Patent application title:

COMPOSITIONS AND THEIR USES DIRECTED TO IL-4R ALPHA

Publication number:

US20070161594A1

Publication date:
Application number:

11/548,657

Filed date:

2006-10-11

Abstract:

Disclosed herein are compounds, compositions and methods for modulating the expression of IL-4R alpha in a cell, tissue or animal. Also provided are methods of target validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders related to expression of IL 4R-α, airway hyperresponsiveness, and/or pulmonary inflammation.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N15/1138 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides against receptors or cell surface proteins

A61P11/00 »  CPC further

Drugs for disorders of the respiratory system

A61P11/02 »  CPC further

Drugs for disorders of the respiratory system Nasal agents, e.g. decongestants

A61P11/06 »  CPC further

Drugs for disorders of the respiratory system Antiasthmatics

A61P11/08 »  CPC further

Drugs for disorders of the respiratory system Bronchodilators

A61P37/08 »  CPC further

Drugs for immunological or allergic disorders Antiallergic agents

A61K38/00 »  CPC further

Medicinal preparations containing peptides

C12N2310/11 »  CPC further

Structure or type of the nucleic acid; Type of nucleic acid Antisense

C12N2310/315 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the backbone Phosphorothioates

C12N2310/3341 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the base; Modified C 5-Methylcytosine

C12N2310/341 »  CPC further

Structure or type of the nucleic acid; Chemical structure; Spatial arrangement of the modifications Gapmers, i.e. of the type ===---===

C12N2310/345 »  CPC further

Structure or type of the nucleic acid; Chemical structure; Spatial arrangement of the modifications having at least two different backbone modifications

C12N2310/321 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the sugar 2'-O-R Modification

C12N2310/3525 »  CPC further

Structure or type of the nucleic acid; Chemical structure; Nature of the modification linked to the nucleic acid via a carbon atom MOE, methoxyethoxy

A61K48/00 IPC

Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

C07F9/6533 IPC

Compounds containing elements of Groups 5 or 15 of the Periodic System; Phosphorus compounds; Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having nitrogen and oxygen atoms as the only ring hetero atoms Six-membered rings

C07H21/02 IPC

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. Provisional Patent Application Ser. Nos. 60/656,760, filed Feb. 25, 2005; 60/688,897, filed Jun. 9, 2005; 60/700,656, filed Jul. 19, 2005; and 60/709,404 filed Aug. 18, 2005; all of which are incorporated herein by reference in their entirety.

INCORPORATION OF SEQUENCE LISTING

A copy of the sequence listing in both a paper and a computer-readable form is provided herewith and hereby incorporated by reference. The computer readable form is provided on 3.5″ diskette containing the file named RTS0792WOSEQ.txt

BACKGROUND OF THE INVENTION

Allergic rhinitis and asthma are widespread conditions with complex and multifactorial etiologies. The severity of the conditions vary widely between individuals, and within individuals, dependent on factors such as genetics, environmental conditions, and cumulative respiratory pathology associated with duration and severity of disease. Both diseases are a result of immune system hyperresponsiveness to innocuous environmental antigens, with asthma typically including an atopic (i.e., allergic) component.

In asthma, the pathology manifests as inflammation, mucus overproduction, and reversible airway obstruction which may result in scarring and remodeling of the airways. Mild asthma is relatively well controlled with current therapeutic interventions including beta-agonists and low dose inhaled corticosteroids or cromolyn. However, moderate and severe asthma are less well controlled, and require daily treatment with more than one long-term control medication to achieve consistent control of asthma symptoms and normal lung function. With moderate asthma, doses of inhaled corticosteroids are increased relative to those given to mild asthmatics, and/or supplemented with long acting beta-agonists (LABA) (e.g., salmeterol) or leukotriene inhibitors (e.g., montelukast, zafirlukast). Although LABA can decrease dependence on corticosteroids, they are not as effective for total asthma control as corticosteroids (e.g., reduction of episodes, emergency room visits) (Lazarus et al., JAMA. 2001.285: 2583-2593; Lemanske et al., JAMA. 2001. 285: 2594-2603). With severe asthma, doses of inhaled corticosteroids are increased, and supplemented with both LABA and oral corticosteroids. Severe asthmatics often suffer from chronic symptoms, including night time symptoms; limitations on activities; and the need for emergency room visits. Additionally, chronic corticosteroid therapy at any level has a number of unwanted side effects, especially in children (e.g., damage to bones resulting in decreased growth).

Allergic rhinitis is inflammation of the nasal passages, and is typically associated with watery nasal discharge, sneezing, congestion and itching of the nose and eyes. It is frequently caused by exposure to irritants, particularly allergens. Allergic rhinitis affects about 20% of the American population and ranks as one of the most common illnesses in the US. Most suffer from seasonal symptoms due to exposure to allergens, such as pollen, that are produced during the natural plant growth season(s). A smaller proportion of sufferers have chronic allergies due to allergens that are produced throughout the year such as house dust mites or animal dander. A number of over the counter treatments are available for the treatment of allergic rhinitis including oral and nasal antihistamines, and decongestants. Antihistamines are utilized to block itching and sneezing and many of these drugs are associated with side effects such as sedation and performance impairment at high doses. Decongestants frequently cause insomnia, tremor, tachycardia, and hypertension. Nasal formulations, when taken improperly or terminated rapidly, can cause rebound congestion. Anticholinergics and montelukast have substantially fewer side effects, but they also have limited efficacy. Similarly, prescription medications are not free of side effects. Nasal corticosteroids can be used for prophylaxis or suppression of symptoms; however, compliance is variable due to side effects including poor taste and nasal irritation and bleeding. Allergen immunotherapy is expensive and time consuming and carries a low risk of anaphylaxis.

Persistent nasal inflammation can result in the development of nasal polyps. Nasal polyps are present in about 4.2% of patients with chronic rhinitis and asthma (4.4% of men and 3.8% of women) (Grigores et al., Allergy Asthma Proc. 2002, 23:169-174). The presence of polyps is increased with age in both sexes and in patients with cystic fibrosis and aspirin-hypersensitivity triad. Nasal polyposis results from chronic inflammation of the nasal and sinus mucous membranes. Chronic inflammation causes a reactive hyperplasia of the intranasal mucosal membrane, which results in the formation of polyps. The precise mechanism of polyp formation is incompletely understood. Nasal polyps are associated with nasal airway obstruction, postnasal drainage, dull headaches, snoring, anosmia, and rhinorrhea. Medical therapies include treatment for underlying chronic allergic rhinitis using antihistamines and topical nasal steroid sprays. For severe nasal polyposis causing severe nasal obstruction, treatment with short-term steroids may be beneficial. Topical use of cromolyn spray has also been found to be helpful to some patients in reducing the severity and size of the nasal polyps. Oral corticosteroids are the most effective medication for the short-term treatment of nasal polyps, and oral corticosteroids have the best effectiveness in shrinking inflammatory polyps. Intranasal steroid sprays may reduce or retard the growth of small nasal polyps, but they are relatively ineffective in massive nasal polyposis. Although nasal polyps can be treated pharmacologically, many of the therapeutics have undesirable side effects. Moreover, polyps tend to be recurrent, eventually requiring surgical intervention. Compositions and methods to inhibit post-surgical recurrence of nasal polyps are not presently available.

Other diseases characterized by similar inflammatory pathways include, but are not limited to, chronic bronchitis, pulmonary fibrosis, emphysema, chronic obstructive pulmonary disease (COPD), and pediatric asthma.

Interleukin Receptor 4-Alpha and Inflammatory Signaling Pathways

It is generally acknowledged that allergy and asthma are a result of the dysregulation of the Th2 cytokine response. The presence of CD4+ T cells producing interleukin 4 (IL 4), IL 5 and IL 13 cytokines in bronchoalveolar lavage fluid and in airway epithelial biopsies of asthmatics has been clearly documented. Neutralization of IL 5 results in a decrease in eosinophilia in man, in the absence of a reduction in airway hyperresponsiveness (AHR). IL 4 and IL 13 have been implicated in multiple pathological processes that underlie asthma and allergy, including Th2 lymphocyte differentiation, induction of immunoglobulin E (IgE) production via regulation of the Ig isotype switch to the epsilon heavy chain in B lymphocytes, upregulation of IgE receptors and vascular associated adhesion molecule-1 (VCAM-1) expression, promotion of eosinophil transmigration in the lung, and mucus hypersecretion. IL 13 mediates the development of airway hyperresponsiveness (AHR) to cholinergic stimuli, lung remodeling, and promotion of the secretory phenotype of the inflamed airway epithelium. These observations make components of the Th2 cytokine pathway, particularly IL 4 and IL 13, potential targets for therapeutic intervention for asthma, allergy, and other forms of airway inflammation and/or hyperresponsiveness.

The IL 4 and IL 13 receptors share a common signaling chain, IL 4 receptor alpha (IL 4R-α). IL 4R-α pairs with the common gamma chain on cells of hematopoietic origin to form a type I IL 4R. This receptor binds exclusively IL 4. IL 4 and IL 13 also signal through a second receptor. The receptor is composed of IL 4R-α and IL 13R-α1 (type II IL 4R). IL 13R-α1 is present on both hematopoietic and non-hematopoietic cells. Formation of the IL 4R-α and IL 13R-α1 heterodimer results in a shift in affinity of IL 13R-α1 from a low affinity receptor, to a high affinity receptor. The IL 13R-α2 is a monomeric, high affinity IL 13 receptor that is thought to act as a decoy receptor to negatively regulate IL 13 activity. Signaling through the type I and type II IL 4Rs activates the Jak-Stat pathway; insulin-interleukin-4 receptor (I4R) motif associated factors such as insulin receptor substrate family of proteins; SH2 containing tyrosine phosphatases; and members of the Stat family such as Stat 6. A number of genetic studies have demonstrated that both IL 4R-α and Stat 6 are essential for allergen-induced pulmonary inflammation and AHR in mice.

IL 4R-α, was cloned independently by two groups (Galizzi et al., Int. Immunol., 1990, 2, 669-675; and Idzerda et al., J. Exp. Med., 1990, 171, 861-873). The human IL4 receptor gene was localized to 16p11.2-16p12.1 by in situ hybridization, and the mouse homolog was localized to the distal region of chromosome 7. The position on human chromosome 16 suggests that the IL4 receptor may be a candidate for rearrangements. For example, 12; 16 translocations are often associated with myxoid liposarcomas (Pritchard et al., Genomics, 1991, 10, 801-806).

Inhibitors of IL 4 and IL 13 independently have produced anti-inflammatory effects in mouse pulmonary inflammation models or in clinical trials (Wills-Karp M et al. Science 282: 2258-2261, 1998; Grunig G et al. Science 282: 2261-2263, 1998; Borish L C et al., Am J Respir Crit Care Med 160: 1816-1823, 1999; Kumar R K et al., Am J Respir Crit Care Med 170: 1043-1048, 2004; Yang G et al., Cytokine 28: 224-232, 2004) and are currently being pursued as novel therapeutics for allergy and asthma.

Antisense Oligonucleotides and Pulmonary Disease

Antisense oligonucleotides (ASOs) are being pursued as therapeutics for pulmonary inflammation, airway hyperresponsiveness, and/or asthma. Lung provides an ideal tissue for aerosolized ASOs for several reasons (Nyce and Metzger, Nature, 1997: 385:721-725, incorporated herein by reference); the lung can be targeted non-invasively and specifically, it has a large absorption surface; and is lined with surfactant that may facilitate distribution and uptake of ASOs. Delivery of ASOs to the lung by aerosol results in excellent distribution throughout the lung in both mice and primates. Immunohistochemical staining of inhaled ASOs in normalized and inflamed mouse lung tissue shows heavy staining in alveolar macrophages, eosinophils, and epithelium, moderate staining in blood vessels endothelium, and weak staining in bronchiolar epithelium. ASO-mediated target reduction is observed in dendritic cells, macrophages, eosinophils, and epithelial cells after aerosol administration. The estimated half life of a 2′-methoxyethoxy (2′-MOE) modified oligonucleotide delivered by aerosol administration to mouse or monkey is about 4 to 7, or at least 7 days, respectively. Moreover, ASOs have relatively predictable toxicities and pharmacokinetics based on backbone and nucleotide chemistry. Pulmonary administration of ASOs results in minimal systemic exposure, potentially increasing the safety of such compounds as compared to other classes of drugs.

Compositions and methods for formulation of ASOs and devices for delivery to the lung and nose are well known. ASOs are soluble in aqueous solution and may be delivered using standard nebulizer devices (Nyce, Exp. Opin. Invest. Drugs, 1997, 6:1149-1156). Formulations and methods for modulating the size of droplets using nebulizer devices to target specific portions of the respiratory tract and lungs are well known to those skilled in the art. Oligonucleotides can be delivered using other devices such as dry powder inhalers or metered dose inhalers which can provide improved patient convenience as compared to nebulizer devices, resulting in greater patient compliance.

Generally, the principle behind antisense technology is that an antisense compound hybridizes to a target nucleic acid and effects the modulation of gene expression activity, or function, such as transcription or translation. The modulation of gene expression can be achieved by, for example, target RNA degradation or occupancy-based inhibition. An example of modulation of target RNA function by degradation is RNase H-based degradation of the target RNA upon hybridization with a DNA-like antisense compound. Another example of modulation of gene expression by target degradation is RNA interference (RNAi) using small interfering RNAs (siRNAs). RNAi is a form of antisense-mediated gene silencing involving the introduction of double stranded (ds)RNA-like oligonucleotides leading to the sequence-specific reduction of targeted endogenous mRNA levels. This sequence-specificity makes antisense compounds extremely attractive as tools for target validation and gene functionalization, as well as therapeutics to selectively modulate the expression of genes involved in diseases.

Antisense oligonucleotides targeted to a number of targets including, but not limited to p38 alpha MAP kinase (US Patent Publication No. 20040171566, incorporated by reference); the CD28 receptor ligands B7-1 and B7-2 (US Patent Publication 20040235164, incorporated by reference); intracellular adhesion molecule (ICAM) (WO 2004/108945, incorporated by reference); and adenosine A1 receptor (Nyce and Metzger, Nature, 1997, 385.721-725) have been tested for their ability to inhibit pulmonary inflammation and airway hyperresponsiveness in mouse, rabbit, and/or monkey models of asthma when delivered by inhalation. Various endpoints were analyzed in each case and a portion of the results are presented herein. ASOs targeted to p38 alpha MAP kinase reduced eosinophil recruitment, airway hyperresponsiveness (AHR), and mucus production in two different mouse models. ASOs targeted to each B7.1 and B7.2 decreased target expression and eosinophil recruitment. An ASO targeted to B7.2 also reduced AHR. ASOs targeted to ICAM-1 decreased AHR and decreased neutrophil and eosinophil recruitment in mice. Treatment of Cynomolgus monkeys with an ASO targeted to ICAM-1 significantly reduced airway impedance (resistance) induced by methacholine challenge in naturally Ascaris allergen-sensitized monkeys. An ASO targeted to adenosine A1 receptor reduced receptor density on airway smooth muscle and reduced AHR in an allergic rabbit model. These data demonstrate that oligonucleotides are effectively delivered by inhalation to cells within the lungs of multiple species, including a non-human primate, and are effective at reducing airway hyperresponsiveness and/or pulmonary inflammation.

However, treatment with any ASO targeted to any inflammatory mediator involved in pulmonary inflammation is not always effective at reducing AHR and/or pulmonary inflammation. ASOs targeted to Jun N-terminal Kinase (JNK-1) found to decrease target expression in vitro were tested in a mouse model of asthma. Treatment with each of two different antisense oligonucleotides targeted to JNK-1 were not effective at reducing methacholine induced AHR, eosinophil recruitment, or mucus production at any of the ASO doses tested.

A number of ASOs and siRNAs designed to target IL 4R-α have been reported for use as research or diagnostic tools, or as pharmaceuticals for the treatment of respiratory disease. US Patent Application US20030104410 teaches an array of nucleic acid probes useful as research tools to identify or detect gene sequences. Allelic variations in the IL 4R-α gene have been identified that increase receptor signaling (Hershey et al., NEJM, 1997, 337:1720-1725; Rosa-Rosa et al., J. Allergy Clin. Immunol. 1999, 104.1008-1014; Kruse et al., Immunol., 1999, 96, 365-371). PCT patent application WO 2000034789 teaches oligonucleotides for use in diagnostic testing to detect these allelic variations. Patent applications WO 2002085309, WO 2004011613 and US 20040049022 teach ASOs targeted to a series of genes potentially relevant to respiratory disease, including IL 4R-α, for use in pharmaceutical compositions. Patent application US 20050143333 teaches a series of siRNAs targeted to interleukins and interleukin receptors, including IL 4R-α. PCT application WO 2004045543 teaches algorithms and rational design and selection of functional siRNAs including those targeted to IL 4R-α. Although it is suggested in these publications that the ASOs and siRNAs can be used in pharmaceutical compositions, there are no data demonstrating the efficacy of the compounds in vivo for the prevention, amelioration, and/or treatment of any disease or disorder.

SUMMARY OF THE INVENTION

The invention provides compounds, particularly oligomeric compounds, especially nucleic acid and nucleic acid-like oligomers, which are targeted to a nucleic acid encoding IL-4R alpha. Preferably, the oligomeric compounds are antisense oligonucleotides targeted to IL 4R-α, particularly human IL 4R-α (GenBank Accession No. X52425.1, entered 26 May 1992 (SEQ ID NO. 1); GenBank Accession No. BM738518.1, entered 1 Mar. 2002; nucleotides 18636000 to 18689000 of GenBank Accession No. NT010393.14 entered 19 Feb. 2004, each of which is incorporated by reference), that modulate the expression of IL 4R-α. The compounds comprise at least a 12 nucleobase portion, preferably at least a 17 nucleobase portion of the sequences listed in Table 3, 4 or 5, or are at least 90% identical to validated target segments, or the sequences listed in Table 3, 4, or 5.

The invention provides a method for modulating the expression of IL 4R-α in cells or tissues comprising contacting the cells with at least one compound of the instant invention, and analyzing the cells for indicators of a decrease in expression of IL 4R-α mRNA and/or protein by direct measurement of mRNA and/or protein levels, and/or indicators of pulmonary inflammation and/or airway hyperresponsiveness.

The invention further provides a method for the prevention, amelioration, and/or treatment of pulmonary inflammation and/or airway hyperresponsiveness comprising administering at least one compound of the instant invention to an individual in need of such intervention. The compound is preferably administered by aerosol (i.e., topically) to at least a portion of the respiratory tract. The portion of the respiratory tract selected is dependent upon the location of the inflammation. For example, in the case of asthma, the compound is preferably delivered predominantly to the lung. In the case of allergic rhinitis, the compound is preferably delivered predominantly to the nasal cavity and/or sinus. The compound is delivered using any of a number of standard delivery devices and methods well known to those skilled in the art, including, but not limited to nebulizers, nasal and pulmonary inhalers, dry powder inhalers, and metered dose inhalers.

The invention also provides a method of use of the compositions of the instant invention for the preparation of a medicament for the prevention, amelioration, and/or treatment disease, especially a disease associated with and including at least one indicator of pulmonary inflammation and/or airway hyperresponsiveness. The medicament is preferably formulated for aerosol administration to at least a portion of the respiratory tract.

DETAILED DESCRIPTION OF THE INVENTION

Asthma, allergy, and a number of other diseases or conditions related to pulmonary inflammation and/or AHR share common inflammatory mediators, including IL 4R-α, the common subunit of IL 4R and IL 13R. Therapeutic interventions for these diseases or conditions are not completely satisfactory due to lack of efficacy and/or unwanted side effects of the compounds. The instant invention provides oligomeric compounds, preferably ASOs, for the prevention, amelioration, and/or treatment of pulmonary inflammation and/or airway hyperresponsiveness. As used herein, the term “prevention” means to delay or forestall onset or development of a condition or disease for a period of time from hours to days, preferably weeks to months. As used herein, the term “amelioration” means a lessening of at least one indicator of the severity of a condition or disease. The severity of indicators may be determined by subjective or objective measures. As used herein, “treatment” means to administer a composition of the invention to effect an alteration or improvement of the disease or condition. Prevention, amelioration, and/or treatment may require administration of multiple doses at regular intervals, or prior to exposure to an agent (e.g., an allergen) to alter the course of the condition or disease. Moreover, a single agent may be used in a single individual for each prevention, amelioration, and treatment of a condition or disease sequentially, or concurrently. In a preferred method of the instant invention, the ASOs are delivered by aerosol for topical delivery to the respiratory tract, thereby limiting systemic exposure and reducing potential side effects.

Overview

Disclosed herein are oligomeric compounds, including antisense oligonucleotides and other antisense compounds for use in modulating the expression of nucleic acid molecules encoding IL 4R-α. This is accomplished by providing oligomeric compounds that hybridize with one or more target nucleic acid molecules encoding IL 4R-α. As used herein, the terms “target nucleic acid” and “nucleic acid molecule encoding IL 4R-α” have been used for convenience to encompass DNA encoding IL 4R-α, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA. In a preferred embodiment, the target nucleic acid is an mRNA encoding IL 4R-α.

The principle behind antisense technology is that an antisense compound that hybridizes to a target nucleic acid, modulates gene expression activities such as transcription or translation. This sequence specificity makes antisense compounds extremely attractive as tools for target validation and gene functionalization, as well as therapeutics to selectively modulate the expression of genes involved in disease. Although not limited by mechanism of action, the compounds of the instant invention are proposed to work by an antisense, non-autocatalytic mechanism.

Compounds

The term “oligomeric compound” refers to a polymeric structure capable of hybridizing to a region of a nucleic acid molecule. This term includes oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, and chimeric combinations of these. Generally, oligomeric compounds comprise a plurality of monomeric subunits linked together by internucleoside linking groups and/or internucleoside linkage mimetics. Each of the monomeric subunits comprises a sugar, abasic sugar, modified sugar, or a sugar mimetic, and except for the abasic sugar includes a nucleobase, modified nucleobase or a nucleobase mimetic. Preferred monomeric subunits comprise nucleosides and modified nucleosides. Oligomeric compounds are routinely prepared linearly but can be joined or otherwise prepared to be circular. Moreover, branched structures are known in the art.

An “antisense compound” or “antisense oligomeric compound” refers to an oligomeric compound that is at least partially complementary to the region of a target nucleic acid molecule to which it hybridizes and which modulates (increases or decreases) its expression. Consequently, while all antisense compounds can be said to be oligomeric compounds, not all oligomeric compounds are antisense compounds. An “antisense oligonucleotide” is an antisense compound that is a nucleic acid-based oligomer. An antisense oligonucleotide can, in some cases, include one or more chemical modifications to the sugar, base, and/or internucleoside linkages. Nonlimiting examples of oligomeric compounds include primers, probes, antisense compounds, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternate splicers, and siRNAs. As such, these compounds can be introduced in the form of single-stranded, double-stranded, circular, branched or hairpins and can contain structural elements such as internal or terminal bulges or loops. Oligomeric double-stranded compounds can be two strands hybridized to form double-stranded compounds or a single strand with sufficient self complementarity to allow for hybridization and formation of a fully or partially double-stranded compound. The compounds of the instant invention are not auto-catalytic. As used herein, “auto-catalytic” means a compound has the ability to promote cleavage of the target RNA in the absence of accessory factors, e.g. proteins.

In one embodiment of the invention, the oligomeric compound is an antisense compound comprising a single stranded oligonucleotide. In some embodiments of the invention the oligomeric compound contains chemical modifications. In a preferred embodiment, the antisense compound is a single stranded, chimeric oligonucleotide wherein the modifications of sugars, bases, and internucleoside linkages are independently selected.

The oligomeric compounds in accordance with this invention may comprise an oligomeric compound from about 12 to about 35 nucleobases (i.e. from about 12 to about 35 linked nucleosides). In other words, a single-stranded compound of the invention comprises from about 12 to about 35 nucleobases, and a double-stranded antisense compound of the invention (such as a siRNA, for example) comprises two strands, each of which is from about 12 to about 35 nucleobases. Contained within the oligomeric compounds of the invention (whether single or double stranded and on at least one strand) are antisense portions. The “antisense portion” is that part of the oligomeric compound that is designed to work by one of the aforementioned antisense mechanisms. One of ordinary skill in the art will appreciate that this comprehends antisense portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleobases.

In one embodiment, the antisense compounds of the invention have antisense portions of 12 to 35 nucleobases. It is understood that the antisense portion may be about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleobases in length.

Antisense compounds 12 to 35 nucleobases in length comprising a stretch of at least eight (8), preferably at least 12, more preferably at least 17 consecutive nucleobases selected from within the illustrative antisense compounds are considered to be suitable antisense compounds as well.

Compounds of the invention include oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 5′-terminus of one of the illustrative antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately upstream of the 5-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 12 to 35 nucleobases). Other compounds are represented by oligonucleotide sequences that comprise at least the 8 consecutive nucleobases from the 3′-terminus of one of the illustrative antisense compounds (the remaining nucleobases being a consecutive stretch of the same oligonucleotide beginning immediately downstream of the 3′-terminus of the antisense compound which is specifically hybridizable to the target nucleic acid and continuing until the oligonucleotide contains about 12 to about 35 nucleobases). It is also understood that compounds may be represented by oligonucleotide sequences that comprise at least 8 consecutive nucleobases from an internal portion of the sequence of an illustrative compound, and may extend in either or both directions until the oligonucleotide contains about 12 to about 35 nucleobases.

Modifications can be made to the compounds of the instant invention and may include conjugate groups attached to one of the termini, selected nucleobase positions, sugar positions or to one of the internucleoside linkages. Possible modifications include, but are not limited to, 2′-F and 2′-OMethyl sugar modifications, inverted abasic caps, deoxynucleobases, and nucleobase analogs such as locked nucleic acids (LNA).

In one embodiment of the invention, double-stranded antisense compounds encompass short interfering RNAs (siRNAs). As used herein, the term “siRNA” is defined as a double-stranded compound having a first and second strand, each strand having a central portion and two independent terminal portions. The central portion of the first strand is complementary to the central portion of the second strand, allowing hybridization of the strands. The terminal portions are independently, optionally complementary to the corresponding terminal portion of the complementary strand. The ends of the strands may be modified by the addition of one or more natural or modified nucleobases to form an overhang. In one nonlimiting example, the first strand of the siRNA is antisense to the target nucleic acid, while the second strand is complementary to the first strand. Once the antisense strand is designed to target a particular nucleic acid target, the sense strand of the siRNA can then be designed and synthesized as the complement of the antisense strand and either strand may contain modifications or additions to either terminus. For example, in one embodiment, both strands of the siRNA duplex would be complementary over the central nucleobases, each having overhangs at one or both termini. It is possible for one end of a duplex to be blunt and the other to have overhanging nucleobases. In one embodiment, the number of overhanging nucleobases is from 1 to 6 on the 3′ end of each strand of the duplex. In another embodiment, the number of overhanging nucleobases is from 1 to 6 on the 3′ end of only one strand of the duplex. In a further embodiment, the number of overhanging nucleobases is from 1 to 6 on one or both 5′ ends of the duplexed strands. In another embodiment, the number of overhanging nucleobases is zero. In a preferred embodiment, each of the strands is 19 nucleobases in length, fully hybridizable with the complementary strand, and includes no overhangs.

Each strand of the siRNA duplex may be from about 12 to about 35 nucleobases. In a preferred embodiment, each strand of the siRNA duplex is about 17 to about 25 nucleobases. The central complementary portion may be from about 12 to about 35 nucleobases in length. In a preferred embodiment, the central complimentary portion is about 17 to about 25 nucleobases in length. It is understood that each the strand of the siRNA duplex and the central complementary portion may be about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleobases in length. The terminal portions can be from 1 to 6 nucleobases. It is understood that the terminal portions can be about 1, 2, 3, 4, 5, or 6 nucleobases in length. The siRNAs may also have no terminal portions. The two strands of an siRNA can be linked internally leaving free 3′ or 5′ termini, or can be linked to form a continuous hairpin structure or loop. The hairpin structure may contain an overhang on either the 5′ or 3′ terminus producing an extension of single-stranded character.

Double-stranded compounds can be made to include chemical modifications as discussed herein.

Chemical Modifications

As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base (sometimes referred to as a “nucleobase” or simply a “base”). The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2′, 3′ or 5′ hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3′ to 5′ phosphodiester linkage. It is often preferable to include chemical modifications in oligonucleotides to alter their activity. Chemical modifications can alter oligonucleotide activity by, for example: increasing affinity of an antisense oligonucleotide for its target RNA, increasing nuclease resistance, and/or altering the pharmacokinetics of the oligonucleotide. The use of chemistries that increase the affinity of an oligonucleotide for its target can allow for the use of shorter oligonucleotide compounds.

The term “nucleobase” or “heterocyclic base moiety” as used herein, refers to the heterocyclic base portion of a nucleoside. In general, a nucleobase is any group that contains one or more atom or groups of atoms capable of hydrogen bonding to a base of another nucleic acid. In addition to “unmodified” or “natural” nucleobases such as the purine nucleobases adenine (A) and guanine (G), and the pyrimidine nucleobases thymine (T), cytosine (C) and uracil (U), many modified nucleobases or nucleobase mimetics known to the art skilled are amenable to the present invention. The terms modified nucleobase and nucleobase mimetic can overlap but generally a modified nucleobase refers to a nucleobase that is fairly similar in structure to the parent nucleobase such as for example a 7-deaza purine or a 5-methyl cytosine whereas a nucleobase mimetic would include more complicated structures such as for example a tricyclic phenoxazine nucleobase mimetic. Methods for preparation of the above noted modified nucleobases are well known to those skilled in the art.

Oligomeric compounds of the present invention may also contain one or more nucleosides having modified sugar moieties. The furanosyl sugar ring of a nucleoside can be modified in a number of ways including, but not limited to, addition of a substituent group, bridging of two non-geminal ring atoms to form a bicyclic nucleic acid (BNA) and substitution of an atom or group such as —S—, —N(R)— or —C(R1)(R2) for the ring oxygen at the 4′-position. Modified sugar moieties are well known and can be used to alter, typically increase, the affinity of the oligomeric compound for its target and/or increase nuclease resistance. A representative list of preferred modified sugars includes but is not limited to bicyclic modified sugars (BNA's), including LNA and ENA (4′-(CH2)2—O-2′ bridge); and substituted sugars, especially 2′-substituted sugars having a 2′-F, 2′-OCH2 or a 2′-O(CH2)2—OCH3 substituent group. Sugars can also be replaced with sugar mimetic groups among others. Methods for the preparations of modified sugars are well known to those skilled in the art.

The present invention includes internucleoside linking groups that link the nucleosides or otherwise modified monomer units together thereby forming an oligomeric compound. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (—CH2—N(CH3)—O—CH2—), thiodiester (—O—C(O)—S—), thionocarbamate (—O—C(O)(NH)—S—); siloxane (—O—Si(H)2-O—); and N,N′-dimethylhydrazine (—CH2—N(CH3)—N(CH3)—). Oligomeric compounds having non-phosphorus internucleoside linking groups are referred to as oligonucleosides. Modified internucleoside linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligomeric compound. Internucleoside linkages having a chiral atom can be prepared racemic, chiral, or as a mixture. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known to those skilled in the art.

As used herein the term “mimetic” refers to groups that are substituted for a sugar, a nucleobase, and/or internucleoside linkage. Mimetics are groups that are structurally quite different (not simply a modification) but functionally similar to the linked nucleosides of oligonucleotides. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target. Representative examples of a sugar mimetic include, but are not limited to, cyclohexenyl or morpholino. Representative examples of a mimetic for a sugar-internucleoside linkage combination include, but are not limited to, peptide nucleic acids (PNA) and morpholino groups linked by uncharged achiral linkages. In some instances a mimetic is used in place of the nucleobase. Representative nucleobase mimetics are well known in the art and include, but are not limited to, tricyclic phenoxazine analogs and universal bases (Berger et al., Nuc Acid Res. 2000, 28:2911-14, incorporated herein by reference). Methods of synthesis of sugar, nucleoside and nucleobase mimetics are well known to those skilled in the art.

As used herein the term “nucleoside” includes, nucleosides, abasic nucleosides, modified nucleosides, and nucleosides having mimetic bases and/or sugar groups.

In the context of this invention, the term “oligonucleotide” refers to an oligomeric compound which is an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). This term includes oligonucleotides composed of naturally- and non-naturally-occurring nucleobases, sugars and covalent internucleoside linkages, possibly further including non-nucleic acid conjugates.

The present invention provides compounds having reactive phosphorus groups useful for forming internucleoside linkages including for example phosphodiester and phosphorothioate internucleoside linkages. Methods of preparation and/or purification of precursors or oligomeric compounds of the instant invention are not a limitation of the compositions or methods of the invention. Methods for synthesis and purification of DNA, RNA, and the oligomeric compounds of the instant invention are well known to those skilled in the art.

As used herein the term “chimeric oligomeric compound” refers to an oligomeric compound having at least one sugar, nucleobase and/or internucleoside linkage that is differentially modified as compared to the other sugars, nucleobases and internucleoside linkages within the same oligomeric compound. The remainder of the sugars, nucleobases and internucleoside linkages can be independently modified or unmodified provided that they are distinguishable from the differentially modified moiety or moieties. In general a chimeric oligomeric compound will have modified nucleosides that can be in isolated positions or grouped together in regions that will define a particular motif. Any combination of modifications and or mimetic groups can comprise a chimeric oligomeric compound of the present invention.

Chimeric oligomeric compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the oligomeric compound may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of inhibition of gene expression. Consequently, comparable results can often be obtained with shorter oligomeric compounds when chimeras are used, compared to for example phosphorothioate deoxyoligonucleotides hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

Certain chimeric as well as non-chimeric oligomeric compounds can be further described as having a particular motif. As used in the present invention the term “motif” refers to the orientation of modified sugar moieties and/or sugar mimetic groups in an oligomeric compound relative to like or differentially modified or unmodified nucleosides. As used in the present invention, the terms “sugars”, “sugar moieties” and “sugar mimetic groups’ are used interchangeably. Such motifs include, but are not limited to, gapped motifs, alternating motifs, fully modified motifs, hemimer motifs, blockmer motifs, and positionally modified motifs. The sequence and the structure of the nucleobases and type of internucleoside linkage is not a factor in determining the motif of an oligomeric compound.

As used in the present invention the term “gapped motif” refers to an oligomeric compound comprising a contiguous sequence of nucleosides that is divided into 3 regions, an internal region (gap) flanked by two external regions (wings). The regions are differentiated from each other at least by having differentially modified sugar groups that comprise the nucleosides. In some embodiments, each modified region is uniformly modified (e.g. the modified sugar groups in a given region are identical); however, other motifs can be applied to regions. For example, the wings in a gapmer could have an alternating motif. The internal region or the gap may, in some instances, comprise uniform unmodified β-D-ribonucleosides or β-D-deoxyribonucleosides or can be a sequence of nucleosides having uniformly modified sugars. The nucleosides located in the gap of a gapped oligomeric compound have sugar moieties that are different than the modified sugar moieties in each of the wings.

As used in the present invention the term “alternating motif” refers to an oligomeric compound comprising a contiguous sequence of nucleosides comprising two differentially sugar modified nucleosides that alternate for essentially the entire sequence of the oligomeric compound, or for essentially the entire sequence of a region of an oligomeric compound. The pattern of alternation can be described by the formula: 5′-A(-L-B-L-A)n(-L-B)nn-3′ where A and B are nucleosides differentiated by having at least different sugar groups, each L is an internucleoside linking group, nn is preferably 0 or 1 and n is preferably from about 5 to about 11; however, the number may be larger than about 11. This formula also allows for even and odd lengths for alternating oligomeric compounds wherein the 3′ and 5′-terminal nucleosides are the same (odd) or different (even).

As used in the present invention the term “fully modified motif” refers to an oligomeric compound comprising a contiguous sequence of nucleosides wherein essentially each nucleoside is a sugar modified nucleoside having uniform modification.

As used in the present invention the term “hemimer motif” refers to a sequence of nucleosides that have uniform sugar moieties (identical sugars, modified or unmodified) and wherein one of the 5′-end or the 3′-end has a sequence of from 2 to 12 nucleosides that are sugar modified nucleosides that are different from the other nucleosides in the hemimer modified oligomeric compound. An example of a typical hemimer is an oligomeric compound comprising β-D-deoxyribonucleosides having a contiguous sequence of sugar modified nucleosides at one of the termini.

As used in the present invention the term “blockmer motif” refers to a sequence of nucleosides that have uniform sugars (identical sugars, modified or unmodified) that is internally interrupted by a block of sugar modified nucleosides that are uniformly modified and wherein the modification is different from the other nucleosides. In one aspect of the present invention oligomeric compounds having a blockmer motif comprise a sequence of β-D-deoxyribonucleosides having one internal block of from 2 to 6 sugar modified nucleosides. The internal block region can be at any position within the oligomeric compound as long as it is not at one of the termini which would then make it a hemimer. Methods of preparation of chimeric oligonucleotide compounds are well known to those skilled in the art.

As used in the present invention the term “positionally modified motif” comprises all other motifs. Methods of preparation of positionally modified oligonucleotide compounds are well known to those skilled in the art.

The compounds described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), α or β, or as (D) or (L) such as for amino acids et al. The present invention is meant to include all such possible isomers, as well as their racemic and optically pure forms.

In one aspect of the present invention oligomeric compounds are modified by covalent attachment of one or more conjugate groups. Conjugate groups may be attached by reversible or irreversible attachments. Conjugate groups may be attached directly to oligomeric compounds or by use of a linker. Linkers may be mono- or bifunctional linkers. Such attachment methods and linkers are well known to those skilled in the art. In general, conjugate groups are attached to oligomeric compounds to modify one or more properties. Such considerations are well known to those skilled in the art.

Oligomer Synthesis

Oligomerization of modified and unmodified nucleosides can be routinely performed according to literature procedures for DNA (Protocols for Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press) and/or RNA (Scaringe, Methods (2001), 23, 206-217. Gait et al., Applications of Chemically synthesized RNA in RNA: Protein Interactions, Ed. Smith (1998), 1-36. Gallo et al., Tetrahedron (2001), 57, 5707-5713).

Oligomeric compounds of the present invention can be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives. The invention is not limited by the method of oligomer synthesis.

Oligomer Purification and Analysis

Methods of oligonucleotide purification and analysis are known to those skilled in the art. Analysis methods include capillary electrophoresis (CE) and electrospray-mass spectroscopy. Such synthesis and analysis methods can be performed in multi-well plates. The method of the invention is not limited by the method of oligomer purification.

Hybridization

“Hybridization” means the pairing of complementary strands of oligomeric compounds. While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Hybridization can occur under varying circumstances.

An oligomeric compound is specifically hybridizable when there is a sufficient degree of complementarity to avoid non-specific binding of the oligomeric compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.

“Stringent hybridization conditions” or “stringent conditions” refers to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances, and “stringent conditions” under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.

“Complementarity,” as used herein, refers to the capacity for precise pairing between two nucleobases on one or two oligomeric compound strands. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligomeric compound and the further DNA or RNA are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligomeric compound and a target nucleic acid.

Identity

Oligomeric compounds, or a portion thereof, may have a defined percent identity to a SEQ ID NO, or a compound having a specific Isis number. As used herein, a sequence is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in the disclosed sequences of the instant invention would be considered identical as they both pair with adenine. Similarly, a G-clamp modified heterocyclic base would be considered identical to a cytosine or a 5-Me cytosine in the sequences of the instant application as it pairs with a guanine. This identity may be over the entire length of the oligomeric compound, or in a portion of the oligomeric compound (e.g., nucleobases 1-20 of a 27-mer may be compared to a 20-mer to determine percent identity of the oligomeric compound to the SEQ ID NO.) It is understood by those skilled in the art that an oligonucleotide need not have an identical sequence to those described herein to function similarly to the oligonucleotides described herein. Shortened (i.e., deleted, and therefore non-identical) versions of oligonucleotides taught herein, or non-identical (e.g., one base replaced with another with non-identical nucleobase pairing, or abasic site) versions of the oligonucleotides taught herein fall within the scope of the invention. Percent identity is calculated according to the number of bases that have identical base pairing corresponding to the SEQ ID NO or compound to which it is being compared. The non-identical bases may be adjacent to each other, dispersed through out the oligonucleotide, or both.

For example, a 16-mer having the same sequence as nucleobases 2-17 of a 20-mer is 80% identical to the 20-mer. Alternatively, a 20-mer containing four nucleobases not identical to the 20-mer is also 80% identical to the 20-mer. A 14-mer having the same sequence as nucleobases 1-14 of an 18-mer is 78% identical to the 18-mer. Such calculations are well within the ability of those skilled in the art.

The percent identity is based on the percent of nucleobases in the original sequence present in a portion of the modified sequence. Therefore, a 30 nucleobase oligonucleotide comprising the full sequence of a 20 nucleobase SEQ ID NO would have a portion of 100% identity with the 20 nucleobase SEQ ID NO while further comprising an additional 10 nucleobase portion. In the context of the invention, the full length of the modified sequence may constitute a single portion. In a preferred embodiment, the oligonucleotides of the instant invention are at least about 80%, more preferably at least about 85%, most preferably at least about 90% identical to the active target segments and/or oligonucleotides presented herein.

It is well known by those skilled in the art that it is possible to increase or decrease the length of an antisense oligonucleotide and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309. 1992, incorporated herein by reference), a series of oligomers 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotide were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the oligonucleotide that contained no mismatches. Similarly, target specific cleavage was achieved using a 13 nucleobase oligomer, including those with 1 or 3 mismatches. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358.1988, incorporated herein by reference) tested a series of tandem 14 nucleobase oligonucleotides, and a 28 and 42 nucleobase oligonucleotide comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone were able to inhibit translation, albeit at a more modest level, than the 28 or 42 nucleobase oligonucleotide.

Target Nucleic Acids

“Targeting” an oligomeric compound to a particular target nucleic acid molecule can be a multistep process. The process usually begins with the identification of a target nucleic acid whose expression is to be modulated. For example, the target nucleic acid can be a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. As disclosed herein, the target nucleic acid encodes IL-4R alpha.

Target Regions, Segments, and Sites

The targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect, e.g., modulation of expression, will result. “Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Target regions include, but are not limited to translation initiation and termination regions, coding regions, open reading frames, introns, exons, 3′-untranslated regions (3′-UTR), and 5′-untranslated regions (5′-UTR). Within regions of target nucleic acids are segments. “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid such as stop codons and start codons. “Sites,” as used in the present invention, are defined as unique nucleobase positions within a target nucleic acid such as splice junctions. Such regions, segments, and sites are well known to those skilled in the art.

Variants

It is also known in the art that alternative RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as “variants.” More specifically, “pre-mRNA variants” are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence. Variants can result in mRNA variants including, but not limited to, those with alternate splice junctions, or alternate initiation and termination codons. Variants in genomic and mRNA sequences can result in disease. Oligonucleotides to such variants are within the scope of the instant invention.

Target Names, Synonyms, Features

In accordance with the present invention are compositions and methods for modulating the expression of IL 4R-α (also known as Interleukin 4 alpha receptor; CD124; IL-4Ra; interleukin 4 receptor alpha chain). Table 1 lists the GenBank accession numbers of sequences corresponding to nucleic acid molecules encoding IL 4R-α (nt=nucleotide), the date the version of the sequence was entered in GenBank, and the corresponding SEQ ID NO in the instant application, when assigned, each of which is incorporated herein by reference.

TABLE 1
Gene Targets
Species Genbank # Genbank Date SEQ ID NO
Human BM738518.1 1 Mar. 2002
Human nt 18636000 to 18689000 of 19 Feb. 2004
NT_010393.14
Human X52425.1 26 May 1992 1
Mouse AF000304.1 1 Dec. 1997
Mouse assembled from M64868.1 Both 6 May 1996
and M64879.1
Mouse BB867141.1 9 Jul. 2003
Mouse BC012309.1 3 Jan. 2005
Mouse M27959.1 16 Sep. 1994
Mouse M27960.1 12 Jun. 1993 2
Mouse M29854.1 12 Jun. 1993

Modulation of Target Expression

Modulation of expression of a target nucleic acid can be achieved through alteration of any number of nucleic acid (DNA or RNA) functions. “Modulation” means a perturbation of function, for example, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in expression. As another example, modulation of expression can include perturbing splice site selection of pre-mRNA processing. “Expression” includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. These structures include the products of transcription and translation. “Modulation of expression” means the perturbation of such functions. The functions of RNA to be modulated can include translocation functions, which include, but are not limited to, translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, and translation of protein from the RNA. RNA processing functions that can be modulated include, but are not limited to, splicing of the RNA to yield one or more RNA species, capping of the RNA, 3′ maturation of the RNA and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA. Modulation of expression can result in the increased level of one or more nucleic acid species or the decreased level of one or more nucleic acid species, either temporally or by net steady state level. One result of such interference with target nucleic acid function is modulation of the expression of IL 4R-α. Thus, in one embodiment modulation of expression can mean increase or decrease in target RNA or protein levels. In another embodiment modulation of expression can mean an increase or decrease of one or more RNA splice products, or a change in the ratio of two or more splice products.

The effect of oligomeric compounds of the present invention on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. The effect of oligomeric compounds of the present invention on target nucleic acid expression can be routinely determined using, for example, PCR or Northern blot analysis. Cell lines are derived from both normal tissues and cell types and from cells associated with various disorders (e.g. hyperproliferative disorders). Cell lines derived from multiple tissues and species can be obtained from American Type Culture Collection (ATCC, Manassas, Va.) and are well known to those skilled in the art. Primary cells, or those cells which are isolated from an animal and not subjected to continuous culture, can be prepared according to methods known in the art or obtained from various commercial suppliers. Additionally, primary cells include those obtained from donor human subjects in a clinical setting (i.e. blood donors, surgical patients). Primary cells prepared by methods known in the art.

Assaying Modulation of Expression

Modulation of IL 4R-α expression can be assayed in a variety of ways known in the art. IL 4R-α mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA by methods known in the art. Methods of RNA isolation are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.1.1-4.2.9 and 4.5.1-4.5.3, John Wiley & Sons, Inc., 1993.

Northern blot analysis is routine in the art and is taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 1, pp. 4.2.1-4.2.9, John Wiley & Sons, Inc., 1996. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM™ 7700 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions. The method of analysis of modulation of RNA levels is not a limitation of the instant invention.

Levels of a protein encoded by IL 4R-α can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), ELISA or fluorescence-activated cell sorting (FACS). Antibodies directed to a protein encoded by IL 4R-α can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional antibody generation methods. Methods for preparation of polyclonal antisera are taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. Preparation of monoclonal antibodies is taught in, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.1-11.11.5, John Wiley & Sons, Inc., 1997.

Immunoprecipitation methods are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley & Sons, Inc., 1998. Western blot (immunoblot) analysis is standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found at, for example, Ausubel, F. M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-11.2.22, John Wiley & Sons, Inc., 1991.

Validated Target Segments

The locations on the target nucleic acid to which active oligomeric compounds hybridize are herein below referred to as “validated target segments.” As used herein the term “validated target segment” is defined as at least an 8-nucleobase portion of a target region, preferably at least a 12-nucleobase portion of a target region, to which an active oligomeric compound is targeted. While not wishing to be bound by theory, it is presently believed that these target segments represent portions of the target nucleic acid which are accessible for hybridization.

Target segments can include DNA or RNA sequences that comprise at least the 8, preferably 12 consecutive nucleobases from the 5′-terminus of a validated target segment (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately upstream of the 5′-terminus of the target segment and continuing until the DNA or RNA contains about 12 to about 35 nucleobases). Similarly validated target segments are represented by DNA or RNA sequences that comprise at least the 8, preferably 12 consecutive nucleobases from the 3-terminus of a validated target segment (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately downstream of the 3′-terminus of the target segment and continuing until the DNA or RNA contains about 12 to about 35 nucleobases). It is also understood that a validated oligomeric target segment can be represented by DNA or RNA sequences that comprise at least 8, preferably 12 consecutive nucleobases from an internal portion of the sequence of a validated target segment, and can extend in either or both directions until the oligonucleotide contains about 12 to about 35 nucleobases.

Screening for Modulator Oligomeric Compounds

In another embodiment, the validated target segments identified herein can be employed in a screen for additional compounds that modulate the expression of IL 4R-α. “Modulators” are those compounds that modulate the expression of IL 4R-α and which comprise at least an 8-nucleobase portion which is complementary to a validated target segment. The screening method comprises the steps of contacting a validated target segment of a nucleic acid molecule encoding IL 4R-α with one or more candidate modulators, and selecting for one or more candidate modulators which perturb the expression of a nucleic acid molecule encoding IL 4R-α. Once it is shown that the candidate modulator or modulators are capable of modulating the expression of a nucleic acid molecule encoding IL 4R-α, the modulator can then be employed in further investigative studies of the function of IL 4R-α, or for use as a research, diagnostic, or therapeutic agent.

Modulator compounds of IL 4R-α can also be identified or further investigated using one or more phenotypic assays, each having measurable endpoints predictive of efficacy in the treatment of a particular disease state or condition. Phenotypic assays, kits and reagents for their use are well known to those skilled in the art.

Kits, Research Reagents, and Diagnostics

The oligomeric compounds of the present invention can be utilized for diagnostics, and as research reagents and kits. Furthermore, antisense compounds, which are able to inhibit gene expression with specificity, are often used by those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathway.

For use in kits and diagnostics, the oligomeric compounds of the present invention, either alone or in combination with other compounds or therapeutics, can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues. Methods of gene expression analysis are well known to those skilled in the art.

Therapeutics

Compounds of the invention can be used to modulate the expression of IL 4R-α in an animal, such as a human. In one non-limiting embodiment, the methods comprise the step of administering to said animal an effective amount of an antisense compound that inhibits expression of IL 4R-α. In one embodiment, the antisense compounds of the present invention effectively inhibit the levels or function of IL 4R-α RNA. Because reduction in IL 4R-α mRNA levels can lead to alteration in IL 4R-α protein products of expression as well, such resultant alterations can also be measured. Antisense compounds of the present invention that effectively inhibit the level or function of IL 4R-α RNA or protein products of expression is considered an active antisense compound. In one embodiment, the antisense compounds of the invention inhibit the expression of IL 4R-α causing a reduction of RNA by at least 10%, by at least 20%, by at least 25%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 98%, by at least 99%, or by 100%.

For example, the reduction of the expression of IL 4R-α can be measured in a bodily fluid, tissue or organ of the animal. Methods of obtaining samples for analysis, such as body fluids (e.g., sputum), tissues (e.g., biopsy), or organs, and methods of preparation of the samples to allow for analysis are well known to those skilled in the art. Methods for analysis of RNA and protein levels are discussed above and are well known to those skilled in the art. The effects of treatment can be assessed by measuring biomarkers associated with the target gene expression in the aforementioned fluids, tissues or organs, collected from an animal contacted with one or more compounds of the invention, by routine clinical methods known in the art. These biomarkers include but are not limited to: liver transaminases, bilirubin, albumin, blood urea nitrogen, creatine and other markers of kidney and liver function; interleukins, tumor necrosis factors, intracellular adhesion molecules, C-reactive protein and other markers of inflammation.

The compounds of the present invention can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier. Acceptable carriers and dilutents are well known to those skilled in the art. Selection of a dilutent or carrier is based on a number of factors, including, but not limited to, the solubility of the compound and the route of administration. Such considerations are well understood by those skilled in the art. In one aspect, the compounds of the present invention inhibit the expression of IL 4R-α. The compounds of the invention can also be used in the manufacture of a medicament for the treatment of diseases and disorders related to IL 4R-α expression.

Methods whereby bodily fluids, organs or tissues are contacted with an effective amount of one or more of the antisense compounds or compositions of the invention are also contemplated. Bodily fluids, organs or tissues can be contacted with one or more of the compounds of the invention resulting in modulation of IL 4R-α expression in the cells of bodily fluids, organs or tissues. An effective amount can be determined by monitoring the modulatory effect of the antisense compound or compounds or compositions on target nucleic acids or their products by methods routine to the skilled artisan.

Thus, provided herein is the use of an isolated single- or double-stranded oligomeric compound targeted to IL 4R-α in the manufacture of a medicament for the treatment of a disease or disorder by means of the method described above. In a preferred embodiment, the oligomeric compound is a single stranded compound.

Salts, Prodrugs and Bioequivalents

The oligomeric compounds of the present invention comprise any pharmaceutically acceptable salts, esters, or salts of such esters, or any other functional chemical equivalent which, upon administration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the oligomeric compounds of the present invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.

The term “prodrug” indicates a therapeutic agent that is prepared in an inactive or less active form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes, chemicals, and/or conditions. In particular, prodrug versions of the oligonucleotides of the invention are prepared as SATE ((S-acetyl-2-thioethyl)phosphate) derivatives according to the methods disclosed in WO 93/24510 or WO 94/26764. Prodrugs can also include oligomeric compounds wherein one or both ends comprise nucleobases that are cleaved (e.g., phosphodiester backbone linkages) to produce the active compound.

The term “pharmaceutically acceptable salts” refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. Sodium salts of antisense oligonucleotides are useful and are well accepted for therapeutic administration to humans. In another embodiment, sodium salts of dsRNA compounds are also provided.

Formulations

The oligomeric compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds.

The present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. In a preferred embodiment, administration is topical to the surface of the respiratory tract, particularly pulmonary, e.g., by nebulization, inhalation, or insufflation of powders or aerosols, by mouth and/or nose.

The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers, finely divided solid carriers, or both, and then, if necessary, shaping the product (e.g., into a specific particle size for delivery). In a preferred embodiment, the pharmaceutical formulations of the instant invention are prepared for pulmonary administration in an appropriate solvent, e.g., water or normal saline, possibly in a sterile formulation, with carriers or other agents to allow for the formation of droplets of the desired diameter for delivery using inhalers, nasal delivery devices, nebulizers, and other devices for pulmonary delivery. Alternatively, the pharmaceutical formulations of the instant invention may be formulated as dry powders for use in dry powder inhalers.

A “pharmaceutical carrier” or “excipient” can be a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal and are known in the art. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition.

Combinations

Compositions of the invention can contain two or more oligomeric compounds. In another related embodiment, compositions of the present invention can contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Alternatively, compositions of the present invention can contain two or more antisense compounds targeted to different regions of the same nucleic acid target. Two or more combined compounds may be used together or sequentially. Compositions of the instant invention can also be combined with other non-oligomeric compound therapeutic agents.

Nonlimiting Disclosure and Incorporation by Reference

While certain compounds, compositions and methods of the present invention have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds of the invention and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.

EXAMPLE 1 Cell Types

The effect of oligomeric compounds on target nucleic acid expression was tested in the following cell types.

A549:

The human lung carcinoma cell line A549 was obtained from the American Type Culture Collection (Manassas, Va.). A549 cells were routinely cultured in DMEM, high glucose (Invitrogen Life Technologies, Carlsbad, Calif.) supplemented with 10% fetal bovine serum, 100 units per ml penicillin, and 100 micrograms per ml streptomycin (Invitrogen Life Technologies, Carlsbad, Calif.). Cells were routinely passaged by trypsinization and dilution when they reached approximately 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of approximately 5000 cells/well for use in oligomeric compound transfection experiments.

b.END:

The mouse brain endothelial cell line b.END was obtained from Dr. Werner Risau at the Max Plank Institute (Bad Nauheim, Germany). b.END cells were routinely cultured in DMEM, high glucose (Invitrogen Life Technologies, Carlsbad, Calif.) supplemented with 10% fetal bovine serum (Invitrogen Life Technologies, Carlsbad, Calif.). Cells were routinely passaged by trypsinization and dilution when they reached approximately 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #353872, BD Biosciences, Bedford, Mass.) at a density of approximately 3000 cells/well for use in oligomeric compound transfection experiments.

Treatment with Oligomeric Compounds

When cells reach appropriate confluency, they are treated with oligonucleotide using a transfection lipid and method, such as Lipofectin™ essentially by the manufacturer's instructions, as described.

When cells reached 65-75% confluency, they were treated with oligonucleotide. Oligonucleotide was mixed with LIPOFECTIN™ Invitrogen Life Technologies, Carlsbad, Calif.) in Opti-MEM™-1 reduced serum medium (Invitrogen Life Technologies, Carlsbad, Calif.) to achieve the desired concentration of oligonucleotide and a LIPOFECTIN™ concentration of 2.5 or 3 μg/mL per 100 nM oligonucleotide. This transfection mixture was incubated at room temperature for approximately 0.5 hours. For cells grown in 96-well plates, wells were washed once with 100 μL OPTI-MEM™-1 and then treated with 130 μL of the transfection mixture. Cells grown in 24-well plates or other standard tissue culture plates are treated similarly, using appropriate volumes of medium and oligonucleotide. Cells are treated and data are obtained in duplicate or triplicate. After approximately 4-7 hours of treatment at 37° C., the medium containing the transfection mixture was replaced with fresh culture medium. Cells were harvested 16-24 hours after oligonucleotide treatment.

Other transfection reagents and methods (e.g., electroporation) for delivery of oligonucleotides to the cell are well known. The method of delivery of oligonucleotide to the cells is not a limitation of the instant invention.

Control Oligonucleotides

Control oligonucleotides are used to determine the optimal oligomeric compound concentration for a particular cell line. Furthermore, when oligomeric compounds of the invention are tested in oligomeric compound screening experiments or phenotypic assays, control oligonucleotides are tested in parallel with compounds of the invention.

The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. The concentration of positive control oligonucleotide that results in 80% inhibition of the target mRNA is then utilized as the screening concentration for new oligonucleotides in subsequent experiments for that cell line. If 80% inhibition is not achieved, the lowest concentration of positive control oligonucleotide that results in 60% inhibition of the target mRNA is then utilized as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligonucleotide transfection experiments. The concentrations of antisense oligonucleotides used herein are from 50 nM to 300 nM when the antisense oligonucleotide is transfected using a liposome reagent and 1 μM to 40 μM when the antisense oligonucleotide is transfected by electroporation.

EXAMPLE 2 Real-Time Quantitative PCR Analysis of IL 4R-α mRNA Levels

Quantitation of IL 4R-α mRNA levels was accomplished by real-time quantitative PCR using the ABI PRISM™ 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions.

Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured were evaluated for their ability to be “multiplexed” with a GAPDH amplification reaction. After isolation the RNA is subjected to sequential reverse transcriptase (RT) reaction and real-time PCR, both of which are performed in the same well. RT and PCR reagents were obtained from Invitrogen Life Technologies (Carlsbad, Calif.). RT, real-time PCR was carried out in the same by adding 20 μL PCR cocktail (2.5×PCR buffer minus MgCl2, 6.6 mM MgCl2, 375 μM each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM® Taq, 5 Units MuLV reverse transcriptase, and 2.5×ROX dye) to 96-well plates containing 30 μL total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48° C. Following a 10 minute incubation at 95° C. to activate the PLATINUM® Taq, 40 cycles of a two-step PCR protocol were carried out: 95° C. for 15 seconds (denaturation) followed by 60° C. for 1.5 minutes (annealing/extension).

Gene target quantities obtained by RT, real-time PCR were normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreen™ (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression was quantified by RT, real-time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA was quantified using RiboGreen™ RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.).

170 μL of RiboGreen™ working reagent (RiboGreen™ reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) was pipetted into a 96-well plate containing 30 μL purified cellular RNA. The plate was read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485 nm and emission at 530 nm.

The GAPDH PCR probes have JOE covalently linked to the 5′ end and TAMRA or MGB covalently linked to the 3′ end, where JOE is the fluorescent reporter dye and TAMRA or MGB is the quencher dye. In some cell types, primers and probe designed to a GAPDH sequence from a different species are used to measure GAPDH expression. For example, a human GAPDH primer and probe set is used to measure GAPDH expression in monkey-derived cells and cell lines.

Probes and primers for use in real-time PCR were designed to hybridize to target-specific sequences. The primers and probes and the target nucleic acid sequences to which they hybridize are presented in Table 2. The target-specific PCR probes have FAM covalently linked to the 5′ end and TAMRA or MGB covalently linked to the 3′ end, where FAM is the fluorescent dye and TAMRA or MGB is the quencher dye.

TABLE 2
Gene target-specific primers and probes
for use in real-time PCR
Target SEQ
Target SEQ ID Sequence ID
Name Species NO Description Sequence (5′ to 3′) NO
IL-4R alpha Human 1 Fwd Primer AATGGTCCCACCAATTGCA 3
IL-4R alpha Human 1 Reverse Primer CTCCGTTGTTCTCAGGGATACAC 4
IL-4R alpha Human 1 Probe TTTTTCTGCTCTCCGAAGCCC 5
IL-4R alpha Mouse 2 Fwd Primer TCCCATTTTGTCCACCGAATA 6
IL-4R alpha Mouse 2 Reverse Primer GTTTCTAGGCCCAGCTTCCA 7
IL-4R alpha Mouse 2 Probe TGTCACTCAAGGCTCTCAGCGGTCC 8

EXAMPLE 3 Antisense Inhibition of Mouse IL-4R Alpha by Oligomeric Compounds

A series of oligomeric compounds was designed to target different regions of mouse IL 4R-α RNA, using published sequences cited in Table 1. The compounds are shown in Table 3. All compounds in Table 3 are chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of 10 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′) by five-nucleotide “wings”. The wings are composed of 2′-O-(2-methoxyethyl) nucleotides, also known as 2′-MOE nucleotides. The internucleoside (backbone) linkages are phosphorothioate throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The compounds were analyzed for their effect on gene target mRNA levels by quantitative real-time PCR as described in other examples herein, using the target-specific primers and probes shown in Table 2. Data are averages from two experiments in which b.END cells were treated with 150 nM of the compounds in Table 3 using Lipofectin™. A reduction in expression is expressed as percent inhibition in Table 3. If the target expression level of oligomeric compound-treated cell was higher than control, percent inhibition is expressed as zero inhibition. The target regions to which these oligomeric compounds are inhibitory are herein referred to as “validated target segments.”

TABLE 3
Inhibition of mouse IL 4R-α mRNA levels by chimeric
oligonucleotides having 2′-MOE wings and deoxy gap
Target SEQ
SEQ ID/ Target % ID
ISIS # GenBank Site Sequence (5′ to 3′) Inhib NO
231931 Assm.fr. 1364 ACCCGCACAAGGTCCTGGGC 20 9
M64868.1/
M64879.1
231932 Assm.fr. 2204 CAGGTCTTACCATTACCACT 33 10
M64868.1/
M64879.1
231933 Assm.fr. 2506 GCCCACTCACTTCTGCAGGG 50 11
M64868.1/
M64879.1
231934 Assm.fr. 2804 CGGTTGTACCACGTGATGCT 51 12
M64868.1/
M64879.1
231935 Assm.fr. 2813 TGATACTCACGGTTGTACCA 29 13
M64868.1/
M64879.1
231936 Assm.fr. 3327 AGGAACTCACTTGGTAATGC 9 14
M64868.1/
M64879.1
231937 Assm.fr. 3559 TGTACCCTCTTACCTGTGCA 30 15
M64868.1/
M64879.1
231929 BB867141.1 49 CAAAAGGTGCCTGCGAGTTC 19 16
231930 BC012309.1 101 GGCTGGGTTACAGGAACAAG 0 17
231928 M27959.1 900 AGCTGGAAGTGGTTGTACCA 23 18
231860 2 78 AATCAGAAGCCAGGTCCCTC 66 19
231861 2 209 CAAAAGGTGCCTGCACAAGG 34 20
231862 2 233 TGCAAAGCCGCCCCATTGGG 66 21
231863 2 244 CAGGAACTTGGTGCAAAGCC 60 22
231864 2 330 TAGTCAGAGAAGCAGGTGGG 44 23
231865 2 340 AGTGCGGATGTAGTCAGAGA 39 24
231866 2 388 CTGAGAACTGCAGTCCACAG 58 25
231867 2 438 GTGAGGTTTTCAGAGAACTC 28 26
231868 2 443 TGCATGTGAGGTTTTCAGAG 48 27
231869 2 611 GTGTGAGGTTGTCTGGAGCT 63 28
231870 2 624 ACATTGGTGTGGAGTGTGAG 38 29
231871 2 716 CTCTGGAGATGTTGACCATG 48 30
231872 2 721 GTCCTCTCTGGAGATGTTGA 43 31
231873 2 726 GGGTTGTCCTCTCTGGAGAT 32 32
231874 2 758 TGTAGGTCACATTATAGACT 66 33
231875 2 891 GGGTTGTACCACGTGATGCT 27 34
231876 2 918 TCACTCAGTCACAGATTTTC 70 35
231877 2 1014 AGCTGGAAGTCCATCTCCTG 23 36
231878 2 1114 CTTCTTAATCTTGGTAATGC 40 37
231879 2 1121 ACCATATCTTCTTAATCTTG 25 38
231880 2 1126 GTCCCACCATATCTTCTTAA 11 39
231881 2 1131 ATCTGGTCCCACCATATCTT 36 40
231882 2 1136 TGGGAATCTGGTCCCACCAT 43 41
231883 2 1225 GGTTGACTCCTGGCTTCGGG 7 42
231884 2 1385 GGACGGTCCTGCTGACCTCC 65 43
231885 2 1390 CCAGAGGACGGTCCTGCTGA 55 44
231886 2 1395 TCTGGCCAGAGGACGGTCCT 65 45
231887 2 1424 TACAGCGCACCACACTGACA 80 46
231888 2 1430 GCTCCATACAGCGCACCACA 72 47
231889 2 1435 AAACAGCTCCATACAGCGCA 77 48
231890 2 1440 GCCTCAAACAGCTCCATACA 58 49
231891 2 1460 CCTCCACATTCTGTACTGGG 75 50
231892 2 1505 CAGGTGACATGCTCAGGTCC 63 51
231893 2 1510 GTTCTCAGGTGACATGCTCA 68 52
231894 2 1515 CCGCTGTTCTCAGGTGACAT 88 53
231895 2 1575 AACAGGTTCTCAGTGAGCCG 62 54
231896 2 1834 CCGGTAGGCAGGATTGTCTG 62 55
231897 2 1839 AAACTCCGGTAGGCAGGATT 68 56
231898 2 1844 CACTAAAACTCCGGTAGGCA 71 57
231899 2 1880 CCAGCTCTCCAGGATTTGGG 68 58
231900 2 1960 TGGTGGCCCTGAAGAATGGG 30 59
231901 2 1991 GGATCTGCTCCCAGCTCTCC 85 60
231902 2 1996 GTGAAGGATCTGCTCCCAGC 80 61
231903 2 2001 CTCATGTGAAGGATCTGCTC 69 62
231904 2 2006 GGACACTCATGTGAAGGATC 52 63
231905 2 2011 CTGCAGGACACTCATGTGAA 67 64
231906 2 2079 TTCACTGCCTGCACAAACTC 60 65
231907 2 2084 CCTGCTTCACTGCGTGCACA 72 66
231908 2 2166 CTGCTGAGCAGGCTCGAGAA 51 67
231909 2 2437 GTCATCCCCAAAGGGCTTGG 69 68
231910 2 2442 CCCAGGTCATCCCCAAAGGG 71 69
231911 2 2469 GTGAGGGACGAGTACACAAT 68 70
231912 2 2497 TTGCTTCAGGTGGCCACACA 69 71
231913 2 2502 TGGTGTTGCTTCAGGTGGCC 71 72
231914 2 2507 GGCTGTGGTGTTGCTTCAGG 51 73
231915 2 2719 CTGGCTGGGAACAGGAGAGT 64 74
231916 2 2788 AGCAACAACAGCACACTCAC 78 75
231917 2 2793 ACCTCAGCAACAACAGCACA 82 76
231918 2 2798 CACAGACCTCAGCAACAACA 78 77
231919 2 2827 TCCCTGGCTTGGAGGAACCC 62 78
231920 2 2859 CCTGCCAGCTGGGCTGTCTC 66 79
231921 2 2869 TTCTGGGAAACCTGCCAGCT 73 80
231922 2 3340 ACTTTGGGCAATCAAGTTTG 32 81
231923 2 3345 CAGTGACTTTGGGCAATCAA 64 82
231924 2 3350 ACTGGCAGTGACTTTGGGCA 59 83
231925 2 3355 GGGTAACTGGCAGTGACTTT 56 84
231926 2 3671 TAAAGACTTTATTGACATAA 41 85
231927 2 3678 GACAAGATAAAGACTTTATT 41 86

All oligonucleotides targeted to the following regions of a GenBank sequence assembled from assembled from M64868.1 and M64879.1 were effective at inhibiting expression of IL 4R-α at least 40% as can be determined by the table above: nucleotides 2506-2525 and 2804-2323. These are validated target segments. All oligonucleotides targeted to the following regions of SEQ ID NO: 2 were effective at inhibiting expression of IL 4R-α at least 40% as can be determined by the table above: nucleotides 78-97; 233-263; 330-349; 388-407; 443-462; 611-630; 716-740; 758-777; 918-9937; 1014-1033; 1114-1133; 1136-1155; 1385-1314; 1424-1459; 1505-1534; 1575-1594; 1834-1863; 1880-1899; 1991-2030; 2979-2103; 2166-2185; 2437-2461; 2469-2488; 2497-2526; 2719-2738; 2788-2817; 2827-2846; 2859-2888; 3345-3374; and 3671-3697. These are validated target segments.

EXAMPLE 4 Antisense Inhibition of Human IL 4R-α by Oligomeric Compounds

A series of oligomeric compounds was designed to target different regions of human IL 4R-α RNA, using published sequences cited in Table 1. The compounds are shown in Tables 4 and 5. All compounds in Tables 4 and 5 are chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of 10 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′) by five-nucleotide “wings”. The wings are composed of 2′-O-(2-methoxyethyl) nucleotides, also known as 2′-MOE nucleotides. The internucleoside (backbone) linkages are phosphorothioate throughout the oligonucleotide. All cytidine residues are 5-methylcytidines. The compounds were analyzed for their effect on gene target mRNA levels by quantitative real-time PCR as described in other examples herein, using the human target-specific primers and probes shown in Table 2. Data are averages from two experiments in which A549 cells were treated with 85 nM of the compounds in Table 4, and 70 nM of the compound in Table 5, using Lipofectin™. A reduction in expression is expressed as percent inhibition in Tables 4 and 5. If the target expression level of oligomeric compound-treated cell was higher than control, percent inhibition is expressed as zero inhibition. The target regions to which these oligomeric compounds are inhibitory are herein referred to as “validated target segments.”

TABLE 4
Inhibition of human IL 4R-α mRNA levels by chimeric
oligonucleotides having 2′-MOE wings and deoxy gap
Target SEQ
SEQ ID/ Target % ID
ISIS # GenBank Site Sequence (5′ to 3′) Inhib NO
364941 1 21 GTAAATCTTTAATTATCTGC 9 87
364945 1 234 CATGTTCCCAGAGCTTGCCA 19 88
364946 1 246 CTGCAAGACCTTCATGTTCC 40 89
364947 1 287 CAAGTAGAGATGCTCATGTA 30 90
364948 1 317 CAATTGGTGGGACCATTCAT 36 91
364949 1 487 ACAGCAGCTGCTGCCCAGCC 51 92
364951 1 741 AATCCCAGACTTCAGGGTGC 45 93
364952 1 777 GCACTGAGCCCAGGCCCTCA 56 94
364953 1 917 CTGACATAGCACAACAGGCA 55 95
364954 1 931 TAATCTTGGTGATGCTGACA 48 96
364955 1 936 TTTCTTAATCTTGGTGATGC 25 97
364958 1 1160 CCCTGGAAAGGCATCTCTTT 54 98
364959 1 1175 GCTGATTTTCCAGAGCCCTG 59 99
364960 1 1182 GCACCATGCTGATTTTCCAG 57 100
364962 1 1492 CCCAGGGCATGTGAGCACTC 49 101
364963 1 1499 AACTCATCCCAGGGCATGTG 59 102
364964 1 1509 TGCACTTGGGAACTCATCCC 49 103
364965 1 1608 GCAAGTCAGGTTGTCTGGAC 54 104
364966 1 1708 GTGGGTCTGGACCCAGCTCT 46 105
364967 1 1716 GGCCAGCAGTGGGTCTGGAC 48 106
364968 1 1845 TGCCCCATGCTGGAGGACAT 37 107
364969 1 1976 GAGAAGGCCTTGTAACCAGC 53 108
364970 1 2000 ACAGCACTGCTGGCAAGCAG 35 109
364971 1 2038 CCCCACTGCTAGCCCCAAAC 24 110
364972 1 2043 CTCTTCCCCACTGCTAGCCC 25 111
364973 1 2058 GAAAGGCTTATACCCCTCTT 62 112
364974 1 2067 GAGGTCTTGGAAAGGCTTAT 55 113
364975 1 2082 AGGGCAGCCAGGAATGAGGT 42 114
364976 1 2087 TCCCCAGGGCAGCCAGGAAT 37 115
364977 1 2230 GCTTTGGCATGTCCTCTACC 50 116
364978 1 2301 GGCTGAGTAGACAATGCCAC 26 117
364979 1 2315 AGGTGGCAGGTAAGGGCTGA 39 118
364980 1 2390 CCACAGCAAGGACTGGCCAT 45 119
364981 1 2469 CAGTGGAACCCCACCTGGAG 23 120
364983 1 2541 GAAGGATGATGAGGATTTAC 51 121
364984 1 2548 CAGGATGGAAGGATGATGAG 41 122
364985 1 2569 AGCTCTGAGCATTGCCAGGG 45 123
364986 1 2626 CCCTCATGTATGTGGGTCCC 48 124
364987 1 2643 GACATGCACCTAAGAGACCC 49 125
364988 1 2674 TAGTCCTCATCTGCAGACTC 50 126
364989 1 2731 AATCTGCCAGCCTGGCTGCC 41 127
364991 1 2751 GGTTCTTCAAGTCTTTTGGA 56 128
364993 1 2772 GGCCAATCACCTTCATACCA 47 129
364994 1 2836 GAGCCCAGCCCAATGCTGGG 7 130
364995 1 2856 CTACTCTCATGGGATGTGGC 61 131
364996 1 2861 GCCCTCTACTCTCATGGGAT 58 132
364997 1 2909 GGCCTCAGTTTTCCTGCAGG 30 133
364998 1 2915 CCCAAGGGCCTCAGTTTTCC 55 134
364999 1 2952 GAGGGAGCAGCCAACAACTC 31 135
365000 1 3048 AGACAGAGGCAGGTGGGCCT 35 136
365001 1 3053 CAGTGAGACAGAGGCAGGTG 63 137
365002 1 3103 CAAGTCATTCCCTTGATGGC 48 138
365004 1 3198 ATCAACCTAAGGAAGCTCTG 49 139
365005 1 3238 TAACTGAACACCCCTTGACA 6 140
365006 1 3290 AATTGTCCCTGCTTTAGTCA 16 141
365007 1 3297 GGCAGCAAATTGTCCCTGCT 55 142
365008 1 3303 GTGTTTGGCAGCAAATTGTC 46 143
365009 1 3420 GGGTAACTGGTGCCTTATGC 53 144
365010 1 3432 GGCCAACATGCAGGGTAACT 44 145
365011 1 3477 ATTACTCAACCCAAGGTTCC 20 146
365012 1 3572 AAGAAACTTTATTTATACAA 0 147
365013 1 3578 GAGACAAAGAAACTTTATTT 2 148
365014 18636000- 8231 CCTAGAATTCAGTCTTCCCT 41 149
18639000
of
NT_010393.14
365015 18636000- 20215 GTTTCCATCTAGAGTACTAG 35 150
18639000
of
NT_010393.14
365016 18636000- 27651 GCCAAGGCACCTGCAGAGAG 38 151
18639000
of
NT_010393.14
365017 18636000- 47104 AGTGAGTGGCAGAGTCAGGA 48 152
18639000
of
NT_010393.14
365018 18636000- 49717 CTTCCAGTGTCTGCAAAAGC 0 153
18639000
of
NT_010393.14

TABLE 5
Inhibition of human IL 4R-α mRNA levels by
chimeric oligonucleotides having 2′-MOE
wings and deoxy gap
Target SEQ
SEQ ID/ Target % ID
ISIS # GenBank Site Sequence (5′ to 3′) Inhib NO
364942 1 167 AGCCACCCCATTGGGAGATG 88 154
364943 1 173 GAGCAAAGCCACCCCATTGG 83 155
369527 1 176 CCAGAGCAAAGCCACCCCAT 51 156
369528 1 193 TCACAGGGAACAGGAGCCCA 48 157
369529 1 194 CTCACAGGGAACAGGAGCCC 62 158
369530 1 196 AGCTCACAGGGAACAGGAGC 44 159
369531 1 197 CAGCTCACAGGGAACAGGAG 54 160
369532 1 199 GGCAGCTCACAGGGAACAGG 69 161
369533 1 200 AGGCAGCTCACAGGGAACAG 64 162
369534 1 201 CAGGCAGCTCACAGGGAACA 64 163
369535 1 202 CCAGGCAGCTCACAGGGAAC 58 164
369536 1 203 ACCAGGCAGCTCACAGGGAA 65 165
369537 1 205 GGACCAGGCAGCTCACAGGG 63 166
369538 1 206 AGGACCAGGCAGCTCACAGG 74 167
369539 1 207 CAGGACCAGGCAGCTCACAG 66 168
369540 1 208 GCAGGACCAGGCAGCTCACA 57 169
369541 1 209 AGCAGGACCAGGCAGCTCAC 48 170
369542 1 210 CAGCAGGACCAGGCAGCTCA 46 171
369543 1 211 GCAGCAGGACCAGGCAGCTC 48 172
369544 1 212 TGCAGCAGGACCAGGCAGCT 39 173
369545 1 213 CTGCAGCAGGACGAGGCAGC 22 174
369546 1 215 ACCTGCAGCAGGACCAGGCA 38 175
369547 1 217 CCACCTGCAGCAGGACCAGG 63 176
369548 1 219 TGCCACCTGCAGCAGGACCA 57 177
369549 1 220 TTGCCACCTGCAGCAGGACC 61 178
369550 1 221 CTTGCCACCTGCAGCAGGAC 60 179
369551 1 222 GCTTGCCACCTGCAGCAGGA 44 180
369552 1 223 AGCTTGCCACCTGCAGGAGG 42 181
364944 1 224 GAGCTTGCCACCTGCAGCAG 56 182
369553 1 225 AGAGCTTGCCACCTGCAGCA 64 183
369554 1 226 CAGAGCTTGCCACCTGCAGC 65 184
369555 1 227 CCAGAGCTTGCCACCTGCAG 66 185
369556 1 228 CCCAGAGCTTGCCACCTGCA 70 186
369557 1 229 TCCCAGAGCTTGCCACCTGC 50 187
369558 1 284 GTAGAGATGCTCATGTAGTC 50 188
369559 1 353 AAAACCAGCTGGTACAACAG 40 189
369560 1 355 GAAAAACCAGCTGGTACAAC 36 190
369561 1 428 TCCATGAGCAGGTGGCACAC 67 191
369562 1 429 ATCCATGAGCAGGTGGCACA 71 192
369563 1 430 CATCCATGAGCAGGTGGCAC 78 193
369564 1 431 TCATCCATGAGCAGGTGGCA 75 194
369565 1 494 CCCTTCCACAGCAGCTGCTG 78 195
369566 1 496 AGCCCTTCCACAGCAGCTGC 86 196
369567 1 497 GAGCCCTTCCACAGCAGCTG 71 197
369568 1 499 AGGAGCCCTTCCACAGCAGC 74 198
369569 1 500 AAGGAGCCCTTCCACAGCAG 76 199
369570 1 501 GAAGGAGCCCTTCCACAGCA 71 200
369571 1 502 TGAAGGAGCCCTTCCACAGC 54 201
369572 1 503 TTGAAGGAGCCCTTCCACAG 35 202
369573 1 504 CTTGAAGGAGCCCTTCCACA 51 203
369574 1 506 GGCTTGAAGGAGCCCTTCCA 40 204
369575 1 508 TGGGCTTGAAGGAGCCCTTC 0 205
369576 1 509 CTGGGCTTGAAGGAGCCCTT 0 206
369577 1 510 GCTGGGCTTGAAGGAGCCCT 3 207
369578 1 530 GCCCTGGGTTTCACATGCTC 64 208
369579 1 531 GGCCCTGGGTTTCACATGCT 62 209
369580 1 619 TATACAGGTAATTGTCAGGG 53 210
369581 1 620 TTATACAGGTAATTGTCAGG 55 211
369582 1 621 ATTATACAGGTAATTGTCAG 40 212
369583 1 642 GTTGACTGCATAGGTGAGAT 70 213
369584 1 645 AATGTTGACTGCATAGGTGA 72 214
369585 1 647 CAAATGTTGACTGCATAGGT 68 215
369586 1 649 TCCAAATGTTGACTGCATAG 61 216
364950 1 735 AGACTTCAGGGTGCTGGCTG 45 217
369587 1 736 CAGACTTCAGGGTGCTGGCT 63 218
369588 1 737 CCAGACTTCAGGGTGCTGGC 63 219
369589 1 998 TCCTGGATTATTATAGCCAC 45 220
364956 1 999 ATCCTGGATTATTATAGCCA 39 221
369590 1 1000 CATCCTGGATTATTATAGCC 43 222
369591 1 1001 GCATCCTGGATTATTATAGC 51 223
369592 1 1003 GAGCATCCTGGATTATTATA 45 224
369593 1 1004 TGAGCATCCTGGATTATTAT 26 225
369594 1 1005 CTGAGCATCCTGGATTATTA 52 226
369595 1 1006 CCTGAGCATCCTGGATTATT 41 227
364957 1 1053 GCACTTGGCTGGTTCCTGGC 77 228
369596 1 1077 GGTAAGACAATTCTTCCAGT 77 229
369597 1 1078 TGGTAAGACAATTCTTCCAG 57 230
369598 1 1079 TTGGTAAGACAATTCTTCCA 66 231
369599 1 1080 CTTGGTAAGACAATTCTTCC 73 232
369600 1 1082 AGCTTGGTAAGACAATTCTT 66 233
369601 1 1083 GAGCTTGGTAAGACAATTCT 61 234
369602 1 1085 AAGAGCTTGGTAAGACAATT 64 235
369603 1 1087 GCAAGAGCTTGGTAAGACAA 64 236
369604 1 1088 GGCAAGAGCTTGGTAAGACA 76 237
369605 1 1090 AGGGCAAGAGCTTGGTAAGA 44 238
369606 1 1092 ACAGGGCAAGAGCTTGGTAA 64 239
369607 1 1093 AACAGGGCAAGAGCTTGGTA 69 240
369608 1 1094 AAACAGGGCAAGAGCTTGGT 77 241
369609 1 1095 AAAACAGGGCAAGAGCTTGG 62 242
369610 1 1096 GAAAACAGGGCAAGAGCTTG 54 243
369611 1 1098 CAGAAAACAGGGCAAGAGCT 62 244
369612 1 1100 TCCAGAAAACAGGGCAAGAG 72 245
369613 1 1184 GGGCACCATGCTGATTTTCC 71 246
369614 1 1221 GCTCTGTGGCCAGAGGACTG 80 247
369615 1 1223 ATGCTCTCTGGCCAGAGGAC 68 248
369616 1 1224 GATGCTCTCTGGCCAGAGGA 58 249
369617 1 1227 GCTGATGCTCTCTGGCCAGA 64 250
369618 1 1395 GTCCAGGAACAGGCTCTCTG 76 251
369619 1 1397 AGGTCCAGGAACAGGCTCTC 68 252
369620 1 1398 CAGGTCCAGGAACAGGCTCT 43 253
369621 1 1399 GCAGGTCCAGGAACAGGCTC 59 254
369622 1 1400 AGCAGGTCCAGGAACAGGCT 45 255
364961 1 1401 GAGCAGGTCCAGGAACAGGC 54 256
369623 1 1506 ACTTGGGAACTCATCCCAGG 58 257
369624 1 1507 CACTTGGGAACTCATCCCAG 58 258
369625 1 1508 GCACTTGGGAACTCATCCCA 66 259
369626 1 1670 CTCAGGGAGTTGCTGAAGCT 63 260
369627 1 1671 GCTCAGGGAGTTGCTGAAGC 62 261
369628 1 1673 TGGCTCAGGGAGTTGCTGAA 28 262
369629 1 1674 CTGGCTCAGGGAGTTGCTGA 47 263
369630 1 1676 GACTGGCTCAGGGAGTTGCT 65 264
369631 1 1700 GGACCCAGCTCTCTGGGACA 57 265
369632 1 1701 TGGACCCAGCTCTCTGGGAC 61 266
369633 1 1703 TCTGGACCCAGCTCTCTGGG 46 267
369634 1 1705 GGTCTGGACCCAGCTCTCTG 70 268
369635 1 1706 GGGTCTGGACCCAGCTCTCT 65 269
369636 1 1777 TGGTTGGCTCAGAGAGCTGG 63 270
369637 1 1779 AGTGGTTGGCTCAGAGAGCT 51 271
369638 1 1780 CAGTGGTTGGCTCAGAGAGC 64 272
369639 1 1781 ACAGTGGTTGGCTCAGAGAG 57 273
369640 1 1782 CACAGTGGTTGGCTCAGAGA 71 274
369641 1 1997 GCACTGCTGGCAAGCAGGCT 52 275
369642 1 2056 AAGGCTTATACCCCTCTTCC 81 276
369643 1 2057 AAAGGCTTATACCCCTCTTC 82 277
364973 1 2058 GAAAGGCTTATACCCCTCTT 60 112
369644 1 2059 GGAAAGGCTTATACCCCTCT 80 279
369645 1 2060 TGGAAAGGCTTATACCCCTC 84 280
369646 1 2062 CTTGGAAAGGCTTATACCCC 68 281
369647 1 2064 GTCTTGGAAAGGCTTATACC 59 282
369648 1 2065 GGTCTTGGAAAGGCTTATAC 58 283
369649 1 2066 AGGTCTTGGAAAGGCTTATA 77 284
364974 1 2067 GAGGTCTTGGAAAGGCTTAT 60 113
369650 1 2068 TGAGGTCTTGGAAAGGGTTA 59 286
369651 1 2126 AGTCCAAAGGTGAACAAGGG 50 287
369652 1 2128 CCAGTCCAAAGGTGAACAAG 55 288
369653 1 2130 GTCCAGTCCAAAGGTGAACA 50 289
369654 1 2131 TGTCCAGTCCAAAGGTGAAC 52 290
369655 1 2403 TCCACAGCAGCAGCCACAGC 57 291
369656 1 2524 TACTCTTCTCTGAGATGCCC 86 292
369657 1 2526 TTTACTCTTCTCTGAGATGC 71 293
369658 1 2528 GATTTACTCTTCTCTGAGAT 57 294
369659 1 2529 GGATTTACTCTTCTCTGAGA 67 295
364982 1 2530 AGGATTTACTCTTCTCTGAG 68 296
369660 1 2531 GAGGATTTACTCTTCTCTGA 87 297
369661 1 2532 TGAGGATTTACTCTTCTCTG 83 298
369662 1 2578 TCTGGCTTGAGCTCTGAGCA 69 299
369663 1 2579 GTCTGGCTTGAGCTCTGAGC 68 300
364990 1 2743 AAGTCTTTTGGAAATCTGCC 69 301
364992 1 2763 CCTTCATACCATGGTTCTTC 81 302
365003 1 3168 GAGCACCTCTAGGCAATGAC 82 303

Oligonucleotides targeted to the following nucleotides of SEQ ID NO: 3 were effective at inhibiting the expression of human IL 4R-α at least about 40% as can be determined by the tables above: nucleotides 167-265; 284-303; 353-372; 428-450; 487-525; 530-550; 619-640; 642-668; 735-760; 777-796; 917-950; 998-1025; 1053-1072; 1077-1121; 1160-1203; 1221-1246; 1395-1420; 1492-1528; 1608-1627; 1670-1695; 1700-1735; 1777-1801; 1976-1995; 1997-2016; 2056-2088; 2056-2101; 2126-2150; 2230-2349; 2390-2422; 2524-2598; 2626-2662; 2674-2693; 2731-2791; 2856-2880; 2915-2934; 3053-3072; 3103-3122; 3168-3187; 3198-3217; 3297-3322; and 3420-3451. These are validated target segments. Although some oligonucleotides within each nucleotide region did not inhibit expression at least 40%, they substantially overlapped (i.e., at least 80% overlapped) oligonucleotides effective at inhibiting expression at least 40%. All oligonucleotides targeted to the following regions of SEQ ID NO: 1 were effective at inhibiting expression of IL 4R-α at least 50% as can be determined by the tables above: nucleotides 284-303; 428-450; 494-525; 530-550; 642-668; 1053-1072; 1184-1203; 1221-1246; 1506-1527; 1777-1801; 1976-2016; 2056-2101; 2126-2150; 2230-2349; 2403-2422; 2524-2551; 2578-2598; 2743-2782; 2856-2880; 2915-2934 and 3168-3187. These are validated target segments. All oligonucleotides targeted to the following regions of GenBank nucleotides 18636000-18639000 of NT010393.14 were effective at inhibiting expression of IL 4R-α at least 40% as can be determined by the table above: nucleotides 8231-8250 and 47104-47123. These are validated target segments.

EXAMPLE 5 Screening of Oligonucleotides Containing Nucleotide Mismatches, Dose Response

Based on the screening above, ISIS 231894 was selected for further study. A series of oligonucleotides were designed based on ISIS 231894 containing 1, 3, 5, and 7 mismatch nucleobases as shown in Table 6 below. It should be noted that the mismatches are interspersed throughout the central portion of the compounds, rather than at the ends. This decreases the affinity of the oligonucleotide for the target mRNA more than mismatch oligonucleotides at the ends. Such concepts are well known and understood by those skilled in the art. The oligonucleotides are 5-10-5 MOE-gapmers, as is ISIS 231894. All cytidine residues are 5-methylcytidines. The mismatch bases are underlined.

TABLE 6
Oligonucleotides targeted to mouse IL 4R-α
containing mismatches
Target SEQ
SEQ ID # mis- ID
ISIS # NO match Sequence (5′ to 3′) NO
231894 2 0 CCGCTGTTCTCAGGTGACAT 53
352489 2 1 CCGCTGTTCTCAGGTGACAT 53
352490 2 3 CCGCTGATCACAGCTGACAT 304
352491 2 5 CCGCTCATCACTGCTGACAT 305
352492 2 7 CCACTCATCACTGCTGACTT 306

The compounds were analyzed for their effect on gene target mRNA levels by quantitative real-time PCR as described in other examples herein using the target specific primers shown in Table 2. Data are averages from two experiments in which b.END cells were treated with the concentrations of the compounds listed.

TABLE 7
Inhibition of mouse IL 4R-α by chimeric,
mismatch oligonucleotides
SEQ
Isis Number 1 5 10 25 50 100 ID
No mismatch nM nM nM nM nM nM NO
231894 Parent 100 54 43 31 21 21 53
352489 1 mm 74 55 52 51 44 49 53
352490 3 mm 92 106 98 88 89 88 304
352491 5 mm 104 104 97 102 114 90 305
352492 7 mm 109 118 121 104 88 69 306

Oligonucleotides having at least three mismatched bases interspersed within the central portion of the compound were not able to reduce the expression of the target RNA by at least 40% even at the highest doses of oligonucleotide tested.

EXAMPLE 6 Mouse Models of Allergic Inflammation

Asthma is a complex disease with variations on disease severity and duration. In view of this, multiple animal models have been designed to reflect various aspects of the disease (see FIG. 1). It is understood that the models have some flexibility in regard to days of sensitization and treatment, and that the timelines provided reflect the days used herein. There are several important features common to human asthma and the mouse model of allergic inflammation. One of these is pulmonary inflammation, in which production of Th2 cytokines, e.g., IL 4, IL 5, IL 9, and IL 13 is dominant. Another is goblet cell metaplasia with increased mucus production. Lastly, airway hyperresponsiveness (AHR) occurs, resulting in increased sensitivity to cholinergic receptor agonists such as acetylcholine or methacholine.

Ovalbumin Induced Allergic Inflammation—Acute Model

The acute model of induced allergic inflammation is a prophylaxis treatment paradigm. Animals are sensitized to allergen by systemic administration (i.e., intraperitoneal injection), and treated with the therapeutic agent prior to administration of the pulmonary allergen challenge (see FIG. 1A). In this model, there is essentially no pulmonary inflammation prior to administration of the therapeutic agent.

Balb/c mice (Charles River Laboratory, Taconic Farms, N.Y.) were maintained in micro-isolator cages housed in a specific pathogen free (SPF) facility. The sentinel cages within the animal colony surveyed negative for viral antibodies and the presence of known mouse pathogens. Mice were sensitized and challenged with aerosolized chicken OVA. Briefly, 20 ug of alum precipitated OVA was injected intraperitoneally on days 0 and 14. On days 24, 25 and 26, the animals were exposed for 20 minutes to 1% OVA (in saline) by ultrasonic nebulization. On days 17, 19, 21, 24 and 26 animals were dosed with 1 ug/kg or 10 ug/kg of ISIS 231894 or the mismatch control oligonucleotide using an aerosol delivery system. Oligonucleotides were suspended in 0.9% sodium chloride and delivered via inhalation using a nose-only exposure system. A Lovelace nebulizer (Model 01-100) was used to deliver the oligonucleotide into an air flow rate of 1.0 liter per minute feeding into a total flow rate of 10 liters per minute. The exposure chamber was equilibrated with an oligonucleotide aerosol solution for 5 minutes before mice were placed in a restraint tubes attached to the chamber. Restrained mice were treated for a total of 10 minutes. Analysis was performed on day 28.

Airway Hyperreponsiveness in Response to Methacholine

Airway responsiveness was assessed by inducing airflow obstruction with a methacholine aerosol using a noninvasive method. This method used unrestrained conscious mice that are placed into a test chamber of a plethsmograph (Buxco Electronics, Inc. Troy, N.Y.). Pressure difference between this chamber and a reference chamber were used extrapolate minute volume, breathing frequency and enhanced pause (Penh). Penh is a dimensionless parameter that is a function of total pulmonary airflow in mice (i.e. the sum of the airflow in the upper and lower respiratory tracts) during the respiratory cycle of the animal. The lower the Penh, the greater the airflow. This parameter is known to closely correlate with lung resistance as measured by traditional, invasive techniques using ventilated animals as shown below (see also Hamelmann et al., 1997).

ISIS 231894, but not the mismatch control oligonucleotide, caused a significant (p 0.05 for both 1 ug/kg and 10 ug/kg vs. vehicle treated controls) dose dependent suppression in methacholine induced AHR in sensitized mice as measured by whole body plethysmography.

Airway hyperresponsiveness to methacholine challenge was also evaluated using an invasive technique designed to monitor changes in airway resistance and pulmonary compliance. Mice were weighed and anesthetized with ketamine (150 mg/kg) mixed with xylazine (10 mg/kg). A trachestomy was performed and the mice were ventilated using the Flexivent system (SCIREQ, Montreal, Canada) using traditional mouse parameters (Adler, A et al. J Appl Physiol 97: 286-292, 2004). Increasing concentrations of methacholine were aerosolized using the Flexivent system with an Aeroneb lab nebulizer system, and resistance (RL) and compliance (CL) were measured.

ISIS 231894, but not the mismatch control oligonucleotide, reduced airway resistance (p<0.05 for 100 ug/kg vs. vehicle treated controls) and increased lung compliance (p<0.05 for 100 ug/kg vs. vehicle treated controls) compared to measurements performed in control animals that inhaled saline only.

Data are presented as group means+/−SEM, N=4-6/group. * p<0.05 vs. vehicle treated controls by Student's T-test.

TABLE 8
Measurement of AHR by Flexivent in response to
methacholine in the acute mouse OVA model
Resistance Compliance
(cm H2O—S/mL) (mL/cmH2O)
Na{dot over (i)}ve  1.54 +/− 0.21*  0.029 +/− 0.005*
Vehicle 4.51 +/− 1.12 0.010 +/− 0.003
231894  1.70 +/− 0.34*  0.030 +/− 0.006*
352492 3.40 +/− 0.65 0.014 +/− 0.004

These data confirm that oligonucleotides targeted to IL 4R-α is effective in the treatment of AHR in a prophylaxis paradigm.

Inflammatory Cell Infiltration

The effect of ISIS 231894 on inflammatory cell profiles was analyzed. Cell differentials were performed on bronchial alveolar lavage (BAL) fluid collected from lungs of the treated mice after injection of a lethal dose of ketamine. Treatment with ISIS 231894, but not the mismatch control, resulted in a significant (p 0.05 for both 1 ug/kg and 10 ug/kg vs. vehicle treated controls) decrease in BAL eosinophil infiltration. These results demonstrate that an oligonucleotide targeted to IL4R-α decreased pulmonary inflammation by decreasing eosinophil infiltration.

A second experiment was performed to confirm the efficacy of ISIS 231894 to decrease AHR and eosinophilia in the acute model. Mice were dosed with OVA as described above. On days 17, 19, 21, 24 and 26, mice were dosed with 10 ug/kg ISIS 231894, mismatch control oligonucleotide, or vehicle (i.e. saline). ISIS 231894, but not the mismatch control oligonucleotide significantly reduced AHR and eosinophilia as compared to treatment with mismatch oligonucleotide or vehicle alone.

These data demonstrate that IL 4R-α is a valid target for the prevention of AHR and lung inflammation, and diseases associated therewith.

Mouse Model of Allergic Inflammation—Rechallenge Model

The rechallenge model of induced allergic inflammation allows testing of a pharmacologic approach in mice that have been previously sensitized and then exposed to an aeroallergen. During the first set of local allergen challenges, the mice develop allergen-specific memory T lymphocytes. Subsequent exposure to a second set of inhaled allergen challenges produces an enhanced inflammatory response in the lung, as demonstrated by increased levels of Th2 cytokines in lavage fluid. The rechallenge model of allergic inflammation includes a second series of aerosolized administration of OVA on days 59 and 60 in addition to the two IP OVA administrations on days 0 and 14 and the nebulized OVA administration of days 24, 25 and 26 of the acute model (see FIG. 1B). Using this model, oligonucleotide treatment occurs after the first set of local allergen challenges. This also allows for the evaluation of the target's role in a recall response, as opposed to an initial immune response.

In the rechallenge model, mice were treated with 10, 100 or 500 ug/kg of either ISIS 231894 or a 7 basepair mismatch control oligonucleotide (ISIS 352492) on days 52, 54, 56, 59 and 61 delivered by nose only inhalation. The study endpoints included many of those used in the acute model: Penh response (i.e., AHR reduction), inflammatory cells in BAL, mucus accumulation, and lung histology. IL 4R-α protein reduction in pulmonary structural and inflammatory cells was also evaluated.

Inflammatory IL4R-α Expression Profile

Lungs were harvested 6 hours following the second nebulized OVA re-challenge on Day 67. Lung cells were recovered after collagenase treatment of the tissue and analyzed by flow cytometry. IL 4R-α protein expression was measured on the surface of a mixed population of lung eosinophils and macrophages (CD11b-positive, GR-1 negative or low); CD11c-positive and MHC class II-positive dendritic cells; and E-cadherin-positive epithelial cells. Data are expressed as mean fluorescence intensity+/−SEM, N=4/group. *p<0.05 vs. vehicle treated controls by Student's T-test.

TABLE 9
IL 4Rα Cell Surface Protein Immunostaining (Mean
Fluorescence Intensity) on Inflammatory and Epithelial
Cells recovered from Lungs of Allergen Re-challenged Mice
Eos/Macs Epithelial Cells
Treatments (MFI) DC (MFI) (MFI)
Naive 142 +/− 27 184 +/− 40  63 +/− 22
Vehicle 181 +/− 26 181 +/− 25 181 +/− 15
231894  10 ug/kg 120* +/− 7.8  200 +/− 38 100 +/− 42
100 126* +/− 14  171 +/− 29 96* +/− 18
500 113* +/− 9.9  124* +/− 20  120 +/− 64
352492  10 ug/kg 135 +/− 32 206 +/− 26 144 +/− 30
100 172 +/− 23 190 +/− 15  139 +/− 8.1
500 186 +/− 32 257 +/− 87 149 +/− 24

These data demonstrate that oligonucleotides targeted to IL 4R-α is effective at reducing cell surface expression of IL 4R-α on multiple populations of cells within the lung.

Airway Hyperreponsiveness in Response to Methacholine as Determined by Penh

On day 60, AHR was analyzed by Penh as described above. A significant reduction in methacholine induced AHR was observed in animals inhaling 1.0 or 10.0 ug/kg ISIS 231894, but not 10 ug/kg of the mismatch control oligonucleotide (ISIS 352492), as compared to vehicle control animals as can be seen in Table 10 below. Data are presented as group means, N=10/group. * p<0.05 vs. vehicle treated controls by Student's T-test.

TABLE 10
Measurement of AHR by Penh in response to
methacholine in a rechallenge mouse model
Methacholine dose (mg/kg)
Base-
Treatments line 0 3 6 12 25 50 100
Naïve 0.53 0.48 0.57 1.10 2.10 2.70 2.61 2.86*
Vehicle 0.60 0.52 0.97 1.52 2.16 3.16 4.46 5.13
231894   10 ug/kg 0.56 0.51 0.92 1.33 1.98 2.37 2.88 3.38*
231894  1.0 ug/kg 0.60 0.55 0.94 1.34 1.88 2.28 3.12 3.48*
231894  0.1 ug/kg 0.55 0.51 0.88 1.40 2.12 2.54 3.40 4.06
231894  0.01 ug/kg 0.54 0.53 0.85 1.37 2.15 3.18 4.12 4.85
231894 0.001 ug/kg 0.54 0.48 0.88 1.30 2.25 3.03 4.9 5.76
352492   10 ug/kg 0.57 0.52 0.93 1.36 2.24 3.17 3.75 4.14

These results demonstrate that oligonucleotides targeted to IL4R-α are effective in the suppression of AHR.

Cytokine and Chemokine Expression in Bronchiolar Lavage Fluid

Pulmonary inflammation was also monitored through quantitation of Th2 cytokines and chemokines, and eosinophils in the airways. The production of Th2 cytokines and chemokines in the lung following aeroallergen exposure is associated with the induction of pulmonary inflammation and airway hyperresponsiveness. BAL fluid was collected, and the level of Th2 cytokines and chemokines were quantitated by ELISA on Day 67, 6 hours after the second nebulized OVA challenge in mice (n=4/group). The level of IL-13 was significantly (p<0.05) decreased at all three doses of Isis 231894. KC, the mouse analog of human IL-8, was significantly (p<0.05) decreased at the two higher doses of Isis 231894, and IL-5 and MCP-1 were significantly (p<0.05 vs. vehicle treated controls) decreased at the 500 ug/kg dose. Cytokine concentrations were determined from linear regression analysis of multi-point standard curves. The mismatch oligonucleotide, Isis 352942, had no effect on Th2 cytokine levels. These data demonstrate that inhibition of IL 4Ra expression is effective in decreasing Th2 cytokine and chemokine expression, specifically Th2 cytokine expression following allergen challenge, which is related to pulmonary inflammation and airway hyperresponsiveness.

Inflammatory Cell Infiltration

Cell differentials were performed on the BALF. The percent of eosinophils in BAL fluid was significantly reduced as compared to BALF from vehicle treated control animals. Results are shown in Table 12. Data are presented as group means, N=10/group. * p<0.05 vs. vehicle treated controls by Student's T-test as compared to vehicle control.

TALE 11
Measurement of Airway Inflammatory Cells
in Allergen Re-challenged Mice
Treatments Mac Lym Eos Neu
Naive 97.0 0.9  0.5* 1.6
Vehicle 31.0 5.7 59.9 3.4
231894   10 ug/kg 72.1 4.2  23.0* 0.7
231894  1.0 ug/kg 69.8 5.1 24*  0.6
231894  0.1 ug/kg 53.1 5.6 38*  3.3
231894  0.01 ug/kg 47.3 4.8  44.1* 3.8
231894 0.001 ug/kg 38.9 4.6 53.2 3.3

These data demonstrate that oligonucleotides targeted to IL4R-α are effective at decreasing eosinophilia in the lung in response to allergen challenge.

Mucus Production

Mucus is an indicator of pulmonary inflammation. Muc5AC gene expression, mucus levels, and goblet cell metaplasia in the airways of OVA re-challenged mice were analyzed. Muc5AC mRNA levels were analyzed by quantitative RT-PCR in extracts from lung tissue harvested on Day 69. Expression levels were normalized to G3PDH expression. Muc 5AC/β-actin mRNA ratio significantly (p<0.05 vs. the vehicle treated control group) decreased with 231894 as compared to vehicle treatment. No decrease was observed in 352492 treated animals (n=4). There was also a significant (p<0.05 vs. the vehicle treated control group) decrease in mucus as determined by digital imaging of PAS-stained lungs from mice following treatment with IL 4R-α ASO, but not with saline or mismatch control oligonucleotide.

These data further demonstrate that an IL4R-α targeted antisense oligonucleotide approach is efficacious in the presence of established immunological memory, and that IL4R-α is an appropriate target for the amelioration, and/or treatment of AHR and pulmonary inflammation, and diseases associated therewith.

Mouse Model of Allergic Inflammation—Chronic Model

The chronic model of induced allergic inflammation uses a therapeutic treatment regimen, with ASO treatment initiated after the establishment local pulmonary inflammation. The chronic model recapitulates some of the histological features of severe asthma in humans, including collagen deposition and lung tissue remodeling. The chronic OVA model produces a more severe disease than that observed in the acute or rechallenged model.

This model includes intranasal OVA administration on days 27-29, 47, 61, and 73-75, at a higher dose (500 ug) than in the acute and chronic models, in addition to the two OVA IP administrations on days 0 and 14 (see FIG. 1C). Intranasal administration of the allergen results in a higher dose of the allergen delivered to the lungs relative to delivery by nebulizer. The increased number of allergen challenges produces more severe inflammatory events, resulting in increased lung damage and pathology more reflective of clinical asthma than other models, in the absence of therapeutic interventions. Endpoints tested were similar to those in the acute and rechallenge model, including Penh (AHR), BAL inflammatory cells and cytokines and mucus accumulation. This model also allows for the analysis of endpoints typically associated with chronic diseases, such as asthma and COPD, including subepithelial fibrosis, collagen deposition, enhanced goblet cell metaplasia, and smooth muscle cell hyperplasia.

Oligonucleotide, either ISIS 231894 or ISIS 352942 was administered by nose-only aerosol at a dose of either 5 ug/kg or 500 ug/kg on days 31, 38, 45, 52, 59, 66 and 73. Analysis of endpoints was performed on day 76, except cytokines which were evaluated on day 62, 6 hours post OVA challenge.

Airway Hyperreponsiveness in Response to Methacholine as Determined by Penh

Treatment of mice with both doses of ISIS 231894 resulted in a significant decrease in methacholine induced AHR as compared to treatment with vehicle (i.e. saline). Data are presented as group means, N=10/group. * p<0.05 vs. vehicle treated controls by Student's T-test.

TABLE 12
Measurement of AHR by Penh in response to methacholine
in a chronic allergic inflammation model
Methacholine concentration (mg/ml)
Base-
Treatment line 0 3 6 12 25 50 100
Naïve 0.55 0.54 0.83 1.34 1.78 2.20 2.49 2.98*
Vehicle 0.67 0.59 1.38 2.01 2.95 5.00 5.86 6.17
231894 500 ug/kg 0.68 0.66 1.48 1.77 2.29 3.03 3.79 4.50*
231894  5 ug/kg 0.74 0.73 1.50 1.96 2.05 2.68 4.13 4.41*

These data demonstrate that oligonucleotides targeted to IL4R-α delivered using at therapeutic treatment regimen are effective at preventing AHR in response to methacholine challenge.

Inflammatory Cell Infiltration

Treatment of mice with the higher dose of 231894 resulted in a significant decrease in the percent of eosinophils in BAL fluid as compared to vehicle control. Both doses of ISIS 231894 significantly reduced the percent neutrophils in BAL as compared to vehicle control. Data are presented as group means, N=7/group. * p<0.05 vs. vehicle treated controls by Student's T-test as compared to vehicle control.

TABLE 13
Measurement of inflammatory cell infiltration in a chronic
allergic inflammation mouse model
Day 62 Day 76
Treatments Mac Lym Eos Neu Mac Lym Eos Neu
Naïve 91.8 1.6 0.2* 6.4* 91.3 2.2 1.2* 5.3*
Vehicle 25.4 6.4 12.2 56.0 37.5 3.4 48.5 10.6
231894 500 ug/kg 58.2 2.4 4.8* 34.6* 61.9 4.8 29.7* 3.6*
231894  5 ug/kg 50.7 6.8 4.5* 38.0* 42.8 6.4 44.5 6.3

These data demonstrate that oligonucleotides targeted to IL4R-α delivered using a therapeutic treatment regimen are effective at decreasing eosinophilia and neutrophilia in the lung in response to allergen challenge.

Cytokine Expression in Bronchiolar Lavage Fluid

Pulmonary inflammation was also monitored by cytokine and chemokine expression and inflammatory cell infiltration. BALF was collected, and the level of four Th2 cytokines were quantitated by ELISA on day 62, 6 hours post allergen challenge. Analysis of BAL fluid revealed a significant reduction in IL-5 and KC in high dose 231894 treated animals as compared to vehicle treated animals.

These data further confirm the utility of oligonucleotides targeted to IL 4R-α for the amelioration and treatment of AHR and pulmonary inflammation and diseases associated therewith.

EXAMPLE 7 Mouse Model of Allergic Inflammation, Analysis for Nasal Rhinitis Endpoints

Mouse models of allergen—induced acute and chronic nasal inflammation similar to those above have been used to study allergic rhinitis in mice (Hussain et al., Larangyoscope. 112: 1819-1826. 2002; Iwasaki et al., J. Allergy Clin Immunol. 112: 134-140. 2003; Malm-Erjefaelt et al., Am J Respir Cell Mol Biol. 24:352-352.2001; McCusker et al., J Allergy Clin Immunol., 110: 891-898; Saito et al., Immunology. 104:226-234. 2001). In all of the models, the mice were sensitized to OVA by injection, as above, followed by intranasal OVA instillation.

The most substantial difference in the models is in the endpoints analyzed. Endpoints include, but are not limited to, the amount of sneezing and nasal scratching immediately after administration of allergen challenge (i.e. intranasal OVA), and nasal histology including mucus and eosinophil counts and measurements of cytokines or other inflammatory products in nasal lavage fluid or nasal tissues. Methods for performing such analyses are detailed in the references cited which are incorporated herein by reference. Administration of oligonucleotides targeted to IL-4R alpha decrease nasal inflammation, as evidenced by fewer infiltrating eosinophils quantitated by digital imaging, and fewer nasal rubs and sneezes per unit of time in IL 4R-α ASO treated animals as compared to saline treatment.

EXAMPLE 8 Rodent Model of Smoking Induced Pulmonary Disease

Smoking is known to cause lung irritation and inflammation which can result in a number of diseases in humans including, but not limited to, emphysema and COPD. A number of smoking animal models are well known to those skilled in the art including those utilizing mice (Churg et al., 2002. Am. J. Respir. Cell. Mol. Biol. 27:368-347; Churg et al., 2004. Am. J. Respir. Crit. Care Med. 170:492-498, both incorporated herein by reference), rats (e.g., Sekhon et al., 1994. Am. J. Physiol. 267:L557-L563, incorporated herein by reference), and guinea pigs (Selman et al., 1996. Am J. Physiol. 271:L734-L739, incorporated herein by reference). Animals are exposed to whole smoke using a smoking apparatus (e.g., Sekhon et al., 1994. Am. J. Physiol. 267:L557-L563) well known to those skilled in the art.

Changes in lung physiology are correlated with dose and time of exposure. In short term studies, cell proliferation and inflammation were observed. In one study, exposure of rats to 7 cigarettes for 1, 2, or 7 days resulted in proliferation of pulmonary artery walls at the level of the membranous bronchioles (MB), respiratory bronchioles (RB), and alveolar ducts (AD). Endothelial cell proliferation was only present in vessels associated with AD. In a separate study (Churg et al., 2002. Am. J. Respir. Cell. Mol. Biol. 27:368-347), mice exposed to whole smoke from four cigarettes were shown to have an increase in neutrophils, desmosine (an indicator of elastin breakdown), and hydroxyproline (an indicator of collagen breakdown) after only 24 hours. In a long term study, an emphysema-like state was induced (Churg et al., 2004. Am. J. Respir. Crit. Care Med. 170:492-498). Mice exposed to whole smoke from four cigarettes using a standard smoking apparatus, for five days per week for six months were found to have an increase in neutrophils and macrophages in BALF as compared to control mice. Whole lung matrix metalloproteinases (MMP)-2, -9, -12, and -13, and matrix type-1 (MT-1) proteins were increased. An increase in matrix breakdown products was also observed in BALF. These markers correlate with tissue destruction and are observed in human lungs with emphysema.

These models can be used to determine the efficacy of therapeutic interventions for the prevention, amelioration, and/or treatment of the damage and disease caused by cigarette smoke and/or other insults. Administration of oligonucleotide can be performed prior to, concurrent with, and/or after exposure to smoke to provide a prophylactic or therapeutic model. ISIS 231894 is 100% complimentary to both mouse and rat IL 4R-α; therefore, it can be used in both mouse and rat studies. Dose ranges are determined by the time of oligonucleotide administration relative to smoke inhalation, with lower doses (e.g., 1-100 ug/kg) required for prevention of lung damage. Higher doses (e.g., 100-1000 ug/kg) are required for treatment after, or alternating with, smoke exposure. Positive control (e.g., smoke exposure, no oligonucleotide administration) and negative control (e.g., no smoke exposure, with or without oligonucleotide treatment) animals are also analyzed.

Endpoints for analysis include those discussed in the asthma models above. Functional endpoints include AHR, resistance and compliance. Morphological changes include BAL cell, cytokine levels, histological determinations of alveolar destruction (i.e., increase in alveolar space) and airway mucus accumulation, as well as tissue markers of disease including collagen and elastin. The emphysematous changes specific to this model discussed in this example can also be analyzed to determine the effect of the antisense oligonucleotide.

EXAMPLE 9 Mouse Model of Elastase Induced Emphysema

Elastase is an essential mediator in lung damage and inflammation release by neutrophils recruited following smoke-induced damage. A rat model of emphysema has been developed to analyze the process of elastase mediated lung damage, and possible therapeutic interventions to prevent, ameliorate, and/or treat the pathologies associated with such damage and resulting disease (Kuraki et al., 2002. Am J Respir Crit Care Med., 166:496-500, incorporated herein by reference). Intratracheal application of elastase induced emphysematous changes in all lobes of the lung including severe lung hemorrhage as demonstrated by increased hemoglobin in BALF; neutrophil accumulation in BALF; inhibition of hyperinflation and degradation of elastic recoil. Histopathological changes included elastase-induced airspace enlargement and breakdown of alveoli. These changes are similar to those observed in human emphysema.

In the model, rats are treated with human sputum elastase (SE563, Elastin Products, Owensville, Mo.) without further purification. Rats are treated with a sufficient dose of elastase, about 200 to 400 units, by intratracheal administration using a microsprayer. Alternatively, intratracheal administration can be performed as described above in the mouse models. After sufficient time to allow for damage to occur, about eight weeks, functional and morphological changes are analyzed. A similar model can be performed using mice with a lowered dose of elastase relative to weight and/or lung area (e.g., 0.05 U of porcine pancreatic elastase/g body weight).

Administration of oligonucleotide can be performed prior to, concurrent with, and/or after administration of elastase to provide a prophylactic or therapeutic model. ISIS 231894 is 100% complimentary to both mouse and rat IL 4R-α. Dose ranges are determined by the time of oligonucleotide administration relative to elastase administration with lower doses (e.g., 1-100 ug/kg) required for prevention of lung damage. Higher doses (e.g., 100-1000 ug/kg) are required for treatment after, or alternating with, elastase administration. Positive control (e.g., elastase treatment, no oligonucleotide administration) and negative control (e.g., no elastase, with or without oligonucleotide treatment) animals are also analyzed.

Endpoints for analysis include those discussed in the asthma models above. Functional endpoints include AHR, resistance and compliance. Morphological changes include BAL cell, cytokine levels, and mucus accumulation. The emphysematous changes specific to this model discussed in this example can also be analyzed to determine the effect of the antisense oligonucleotide.

Claims

1. (canceled)

2. An antisense compound 12 to 35 nucleobases in length targeted to a nucleic acid molecule encoding human IL-4R alpha (SEQ ID NO: 1), wherein the compound is targeted to nucleotides 2056-2101; 167-265; 284-303; 353-372; 428-450; 487-525; 530-550; 619-640; 642-668; 735-760; 777-796; 917-950; 998-1025; 1053-1072; 1077-1119; 1160-1203; 1221-1246; 1395-1420; 1492-1528; 1608-1627; 1670-1695; 1700-1735; 1777-1801; 1976-1995; 1997-2016; 2126-2150; 2230-2249; 2390-2422; 2524-2567; 2569-2598; 2626-2662; 2674-2693; 2731-2791; 2856-2880; 2915-2934; 3053-3072; 3103-3122; 3168-3187; 3198-3217; 3297-3322; or 3420-3451 of SEQ ID NO: 1.

3. The compound of claim 2 wherein the compound is at least about 80% identical to the complement of a 20 nucleobase portion of nucleotides 2056-2101; 167-265; 284-303; 353-372; 428-450; 487-525; 530-550; 619-640; 642-668; 735-760; 777-796; 917-950; 998-1025; 1053-1072; 1077-1119; 1160-1203; 1221-1246; 1395-1420; 1492-1528; 1608-1627; 1670-1695; 1700-1735; 1777-1801; 1976-1995; 1997-2016; 2126-2150; 2230-2249; 2390-2422; 2524-2567; 2569-2598; 2626-2662; 2674-2693; 2731-2791; 2856-2880; 2915-2934; 3053-3072; 3103-3122; 3168-3187; 3198-3217; 3297-3322; or 3420-3451 of SEQ ID NO: 1.

4. The compound of claim 3, wherein the compound is at least about 80% identical to the complement of a 20 nucleobase portion of nucleotides 2056 to 2087 of SEQ ID NO. 1.

5. The compound of claim 4 wherein the compound is at least about 80% identical to SEQ ID NO. 280.

6. The compound of claim 2 wherein the compound is a single stranded compound.

7. The compound of claim 2 comprising at least one modified internucleoside linkage, sugar moiety, or nucleobase.

8. The compound of claim 7, comprising a chimeric oligonucleotide.

9. The compound of claim 7 wherein the modified internucleoside linkage is a phosphorothioate linkage.

10. The compound of claim 7 wherein the modified sugar moiety is a 2′-MOE modification.

11. The compound of claim 7 wherein the modified nucleobase is a 5-methylcytosine.

12. A pharmaceutical composition comprising a compound of claim 2 and a pharmaceutically acceptable penetration enhancer, carrier, or diluent.

13-18. (canceled)

Resources

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: