfonyl group, for example phenylsulfonyl. The term “alkylsulfonyl” denotes an alkyl group attached through a sulfonyl group, for example methylsulfonyl.
The term “alkoxycarbonyl” denotes a group of formula —C(═O)—O—R where R is alkyl, alkenyl, or alkynyl, where the alkyl, alkenyl, or alkynyl portions thereof can be optionally substituted as described herein.
The term “aryloxycarbonyl” denotes a group of formula —C(═O)—O—R where R is aryl, where the aryl portion thereof can be optionally substituted as described herein.
The terms “arylalkyloxy” or “aralkyloxy” are equivalent, and denote a group of formula —O—R′—R″, where R′ is R is alkyl, alkenyl, or alkynyl which can be optionally substituted as described herein, and wherein R″ denotes a aryl or substituted aryl group.
The terms “alkylaryloxy” or “alkaryloxy” are equivalent, and denote a group of formula —O—R′—R″, where R′ is an aryl or substituted aryl group, and R″ is alkyl, alkenyl, or alkynyl which can be optionally substituted as described herein.
As used herein, the term “aldehyde group” denotes a group that bears a moiety of formula —C(═O)—H. The term “ketone” denotes a moiety containing a group of formula —R—C(═O)—R═, where R and R═ are independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, or alkaryl, each of which may be substituted as described herein.
As used herein, the term “ester” denotes a moiety having a group of formula —R—C(═O)—O—R═ or —R—O—C(═O)—R═ where R and R═ are independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, or alkaryl, each of which may be substituted as described herein.
The term “ether” denotes a moiety having a group of formula —R—O—R═ or where R and R═are independently alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, or alkaryl, each of which may be substituted as described herein.
The term “crown ether” has its usual meaning of a cyclic ether containing several oxygen atoms. As used herein the term “organosulfur compound” denotes aliphatic or aromatic sulfur containing compounds, for example thiols and disulfides. The term “organometallic group” denotes an organic molecule containing at least one metal atom.
The term “organosilicon compound” denotes aliphatic or aromatic silicon containing compounds, for example alkyl and aryl silanes.
The term “carboxylic acid” denotes a moiety having a carboxyl group, other than an amino acid.
As used herein, the term “amino acid” denotes a molecule containing both an amino group and a carboxyl group. In some preferred embodiments, the amino acids are α-, β-, γ- or δ-amino acids, including their stereoisomers and racemates. As used herein the term “L-amino acid” denotes an a-amino acid having the L configuration around the α-carbon, that is, a carboxylic acid of general formula CH(COOH)(NH2)-(side chain), having the L-configuration. The term “D-amino acid” similarly denotes a carboxylic acid of general formula CH(COOH)(NH2)-(side chain), having the D-configuration around the α-carbon. Side chains of L-amino acids include naturally occurring and non-naturally occurring moieties. Non-naturally occurring (i.e., unnatural) amino acid side chains are moieties that are used in place of naturally occurring amino acid side chains in, for example, amino acid analogs. See, for example, Lehninger, Biochemistry, Second Edition, Worth Publishers, Inc, 1975, pages 72-77, incorporated herein by reference. Amino acid substituents may be attached through their carbonyl groups through the oxygen or carbonyl carbon thereof, or through their amino groups, or through functionalities residing on their side chain portions.
As used herein “polynucleotide” refers to a nucleic acid molecule and includes genomic DNA cDNA, RNA, mRNA and the like.
As used herein “antisense oligonucleotide” refers to a nucleic acid molecule that is complementary to at least a portion of a target nucleotide sequence of interest and specifically hybridizes to the target nucleotide sequence under physiological conditions.
For further information on the background of the invention the following references may be consulted, each of which, along with other references cited herein, is incorporated herein by reference in its entirety:
References:
The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples, which are provided herein for purposes of illustration only, and are not intended to limit the scope of the invention.
Expression of a dominant negative allele in an otherwise mismatch repair (MMR) proficient cell can render these host cells MMR deficient (Nicolaides, N. C. et al. (1998) Mol. Cell. Biol. 18:1635-1641, U.S. Pat. No. 6,146,894 to Nicolaides et al.). The creation of MMR deficient cells can lead to the generation of genetic alterations throughout the entire genome of a host's offspring, yielding a population of genetically altered offspring or siblings that have an enhanced rate of homologous recombination. This patent application teaches of the use of dominant negative MMR genes in cells, including but not limited to rodent, human, primate, yeast, insect, fish and prokaryotic cells with enhanced rates of homologous recombination followed by the introduction of locus specific targeting fragments (LSTFs) that can alter the expression of a chromosomal locus or integrate into a given exon of a gene for facilitated analysis of gene expression.
To demonstrate the ability to create MMR defective mammalian cells with elevated rates of homologous recombination using dominant negative alleles of MMR genes, we first transfected a MMR proficient human cell line with an expression vector containing the human the previously published dominant negative PMS2 mutant referred herein a s PMS134 (cell line referred to as 293PMS134), or with no insert (cell line referred to as 293vec) into human embryonic kidney cells (HEK293). A fragment containing the PMS134 cDNA was cloned into the pEF expression vector, which contains the constitutively active elongation factor promoter along with the neomycin resistance gene as selectable marker. The results showed that the PMS134 mutant could exert a robust dominant negative effect, resulting in biochemical and genetic manifestations of MMR deficiency. A brief description of the methods is provided below.
A hallmark of MMR deficiency is the generation of unstable microsatellite repeats in the genome of host cells. This phenotype is referred to as microsatellite instability (MI). MI consists of deletions and/or insertions within repetitive mono-, di- and/or trinucleotide repetitive sequences throughout the entire genome of a host cell. Extensive genetic analysis eukaryotic cells have found that the only biochemical defect that is capable of producing MI is defective MMR. In light of this unique feature that defective MMR has on promoting MI, it is now used as a biochemical marker to survey for lack of MMR activity within host cells.
A method used to detect MMR deficiency in eukaryotic cells is to employ a reporter gene that has a polynucleotide repeat inserted within the coding region that disrupts its reading frame due to a frame shift. In the case where MMR is defective, the reporter gene will acquire random mutations (i.e. insertions and/or deletions) within the polynucleotide repeat yielding clones that contain a functional reporter gene. An example of the ability to alter desired genes via defective MMR comes from experiments using HEK293 cells (described above), where a mammalian expression construct containing a defective β-galactosidase gene (referred to as pCAR-OF) was transfected into 293PMS134 or 293vec cells as described above. The pCAR-OF vector consists of a β-galactosidase gene containing a 29-basepair poly-CA tract inserted at the 5′ end of its coding region, which causes the wild-type reading frame to shift out-of-frame. This chimeric gene is cloned into the pCEP4, which contains the constitutively cytomegalovirus (CMV) promoter upstream of the cloning site and also contains the hygromycin-resistance (HYG) gene that allows for selection of cells containing this vector. The pCAR-OF reporter cannot generate β-galactosidase activity unless a frame-restoring mutation (i.e., insertion or deletion) arises following transfection into a host. Another reporter vector called pCAR-IF contains a β-galactosidase in which a 27-bp poly-CA repeat was cloned into the same site as the pCAR-OF gene, but it is biologically active because the removal of a single repeat restores the open reading frame and produces a functional chimeric β-galactosidase polypeptide (not shown). In these proof-of-concept studies, 293PMS134 and 293vec cells were transfected with the pCAR-OF reporter vector and selected for 17 days in neomycin plus hygromycin selection medium. After the 17th day, resistant colonies were stained for β-galactosidase production to determine the number of clones containing a genetically altered β-galactosidase gene. All conditions produced a relatively equal number of neomycin/hygromycin resistant cells, however, only the cells expressing the PMS134 dominant negative allele (293PMS134) contained a subset of clones that were positive for β-galactosidase activity (Table 1). Table 1 shows the data from these experiments, where cell colonies were stained in situ for β-galactosidase activity and scored for activity. Cells were scored positive if the colonies turned blue in the presence of X-gal substrate and scored negative if colonies remained white. Analysis of triplicate experiments showed a significant increase in the number of β-galactosidase positive cells in the 293PMS134 cultures, while no β-galactosidase cells were seen in the control 293vec cells.
| TABLE 1 |
| Number of 293PMS134 and 293vec cells containing functional |
| β-galactosidase gene as a result of MMR deficiency. |
| % Clones | |||
| Cells | White Colonies | Blue Colonies | with altered β-gal |
| 293vec | 95 ± 17 | 0 | 0/95 = 0% |
| 293PMS134 | 88 ± 13 | 44 ± 8 | 44/132 = 33% |
| Table 1. β-galactosidase expression of 293vec and 293PMS134134 cells transfected with pCAR-OF reporter vectors. Cells were transfected with the pCAR-OF β-galactosidase reporter plasmid. Transfected cells were selected in hygromycin and G418, expanded and stained with X-gal solution to measure for β-galactosidase activity (blue colored cells). 3 plates each were analyzed by microscopy. The results below represent the mean +/− standard deviation of these experiments. |
293PMS134/pCAR-OF clones that were pooled and expanded also showed a number of cells that contained a functional β-galactosidase gene. No β-galactosidase positive cells were observed in 293vec cells transfected with the pCAR-OF vector (data not shown). These data demonstrate the ability of dominant negative alleles of MMR genes to suppress endogenous MMR activity. These cells are now primed for the introduction of locus specific targeting fragments for altering the expression or tagging the exon of specific genes within the chromosomal context of the host.
In situ X-Gal Staining
For in situ analysis, 100,000 cells are harvested and fixed in 1% gluteraldehyde, washed in phosphate buffered saline solution and incubated in 1 ml of X-gal substrate solution (0.15 M NaCl, 1 mM MgCl2, 3.3 mM K4Fe(CN)6, 3.3 mM K3Fe(CN)6, 0.2% X-Gal ) in 24 well plates for 2 hours at 37° C. Reactions are stopped in 500 mM sodium bicarbonate solution and transferred to microscope slides for analysis. Three plates each are counted for blue (β-galactosidase positive cells) or white (β-galactosidase negative cells) to assess for MMR inactivation. Table 1 shows the results from these studies.
| TABLE 1 |
| Number of 293PMS134 and 293vec cells containing |
| functional β-galactosidase gene as a result of MMR deficiency. |
| % Clones | |||
| Cells | White Colonies | Blue Colonies | with altered β-gal |
| 293vec | 95 +/− 17 | 0 | 0/95 = 0% |
| 293PMS134 | 88 +/− 13 | 44 +/− 8 | 44/132 = 33% |
It has been previously reported that MMR defective cells have a higher rate of homologous recombination due to the decreased stringency for identical basepair matches of the target vector to the chromosomal locus. We observed the ability to generate an increased rate of homologous recombination of fragments containing very short regions of homology in MMR defective cells obtained from colorectal cancer patents, such as the HCT116 cell line (N. Nicolaides personal observation), while homologous recombination in cells that were MMR proficient had undetectable integration of this type of fragment into a targeted locus such as the wild type HEK293 cell line.
To address the ability to use LSTFs containing short areas of homology for rapid genome targeting of chromosomal loci, we employed the use of MMR defective 293 cells (293PMS134) that express the PMS134 dominant negative allele as described in Example 1. We then employed a LSTF that containing the Cytomegalovirus (CMV) promoter downstream of a constitutively expressed hygromycin cassette to monitor integration in the MMR defective line (see FIG. 1).
Generation of Promoter Locus-specific Targeting Fragments and Cell Lines.
PCR products were amplified from the p4 plasmid, which contains a DNA insert with the Thymidine Kinase (Tk) promoter upstream of the hygromycin resistance (Hyg) gene followed by the SV40 polyadenylation signal and the cytomegalovirus (CMV) promoter. Plasmid was amplified with primers containing 3′ sequences that are homologous to the plasmid vector sequence region upstream of the Tk promoter and downstream of the CMV promoter. Each primer also contained 70 nt that were homologous to the genomic locus of various target genes at the start site of transcription. PCRs were typically carried out using buffers as previously described (Grasso, L. et al. (1998) “Molecular analysis of human interleukin-9 receptor transcripts in peripheral blood mononuclear cells. Identification of a splice variant encoding for a nonfunctional cell surface receptor” J. Biol. Chem. 273:24016-24024). Amplification conditions consisted of one cycle of 95° C. for 5minutes, 30 cycles of 94° C. for 30 seconds/47° C. for 30 seconds/72° C. for 1 minute, and one cycle of 72° C. for 2 minutes. Primers pairs used for each gene are indicated in Table 2. LSTFs were analyzed by gel electrophoresis to ensure molecular weight. Products were then purified by spin column to remove primers, salts and unincorporated dNTPs from fragments.
The generation of stable cell lines with promoter locus-specific targeted knock-in fragments was performed as follows. Briefly, 1×105 HEK293 (human embryonic kidney) cells stably expressing the PMS134 gene (see Example 1) were transfected with 1 μg of purified PCR products from above using 3 μl Fugene6 (Invitrogen) and stable transfectant pools were generated by co-selection with 100 μg/ml hygromycin B and G418 (neomycin). Cultures were selected for 14 days in neomycin and hygromycin. Pools and clones were analyzed for locus specific integration using reverse transcriptase coupled PCR as described (Nicolaides, N. C. et al. (1997) “Interleukin 9: a candidate gene for asthma” Proc. Natl. Acad. Sci. USA 94:13175-13180). Briefly, 1×105 hygromycin/neomycin resistant cells transfected with various PCR fragments were lysed in 50 μl lysis buffer containing tris-edta and NP40 and incubated for 10 minutes on ice. Samples were added to oligo d(T) tubes in the presence of 50 μl binding buffer and incubated 15′ at RT with shaking. Lysates were aspirated and washed 2× each with high salt wash buffer followed by low salt wash buffer. 33 μls 1× First-strand cDNA mix containing NTPs and reverse transcriptase was added to tubes and incubated 1 hr at 37° C. 67 μl of a dH2O/TAQ mixture was aliquoted into each sample along with appropriate gene-specific primers from Table 2. Amplification conditions consisted of one cycle of 95° C. for 5 minutes, 30 cycles of 94° C. for 30 seconds/47° C for 30 seconds/72° C. for 1 minute, and one cycle of 72° C. for 2 minutes.
Analysis of site-specific integration was carried out using four different previously studied loci that are expressed at undetectable levels in the HEK293 cell line and growth conditions used in these studies. The target genes were the human N-Ras (a signal transduction gene), beta-globin (a structural protein), INF-gamma (a secreted growth factor), and galanin receptor (a seven transmembrane G-coupled receptor). The primers used for each 5′ flanking locus is given below in Table 2 where the last 30 nts of each primer is specific for the 5′ and 3′ ends of the targeting fragment containing the Tk promoter driving hygromycin expression followed by the CMV promoter, while the 5′ ends of each primer pair are specific to the 5′ flanking region of each locus, N-RAS (SEQ ID NO: 13 and 14); beta-globin (SEQ ID NO: 15 and 16); Interferon gamma (SEQ ID NO: 17 and 18); and galanin receptor (SEQ ID NO: 19 and 20). Transfected cells were first analyzed by RT-PCR analysis to identify increased steady-state gene expression using primer pairs that were capable of detecting spliced mRNA (primers listed in Table 3). These primer combinations can detect the endogenous gene expression of a target gene independent of LSTF integration. Expression analysis of transfected cells failed to reveal robust expression levels of any of these four loci in parental HEK293 or control HEK293 cells transfected with the different fragments. Conversely, robust expression was observed for all targeted loci in transfected 293PMS134 cells containing the appropriate LSTF. A representative example is shown using cells where the beta-globin locus was targeted. HEK293 cells, which are derived from embryonic kidney have not been found to express the erythroid-specific beta-globin. Shown in FIG. 2 is expression analysis of beta-globin using cDNA specific primers (SEQ ID NO:24 and SEQ ID NO:25, Table 3) in targeted cells containing the beta-globin LSTF, while none was observed in cells transfected with targeting vectors to other loci, which served as negative controls. An independent RT-PCR was carried using cDNA from the positive cultures using a 5′ primer that was located in the distal leader sequence of he CMV promoter (SEQ ID NO: 21, Table 3) and a 3′ primer located within the coding region of the beta-globin gene (SEQ ID NO: 25, Table 3). This primer set is only capable of producing a product with an expected molecular weight if the LSTF is integrated within the specific targeted locus because the resultant product consists of a hybrid transcript consisting of a cDNA comprised of a CMV leader fused to the initiating start codon for the targeted gene, which can only occur by correct genome integration for formation of this hybrid message. Similar results were found using targeting fragments to other chromosomal loci as well as using primers containing 50 nts of flanking sequence, whereas no locus specific expression was observed in HEK293 control cells transfected with similar fragments (data not shown).
| TABLE 2 | |
| Transfection construct primers. |
| Gene | 5′ primer name | 5′ primer sequence | 3′ primer name | 3′ primer sequence |
| N-Ras | NRAS-564674 | TTCAGAGTAGAAAACTAAATATGAT | NRAS-567492R | GCCCCAGTTGGACCCTG | |
| (SEQ ID NO:13) | GAATAACTAAAAATAATTTCTCAAA | (SEQ ID NO:14) | AGGTCGTACTCACCCCA | ||
| TTTTTTCTGATGGTTCCTTCGCTTC | ACAGCTCAGCGCCCCCT | ||||
| ATCCCCGTGGCCCGTTGCTCGCG | CTCCAGCGCCGCCATAA | ||||
| GCTACCCAGCTTCTAGA | |||||
| GATCTGACGGTTCAC | |||||
| β-globin | HBB-59479 | TGTGTGTGTGTTGTGGTCAGTGGGG | HBB-62206R | TCAGGAGTCAGGTGCAC | |
| (SEQ ID NO:15) | CTGGAATAAAAGTAGAATAGACCTG | (SEQ ID NO:16) | CATGGTGTCTGTTTGAGG | ||
| CACCTGCTGTGGCATCCATTCTGCTT | TTGCTAGTGAACACAGT | ||||
| CATCCCCGTGGCCCGTTGCTCGCG | TGTGTCAGAAGCAAATG | ||||
| TTACCCAGCTTCTAGAG | |||||
| ATCTGACGGTTCAC | |||||
| INF-γ | IFNG-1626972 | GTTCTCTGGACGTAATTTTTCTTGAG | IFNG-1629791R | ATCAGGTCCAAAGGACT | |
| (SEQ ID NO:17) | CAGAGCAACAGTAGAGCTTTGTATG | (SEQ ID NO:18) | TAACTGATCTTTCTCTTC | ||
| CAACAATGTAATTTTTACACTGCTTC | TAATAGCTGATCTTCAG | ||||
| ATCCCCGTGGCCCGTTGCTCGCG | ATGATCAGAACAATGTG | ||||
| CTACCCAGCTTCTAGAG | |||||
| ATCTGACGGTTCAC | |||||
| GalaninI | GallR-283026F | TGGCAGGAGCGGAAGCAAGAGAGG | GallR-280208R | GCTCGGCTGAAATCCGC | |
| Receptor | (SEQ ID NO:19) | GAAGGGAGGAGGTGCCACACACTTT | (SEQ ID NO:20) | GCCCCTTAGAAGTCACG | |
| CAAACAACCAGATCTTCAGACCTGC | GTGCGCGAGCAGAGACT | ||||
| TTCATCCCCGTGGCCCGTTGCTCGCG | GGACGGATTCTAGCGGG | ||||
| ATTACCCAGCTTCTAGA | |||||
| GATCTGACGGTTCAC | |||||
| TABLE 3 | |
| RT-PCR primers. |
| 5′ primer name | 5′ primer sequence | 3′ primer name | 3′ primer sequence |
| (SEQ ID NO:21) | CAGATCTCTAGAAGCTGGGT | |||
| Nras (SEQ ID NO:22) | ATGACTGAGTACAAACTGGTGGTGG | Nras-R (SEQ ID | CATTCGGTACTGGCGTATTTCTC | |
| NO:23) | ||||
| Globin (SEQ ID | ATGGTGCACCTGACTCCTGAGGAG | Globin (SEQ ID | GTTGGACTTAGGGAACAAAGGA | |
| NO:24) | NO:25) | AC | ||
| Glanin (SEQ ID | ATGCTGGTGAGCATCTTCACCCTG | Glanin (SEQ ID | CTGAAGAGGAAGGAAGCCGGCG | |
| NO:26) | NO:27) | TC | ||
| IFNg (SEQ ID | ATGAAATATACAAGTTATATCTTGGC | IFNg (SEQ ID | CAGGACAACCATTACTGGGATGC | |
| NO:28) | NO:29) | |||
Analysis of cell lines transfected with promoter-specific LSTFs can be carried out by any number of methods that measure levels of RNA or proteins. Such methods of analysis may include but are not limited to microarray analysis, in situ RT-PCR, Northern blot, western blotting, immunostaining, fluorescent Activated Cell Sorting, etc. Cell lines over expressing a gene of interest may be analyzed by functional assays using biological systems that are sensitive to the production of certain biochemicals of growth factors. These methods are routinely used by those skilled in the art of high throughput screening and are useful for analyzing the expression levels of target genes in cells transfected with LSTFs.
Generation of Exon Locus-specific Targeting Fragments and Cell Lines.
The ability to target an exon of a specific gene in any given host organism enables the generation of exon specific tags to monitor gene expression profiles of a target gene upon exposure to biological factors and/or pharmaceutical compounds. This application teaches the use of inhibitors of MMR in somatic cells that can enhance the recombination of fragments with as little as 50 nts of homologous sequence to a chromosomal target within complex genomes including those derived of human materials (see above). To take advantage of the ability to generate locus specific targets, we teach of the use of a exon locus specific targeting (LST) vectors that can be used to generate knock-ins within an exon of a specific locus, whereby the LST fragment contains a selectable marker fused to a reporter gene that can be used in combination with any number of analytical systems to monitor gene expression in situ or in vitro. An example of one such fusion cassette is presented in FIG. 3, whereby the hygromycin resistance gene is fused in-frame with the luciferase gene. Using a similar strategy as described above, we generated a number of fusion expression cassettes that contain a selectable maker fused in-frame with a reporter gene. These vectors can consist of any selectable marker that can be used to select for stable transformants and any reporter gene that can be monitored to analyze expression levels of particular locus or loci.
Exon LSTFs is generated by PCR using 80-100 nt primers that contain 50-70 nts of 5′ sequence that are homologous to the 5′ and 3′ boarders of a given gene's exon, while the terminal 30nts are specific for the first and last codons of the fusion protein, such as those given as examples in FIG. 3. PCR products are amplified from the pFusion plasmid, containing a DNA insert with the selectable marker/reporter gene. PCRs are carried out using buffers as previously described (Grasso, L. et al. (1998) “Molecular analysis of human interleukin-9 receptor transcripts in peripheral blood mononuclear cells. Identification of a splice variant encoding for a nonfunctional cell surface receptor” J. Biol. Chem. 273:24016-24024). Amplification conditions consisted of one cycle of 95C for 5′, 30 cycles of 94° C. for 30 seconds/47° C. for 30 seconds/72° C. for 1 minute, and one cycle of 72° C. for 2 minutes. Primers pairs used for each exon LSTF are indicated in Table 4. LST fragments are analyzed by gel electrophoresis to ensure correct size. Reactions with correct size are then purified by spin column to remove primers from fragments
Generation of stable cell lines with exon locus-specific targeted knock-in fragments are performed as follows. Briefly, 1×105 MMR defective cells (stably expressing the PMS134 gene (see Example 1) are transfected with 1 μg of purified PCR products from above using 3 μl Fugene 6 (Invitrogen) and stable transfectant pools are generated by co-selection with 100 μg/ml hygromycin B and G418 (neomycin). Cultures are selected for 14 days in neomycin and hygromycin. Pools and clones are analyzed for locus specific integration using reverse transcriptase coupled PCR as described (Nicolaides, N. C. et al. (1997) “Interleukin 9: a candidate gene for asthma” Proc. Natl. Acad. Sci. USA 94:13175-13180). Briefly, 1×105 hygromycin/neomycin resistant cells transfected with various PCR fragments are lysed in 50 μl lysis buffer containing tris-edta and NP40 and incubated 10 minutes on ice. Samples are added to oligo d(T) tubes in the presence of 50 μl binding buffer and incubated 15′ at RT with shaking. Lysates are aspirated and washed 2× each with high salt wash buffer followed by low salt wash buffer. 33 μls 1× First-strand cDNA mix containing NTPs and reverse transcriptase is added to tubes and incubated 1 hr at 37° C. 67 μl of a dH20/TAQ mixture was aliquoted into each sample along with appropriate gene-specific primers that target sequences contained within the proceeding exon and a 3′ primer that targets sequence proximal to the fusion integration site. A schematic description of the exon LSTF and PCR analysis for integration are shown in FIG. 4.
| TABLE 4 | |
| Primers for exon locus specific targeting fragments. The N(50–70) indicates sequence | |
| to be added to each primer for a specific exon. |
| Fusion LSTF | 5′ primer | 3′ primer |
| Hyg-GFP | 5′-N(50-70)-atgaaaaagc | (SEQ ID NO:30) | 5′-N(50-70)- | (SEQ ID NO:31) | |
| ctgaactcaccgcgacgtct-3′ | tttatataattcatccata | ||||
| ccatgtgtgtg-3′ | |||||
| Hyg-Luc | 5′-N(50-70)-atgaaaaagc | (SEQ ID NO:32) | 5′-N(50-70)-caatttggactttccg | (SEQ ID NO:33) | |
| ctgaactcaccgcgacgtct-3′ | cccttcttggcctt-3′ | ||||
Another means for enhancing gene expression from the genome of a host organism is through the process of gene amplification. A number of studies have reported the use of expression vectors consisting of a gene of interest linked to a DHFR expression cassette. Once the expression vector has been inserted into the genome of a host cell line, expression cassettes can be amplified by selecting for clonal resistance to methotrexate, a process that occurs through gene amplification of the DHFR gene and surrounding proximal and distal loci (Ma, C. et al. (1993) “Sister chromatid fusion initiates amplification of the dihydrofolate reductase gene in Chinese hamster cells” Genes Dev. 7:605-620). A method is taught here that employs the use of LSTFs in MMR defective cells via the use of MMR inhibitors, whereby the LSTF contains a constitutively expressed DHFR gene juxtaposed to selectable markers with the ends of the LSTF containing 50-70 bps of homologous sequence to an endogenous gene locus. The target site may be proximal, intragenic or distal to the target locus. Briefly, the LSTF is generated from a Hyg-DHFR cassette via PCR using the pHYG-DHFR vector as template. Amplifications are generated using primers that are 5′ to the TK promoter, which controls the HYG expression and a primer that is directed to the sequence 3′ of the DHFR gene, which consists of the SV40polyA signal. Each primer contains 50-70 nts that are homologous to the chromosomal target site. Cells are transfected with a dominant negative MMR expression vector, which contains a neomycin resistance marker as described in Example 1 along with the LSTF. Upon cotransfection, cells are coselected in hygromycin and neomycin for 14 days. Cells are analyzed for chromosomal specific integration using primers that flank the targeted site of integration. Analysis can be in pooled cultures or in single clones. Upon confirmation of integration, cells are selected for chromosomal site-specific amplification by methotrexate (MTX) selection. Briefly, 1.0×106 cells are seeded in 10cm culture dishes with complete growth medium supplemented with 10% dialyzed fetal bovine serum 24 h prior to drug selection. Next, MTX is added at 15 times the calculated IC50 and the plates are incubated at 37° C. Cells are grown in the presence of continuous MTX selection for 14 to 21 days. Colonies are selected and analyzed for DHFR and chromosome amplification. Analysis of genomic DNA is carried out using the modified salting out method. Briefly, cells are isolated from parental or MTX exposed clones. Cells are pelleted and lysed in 1 ml of lysis buffer (25 mM Tris-HCl pH 8.0, 25 mM EDTA, 1% SDS, 0.5 mg/ml proteinase K). Cell lysates are incubated at 50° C. 12 hrs to overnight. Following ethanol precipitation and resuspension, RNaseA was added to 100 μg/ml and the mixture was kept at 37° C. for 30 min. Next, DNAs are phenol extracted and precipitated by the addition of 3 M NaOAc and ethanol. DNA pellets are washed once with 70% ethanol, air-dried and resuspended in TE buffer. DNAs are digested with different restriction enzymes and probed for DHFR and the locus of interest for amplification as compared to the control cells. MMR activity is restored in amplified clones and the cells are used for experimentation or production.
A benefit taught by this application is the combined use of MMR deficiency, enhanced homologous recombination with LSTFs and the ability to produce site-specific gene amplification within a host's genomic locus. Recently, a report by Lin, C. T. et al. ((2001) “Suppression of gene amplification and chromosomal DNA integration by the DNA mismatch repair system” Nucl. Acid Res. 29:3304-3310) found the lack of MMR results in increased gene amplification using a reporter gene system. The approach taught here describes a method that allows for enhanced locus amplification within a specific chromosomal site a hosts genome.
Discussion
The results and observation described here lead to several conclusions. First, expression of PMS134 results in an increase in microsatellite instability in HEK293 through the dominant negative blockage in mismatch repair. Second, that the inhibition of MMR in somatic cells can lead to increased rates of homologous recombination between short nucleotide sequences 50-70 nts in length. Finally, the combination of blocking MMR with dominant negative inhibitors such as polypeptides or chemical inhibitors can lead to a rapid process that can be used to genetically engineer somatic mammalian cells to alter the expression of a particular locus at the chromosomal level as well as tag exons of genes whereby the expression of a chromosomal locus can be monitored in response to biochemicals and pharmaceutical compound exposure.
While previous reports have taught the use of inhibiting MMR can lead to increased homologous recombination w ith divergent sequences, this application teaches t he use of employing MMR deficient somatic cell lines along with targeting fragments containing 50-70 nts of homology to a gene locus to alter and/or monitor its expression.
The blockade of MMR in cells to increase LSTF integration can be through the use of dominant negative MMR gene alleles from any species including bacteria, yeast, protozoa, insects, rodents, primates, mammalian cells, and man. Blockade of MMR can also be generated through the use of antisense RNA or deoxynucleotides directed to any of the genes involved in the MMR biochemical pathway. Blockade of MMR can be through the use of polypeptides that interfere with subunits of the MMR complex including but not limited to antibodies. Finally, the blockade of MMR may be through the use of chemicals such as but not limited tononhydrolyzable ATP analogs, which have been shown to block MMR (Galio, L. et al. (1999) “ATP hydrolysis-dependent formation of a dynamic ternary nucleoprotein complex with MutS and MutL” Nucl. Acids Res. 27:2325-2331; Spampinato, C. and P. Modrich (2000) “The MutL ATPase is required for mismatch repair” J. Biol. Chem. 275:9863-9869.
1. A method of introducing a locus specific targeting fragment into the genome of a cell in vitro through homologous recombination comprising:
inhibiting endogenous mismatch repair in cells of a cell population by introducing into said cells a polynucleotide comprising a dominant negative form of the human PMS2 gene, wherein the dominant negative form of said human PMS2 gene is PMS2-134, PMSR2, or PMSR3 and wherein said polynucleotide is expressed, thereby generating mismatch repair-inhibited cells;
contacting said mismatch repair-inhibited cells with a locus specific targeting fragment, wherein said locus specific targeting fragment is a polynucleotide comprising at least one promoter, a sequence encoding a selectable marker, and 5′ and 3′ flanking regions of about 20 to about 120 nucleotides; wherein said 5′ and 3′ flanking regions are homologous to a selected portion of the genome of said cells; and wherein said locus specific targeting fragment integrates into the genome of said cells by homologous recombination; and
selecting a cell comprising said locus specific targeting fragment.
2. The method of claim 1, further comprising restoring mismatch repair activity of said cell comprising said locus specific targeting fragment.
3. The method of claim 1, wherein said promoter is selected from the group consisting of a CMV promoter, an SV40 promoter, elongation factor promoter, LTR sequence, a pIND promoter sequence, a tetracycline promoter sequence, and a MMTV promoter sequence.
4. The method of claim 1, wherein said selectable marker is selected from the group consisting of a hygromycin resistance gene, a neomycin resistance gene and a zeocin resistance gene.
5. The method of claim 1, wherein said 5′ and 3′ flanking regions are about 30 to about 100 nucleotides in length.
6. The method of claim 1, wherein said 5′ and 3′ flanking regions are about 40 to about 90 nucleotides in length.
7. The method of claim 1, wherein said 5′ and 3′ flanking regions are about 50 to about 80 nucleotides in length.
8. The method of claim 1, wherein said 5′ and 3′ flanking regions are about 50 to about 70 nucleotides in length.
9. The method of claim 1, wherein said cell population comprises vertebrate cells, invertebrate cells, mammalian cells, reptilian cells, fungal cells, or yeast cells.
10. The method of claim 1, wherein said 5′ and 3′ flanking regions are homologous to a 5′ flanking region of a selected chromosomal locus of said cell comprising said locus specific targeting fragment.
11. The method of claim 1 wherein said locus specific targeting fragment comprises a second protein-encoding sequence operatively linked to a second promoter.
12. The method of claim 11 wherein said second protein-encoding sequence is a dihydrofolate reductase sequence.
13. The method of claim 1 wherein said cells are somatic cells.
14. A method of genetically altering a cell to overproduce a selected polypeptide in vitro comprising:
inhibiting endogenous mismatch repair of cells of a cell population by introducing into said cells a polynucleotide comprising a dominant negative form of the human PMS2 gene, wherein the dominant negative form of said human PMS2 gene is PMS2-134, PMSR2, or PMSR3 and wherein said polynucleotide is expressed, thereby generating mismatch repair-inhibited cells;
introducing a locus specific targeting fragment into said mismatch repair-inhibited cells, wherein said locus specific targeting fragment is a polynucleotide comprising at least one promoter sequence, a sequence encoding a selectable marker, a sequence encoding the selected polypeptide, and 5′ and 3′ flanking regions of about 20 to about 120 nucleotides, wherein said 5′ and 3′ flanking regions are homologous to a selected portion of the genome of said cell, and wherein said locus specific targeting fragment integrates into the genome of said cell by homologous recombination; and
selecting a cell that overproduces said selected polypeptide.
15. The method of claim 14, further comprising restoring mismatch repair activity of said cell.
16. The method of claim 14, wherein said promoter is selected from the group consisting of a CMV promoter, an SV40 promoter, elongation factor promoter, LTR sequence, a pIND promoter sequence, a tetracycline promoter sequence, and a MMTV promoter sequence.
17. The method of claim 14, wherein said selectable marker is selected from the group consisting of a hygromycin resistance gene, a neomycin resistance gene and a zeocin resistance gene.
18. The method of claim 14, wherein said 5′ and 3′ flanking regions are about 30 to about 100 nucleotides in length.
19. The method of claim 14, wherein said 5′ and 3′ flanking regions are about 40 to about 90 nucleotides in length.
20. The method of claim 14, wherein said 5′ and 3′ flanking regions are about 50 to about 80 nucleotides in length.
21. The method of claim 14, wherein said 5′ and 3′ flanking regions are 50 to 70 nucleotides in length.
22. The method of claim 14, wherein said cell population comprises vertebrate cells, invertebrate cells, mammalian cells, reptilian cells, fungal cells, or yeast cells.
23. The method of claim 14 wherein said cells are somatic cells.
24. A method of introducing a locus specific targeting fragment into the genome of a cell in vitro through homologous recombination comprising:
inhibiting endogenous mismatch repair in cells of a cell population by contacting said cells with a chemical inhibitor of mismatch repair, wherein said chemical inhibitor of mismatch repair is an anthracene, wherein said anthracene has the formula:
wherein R1-R10 are independently hydrogen, hydroxyl, amino group, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, aryl, substituted aryl, aryloxy, substituted aryloxy, heteroaryl, substituted heteroaryl, aralkyloxy, arylalkyl, alkylaryl, alkylaryloxy, arylsulfonyl, alkylsulfonyl, alkoxycarbonyl, aryloxycarbonyl, guanidino, carboxy, an alcohol, an amino acid, sulfonate, alkyl sulfonate, CN, NO2, an aldehyde group, an ester, an ether, a crown ether, a ketone, an organosulfur compound, an organometallic group, a carboxylic acid, an organosilicon or a carbohydrate that optionally contains one or more alkylated hydroxyl groups;
wherein said heteroaryl and substituted heteroaryl contain at least one heteroatom that is oxygen, sulfur, a metal atom, phosphorus, silicon or nitrogen; and
wherein the substituents of said substituted alkyl, substituted alkenyl, substituted alkynyl, substituted aryl, and substituted heteroaryl are halogen, CN, NO2, lower alkyl, aryl, heteroaryl, aralkyl, aralkyloxy, guanidino, alkoxycarbonyl, alkoxy, hydroxy, carboxy or amino group; and
wherein said amino group is optionally substituted with an acyl group, or 1 to 3 aryl or lower alkyl groups; or
wherein any two of R1-R10 can together form a polyether; or
wherein any two of R1-R10 can, together with intervening carbon atoms of the anthracene, form a crown ether,
thereby generating mismatch repair-inhibited cells;
contacting said mismatch repair-inhibited cells with a locus specific targeting fragment, wherein said locus specific targeting fragment is a polynucleotide comprising at least one promoter, a sequence encoding a selectable marker, and 5′ and 3′ flanking regions of about 20 to about 120 nucleotides; wherein said 5′ and 3′ flanking regions are homologous to a selected portion of the genome of said cells; and wherein said locus specific targeting fragment integrates into the genome of said cells by homologous recombination; and
selecting a cell comprising said locus specific targeting fragment.
25. The method of claim 24, further comprising restoring mismatch repair activity of said cell comprising said locus specific targeting fragment.
26. The method of claim 24, wherein said promoter is selected from the group consisting of a CMV promoter, an SV40 promoter, elongation factor promoter, LTR sequence, a pIND promoter sequence, a tetracycline promoter sequence, and a MMTV promoter sequence.
27. The method of claim 24, wherein said selectable marker is selected from the group consisting of a hygromycin resistance gene, a neomycin resistance gene and a zeocin resistance gene.
28. The method of claim 24, wherein said 5′ and 3′ flanking regions are about 30 to about 100 nucleotides in length.
29. The method of claim 24, wherein said 5′ and 3′ flanking regions are about 40 to about 90 nucleotides in length.
30. The method of claim 24, wherein said 5′ and 3′ flanking regions are about 50 to about 80 nucleotides in length.
31. The method of claim 24, wherein said 5′ and 3′ flanking regions are about 50 to about 70 nucleotides in length.
32. The method of claim 24, wherein said cell population comprises vertebrate cells, invertebrate cells, mammalian cells, reptilian cells, fungal cells, or yeast cells.
33. The method of claim 24, wherein said 5′ and 3′ flanking regions are homologous to a 5′ flanking region of a selected chromosomal locus of said cell comprising said locus specific targeting fragment.
34. The method of claim 24 wherein said locus specific targeting fragment comprises a second protein-encoding sequence operatively linked to a second promoter.
35. The method of claim 34 wherein said second protein-encoding sequence is a dihydrofolate reductase sequence.
36. The method of claim 24 wherein said cells are somatic cells.
37. A method of genetically altering a cell to overproduce a selected polypeptide in vitro comprising:
inhibiting endogenous mismatch repair of cells of a cell population by contacting said cells with a chemical inhibitor of mismatch repair, wherein said chemical inhibitor of mismatch repair is an anthracene, wherein said anthracene has the formula:
wherein R1-R10 are independently hydrogen, hydroxyl, amino group, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, aryl, substituted aryl, aryloxy, substituted aryloxy, heteroaryl, substituted heteroaryl, aralkyloxy, arylalkyl, alkylaryl, alkylaryloxy, arylsulfonyl, alkylsulfonyl, alkoxycarbonyl, aryloxycarbonyl, guanidino, carboxy, an alcohol, an amino acid, sulfonate, alkyl sulfonate, CN, NO2, an aldehyde group, an ester, an ether, a crown ether, a ketone, an organosulfur compound, an organometallic group, a carboxylic acid, an organosilicon or a carbohydrate that optionally contains one or more alkylated hydroxyl groups;
wherein said heteroaryl and substituted heteroaryl contain at least one heteroatom that is oxygen, sulfur, a metal atom, phosphorus, silicon or nitrogen; and
wherein the substituents of said substituted alkyl, substituted alkenyl, substituted alkynyl, substituted aryl, and substituted heteroaryl are halogen, CN, NO2, lower alkyl, aryl, heteroaryl, aralkyl, aralkyloxy, guanidino, alkoxycarbonyl, alkoxy, hydroxy, carboxy or amino group; and
wherein said amino group is optionally substituted with an acyl group, or 1 to 3 aryl or lower alkyl groups; or
wherein any two of R1-R10 can together form a polyether; or
wherein any two of R1-R10 can, together with intervening carbon atoms of the anthracene, form a crown ether,
thereby generating mismatch repair-inhibited cells;
introducing a locus specific targeting fragment into said mismatch repair-inhibited cells, wherein said locus specific targeting fragment is a polynucleotide comprising at least one promoter sequence, a sequence encoding a selectable marker, a sequence encoding the selected polypeptide, and 5′ and 3′ flanking regions of about 20 to about 120 nucleotides, wherein said 5′ and 3′ flanking regions are homologous to a selected portion of the genome of said cell, and wherein said locus specific targeting fragment integrates into the genome of said cell by homologous recombination; and
selecting a cell that overproduces said selected polypeptide.
38. The method of claim 37, further comprising restoring mismatch repair activity of said cell.
39. The method of claim 37, wherein said promoter is selected from the group consisting of a CMV promoter, an SV40 promoter, elongation factor promoter, LTR sequence, a pIND promoter sequence, a tetracycline promoter sequence, and a MMTV promoter sequence.
40. The method of claim 37, wherein said selectable marker is selected from the group consisting of a hygromycin resistance gene, a neomycin resistance gene and a zeocin resistance gene.
41. The method of claim 37, wherein said 5′ and 3′ flanking regions are about 30 to about 100 nucleotides in length.
42. The method of claim 37, wherein said 5′ and 3′ flanking regions are about 40 to about 90 nucleotides in length.
43. The method of claim 37, wherein said 5′ and 3′ flanking regions are about 50 to about 80 nucleotides in length.
44. The method of claim 37, wherein said 5′ and 3′ flanking regions are 50 to 70 nucleotides in length.
45. The method of claim 37, wherein said cell population comprises vertebrate cells, invertebrate cells, mammalian cells, reptilian cells, fungal cells, or yeast cells.
46. The method of claim 37 wherein said cells are somatic cells.