US20050095640A1
2005-05-05
11/013,179
2004-12-15
Method of producing controls for use in gene expression analysis systems such as macroarrays, real-time PCR, northern blots, SAGE and microarrays. The controls are generated either from near-random sequence of DNA, or from inter- or intragenic regions of a genome. Ten specific control sequences are also disclosed. Also presented are methods of using these controls, including as negative controls, positive controls, and as calibrators of a gene expression analysis system.
Get notified when new applications in this technology area are published.
C12Q1/6809 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Methods for determination or identification of nucleic acids involving differential detection
C12Q2545/101 » CPC further
Reactions characterised by their quantitative nature the purpose being quantitative analysis with an internal standard/control
This application claims priority to U.S. provisional patent application Ser. Nos. 60/289,202, filed May 7, 2001; and 60/312,420, filed Aug. 15, 2001; the disclosures of which are incorporated herein by reference in their entireties.
REFERENCE TO SEQUENCE LISTING SUBMITTED ON COMPACT DISCThe present application includes a Sequence Listing filed on one CD-R disc, provided in duplicate, containing a single file named PB0120.ST25.txt, having 32 kilobytes, last modified on May 6, 2002, and recorded on May 6, 2002. The Sequence Listing contained in said file on said disc is incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION1. Field of the Invention
The present invention relates to a method of using artificial genes as controls in gene expression analysis systems. More particularly, the present invention relates to a method of producing Controls for use in gene expression analysis systems such as macroarrays, real-time PCR, northern blots, SAGE and microarrays, such as those provided in the Microarray ScoreCard system.
2. Description of Related Art
Gene expression profiling is an important biological approach used to better understand the molecular mechanisms that govern cellular function and growth. Microarray analysis is one of the tools that can be applied to measure the relative expression levels of individual genes under different conditions. Microarray measurements often appear to be systematically biased, however, and the factors that contribute to this bias are many and ill-defined (Bowtell, D. L., Nature Genetics 21, 25-32 (1999); Brown, P. P. and Botstein, D., Nature Genetics 21, 33-37 (1999)). Others have recommended the use of “spikes” of purified mRNA at known concentrations as controls in microarray experiments. Affymetrix includes several for use with their GeneChip products. In the current state of the art, these selected genes are actual genes selected from very distantly related organisms. For example, the human chip (designed for use with human mRNA) includes control genes from bacterial and plant sources. Affymetrix sells mRNA corresponding to these genes for spiking into the labeling reaction and inclusion in the hybridization reaction.
Each of the prior art controls includes transcribed sequences of DNA from some source. As a result, that source cannot be the subject of a hybridization experiment using those controls due to the inherent hybridization of the controls to its source. What is needed, therefore, is a set of controls which do not hybridize with the DNA of any source which may be the subject of an experiment. More desirably, there is a need for a control for gene expression analysis which does not hybridize with any known source.
SUMMARY OF THE INVENTIONAccordingly, this invention provides a process of producing controls that are useful in gene expression analysis systems designed for any species and which can be tested to insure lack of hybridization with mRNA from sources other than the control DNA itself.
The invention relates in a first embodiment to a process for producing at least one control for use in a gene expression analysis system. The process comprises selecting at least one non-transcribed (inter- or intragenic) region of genomic DNA from a known sequence, designing primer pairs for said at least one non-transcribed region and amplifying said at least one non-transcribed region of genomic DNA to generate corresponding double stranded DNA, then cloning said double stranded DNA using a vector to obtain additional double stranded DNA and formulating at least one control comprising said double stranded DNA.
The present invention relates in a second embodiment to a process of producing at least one control for use in a gene expression analysis system wherein testing of said at least one non-transcribed region to ensure lack of hybridization with mRNA from sources other than said at least one non-transcribed region of genomic DNA is performed.
The present invention in a third embodiment relates to said process further comprising purifying said DNA and mRNA, determining the concentrations thereof and formulating at least one control comprising said DNA or of said mRNA at selected concentrations and ratios.
Another embodiment of the present invention is a control for use in a gene expression analysis system comprising a known amount of at least one DNA generated from at least one non-transcribed region of genomic DNA from a known sequence, or comprising a known amount of at least one mRNA generated from DNA generated from at least one non-transcribed region of genomic DNA from a known sequence. The present invention may optionally include generating mRNA complementary to said DNA and formulating at least one control comprising said mRNA, by optionally purifying said DNA and mRNA, determining the concentrations thereof and formulating at least one control comprising said DNA or of said mRNA at selected concentrations and ratios.
Another embodiment of the present invention is a control for use in a gene expression analysis system wherein a known amount of at least one DNA sequence generated from at least one non-transcribed region of genomic DNA from a known sequence, a known amount of at least one mRNA generated from DNA generated from at least one non-transcribed region of genomic DNA from a known sequence is included, and the aforementioned control wherein, said DNA and mRNA do not hybridize with any DNA or mRNA from a source other than the at least one non-transcribed region of genomic DNA.
The present invention, relates to a method of using said control, as a negative control in a gene expression analysis system by adding a known amount of said control containing a known amount of DNA, to a gene expression analysis system as a control sample and subjecting the sample to hybridization conditions in the absence of complementary labeled mRNA and examining the control sample for the absence or presence of signal.
Further, said controls can be used in a gene expression analysis system by adding a known amount of a said control containing a known amount of DNA to a gene expression analysis system as a control sample and subjecting the sample to hybridization conditions, in the presence of a said control containing a known amount of labeled complementary mRNA, and measuring the signal values for the labeled mRNA and determining the expression level of the DNA based on the signal value of the labeled mRNA.
Additionally, said controls may be used as calibrators in a gene expression analysis system by adding a known amount of a said control containing known amounts of several DNA sequences to a gene expression analysis system as control samples and subjecting the samples to hybridization conditions in the presence of a said control containing known amounts of corresponding complementary labeled mRNAs, each mRNA being at a different concentration and measuring the signal values for the labeled mRNAs and constructing a dose-response or calibration curve based on the relationship between signal value and concentration of each mRNA.
Also, the present invention relates to a method of using said controls as calibrators for gene expression ratios in a two-color gene expression analysis system by adding a known amount of at least one of said controls containing a known amount of DNA to a two-color gene expression analysis system as control samples and subjecting the samples to hybridization conditions in the presence of a said control containing known amounts of two differently labeled corresponding complementary labeled mRNAs for each DNA sample present and measuring the ratio of the signal values for the two differently labeled mRNAs and comparing the signal ratio to the ratio of concentrations of the two or more differently labelled mRNAs.
A further embodiment of the present invention is a process of producing controls that are useful in gene expression analysis systems designed for any species and which can be tested to insure lack of hybridization with mRNA from sources other than the synthetic sequences of DNA from which the control is produced.
One or more such controls can be produces by a process comprising synthesizing a near-random sequence of non-transcribed DNA, designing primer pairs for said at least one near random sequence and amplifying said non-transcribed DNA to generate corresponding double stranded DNA, then cloning said double stranded DNA using a vector to obtain additional double stranded DNA and formulating at least one control comprising said double stranded DNA.
The process can also be used to produce at least one control for use in a gene expression analysis system wherein testing of said sequence of non-transcribed synthetic DNA to ensure lack of hybridization with mRNA from sources other than said sequence of non-transcribed DNA is performed.
Additionally, mRNA complementary to said synthetic DNA can be generated and formulated to generate at least one control comprising said mRNA.
DNA and mRNA can be subsequently purified, the concentrations thereof determined, and one or more controls comprising said DNA or said mRNA at selected concentrations and ratios be formulated.
Another embodiment of the present invention is a control for use in a gene expression analysis system produced by the process comprises synthesizing a near-random sequence of DNA, designing primer pairs for said synthetic DNA and amplifying said DNA to generate corresponding double stranded DNA, then cloning said double stranded DNA using a vector to obtain additional double stranded DNA and formulating at least one control comprising a known amount of at least one said double stranded DNA or a known amount of at least one mRNA generated from said DNA, and optionally, wherein, said DNA and mRNA do not hybridize with any DNA or mRNA from a source other than said DNA sequence of non-transcribed DNA.
The present invention, additionally, relates to a method of using said controls containing a known amount of DNA, as a negative control in a gene expression analysis system including adding a known amount of said control containing a known amount of DNA to a gene expression analysis system as a control sample, and subjecting the sample to hybridization conditions in the absence of complementary labeled mRNA and examining the control sample for the absence or presence of signal.
Further, said controls may be used in a gene expression analysis system wherein a known amount of a said control containing a known amount of DNA is added to a gene expression analysis system as a control sample and subjecting the sample to hybridization conditions in the presence of a said control containing a known amount of labeled complementary mRNA and measuring the signal values for the labeled mRNA and determining the expression level of the DNA based on the signal value of the labeled mRNA.
The present invention, also relates to a method of using said controls as calibrators in a gene expression analysis system including adding known amounts of a said control containing known amounts of several DNAs to a gene expression analysis system as control samples and subjecting the samples to hybridization conditions in the presence of a said control containing known amounts of corresponding complementary labeled mRNAs, each mRNA being at a different concentration and measuring the signal values for the labeled mRNAs and constructing a dose-response or calibration curve based on the relationship between signal value and concentration of each mRNA.
The present invention, additionally, relates to a method of using said controls as calibrators for gene expression ratios in a two-color gene expression analysis system comprising adding a known amount of at least one of said controls containing a known amount of DNA to a two-color gene expression analysis system as control samples and subjecting the samples to hybridization conditions in the presence of a said control containing known amounts of two differently labeled corresponding complementary labeled mRNAs for each DNA sample present and measuring the ratio of the signal values for the two differently labeled mRNAs and comparing the signal ratio to the ratio of concentrations of the two or more differently labeled mRNAs.
Further embodiments and uses of the current invention will become apparent from a consideration of the ensuing description.
BRIEF DESCRIPTION OF THE DRAWINGSThe above and other objects and advantages of the present invention will be apparent upon consideration of the following detailed description taken in conjunction with the accompanying drawings, in which like characters refer to like parts throughout, and in which:
FIG. 1 presents the control nucleotide sequences of YIR1;
FIG. 2 presents the control nucleotide sequences of YIR2;
FIG. 3 presents the control nucleotide sequences of YIR3;
FIG. 4 presents the control nucleotide sequences of YIR4;
FIG. 5 presents the control nucleotide sequences of YIR5;
FIG. 6 presents the control nucleotide sequences of YIR6;
FIG. 7 presents the control nucleotide sequences of YIR7;
FIG. 8 presents the control nucleotide sequences of YIR8;
FIG. 9 presents the control nucleotide sequences of YIR11;
FIG. 10 presents the control nucleotide sequences of YIR19;
FIG. 11 presents the nucleotide sequences of YIR1s used in a spike mix;
FIG. 12 presents the nucleotide sequences of YIR2s used in a spike mix;
FIG. 13 presents the nucleotide sequences of YIR3s used in a spike mix;
FIG. 14 presents the nucleotide sequences of YIR4s used in a spike mix;
FIG. 15 presents the nucleotide sequences of YIR5s used in a spike mix;
FIG. 16 presents the nucleotide sequences of YIR6s used in a spike mix;
FIG. 17 presents the nucleotide sequences of YIR7s used in a spike mix;
FIG. 18 presents the nucleotide sequences of YIR8s used in a spike mix;
FIG. 19 presents the nucleotide sequences of YIR11s used in a spike mix; and
FIG. 20 presents the nucleotide sequences of YIR19s used in a spike mix.
DETAILED DESCRIPTION OF THE INVENTIONThe present invention teaches Controls for use in gene expression analysis systems such as microarrays. Many have expressed interest in being able to obtain suitable genes and spikes as controls for inclusion in their arrays.
An advantage of the Controls of this invention is that a single set can be used with assay systems designed for any species, as these Controls will not be present unless intentionally added. This contrasts with the concept of using genes from “distantly related species.” For example, an analysis system directed at detecting human gene expression might employ a Bacillus subtilis gene as control, which may not be present in a human genetic material. But this control might be present in bacterial genetic material (or at least, cross hybridize), thus it may not be a good control for an experiment on bacterial gene expression. The novel Controls presented here provide an advantage over the state of the art in that the same set of controls can be used without regard to the species for the test sample RNA.
The present invention employs the novel approaches of using either non-transcribed genomic sequences or totally random synthetic sequences as a template and generating both DNA and complementary “mRNA” from such sequences, for use as controls. The Controls could be devised de novo by designing near-random sequences and synthesizing them resulting in synthetic macromolecules as universal controls. Totally synthetic random DNA fragments are so designed that they do not cross-hybridize with each other or with RNA from any biologically relevant species (meaning species whose DNA or RNA might be present in the gene expression analysis system). The cost of generating such large synthetic DNA molecules can be high. However, they only need to be generated a single time. Additionally, fragment size can be increased by ligating smaller synthetic fragments together by known methods. In this way, fragments large enough to be easily cloned can be created. Through cloning and PCR sufficient quantities of DNA for use as controls can be produced and mRNA can be generated by in vitro transcription for use in controls.
A simpler approach is to identify sequences from the non-transcribed regions of genomic DNA from an organism, and use these as a template for synthesis via PCR (polymerase chain reaction). Ideally, sequences of around 1000 bases (could range from 500 to 2000 bases) are selected based on computer searches of publicly accessible sequence data. The criteria for selection include:
PCR primer pairs are designed for the selected sequence(s) and PCR is performed using genomic DNA (as a template) to generate PCR fragments (dsDNA) corresponding to the non-transcribed sequence(s) as the control DNA. Additional control DNA can be cloned using a vector and standard techniques. Subsequently, standard techniques such as in vitro transcription are used to generate mRNA (complementary to the cDNA and containing a poly-A tail) as the control mRNA. Standard techniques are used for purifying the Control DNA and Control mRNA products, and for estimating their concentrations.
Empirical testing is also performed to ensure lack of hybridization between the Control DNA on the array and other mRNAs, as well as with mRNA from important gene expression systems (e.g., human, mouse, Arabidopsis, etc.).
The above approaches were used to generate ten control sequences from intergenic regions of the yeast Saccharomyces cerevisiae genome. Specifically, using yeast genome sequence data publicly available (http://genome-www.stanford.edu/Saccharomyces/), intergenic regions approximately 1 kb in size were identified. These sequences were BLAST'd and those showing no homology to other sequences were identified as candidates for artificial gene controls. Candidates were analyzed for GC-content and a subset with a GC-content of ≧36% were identified. Specific primer sequences have been identified and synthesized. PCR products amplified with the specific primers have been cloned directly into the pGEM™-T Easy vector (Promega Corp., Madison, Wis.). Both array targets and templates for spike mRNA have been amplified from these clones using distinct and specific primers.
To maximize the chances of identifying 10 control sequences, a greater number of intergenic regions have been cloned for testing. All candidate sequences were spotted on glass microarray slides and hybridized with each candidate spike mRNA independently to identify those that cross-hybridize. Ten candidates exhibiting specific hybridization were chosen to form the specific set of controls. When used as controls, all of the ten yeast intergenic regions (YIRs) were generated by PCR with specific primers (Table 1), using 5 ng of cloned template (plasmid DNA) and a primer concentration of 0.5 μM in a 100 μl reaction volume, and cycled as follows: 35 cycles of
| TABLE 1 |
| Primers used for amplification of controls. |
| Target | Forward Primer | Reverse Primer |
| YIR1 | TTCGTTGGATTGAGTAAGAA | GCACTTCTAGTAAGCACATG | |
| SEQ ID NO: 21 | SEQ ID NO: 31 | ||
| YIR2 | GCGAATAACCAAAACGAGAC | GCACTAAACTAAAACCGTGA | |
| SEQ ID NO: 22 | SEQ ID NO: 32 | ||
| YIR3 | TGTTTTTGCTATATTACGTGGG | CCAGCGAACACAATTCAAAA | |
| SEQ ID NO: 23 | SEQ ID NO: 33 | ||
| YIR4 | TTTCGGTAGTGAGATGGCAG | TGTACCACTTTTGCACCATA | |
| SEQ ID NO: 24 | SEQ ID NO: 34 | ||
| YIR5 | TTAGTTTGGAACAGCAGTGT | GTTTCCTCGCTCATACCCTA | |
| SEQ ID NO: 25 | SEQ ID NO: 35 | ||
| YIR6 | AATGAGTTACCGTCTGTTAC | AGTAAAGTCATGGTGGATTG | |
| SEQ ID NO: 26 | SEQ ID NO: 36 | ||
| YIR7 | TCCTAGAGTAGCGATTCCCC | GCACCTATCGTCATTGTCTT | |
| SEQ ID NO: 27 | SEQ ID NO: 37 | ||
| YIR8 | TAGTTGGAGGTTGGTGAGTA | CTTCAACTCGTACGTGATGG | |
| SEQ ID NO: 28 | SEQ ID NO: 38 | ||
| YIR11 | CCATTCATATCATTTAGTGC | CCATTCCAGTTCATATTGAA | |
| SEQ ID NO: 29 | SEQ ID NO: 39 | ||
| YIR19 | GATTTAATACAGTACCTTTCTT | CCACTTTGATGGACTATTATG | |
| CGC | TATC | ||
| SEQ ID NO: 30 | SEQ ID NO: 40 | ||
All YIR control mRNAs for the spike mix are generated by in vitro transcription. Templates for in vitro transcription (IVT) are generated by amplification with specific primers that are designed to introduce a T7 RNA polymerase promoter on the 5′ end and a polyT (T21) tail on the 3′ end of the PCR products (see Table 2). Run-off mRNA is produced using 1 μl of these PCR products per reaction with the AmpliScribe system (Epicentre, Madison, Wis.). IVT products are purified using the RNAEasy system (Qiagen Inc., Valencia, Calif.) and quantified by spectrophotometry.
FIG. 1 through FIG. 10 presents the nucleotide sequences of the ten YIR controls, while FIG. 11 through 20 presents the nucleotide sequences of the ten YIRs (‘s’ for spike mix) as used in a spike mix. The primer sequences used for amplifying the controls were listed in Table 1, the primer sequences used for amplifying spike mix templates were listed in Table 2. These sequences are further presented in the Sequence Listing, incorporated herein by reference in its entirety, as follows:
SEQ ID NO: 10 nt, control nucleotide sequence YIR19;
| TABLE 2 |
| Primers used for amplification of in vitro |
| transcription targets. |
| Template | Forward Primer | Reverse Primer | |
| YIR1 | SEQ ID NO: 41 | SEQ ID NO: 51 | |
| GCATTAGCGGCCGCGAAATTAATA | TTTTTTTTTTTTTTTTTT | ||
| CGACTCACTATAGGGAGAAATGTC | TTTGAATACTTCCACTTT | ||
| GATACTGTGTTACG | GGTGC | ||
| YIR2 | SEQ ID NO: 42 | SEQ ID NO: 52 | |
| GCATTAGCGGCCGCGAAATTAATA | TTTTTTTTTTTTTTTTTT | ||
| CGACTCACTATAGGGAGATTTCTT | TTTAATATGCGGCTGCGC | ||
| TTTCCCTATTTCTCACTGG | TAAAA | ||
| YIR3 | SEQ ID NO: 43 | SEQ ID NO: 53 | |
| GCATTAGCGGCCGCGAAATTAATA | TTTTTTTTTTTTTTTTTT | ||
| CGACTCACTATAGGGAGAACTGTA | TTTAGTCGGTAATTTCTT | ||
| TATAAAAGAGGACTGC | TCTGG | ||
| YIR4 | SEQ ID NO: 44 | SEQ ID NO: 54 | |
| GCATTAGCGGCGGAAATTAATA | TTTTTTTTTTTTTTTTTT | ||
| CGACTACTATAGGGAGAATAATA | TTTACATGAGTATTAATT | ||
| ACTTCTGGCTTTTCGC | AAAT | ||
| YIR5 | SEQ ID NO: 45 | SEQ ID NO: 55 | |
| GCATTAGCGGCCGCGAAATTAA | TTTTTTTTTTTTTTTTTT | ||
| TACGACTCACTATAGGGAGAAG | TTTTTTAAAGGTATCATC | ||
| ATACCGTCCTTGGATAGA | CTGT | ||
| YIR6 | SEQ ID NO: 46 | SEQ ID NO: 56 | |
| GCATTAGCGGCGCGAAATTAATA | TTTTTTTTTTTTTTTTTT | ||
| CGACTCATATAGGGAGATTGGGA | TTTGCCGGACCTTTAAGC | ||
| CGGTTTTTGCACTAAGAA | ATAA | ||
| YIR7 | SEQ ID NO: 47 | SEQ ID NO: 57 | |
| GCATTAGGGCGCGAAATTAATA | TTTTTTTTTTTTTTTTTT | ||
| GATACTATAGGGAGATTCGG | TTTATAATTAGGGGTTCT | ||
| TATTTTAATCTT | GATA | ||
| YIR8 | SEQ ID NO: 48 | SEQ ID NO: 58 | |
| GATTAGGGGCGAAATTAATA | TTTTTTTTTTTTTTTTTT | ||
| GACTACTATAGGGAGACAGAT | TTTATGTTAGACTGAAAG | ||
| TGCTTAAAAAGAA | AAA | ||
| YIR11 | SEQ ID NO: 49 | SEQ ID NO: 59 | |
| GCATTAGCGGCCGCGAAATTAA | TTTTTTTTTTTTTTTTTT | ||
| TACGACTCACTATAGGGAGATT | TTTATTAAATTCGGCTAG | ||
| ATGGCTACTTTTCATTCC | CAC | ||
| YIR19 | SEQ ID NO: 50 | SEQ ID NO: 60 | |
| GCATTAGCGGCCGCGAAATTAATA | TTTTTTTTTTTTTTTTTT | ||
| CGACTCACTATAGGGAGAGCTAGG | TTTAGCATAAAACCTCAG | ||
| ATCTATATGCGAAT | CTTTA | ||
The following examples demostrate how these Control DNA and Control mRNA are then used as controls in microarray gene expression experiments:
The above examples illustrate specific aspects of the present invention and are not intended to limit the scope thereof in any respect and should not be so construed.
Those skilled in the art having the benefit of the teachings of the present invention as set forth above, can effect numerous modifications thereto. These modifications are to be construed as being encompassed within the scope of the present invention as set forth in the appended claims.
| TABLE 3 |
| Suggested Control mRNA spike mix composition for |
| two-color gene expression ratio experiments. |
| Target | Conc. In mix | |||
| Cy3:Cy5 | (pg/5 μl mix) | Relative |
| Control | Ratio | Cy3 | Cy5 | abundance* | |
| YIR1s | 1:1 | 33 000 | 33 000 | 3.3% | |
| YIR2s | 1:1 | 10 000 | 10 000 | 1% | |
| YIR3s | 1:1 | 1 000 | 1 000 | 0.1% | |
| YIR4s | 1:1 | 330 | 330 | 0.033% | |
| YIR5s | 1:1 | 100 | 100 | 0.01% | |
| YIR6s | 1:1 | 33 | 33 | 0.0033% | |
| YIR7s | 1:3 | 1 000 | 3 000 | NA | |
| YIR8s | 3:1 | 3 000 | 1 000 | NA | |
| YIR11s | 1:10 | 1 000 | 10 000 | NA | |
| YIR19s | 10:1 | 10 000 | 1 000 | NA | |
*For the labeling reactions, add 5 μl of the appropriate spike mix per microgram of Control mRNA. Use the spiked Control mRNA in the first-strand cDNA synthesis reaction. The spiked Control mRNA can be labeled using oligo dT and/or random primers. |
1-25. (canceled)
26. A control for use in a gene expression analysis system comprising:
a known amount of at least one DNA target generated from at least one intergenic or intronic region of genomic DNA from a known sequence; or
a known amount of at least one spike mRNA generated from DNA generated from said at least one intergenic or intronic region of genomic DNA from a known sequence.
27. The control of claim 26, wherein said at least one DNA target or spike mRNA do not hybridize at high stringency with any DNA or mRNA from a source other than said at least one intergenic or intronic region of genomic DNA.
28. The control of claim 26, wherein said at least one DNA target or spike mRNA is formulated at selected concentrations and ratios.
29. The control of claim 26, wherein said at least one DNA target is addressably disposed upon a substrate.
30. The control of claim 26, wherein said at least one spike mRNA is detectably labeled.
31. The control of claim 26, wherein said at least one DNA target or spike mRNA is between 500 and 2000 nucleotides in length.
32. The control of claim 26, wherein said at least one DNA target or spike mRNA is about 1000 nucleotides in length.
33. The control of claim 26, wherein
(a) said at least one DNA is selected from the group consisting of
(i) SEQ ID Nos: 1-10;
(ii) at least 17 contiguous nucleotides of SEQ ID Nos: 1-10; and
(iii) a complete complement of the sequence set forth in (i) and (ii); or
(b) said at least one mRNA is transcribed from the group consisting of
(i) SEQ ID Nos: 11-20;
(ii) at least 17 contiguous nucleotides of SEQ ID Nos: 11-20; and
(iii) a complete complement of the sequence set forth in (i).
34. A control for use in a gene expression analysis system, comprising:
(a) a known amount of at least one DNA target, generated from a random mechanically synthesized sequence of DNA; and
(b) a known amount of at least one spike mRNA generated from said at least one DNA target.
35. The control of claim 34, wherein said at least one DNA target or spike mRNA do not hybridize at high stringency with any DNA or mRNA from a source other than said sequence of DNA or mRNA.
36. The control of claim 34, wherein said at least one DNA target or spike mRNA is formulated at selected concentrations and ratios.
37. The control of claim 34, wherein said at least one DNA target is addressably disposed upon a substrate.
38. The control of claim 34, wherein said at least one spike mRNA is detectably labeled.
39. A method of using a control as a negative control in a gene expression analysis system comprising:
adding a known amount of said control DNA of claim 26, to a gene expression analysis system as a control sample;
subjecting the sample to hybridization conditions in the absence of complementary labeled mRNA;
examining the control sample for the absence or presence of signal.
40. A method of using controls in a gene expression analysis system comprising:
adding a known amount of said control DNA of claim 26, to a gene expression analysis system as a control sample;
subjecting the sample to hybridization conditions in the presence of a known amount of labeled complementary mRNA of claim 26;
measuring the signal values for the labeled mRNA and determining the expression level of the DNA based on the measured signal value.
41. A method of using controls as calibrators in a gene expression analysis system comprising:
adding a known amount of a said control containing known amounts of several DNAs of claim 26, to a gene expression analysis system as control samples;
subjecting the samples to hybridization conditions in the presence of a said control containing known amounts of corresponding complementary labeled mRNAs of claim 26, each mRNA being at a different concentration;
measuring the signal values for the labeled mRNAs and constructing a dose-response or calibration curve based on the relationship between signal value and concentration of each mRNA.
42. A method of using controls as calibrators for gene expression ratios in a two-color gene expression analysis system comprising:
adding a known amount of at least one of said controls containing a known amount of DNA of claim 26, to a two-color gene expression analysis system as control samples;
subjecting the samples to hybridization conditions in the presence of a said control containing known amounts of two differently labeled corresponding complementary labeled mRNAs of claim 26, for each DNA sample present;
measuring the ratio of the signal values for the two differently labeled mRNAs and comparing the signal ratio to the ratio of concentrations of the two or more differently labeled mRNAs.
43. A process of producing at least one control of claim 26, which process comprising:
selecting at least one intergenic or intronic region of genomic DNA from a known sequence;
designing primer pairs for said at least one intergenic or intronic region;
amplifying said at least one intergenic or intronic region of genomic DNA to generate corresponding double stranded DNA;
cloning said double stranded control DNA using a vector to obtain additional double stranded DNA; and
formulating at least one control comprising said double stranded DNA.
44. The process of claim 43, further comprising:
testing said at least one intergenic or intronic region to ensure lack of hybridization with mRNA from sources other than said at least one intergenic or intronic region of genomic DNA.
45. The process of claim 43, further comprising:
generating mRNA complementary to said double stranded control DNA; and
formulating at least one control comprising said mRNA.
46. The process of claim 45, further comprising:
purifying said DNA and mRNA;
determining the concentrations thereof; and
formulating at least one control comprising said DNA or said mRNA at selected concentrations and ratios.
47. A method of using a control as a negative control in a gene expression analysis system comprising:
adding a known amount of said control containing a known amount of DNA of claim 34, to a gene expression analysis system as a control sample;
subjecting the sample to hybridization conditions in the absence of complementary labeled mRNA;
examining the control sample for the absence or presence of signal.
48. A method of using controls in a gene expression analysis system comprising:
adding a known amount of a said control containing a known amount of DNA of claim 34, to a gene expression analysis system as a control sample;
subjecting the sample to hybridization conditions in the presence of a known amount of labeled complementary mRNA of claim 34;
measuring the signal values for the labeled mRNA and determining the expression level of the DNA based on the measured signal value.
49. A method of using controls as calibrators in a gene expression analysis system comprising:
adding a known amount of a said control containing known amounts of several DNAs of claim 34, to a gene expression analysis system as control samples;
subjecting the samples to hybridization conditions in the presence of a said control containing known amounts of corresponding complementary labeled mRNAs of claim 34, each mRNA being at a different concentration;
measuring the signal values for said labeled control mRNAs and constructing a dose-response or calibration curve based on the relationship between signal value and concentration of each mRNA
50. A method of using controls as calibrators for gene expression ratios in a two-color gene expression analysis system comprising:
adding a known amount of at least one of said controls containing a known amount of DNA of claim 34, to a two-color gene expression analysis system as control samples;
subjecting the samples to hybridization conditions in the presence of a said control containing known amounts of two differently labeled corresponding complementary labeled control mRNAs of claim 34, for each DNA sample present;
measuring the ratio of the signal values for the two differently labeled mRNAs and comparing the signal ratio to the ratio of concentrations of the two or more differently labeled mRNAs.
51. A process of producing at least one control of claim 34, which process comprising:
synthesizing a near-random sequence of DNA;
designing primer pairs for said sequence of DNA;
amplifying said DNA to generate corresponding double stranded DNA;
cloning said double stranded control DNA using a vector to obtain additional double stranded DNA; and
formulating at least one control comprising said double stranded DNA.
52. The process of claim 51, further comprising:
testing said DNA to ensure lack of hybridization with mRNA from sources other than said DNA.
53. The process of claim 51, further comprising:
generating mRNA complementary to said DNA; and
formulating at least one control comprising said mRNA.
54. The process of claim 53, further comprising:
purifying said DNA and mRNA;
determining the concentrations thereof; and
formulating at least one control comprising said DNA or said mRNA at selected concentrations and ratios.