Patent application title:

Molecular markers and methods for identifying date palm genotypes

Publication number:

US20150337395A1

Publication date:
Application number:

14/647,242

Filed date:

2013-11-26

Abstract:

The present invention concerns two sets of mini- and micro-satellite molecular markers, and the use thereof to study the genetic diversity and/or identify the genotypes of date palms. The invention also concerns method for identifying date palm cultivars using these sets of molecular markers, and kits for implementing these methods.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/6895 »  CPC main

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae

C12Q2600/156 »  CPC further

Oligonucleotides characterized by their use Polymorphic or mutational markers

C12Q1/68 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Description

RELATED PATENT APPLICATIONS

The present application is filed pursuant to 35 U.S.C §371 as a U.S. National Phase application of international application No. PCT/EP2013/074728, which was filed on Nov. 26, 2013, claiming the benefit of French patent application number FR 12 61226 filed on Nov. 26, 2012. The International application was published as PCT Publication No. WO 2014/080034 on May 30, 2014. The entire contents of each of the aforementioned applications is incorporated herein by reference in their entirety.

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been filed electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 26, 2015, is named 47855002002_SL.txt and is 8,780 bytes in size.

FIELD OF THE INVENTION

The present invention concerns two sets of molecular markers specific for the genetic variety of date palms and the use thereof for identifying date palm genotypes and cultivars.

CONTEXT OF THE INVENTION

The date palm (Phoenix dactylifera L.) is a monocotyledonous plant of the family Arecaceae which is widely cultivated for its fruits, which are dates. In arid regions, the date palm plays not only a major economic role, through the production of dates which make up the basis of the human and animal diet, but also an ecological role since it gives the oasis its structure. The date palm has been cultivated by humans for thousands of years; the first documents and drawings confirm the cultivation thereof going back to 6000 years BC. Suitable for cultivation in arid and semi-arid regions, it has gradually been introduced on the five continents.

The cultivation of the date palm has evolved from a traditional, rich and diversified system to an industrial system centered on a single-variety oligoculture. This constitutes a potential risk of genetic erosion of the inheritance. The loss of genetic diversity is worsened by the biotic stresses (diseases and ravaging pests) and abiotic stresses (drought and soil salinity) to which palm groves are subjected. Consequently, it becomes essential, for many producing countries, to characterize the diversity of the genetic resources, in order to organize the preservation and safeguarding thereof.

The characterization of the diversity of date palm cultivars can be obtained using morphological markers or molecular markers of RAPD (Random Amplified Polymorphic DNA), RFLP (Restriction Fragment Length Polymorphism), AFLP (Amplified Fragment Length Polymorphism) and SSR (Simple Sequence Repeat) type. During the last decade, the development and use of molecular markers made it possible to improve the study of genetic resources in plant organisms by reducing the uncertainty due to the variation in morphological and agronomic characters under the effect of environmental factors.

Microsatellite markers or SSRs are particularly advantageous: they are abundant in the genome; they have high levels of polymorphism, which provides great reliability in the characterization of individuals; and they are codominant and transmitted according to Mendelian law.

In the date palm, 16 dinucleotide microsatellite markers, (GA)n, have been generated from a DNA library (Billotte et al., Molecular Ecology Notes, 2004, 4: 256-258). These markers have been validated with respect to their accuracy in distinguishing the various cultivars of Tunisia (Zehdi et al., Hereditas, 2004, 141: 278-287) and of Sudan (Elshibli et al., Genetica, 2008, 134: 251-260). However, the majority of the date palm diversity studies have been carried out using various sets of markers. Furthermore, the microsatellite markers have generally been validated on samplings carried out at the local geographic level. It follows that the results obtained by the various teams are not internationally compatible. In addition, some dinucleotide markers are difficult to analyze because of the size of the alleles generated, sometimes varying by a single nucleotide. Since 2011, the partial sequencing of the date palm genome, which was recently published (Al-Dous et al., Nature Biotechnology, 2011, 29: 521-527), has offered the possibility of gaining access to a large number of markers with various repeating motifs.

It is therefore important to develop new strategies, validated on samplings representing the worldwide diversity of the species, which make it possible to standardize the identification procedures with the objective of characterizing the agrodiversity of the date palm. Such strategies would open up new horizons for the reintroduction of biodiversity in palm groves and implementation of programs for genetic improvement. There is also a need for tools enabling the certification of vegetatively propagated plants sought by farmers in palm groves and vitroplant production laboratories.

SUMMARY OF THE INVENTION

Generally, the present invention relates to sets of optimized molecular markers, composed of a limited number of markers selected for their precision and their capacity to generate a high polymorphism. These sets of markers have been validated on a collection of genotypes representing the worldwide diversity of the date palm. More specifically, the present invention relates to a first set of 19 mini- and microsatellite markers making it possible to analyze 100% of genotypes. This set is particularly useful for research on the analysis of genetic diversity, the identification of genotypes, the analysis of hybrids and gene flows within Phoenix. The present invention also relates to a second set of 7 mini- and microsatellite markers making it possible to identify 99% of genotypes. This second set is particularly useful for the certification of cultivars. The inventors have also designed a reference cultivar library covering the worldwide diversity of the date palm and a database which manages all the information generated.

Consequently, in a first aspect, the present invention relates to a first set of mini- and microsatellite markers specific for the date palm, characterized in that the set consists of the following 19 microsatellite markers:

    • the mPdCIR010 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571673.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 1 and, in 3′, by the nucleotide sequence SEQ ID NO: 2;
    • the mPdCIR015 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571674.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 3 and, in 3′, by the nucleotide sequence SEQ ID NO: 4;
    • the mPdCIR016 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571675.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 5 and, in 3′, by the nucleotide sequence SEQ ID NO: 6;
    • the mPdCIR025 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571676.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 7 and, in 3′, by the nucleotide sequence SEQ ID NO: 8;
    • the mPdCIR032 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571677.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 9 and, in 3′, by the nucleotide sequence SEQ ID NO: 10;
    • the mPdCIR035 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571678.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 11 and, in 3′, by the nucleotide sequence SEQ ID NO: 12;
    • the mPdCIR057 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571682.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 13 and, in 3′, by the nucleotide sequence SEQ ID NO: 14;
    • the mPdCIR063 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571683.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 15 and, in 3′, by the nucleotide sequence SEQ ID NO: 16;
    • the mPdCIR078 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571685.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 17 and, in 3′, by the nucleotide sequence SEQ ID NO: 18;
    • the mPdCIR085 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571686.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 19 and, in 3′, by the nucleotide sequence SEQ ID NO: 20;
    • the CpfM12 marker, which, in the 5′→3′ direction, has a (ctaactactata) motif, is present in the sequence having the GenBank accession number EU043484.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 21 and, in 3′, by the nucleotide sequence SEQ ID NO: 22;
    • the PdCUC3-ssr1 marker, which, in the 5′→3′ direction, has a (gt+ga) motif, is present in the sequence having the GenBank accession number HM622273.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 23 and, in 3′, by the nucleotide sequence SEQ ID NO: 24;
    • the PdCUC3-ssr2 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number HM622273.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 25 and, in 3′, by the nucleotide sequence SEQ ID NO: 26;
    • the PdAG1-ssr1 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number KC188338.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 27 and, in 3′, by the nucleotide sequence SEQ ID NO: 28;
    • the PdAP3-ssr marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number KC188337.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 29 and, in 3′, by the nucleotide sequence SEQ ID NO: 30;
    • the mPdIRD13 marker, which, in the 5′→3′ direction, has a (cac) motif, is present in the PDK20 s1496731g0021 scaffold (GenBank accession number GL741615.1), and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 31 and, in 3′, by the nucleotide sequence SEQ ID NO: 32;
    • the mPdIRD31 marker, which, in the 5′→3′ direction, has a (cca) motif, is present in the PDK20 s1419261g0031 scaffold (described in http://qatar-weill.cornell.edu/research/datepalmGenome/download.html), and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 33 and, in 3′, by the nucleotide sequence SEQ ID NO: 34;
    • the mPdIRD33 marker, which, in the 5′→3′ direction, has a (cag) motif, is present in the PDK20 s1569281g0011 scaffold (described in http://qatar-weill.cornell.edu/research/datepalmGenome/download.html), and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 35 and, in 3′, by the nucleotide sequence SEQ ID NO: 36; and
    • the mPdIRD40 marker, which, in the 5′ →3′ direction, has a (ccagtg) motif, is present in the PDK20 s1327401g0021 scaffold (described in http://qatar-weill.cornell.edu/research/datepalmGenome/download.html), and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 37 and, in 3′, by the nucleotide sequence SEQ ID NO: 38.

The present invention also relates to a second set of mini- and microsatellite markers specific for the date palm, characterized in that the set consists of the following 7 microsatellite markers: CpfM12, mPdIRD031, mPdIRD033, mPdIRD040, PdCUC3-ssr2, PdAP3-ssr and mPdCIR078 as defined above.

In another aspect, the present invention relates to a method for identifying the genotype of a date palm by detecting, using the set of 19 mini- and microsatellite markers, an SSR polymorphism in the genome of the date palm, characterized in that the detecting of the SSR polymorphism comprises, for each molecular marker of the set:

    • amplification of a portion of the genomic DNA of the date palm tested which comprises the mini- or microsatellite, using a pair of primers specific for the marker in order to obtain amplicons; and
    • analysis of the amplicons obtained in order to determine the genotype of the date palm tested.

In some embodiments, the analysis of the amplicons comprises the analysis of the amplicon sizes.

In some embodiments, the method is characterized in that the amplifications are carried out with each of the pairs of specific primers that follow:

    • a forward SSR primer of sequence SEQ ID NO: 1 and a reverse SSR primer of sequence SEQ ID NO: 2;
    • a forward SSR primer of sequence SEQ ID NO: 3 and a reverse SSR primer of sequence SEQ ID NO: 4;
    • a forward SSR primer of sequence SEQ ID NO: 5 and a reverse SSR primer of sequence SEQ ID NO: 6;
    • a forward SSR primer of sequence SEQ ID NO: 7 and a reverse SSR primer of sequence SEQ ID NO: 8;
    • a forward SSR primer of sequence SEQ ID NO: 9 and a reverse SSR primer of sequence SEQ ID NO: 10;
    • a forward SSR primer of sequence SEQ ID NO: 11 and a reverse SSR primer of sequence SEQ ID NO: 12;
    • a forward SSR primer of sequence SEQ ID NO: 13 and a reverse SSR primer of sequence SEQ ID NO: 14;
    • a forward SSR primer of sequence SEQ ID NO: 15 and a reverse SSR primer of sequence SEQ ID NO: 16;
    • a forward SSR primer of sequence SEQ ID NO: 17 and a reverse SSR primer of sequence SEQ ID NO: 18;
    • a forward SSR primer of sequence SEQ ID NO: 19 and a reverse SSR primer of sequence SEQ ID NO: 20;
    • a forward SSR primer of sequence SEQ ID NO: 21 and a reverse primer of sequence SEQ ID NO: 22;
    • a forward SSR primer of sequence SEQ ID NO: 23 and a reverse SSR primer of sequence SEQ ID NO: 24;
    • a forward SSR primer of sequence SEQ ID NO: 25 and a reverse SSR primer of sequence SEQ ID NO: 26;
    • a forward primer of sequence SEQ ID NO: 27 and a reverse SSR primer of sequence SEQ ID NO: 28;
    • a forward SSR primer of sequence SEQ ID NO: 29 and a reverse SSR primer of sequence SEQ ID NO: 30;
    • a forward SSR primer of sequence SEQ ID NO: 31 and a reverse SSR primer of sequence SEQ ID NO: 32;
    • a forward SSR primer of sequence SEQ ID NO: 33 and a reverse SSR primer of sequence SEQ ID NO: 34;
    • a forward SSR primer of sequence SEQ ID NO: 35 and a reverse SSR primer of sequence SEQ ID NO: 36; and
    • a forward SSR primer of sequence SEQ ID NO: 37 and a reverse SSR primer of sequence SEQ ID NO: 38.

In another aspect, the present invention relates to a method for identifying or certifying a date palm cultivar by detecting, using the set of 7 mini- or microsatellite markers, an SSR polymorphism in the genome of the date palm, characterized in that the detecting of the SSR polymorphism comprises, for each molecular marker of the set:

    • amplification of a portion of the genomic DNA of the date palm tested which comprises the mini- or microsatellite, using a pair of primers specific for the marker in order to obtain amplicons; and
    • analysis of the amplicons obtained in order to determine the genotype of the date palm tested.

In some embodiments, the analysis of the amplicons comprises the analysis of the amplicon sizes.

In some embodiments, the method is characterized in that the amplifications are carried out with each of the pairs of specific primers that follow:

    • a forward SSR primer of sequence SEQ ID NO: 17 and a reverse SSR primer of sequence SEQ ID NO: 18;
    • a forward SSR primer of sequence SEQ ID NO: 21 and a reverse SSR primer of sequence SEQ ID NO: 22;
    • a forward SSR primer of sequence SEQ ID NO: 25 and a reverse SSR primer of sequence SEQ ID NO: 26;
    • a forward SSR primer of sequence SEQ ID NO: 29 and a reverse SSR primer of sequence SEQ ID NO: 30;
    • a forward SSR primer of sequence SEQ ID NO: 33 and a reverse SSR primer of sequence SEQ ID NO: 34;
    • a forward SSR primer of sequence SEQ ID NO: 35 and a reverse SSR primer of sequence SEQ ID NO: 36; and
    • a forward SSR primer of sequence SEQ ID NO: 37 and a reverse SSR primer of sequence SEQ ID NO: 38.

In some embodiments of the methods according to the invention, the step of analyzing the amplicons obtained in order to determine the genotype or the cultivar of the date palm tested comprises, for each of the markers of the set used:

    • separation, as a function of their size, of the amplicons obtained by amplification of a portion of the genomic DNA of the date palm tested, and
    • comparison of the sizes of said amplicons with the sizes of the amplicons obtained by amplification, under the same conditions, of a portion of the genomic DNA of control date palms.

In some embodiments, the methods according to the invention are carried out on genomic DNA extracted from a sample of the date palm tested, where the sample of the date palm is a protoplast, callus, embryo, leaf, stipe, root, shoot or cutting sample of the date palm.

In another aspect, the present invention relates to a first set of pairs of primers specific for a microsatellite marker for identifying the genotype of a date palm, the set consisting of the following pairs of primers:

    • a forward SSR primer of sequence SEQ ID NO: 1 and a reverse SSR primer of sequence SEQ ID NO: 2;
    • a forward SSR primer of sequence SEQ ID NO: 3 and a reverse SSR primer of sequence SEQ ID NO: 4;
    • a forward SSR primer of sequence SEQ ID NO: 5 and a reverse SSR primer of sequence SEQ ID NO: 6;
    • a forward SSR primer of sequence SEQ ID NO: 7 and a reverse SSR primer of sequence SEQ ID NO: 8;
    • a forward SSR primer of sequence SEQ ID NO: 9 and a reverse SSR primer of sequence SEQ ID NO: 10;
    • a forward SSR primer of sequence SEQ ID NO: 11 and a reverse SSR primer of sequence SEQ ID NO: 12;
    • a forward SSR primer of sequence SEQ ID NO: 13 and a reverse SSR primer of sequence SEQ ID NO: 14;
    • a forward SSR primer of sequence SEQ ID NO: 15 and a reverse SSR primer of sequence SEQ ID NO: 16;
    • a forward SSR primer of sequence SEQ ID NO: 17 and a reverse SSR primer of sequence SEQ ID NO: 18;
    • a forward SSR primer of sequence SEQ ID NO: 19 and a reverse SSR primer of sequence SEQ ID NO: 20;
    • a forward SSR primer of sequence SEQ ID NO: 21 and a reverse primer of sequence SEQ ID NO: 22;
    • a forward SSR primer of sequence SEQ ID NO: 23 and a reverse SSR primer of sequence SEQ ID NO: 24;
    • a forward SSR primer of sequence SEQ ID NO: 25 and a reverse SSR primer of sequence SEQ ID NO: 26;
    • a forward primer of sequence SEQ ID NO: 27 and a reverse SSR primer of sequence SEQ ID NO: 28;
    • a forward SSR primer of sequence SEQ ID NO: and a reverse SSR primer of sequence SEQ ID NO: 30;
    • a forward SSR primer of sequence SEQ ID NO: and a reverse SSR primer of sequence SEQ ID NO: 32;
    • a forward SSR primer of sequence SEQ ID NO: 33 and a reverse SSR primer of sequence SEQ ID NO: 34;
    • a forward SSR primer of sequence SEQ ID NO: 35 and a reverse SSR primer of sequence SEQ ID NO: 36; and
    • a forward SSR primer of sequence SEQ ID NO: 37 and a reverse SSR primer of sequence SEQ ID NO: 38.

The present invention also relates to a second set of pairs of primers specific for a microsatellite marker for identifying or certifying the cultivar of a date palm, the set consisting of the following pairs of primers:

    • a forward SSR primer of sequence SEQ ID NO: 17 and a reverse SSR primer of sequence SEQ ID NO: 18;
    • a forward SSR primer of sequence SEQ ID NO: 21 and a reverse SSR primer of sequence SEQ ID NO: 22;
    • a forward SSR primer of sequence SEQ ID NO: 25 and a reverse SSR primer of sequence SEQ ID NO: 26;
    • a forward SSR primer of sequence SEQ ID NO: 29 and a reverse SSR primer of sequence SEQ ID NO: 30;
    • a forward SSR primer of sequence SEQ ID NO: 33 and a reverse SSR primer of sequence SEQ ID NO: 34;
    • a forward SSR primer of sequence SEQ ID NO: 35 and a reverse SSR primer of sequence SEQ ID NO: 36; and a forward SSR primer of sequence SEQ ID NO: 37 and a reverse SSR primer of sequence SEQ ID NO: 38.

In some embodiments, a set of pairs of primers according to the invention is characterized in that one of the primers of each of the pairs of primers comprises a detectable marker.

One aspect of the invention relates to the use of the first set of pairs of primers for identifying the genotype of a date palm.

Another aspect of the invention relates to the use of the second set of pairs of primers for identifying or certifying the cultivar of a date palm.

Finally, the invention provides a first kit for identifying the genotype of date palms, comprising the first set of 19 pairs of primers according to the invention and instructions for carrying out a method for identifying the genotype according to the invention.

The invention also provides a second kit for identifying or certifying the cultivar of date palms, comprising the second set of 7 pairs of primers according to the invention and instructions for carrying out a method for identifying the cultivar according to the invention.

A more detailed description of some preferred embodiments of the invention is given below.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 depicts an identification key to identify 99% of the genotypes.

DETAILED DESCRIPTION OF THE INVENTION

As mentioned above, the present invention relates to two sets of molecular markers for studying the genetic biodiversity of the date palm and identifying cultivars.

I—Sets of Markers for Genotyping the Date Palm

The inventors have assembled a novel optimized collection of mini- and microsatellites defined by the exploitation of microsatellite markers described in the literature or identified from the available genomic resources.

The term “minisatellite” is intended to mean herein a DNA sequence formed by a continuous repetition of motifs composed of 10 to 100 nucleotides and most commonly flanked by conserved regions. The term “microsatellite” is intended to mean herein a DNA sequence formed by a continuous repetition of motifs composed of 1 to 10 nucleotides and most commonly flanked by conserved regions. Generally, the length of these (minisatellite or microsatellite) SSR sequences, i.e. the number of repetitions of the motif, is variable from one species to another, from one individual to another and from one allele to another in the same individual. All of the information relating to the lengths of sequences of the mini- and microsatellite markers is indicative of the genotype of the date palm.

The first set of markers according to the invention comprises 19 SSR markers: CpfM12, mPdIRD031, mPdIRD033, mPdIRD040, PdCUC3-ssr2, PdAP3-ssr, mPdCIR078, mPdCIR015, mPdCIR016, mPdCIR032, mPdCIR035, mPdCIR057, mPdCIR085, PdAG1-ssr, mPdCIR010, mPdCIR025, mPdCIR063, PdCUC3-ssr1 and mPdIRD013.

The second set of markers according to the invention comprises 7 SSR markers: CpfM12, mPdIRD031, mPdIRD033, mPdIRD040, PdCUC3-ssr2, PdAP3-ssr and mPdCIR078.

The mPdCIR078, mPdCIR015, mPdCIR016, mPdCIR032, mPdCIR035, mPdCIR057, mPdCIR085, mPdCIR010, mPdCIR025 and mPdCIR063 markers are (GA)n dinucleotide loci which have been described by Billotte et al. (Molecular Ecology Notes, 2004, 4: 256-258).

The mPdIRD031, mPdIRD033, mPdIRD040 and mPdIRD013 markers are microsatellite tandem repeats of 3 or 6 base pairs that the present inventors have identified in silico in coding sequences of the sequence of the date palm genome (Al-Dous et al., Nature Biotechnology, 2011, 29: 521-527—http://qatar-weill.cornell.edu/research/datepalmGenome/download.html). These 4 loci were selected among 47 for their amplification capacity and the polymorphism that they generate.

The PdCUC3-ssr1 and PdCUC3-ssr2 markers are dinucleotide sequences identified in CUC genes (Adam et al., Molecular Biology and Evolution, 2010, 28: 1439-1454).

The PdAG1-ssr1 and PdAP3-ssr1 markers are dinucleotide sequences identified by the present inventors in the AG1 gene and the AP3 gene (not published) respectively.

The CpfM12 marker is a minisatellite marker of the chloroplast genome (Henderson et al., Conservation Genetics, 2006, 7: 213-223).

The invention relates to two sets of mini- and microsatellite markers specific for the genetic diversity of the date palm, where the markers are identified either by their motif and the sequence in which they are contained, or by their motif and the conserved nucleotide sequences which flank them in 5′ and in 3′. The terms “nucleotide sequence”, “sequence” and “nucleic sequence” are used herein without implied distinction. These terms are intended to denote a precise succession of nucleotides which makes it possible to define a region of a nucleic acid and which can correspond both to a double-stranded DNA or a single-stranded DNA and to products of transcription of these DNA molecules.

The information provided below for defining each SSR marker of a set of markers according to the invention concerns the 5′→3′ strand of the region of the genome in which the SSR is located. As those skilled in the art will recognize, given that an SSR sequence is a double-stranded DNA sequence, the invention also encompasses the complementary motif and the complementary locus (which are on the 3′→5′ strand).

The mPdCIR010 marker is characterized in that, in the 5′→3′ direction, it has a (ga) motif, it is present in the sequence having the GenBank accession number AJ571673.1 (Phoenix dactylifera microsatellite DNA, clone CIR010), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 1 and, in 3′, by the nucleotide sequence SEQ ID NO: 2.

The mPdCIR015 marker is characterized in that, in the 5′→3′ direction, it has a (ga) motif, it is present in the sequence having the GenBank accession number AJ571674.1 (Phoenix dactylifera microsatellite DNA, clone CIR015), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 3 and, in 3′, by the nucleotide sequence SEQ ID NO: 4.

The mPdCIR016 marker is characterized in that, in the 5′→3′ direction, it has a (ga) motif, it is present in the sequence having the GenBank accession number AJ571675.1 (Phoenix dactylifera microsatellite DNA, clone CIR016), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 5 and, in 3′, by the nucleotide sequence SEQ ID NO: 6.

The mPdCIR025 marker is characterized in that, in the 5′→3′ direction, it has a (ga) motif, it is present in the sequence having the GenBank accession number AJ571676.1 (Phoenix dactylifera microsatellite DNA, clone CIR025), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 7 and, in 3′, by the nucleotide sequence SEQ ID NO: 8.

The mPdCIR032 marker is characterized in that, in the 5′→3′ direction, it has a (ga) motif, it is present in the sequence having the GenBank accession number AJ571677.1 (Phoenix dactylifera microsatellite DNA, clone CIR032), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 9 and, in 3′, by the nucleotide sequence SEQ ID NO: 10.

The mPdCIR035 marker is characterized in that, in the 5′→3′ direction, it has a (ga) motif, it is present in the sequence having the GenBank accession number AJ571678.1 (Phoenix dactylifera microsatellite DNA, clone CIR035), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 11 and, in 3′, by the nucleotide sequence SEQ ID NO: 12.

The mPdCIR057 marker is characterized in that, in the 5′→3′ direction, it has a (ga) motif, it is present in the sequence having the GenBank accession number AJ571682.1 (Phoenix dactylifera microsatellite DNA, clone CIR057), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 13 and, in 3′, by the nucleotide sequence SEQ ID NO: 14.

The mPdCIR063 marker is characterized in that, in the 5′→3′ direction, it has a (ga) motif, it is present in the sequence having the GenBank accession number AJ571683.1 (Phoenix dactylifera microsatellite DNA, clone CIR063), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 15 and, in 3′, by the nucleotide sequence SEQ ID NO: 16.

The mPdCIR078 marker is characterized in that, in the 5′→3′ direction, it has a (ga) motif, it is present in the sequence having the GenBank accession number AJ571685.1 (Phoenix dactylifera microsatellite DNA, clone CIR078), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 17 and, in 3′, by the nucleotide sequence SEQ ID NO: 18.

The mPdCIR085 marker is characterized in that, in the 5′→3′ direction, it has a (ga) motif, it is present in the sequence having the GenBank accession number AJ571686.1 (Phoenix dactylifera microsatellite DNA, clone CIR085), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 19 and, in 3′, by the nucleotide sequence SEQ ID NO: 20.

The CpfM12 marker is characterized in that, in the 5′→3′ direction, it has a (ctaactactata) motif, it is present in the sequence having the GenBank accession number EU043484.1, and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 21 and, in 3′, by the nucleotide sequence SEQ ID NO: 22.

The PdCUC3-ssr1 marker is characterized in that, in the 5′→3′ direction, it has a (gt+ga) motif, it is present in the sequence having the GenBank accession number HM622273.1 (Phoenix dactylifera cup-shaped cotyledon 3-related protein (CUC3) gene, partial cds), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 23 and, in 3′, by the nucleotide sequence SEQ ID NO: 24.

The PdCUC3-ssr2 marker is characterized in that, in the 5′→3′ direction, it has a (ga) motif, it is present in the sequence having the GenBank accession number HM622273.1 (Phoenix dactylifera cup-shaped cotyledon 3-related protein (CUC3) gene, partial cds), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 25 and, in 3′, by the nucleotide sequence SEQ ID NO: 26.

The PdAG1-ssr1 marker is characterized in that, in the 5′→3′ direction, it has a (ga) motif, it is present in the sequence having the GenBank accession number KC188338.1, and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 27 and, in 3′, by the nucleotide sequence SEQ ID NO: 28.

The PdAP3-ssr marker is characterized in that, in the 5′→3′ direction, it has a (ga) motif, it is present in the sequence having the GenBank accession number KC188337.1, and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 29 and, in 3′, by the nucleotide sequence SEQ ID NO: 30.

The mPdIRD13 marker is characterized in that, in the 5′→3′ direction, it has a (cac) motif, it is present in the PDK20 s1496731g0021 scaffold (GenBank accession number GL741615.1), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 31 and, in 3′, by the nucleotide sequence SEQ ID NO: 32.

The mPdIRD31 marker is characterized in that, in the 5′→3′ direction, it has a (cca) motif, it is present in the PDK20 s1419261g0031 scaffold (described in http://qatar-weill.cornell.edu/research/datepalmGenome/download.html), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 33 and, in 3′, by the nucleotide sequence SEQ ID NO: 34.

The mPdIRD33 marker is characterized in that, in the 5′→3′ direction, it has a (cag) motif, it is present in the PDK20 s1569281g0011 scaffold (described in http://qatar-weill.cornell.edu/research/datepalmGenome/download.html), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 35 and, in 3′, by the nucleotide sequence SEQ ID NO: 36.

The mPdIRD40 marker is characterized in that, in the 5′→3′ direction, it has a (ccagtg) motif, it is present in the PDK20 s1327401g0021 scaffold (described in http://qatar-weill.cornell.edu/research/datepalmGenome/download.html), and it is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 37 and, in 3′, by the nucleotide sequence SEQ ID NO: 38.

II—Use of the Sets of Markers for Identifying Date Palm Genotypes and/or Date Palm Cultivars

As the present inventors have demonstrated, the sets of molecular markers described above can be used for identifying date palm genotypes. Generally, an identification method according to the invention is carried out by detecting, using a set of markers, an SSR polymorphism in the genome of a date palm individual, and comprises, for each of the mini- or microsatellite markers of the set, the amplification of a region of the genome of the date palm to be tested, the region comprising the SSR sequence.

Date Palm Samples

In a method according to the invention, the step consisting in amplifying a region (or portion) of the genome of the date palm comprising a repeat SSR motif is carried out on a sample of the date palm to be tested, and preferably on genomic DNA extracted from the sample of the date palm. The term “genomic DNA” is intended to mean herein the DNA of the nuclear genome (i.e. the genomic DNA contained in the nucleus) and of the chloroplast genome (i.e. the genomic DNA contained in the chloroplasts).

Any date palm sample containing genomic DNA can therefore be used in the implementation of the present invention. For example, the genomic DNA can be extracted from date palm protoplasts, calluses, embryos, leaves, stipes, roots, shoots or cuttings.

The methods for extracting DNA from biological tissues are well known in the art (see, for example, Sambrook et al., “Molecular Cloning—A Laboratory Manual”, Cold Spring Harbor Laboratory Press, 1989). There are also numerous commercially available kits (for example from BD Biosciences Clontech (Palo Alto, Calif.), Epicentre Technologies (Madison, Wis.), Gentra Systems, Inc. (Minneapolis, Minn.), MicroProbe Corp. (Bothell, Wash.), Organon Teknika (Durham, N.C.) and Qiagen Inc. (Valencia, Calif.)) which can be used to extract the DNA from date palm samples.

Amplification of the Microsatellite Sequence

As those skilled in the art will recognize, in the implementation of the invention, the amplification of a portion of the date palm genome comprising a microsatellite sequence according to the invention can be carried out by any appropriate technique known in the art, since the technique used is not a limiting factor of the invention.

Preferably, in a method according to the invention, the genomic DNA amplification reactions are carried out by PCR (Polymerase Chain Reaction) amplification (Mullis and Faloona, Methods Enzymol., 1987, 155: 355-350) which offers the advantage of analyzing the molecular markers in a short time while using low DNA concentrations. The flanking regions of the microsatellites serve as primers during the PCR. Given that these regions are conserved, a pair of primers specific for these flanking regions specifically amplifies only this microsatellite (and not another).

The various amplicons (or amplification products) generated from a given microsatellite region have characteristic and reproducible sizes. The variation in the sizes of the PCR products is caused by differences in the number of repeats of the motif of the microsatellite. These sizes are therefore indicative of the length (if the date palm sample is homozygous) or the lengths (if the date palm sample is heterozygous) of the microsatellite sequence in the individual.

Those skilled in the art know how to select the optimal conditions (temperature, time and number of cycles, pH, and concentration of the reagents) for performing a PCR amplification (“PCR Protocols: A Guide to Methods and Applications”, M. A. Innis (Ed.), 1990, Academic Press: New York; “PCR Strategies”, M. A. Innis (Ed.), 1995, Academic Press: New York; “Polymerase chain reaction: basic principles and automation in PCR: A Practical Approach”, McPherson et al. (Eds.), 1991, IRL Press: Oxford; R. K. Saiki et al., Nature, 1986, 324: 163-166).

Primers and Probes for the Amplification of a Portion of the Date Palm Genome Comprising an SSR Sequence

On the basis of the nucleotide sequence of a scaffold or other genomic sequence in which a microsatellite of a set of molecular markers of the invention is located and of the position of this microsatellite in this scaffold or this sequence, those skilled in the art know how to design SSR primers suitable for the amplification of a portion of the date palm genome which comprises the microsatellite sequence.

The terms “primer” and “PCR primer” are used here interchangeably and denote an oligonucleotide which is capable of acting as a starting point for the synthesis of an amplification product, when it is placed under appropriate amplification conditions (for example, salt concentration, temperature and pH) in the presence of nucleotides and of a nucleic acid polymerization agent (for example a DNA polymerase). A primer according to the invention comprises an oligonucleotide advantageously containing between 5 and 50 nucleotides, generally between 15 and 50 nucleotides, preferably between 20 and 35 nucleotides, and even more preferably between 20 and 25 nucleotides (for example, 20, 21, 22, 23, 24 or 25 nucleotides).

The term “SSR primer” refers to a primer which is specific for a region flanking or adjacent to the microsatellite region and which, in combination with another SSR primer, is capable of specifically amplifying the microsatellite region. The amplification is generally carried out using a pair of SSR primers comprising a forward (or “sense”) primer and a reverse (or “antisense”) primer which each hybridize on one of the two strands of the genomic DNA.

Preferably, a forward SSR primer according to the invention comprises, or consists of, a sequence of 15 to 50 consecutive nucleotides, preferably of 20 to 35 consecutive nucleotides, and even more preferably of 20 to 25 consecutive nucleotides, of the sequence of at most 1000 nucleotides flanking, in 5′, the microsatellite region according to the invention. Preferably, a reverse SSR primer according to the invention comprises, or consists of, a sequence of 15 to 50 consecutive nucleotides, preferably of 20 to 35 consecutive nucleotides, and even more preferably of 20 to 25 consecutive nucleotides, of the sequence complementary to the sequence of at most 1000 nucleotides flanking, in 3′, the microsatellite region according to the invention.

The term “sequence complementary to” a given nucleotide sequence is intended to mean a sequence which forms, by hybridization, a stable duplex with said nucleotide sequence. The term “sequence complementary to” denotes both the complementary sequence presented in the 3′→5′ direction and the complementary sequence presented in the 5′→3′ direction (i.e. the reverse complementary sequence). The term “hybridization” is intended to mean herein the head-to-tail association of two single-stranded polynucleotides by Watson-Crick pairings (A-T, G-C). In certain cases, the hybridization is perfect, i.e. the sequences are totally complementary. Thus, for example, the term “the sequence complementary to the sequence SEQ ID NO: 1” is the nucleotide sequence which is perfectly or totally complementary to SEQ ID NO: 1.

Thus, in the implementation of a method of the invention, the amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ga) motif of the mPdCIR010 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 1 (ACCCCGGACGTGAGGTG), and
    • a reverse SSR primer of sequence SEQ ID NO: 2 (CGTCGATCTCCTCCT TTGTCTC).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ga) motif of the mPdCIR015 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 3 (AGCTGGCTCCTCCCTTCTTA), and
    • a reverse SSR primer of sequence SEQ ID NO: 4 (GCTCGGTTGGACTTGTTCT).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ga) motif of the mPdCIR016 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 5 (AGCGGGAAATGAAAAGGTAT), and
    • a reverse SSR primer of sequence SEQ ID NO: 6 (ATGAAAACGTGCCAAATGTC).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ga) motif of the mPdCIR025 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 7 (GCACGAGAAGGCTTATAGT), and
    • a reverse SSR primer of sequence SEQ ID NO: 8 (CCCCTCATTAGGATTCTAC).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ga) motif of the mPdCIR032 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 9 (CAAATCTTTGCCGTGAG), and
    • a reverse SSR primer of sequence SEQ ID NO: 10 (GGTGTGGAGTAATCATGTAGTAG).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ga) motif of the mPdCIR035 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 11 (ACAAACGGCGATGGGATTAC), and
    • a reverse SSR primer of sequence SEQ ID NO: 12 (CCGCAGCTCACCTCTTCTAT).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ga) motif of the mPdCIR057 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 13 (AAGCAGCAGCCCTTCCGTAG), and
    • a reverse SSR primer of sequence SEQ ID NO: 14 (GTTCTCACTCGCCCAAAAATAC).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ga) motif of the mPdCIR063 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 15 (CTTTTATGTGGTCTGAGAGA), and
    • a reverse SSR primer of sequence SEQ ID NO: 16 (TCTCTGATCTTGGGTTCTGT).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ga) motif of the mPdCIR078 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 17 (TGGATTTCCATTGTGAG), and
    • a reverse SSR primer of sequence SEQ ID NO: 18 (CCCGAAGAGACGCTATT).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ga) motif of the mPdCIR085 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 19 (GAGAGAGGGTGGTGTTATT), and
    • a reverse SSR primer of sequence SEQ ID NO: 20 (TTCATCCAGAACCACAGTA).

The amplification of a region of the genome of the date palm comprising the sequence of the minisatellite having the (ctaactactata) motif of the CpfM12 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 21 (CCGCCCACGATGAAGTAATGTA), and
    • a reverse SSR primer of sequence SEQ ID NO: 22 (GTCACGGGTTCAAATCCTGTCTC).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (gt+ga) motif of the PdCUC3-ssr1 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 23 (CGTGGACTCATGACTCGCATGTCC), and
    • a reverse SSR primer of sequence SEQ ID NO: 24 (GGTCCTTGCCGGTGGCCTTC).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ga) motif of the PdCUC3-ssr2 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 25 (ACATTGCTCTTTTGCCATGGGCT), and
    • a reverse SSR primer of sequence SEQ ID NO: 26 (CGAGCAGGTGGGGTTCGGGT).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ga) motif of the PdAG1-ssr1 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 27 (TCTGATTTCGTTTACTTCTTAGGA), and
    • a reverse SSR primer of sequence SEQ ID NO: 28 (TTCATATTCAGTTGTCGGGTGTA).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ga) motif of the PdAP3-ssr marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 29 (GAGAAATAGAGAGCTGTGCAAG), and
    • a reverse SSR primer of sequence SEQ ID NO: 30 (CTGCAGTACTCGGAGAACTTG).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (cac) motif of the mPdIRD13 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer of sequence SEQ ID NO: 31 (GCGGAGACAGGAGATGGTAA), and
    • a reverse SSR primer of sequence SEQ ID NO: 32 (CTTGACTGCTTCTGCTGCTG).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (cca) motif of the mPdIRD31 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer comprising, or consisting of, between 15 and 50 consecutive nucleotides of the sequence of at most 1000 nucleotides flanking, in 5′, position 29073 in the PDK20 s1419261g0031 scaffold (http://qatar-weill.cornell.edu/research/datepalmGenome/download.html), and
    • a reverse SSR primer comprising, or consisting of, between 15 and 50 consecutive nucleotides of the sequence complementary to the sequence of at most 1000 nucleotides flanking, in 3′, position 29093 in the PDK20 s1419261g0031 scaffold.

The sequence of at most 1000 nucleotides may comprise any number of nucleotides preferably between 1000 and 250, for example 1000, 900, 800, 700, 600, 500, 400, 300 or 250.

In one particular embodiment, a pair of primers for the amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (cca) motif of the mPdIRD31 marker comprise a forward SSR primer of sequence SEQ ID NO: 33 (GCAGGTGGACTGCAAAATCT) and a reverse SSR primer of sequence SEQ ID NO: 34 (CTATTGGGGTGCTGATCCAT).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (cag) motif of the mPdIRD33 marker is preferably carried out using a pair of SRR primers comprising:

    • a forward SSR primer comprising, or consisting of, between 15 and 50 consecutive nucleotides of the sequence of at most 1000 nucleotides flanking, in 5′, position 5206 in the PDK20 s1569281g0011 scaffold (http://qatar-weill.cornell.edu/research/datepalmGenome/download.html), and
    • a reverse SSR primer comprising, or consisting of, between 15 and 50 consecutive nucleotides of the sequence complementary to the sequence of at most 1000 nucleotides flanking, in 3′, position 5226 in the PDK20 s1569281g0011 scaffold.

The sequence of at most 1000 nucleotides may comprise any number of nucleotides preferably between 1000 and 250, for example 1000, 900, 800, 700, 600, 500, 400, 300 or 250.

In one particular embodiment, a pair of primers for the amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (cag) motif of the mPdIRD33 marker comprises a forward SSR primer of sequence SEQ ID NO: 35 (GGAGCATACAGTGGGTTTGC) and a reverse SSR primer of sequence SEQ ID NO: 36 (CAGCCTGGGAATGAGGATAG).

The amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ccagtg) motif of the mPdIRD40 marker is preferably carried out using a pair of SSR primers comprising:

    • a forward SSR primer comprising, or consisting of, between 15 and 50 consecutive nucleotides of the sequence of at most 1000 nucleotides flanking, in 5′, position 16193 in the PDK20 s1327401g0021 scaffold (http://qatar-weill.cornell.edu/research/datepalmGenome/download.html), and
    • a reverse SSR primer comprising, or consisting of, between 15 and 50 consecutive nucleotides of the sequence complementary to the sequence of at most 1000 nucleotides flanking, in 3′, position 16216 in the PDK20 s1327401g0021 scaffold.

The sequence of at most 1000 nucleotides may comprise any number of nucleotides preferably of between 1000 and 250, for example 1000, 900, 800, 700, 600, 500, 400, 300 or 250.

In one particular embodiment, a pair of primers for the amplification of a region of the genome of the date palm comprising the sequence of the microsatellite having the (ccagtg) motif of the mPdIRD40 marker comprises a forward SSR primer of sequence SEQ ID NO: 37 (GAGAGATGCGTCAGGGAATC) and a reverse SSR primer of sequence SEQ ID NO: 38 (CCAGAATCTTCCAAGCAAGC).

In some embodiments, a primer according to the invention is labeled so as to enable its detection (and, consequently, that of the amplification products or amplicons obtained by PCR). Various types of labeling, known to those skilled in the art, can be used (radioactive labeling, fluorescence labeling, chemiluminescence labeling, labeling of M13 type, etc.). The marker may be integrated into the oligonucleotide forming the primer, or can be linked to this oligonucleotide (for example by covalent bonding). The term “labeled primer” or “probe” is therefore intended to denote a primer which contains, or which is linked or bonded (for example covalently) to, a detectable marker.

The primers can be prepared by any appropriate method known to those skilled in the art, chosen in particular from the conventional oligonucleotide synthesis methods, such as the solid-phase synthesis methods. The primers according to the invention may, for example, be prepared using an oligonucleotide synthesizer (such as those sold, for example, by Applied Biosystems or GE Healthcare). Likewise, methods for labeling oligonucleotides are known in the art.

The present invention relates to the primers described herein (or any other primer which can be deduced from the information provided) and also to the use thereof for identifying the genotype (and/or cultivar) of the date palm by amplification of a portion of the genome of the date palm which comprises a microsatellite sequence according to the invention.

Amplicon Analysis

In one method for identifying the genotype of the date palm using one of the two sets of molecular markers according to the invention, after amplification, for each marker of the set, of a portion of the genome of the date palm comprising the microsatellite sequence, the amplicons are analyzed in order to determine the genotype of the date palm tested.

The analysis of the amplicons can be carried out by any method. The analysis generally comprises the separation of the amplicons according to their size (and therefore to the size of the microsatellite sequence). The separation may, for example, be carried out by electrophoresis (a technique which makes it possible to separate DNA fragments according to their electrical charge and their size) on agarose gel or on polyacrylamide gel. The separation is followed by the detection of the separated fragments by staining with ethidium bromide or silver, or else by detection of the detectable marker of the primer (by fluorescence, radioactivity, etc.).

In order to determine the genotype of the date palm tested, the sizes of the amplicons obtained can be compared with the sizes of the amplicons obtained after amplification, carried out under the same conditions, of the genomic DNA of a control date palm. The term “control date palm” denotes herein a date palm of which the genotype (origin, variety, cultivar, etc.) is known.

The step of comparing the sizes of the amplicons obtained from the sample of date palm tested may comprise the use of several control date palms. In particular, the step of comparing the sizes of the amplicons obtained, for the set of 19 or the set of 7 markers, from the date palm sample may comprise comparison with the sizes of the amplicons obtained, for the same set of markers, from the genotypes used by the inventors, and grouped together in the database PhoenixDB http://phoenixdb.mpl.ird.fr (login: phoenix; password: s7RSFV).

In order to determine the genotype of the date palm tested, the amplicons may, after separation according to their size, be sequenced in order to determine the number(s) of repeats of the SSR motif in the genome of the date palm tested. The DNA fragment sequencing methods are known in the art. In particular, it is possible to use automatic sequencers such as those available from Beckman, Applied BioSystems, or LiCor Biosciences.

Identification of the Genotype and/or the Cultivar of the Date Palm Tested

As indicated above, the set of 19 markers makes it possible to analyze 100% of the date palm genotypes. The date palms tested using a method according to the invention may originate from any region of the world, in particular from Israel, Libya, Tunisia, Mauritania, Algeria, Pakistan, Iraq, Sudan, Cape Verde, Spain, Niger, Morocco, Italy, Oman, Djibouti, Iran, India, Thailand or Vietnam.

In particular, the set of 19 markers makes it possible to identify the genotypes and varieties of date palms of the species Phoenix dactylifera L. chosen from Aqdool, Taj, Lemsi male, Edaghed, Halwa, Halwaya, Gadri (Yellow Seed), Ashrasi, Badrayah, Gadri, Kentichi, Mech Degla, Benosh, Besser Helou, Khmag, Laloo, Awreeq, Dguel Mghas, Amreer, Dokhar, Aréchti, Deglet Jdir, Barakawi, Elche, Outaghsaït, Buféa, Adam Goas, Deglet Wlad Mahmoud, Tunisian Ghars, Gadri, Jonah, Akerbouche, Baydir, Tinjdel, Abbad, Ali pun chohara, Timakur, Moroccan Bou Feggous, Algerian Bou Feggous (Fagous), Thorry, Tunisian Alig, Peggy Ann (close to Thorry), Algerian Kenta, La Confitera, Medjoul, Back Cross Medjool 4th G, Romana I, Bidh-Hmam, Tunisian Kenta, Chikh, Chikh (Hamuri), Chikh (Mhammed), Hamraya III, Algerian Alig, Alig (Bu'Rus), Alig (Ftimi), Tamazouart, Deglet Gurara, Lagou, Bayd Hmam, Bitamoda, Bent Cherk, Bent Cherk (Cherka), Bukhannus, Tinasser, Degla Baida, Gondaila, Cheddakh, Deglet Hassan, Timedjwel, Takhoudrayt, Tunisian Bou Feggous, Bessir, Bouskri, Deglet Bey, Deglet Bey (Menakher), Sekani, Talees, Dogna, Tinhamour, Taghiyat, Tunisian Hmara, Gasbi, Me'udiya, Tadmamt, Tindukan, Aman, Takerboucht, Tazizawt, Ouarglia, Aghares, Goundi, Peli Sundar, Khara Basra, Amir Hajj, Mobai (Den wala), Mobai (Dost Muhammadi Wala), Mobai, Horra, Rachna, Fasli, Shakri, Zaidi (Danda), Zaidi (Halimi), Zaidi (Masri), Zaidi (not Karblain), Zaidi, Zaidi, Dhakki, Dhakki (Congon), Khalas, Seib, Naghal (Gajjar/Gujjar), Naghal, Lolo, Bahlani, Gabeeni Mobai, Romana II, Dokhar, Adam Alkag, Aseel (Angor), Aseel, Aseel (Dhakki Zard), Aseel (Khurma), Chohara, Qasab, Badmi, Barhi, Hardasht, Hardasht (Jwana), Jeremiah, Khastawi, Tadala, Medina Kaylanya, Braim, Makran, Mcharret, Taghera, Saidi, Tati, Timrisa, Deglet Nour, Deglet Nour mere des Pa, Adam Hror, Eve, D'quel El Hadj, Banekhluf, Bukezzine, Ahmar, Rukkan, Shado, Gulistan, Khurmo, Halawi (Champa Kali), Halawi (Gulistan), Halawi, Halawi (Hillawi), Halawi (Neelum), Halawi (Pela Dora), Halawi (Zohdi), Khupra, Adam Timu, Choti Sandori, Chataya, Tawadan, Yellow Lulu, Bouldjib, Aghaliane, Ain Zbib, Tazerzist, Deglet Jito, Adam Bchir, Ma'tug, Ajwa, Chapshoq, Khalass Oman, Zerin, Surkh Begum Jungi, Gurbago, Karblain, Karblain (Ko-harba), Sajho Wali, Kozan Abad, Basra, Tabarzal, Pashpag, Pasht Kharoch, Black Bou Sthammi, Shamran, Otakanr, Kesba, Kesba (Sokrya), Zardo, Deglet Mech'a, Begum Jungi II, Kokna, Zard Begum Jungi, Dhaidi wali, Bounaringa, Hawwa wali, Khalass, Akhrot, Fard (Dhandari), Fard (Farz), Fard, Ajoujil, Qantar, Jaman, Ko-harba, Goknah, Azizaou (Arab name: Adam Zrak), Azizaou (Arab name: Amazigh), Tafeziwin, Adam Deglet Noir, Timliha, Adam Esof, Dguel Sidi Khlil, Adam Araw, Gadri (Red), Ain Zbib, Ououchtt, Tinhud, Tawragha, Tissibi, Ighes N'wagada, Tilemsu, Kasho wali, Desi, Halini, Hilali, Hussaini, Hussaini (Jan-sohar), Zard Kharoch, Bahram, Naz Tabakki, Saylani, Lasora, Khadrawy, Bdmalki, Bdmalki (Sarmadti), Maktoom, Kharoch, Jhajhri, Roghni, Gharas, Surkh, Noor Muhammadi Much, Mathusaleh, Aghammu, Mozati, Surkh Dhakki, Bent Qbala, Nasser Oussaleh, Bawa'adhim, Timliha, Tifazwin, Tanslit, Hmira, Taghera, Tgaza, Asemmat, Adam Bulla, Hamraya I, Be-Rehmi, Tinrigh, Khadri, Tazarzayet, Ebrea, Savi Khaji, Andekly, Begum Jungi, Litima, Harthan (Aharthan), Harthan (Oumazer), Klair, Timjouhart, red Lulu, Ouzamig, Tachlilat, Dimolo, Tawraghet, Tazougart, Tinicine, Hamraya II, Angou (=Algerian Ghars), Ghars, Tanteboucht, Tanteboucht (El Kayed), Abdel Azzaz, Bacheir, Tantabecht, Zoq El Moggar, Taramount, Bandid, El Gachouche, D'quel M'rass, Takermoust, Tizouyadj, Zaghraya, Ratti Khajji, Begun and Nisri, Dfor Lgot.

This set of markers also makes it possible to identify the genotypes of palms of the species Phoenix canariensi, Phoenix atlantica, Phoenix acaulis, Phoenix loureiroi, Phoenix andamanensis, Phoenix pusilla, Phoenix reclinata, Phoenix caespitosa, Phoenix roebelenii, Phoenix paludosa, Phoenix sylvestris and Phoenix theophrasti.

The set of 7 markers according to the invention makes it possible to analyze 99% of the date palm cultivars. In particular, the set of 7 markers makes it possible to identify the cultivars of Phoenix dactylifera L. chosen from the cultivars originating from Algeria, such as the cultivars Adam Hror, Aghares, Ajoujil, Akerbouche, Bent Qbala, Chikh, Degla Baida, Deglet Jdir, Dfor Lgot, Dguel Mghas, Takerboucht, Takermoust, Tanslit, Tanteboucht; Tati, Tgaza, Thorry, Timjouhart, Tinasser, Tissibi and Zaghraya; the cultivars originating from Arabia, such as the cultivars Ajwa and Khalass; the cultivars originating from Spain, such as the cultivar La Confitera; the cultivars originating from Iraq, such as the cultivars Ashrasi, Badmi, Bahram, Barhi, Basra, Bdmalki, Benosh, Halawi, Khadrawi, Khara Basra, Khastawi, Maktoom, Saylani and Zaidi; the cultivars originating from Italy, such as the cultivars Ebrea and Romana; the cultivars originating from Libya, such as the cultivars Amreer, Aqdool, Awreeq, Khmag, Taghiyat and Talees; the cultivars originating from Morocco, such as the cultivars Black Bou Sthammi, Moroccan Bou Feggous, Bouskri and Medjoul; the cultivars originating from Mauritania, such as the cultivars Ahmar, Edaghed and Sekani; the cultivars originating from Oman, such as the cultivars Bounaringa, Fard, Hilali and Naghal; the cultivars originating from Pakistan, such as the cultivars Ali puri chohara, Aseel, Begun, Dhakki, Halini, Hardasht, Hussaini, Karblain, Kozan Abad, Mobai, Mozati, Nisri, Pashpag, Rukkan, Sajho Wali, Shakri, Shamran and Wahn wali; the cultivars originating from Sudan, such as the cultivars Barakawi, Bitamoda, Dogna and Gondaila; the cultivars originating from Tunisia, such as the cultivars Algerian Alig, Tunisian Alig, Aman, Angou (=Algerian Ghars), Aréchti, Besser Helou, Bessir, Bidh-Hmam, Tunisian Bou Feggous, Cheddakh, Deglet Bey, Deglet Nour, Gasbi, Tunisian Ghars, Goundi, Tunisian Hmara, Horra, Tunisian Kenta, Kentichi, Lagou and Tazerzist.

III—Kits for Identifying the Genotype of the Date Palm

The present invention also relates to kits comprising material of use for implementing a method according to the invention. In particular, the present invention relates to kits for identifying the genotype of the date palm and/or identifying the cultivar of the date palm, containing material which makes it possible to detect, in the genome of the date palm, the polymorphism of 19 microsatellite sequences according to the invention or of 7 microsatellite sequences according to the invention.

Generally, a kit according to the invention comprises at least one set of pairs of SSR primers described herein enabling the amplification of each of the (19 or 7) markers of a set of the invention. A kit according to the invention can be designed so as to be used with a particular amplification technique, in particular a PCR technique.

In particular, in some embodiments of the invention, the kit comprises the following pairs of primers:

    • a forward SSR primer of sequence SEQ ID NO: 1 and a reverse SSR primer of sequence SEQ ID NO: 2;
    • a forward SSR primer of sequence SEQ ID NO: 3 and a reverse SSR primer of sequence SEQ ID NO: 4;
    • a forward SSR primer of sequence SEQ ID NO: 5 and a reverse SSR primer of sequence SEQ ID NO: 6;
    • a forward SSR primer of sequence SEQ ID NO: 7 and a reverse SSR primer of sequence SEQ ID NO: 8;
    • a forward SSR primer of sequence SEQ ID NO: 9 and a reverse SSR primer of sequence SEQ ID NO: 10;
    • a forward SSR primer of sequence SEQ ID NO: 11 and a reverse SSR primer of sequence SEQ ID NO: 12;
    • a forward SSR primer of sequence SEQ ID NO: 13 and a reverse SSR primer of sequence SEQ ID NO: 14;
    • a forward SSR primer of sequence SEQ ID NO: 15 and a reverse SSR primer of sequence SEQ ID NO: 16;
    • a forward SSR primer of sequence SEQ ID NO: 17 and a reverse SSR primer of sequence SEQ ID NO: 18;
    • a forward SSR primer of sequence SEQ ID NO: 19 and a reverse SSR primer of sequence SEQ ID NO: 20;
    • a forward SSR primer of sequence SEQ ID NO: 21 and a reverse primer of sequence SEQ ID NO: 22;
    • a forward SSR primer of sequence SEQ ID NO: 23 and a reverse SSR primer of sequence SEQ ID NO: 24;
    • a forward SSR primer of sequence SEQ ID NO: 25 and a reverse SSR primer of sequence SEQ ID NO: 26;
    • a forward primer of sequence SEQ ID NO: 27 and a reverse SSR primer of sequence SEQ ID NO: 28;
    • a forward SSR primer of sequence SEQ ID NO: 29 and a reverse SSR primer of sequence SEQ ID NO: 30;
    • a forward SSR primer of sequence SEQ ID NO: 31 and a reverse SSR primer of sequence SEQ ID NO: 32;
    • a forward SSR primer of sequence SEQ ID NO: 33 and a reverse SSR primer of sequence SEQ ID NO: 34;
    • a forward SSR primer of sequence SEQ ID NO: 35 and a reverse SSR primer of sequence SEQ ID NO: 36; and
    • a forward SSR primer of sequence SEQ ID NO: 37 and a reverse SSR primer of sequence SEQ ID NO: 38.

In other embodiments of the invention, the kit comprises the following pairs of primers:

    • a forward SSR primer of sequence SEQ ID NO: 17 and a reverse SSR primer of sequence SEQ ID NO: 18;
    • a forward SSR primer of sequence SEQ ID NO: 21 and a reverse SSR primer of sequence SEQ ID NO: 22;
    • a forward SSR primer of sequence SEQ ID NO: 25 and a reverse SSR primer of sequence SEQ ID NO: 26;
    • a forward SSR primer of sequence SEQ ID NO: 29 and a reverse SSR primer of sequence SEQ ID NO: 30;
    • a forward SSR primer of sequence SEQ ID NO: 33 and a reverse SSR primer of sequence SEQ ID NO: 34;
    • a forward SSR primer of sequence SEQ ID NO: 35 and a reverse SSR primer of sequence SEQ ID NO: 36; and
    • a forward SSR primer of sequence SEQ ID NO: 37 and a reverse SSR primer of sequence SEQ ID NO: 38.

It is understood that a kit may comprise the two sets of pairs of primers.

A kit according to the invention may also comprise reagents or solutions for extracting the genomic DNA from the date palm sample, PCR amplification reagents or solutions, reagents or solutions for separating amplicons according to their size, sequencing reagents or solutions, and/or detection means. Protocols for using these reagents and/or solutions may be included in the kit.

The various components of the kit may be provided in solid form (for example in lyophilized form) or in liquid form. A kit may optionally comprise a container containing each of the reagents or solutions, and/or containers for carrying out certain steps of the method of the invention.

A kit according to the invention may also comprise instructions for carrying out the method of the invention for detecting, in the date palm genome, the SSR polymorphism of each of the 19 or of the 7 markers of a set according to the invention. The instructions for carrying out a method according to the invention may comprise instructions for the extraction of genomic DNA from date palm samples, instructions regarding the PCR amplification conditions, instructions regarding the analysis of the amplicons obtained and/or instructions for interpreting the results.

A kit according to the invention may also comprise an information sheet in the form stipulated by a governmental agency regulating the preparation, sale and use of biological products.

Unless otherwise defined, all the technical and scientific terms used herein have the same meaning as that commonly understood by an ordinary specialist in the field to which this invention belongs. Likewise, all the publications and patent applications, all the patents and any other references mentioned herein are incorporated by way of reference.

Example

The following example describes some embodiments of the present invention. However, it is understood that the example is provided only by way of illustration and does not in any way limit the scope of the invention.

Identification of the Sets of Molecular Markers of Microsatellite Type

Materials and Methods

Plant Material.

A collection of 550 Phoenix dactylifera cultivars collected in Tunisia, Algeria, Morocco, Pakistan, Egypt and Oman was assembled. Samples of P. canariensis, P. loureiroi, P. reclinata and P. roebelenii were also collected. In this sample, a subcollection of 100 reference varieties were selected on the basis of their significance in the principal Phoenix-growing countries.

DNA Extraction.

Each sample consisting of leaves was lyophilized for 72 hours by means of an Alpha1-4LD Plus lyophilizer (Fisher Scientific, France). The lyophilized leaves were ground with the TissueLyser System (Qiagen, USA) and then the extraction was carried out with the Dneasy plant kit (Qiagen, USA) according to the maker's protocol.

The DNA obtained was assayed with the Tecan GENios™ spectrofluorimeter (Tecan, Switzerland). The concentrations of all the samples were adjusted to 10 ng/μl for the rest of the manipulation.

Genetic Analyses.

The genetic analyses (number of alleles, heterozygosity observed and expected, Fis, Wright fixation index) were carried out using the Genetix 4.05 software (Belkhir et al., 2004, Genetix 4.05, software on Windows™ for population genetics. Genome, Populations, Interactions Laboratory, CNRS UMR 5171, University of Montpellier II, Montpellier, France).

Description of the Microsatellite Markers

A new optimized collection of microsatellites was defined by the exploitation of microsatellite markers described in the literature or identified from the available genomic resources.

The mPdCIR078, mPdCIR015, mPdCIR016, mPdCIR032, mPdCIR035, mPdCIR057, mPdCIR085, mPdCIR010, mPdCIR025 and mPdCIR063 markers are (GA)n dinucleotide loci, which have been described by Billotte et al. (Molecular Ecology Notes, 2004, 4: 256-258).

The mPdIRD031, mPdIRD033, mPdIRD040 and mPdIRD013 markers are microsatellite tandem repeats of 3 or 6 base pairs that the present inventors identified in silico in coding sequences of the sequence of the genome of the date palm (Al-Dous et al., Nature Biotechnology, 2011, 29: 521-527—http://qatar-weill.cornell.edu/research/datepalmGenome/download.html). These 4 loci were selected among 47 for their amplification capacity and the polymorphism that they generate.

The PdCUC3-ssr1CUC and PdCUC3-ssr2 markers are dinucleotide sequences identified in CUC genes (Adam et al., Molecular Biology and Evolution, 2010, 28: 1439-1454).

The PdAG1-ssr1 and PdAP3-ssr1 markers are dinucleotide sequences identified by the present inventors respectively in the AG1 and AP3 genes (not published).

The CpfM12 marker is a minisatellite marker of the chloroplast genome (Henderson et al., Conservation Genetics, 2006, 7: 213-223).

On the basis of these markers, the inventors identified 2 sets according to the objective pursued: a set of 19 markers which makes it possible to identify 100% of the genotypes, and a reduced set of 7 loci for cultivar certification. For the latter, an identification key was defined which makes it possible to identify 99% of the genotypes (FIG. 1).

Claims

1. A method for identifying the genotype of a date palm comprising a step of detecting, using a set of minisatellite and microsatellite molecular markers, an SSR polymorphism in the genome of the date palm, wherein the step of detecting the SSR polymorphism comprises, for each molecular marker of the set:

amplifying, using a pair of primers specific for the marker, a portion of the genomic DNA of the date palm tested comprising the minisatellite or microsatellite in order to obtain amplicons; and

analyzing the amplicons obtained in order to determine the genotype of the date palm tested.

2. The method as claimed in claim 1, wherein the set consists of the following 19 molecular markers:

the mPdCIR010 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571673.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 1 and, in 3′, by the nucleotide sequence SEQ ID NO: 2;

the mPdCIR015 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571674.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 3 and, in 3′, by the nucleotide sequence SEQ ID NO: 4;

the mPdCIR016 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571675.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 5 and, in 3′, by the nucleotide sequence SEQ ID NO: 6;

the mPdCIR025 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571676.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 7 and, in 3′, by the nucleotide sequence SEQ ID NO: 8;

the mPdCIR032 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571677.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 9 and, in 3′, by the nucleotide sequence SEQ ID NO: 10;

the mPdCIR035 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571678.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 11 and, in 3′, by the nucleotide sequence SEQ ID NO: 12;

the mPdCIR057 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571682.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 13 and, in 3′, by the nucleotide sequence SEQ ID NO: 14;

the mPdCIR063 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571683.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 15 and, in 3′, by the nucleotide sequence SEQ ID NO: 16;

the mPdCIR078 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571685.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 17 and, in 3′, by the nucleotide sequence SEQ ID NO: 18;

the mPdCIR085 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number AJ571686.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 19 and, in 3′, by the nucleotide sequence SEQ ID NO: 20;

the CpfM12 marker, which, in the 5′→3′ direction, has a (ctaactactata) motif, is present in the sequence having the GenBank accession number EU043484.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 21 and, in 3′, by the nucleotide sequence SEQ ID NO: 22;

the PdCUC3-ssr1 marker, which, in the 5′→3′ direction, has a (gt+ga) motif, is present in the sequence having the GenBank accession number HM622273.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 23 and, in 3′, by the nucleotide sequence SEQ ID NO: 24;

the PdCUC3-ssr2 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number HM622273.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 25 and, in 3′, by the nucleotide sequence SEQ ID NO: 26;

the PdAG1-ssr1 marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number KC188338.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 27 and, in 3′, by the nucleotide sequence SEQ ID NO: 28;

the PdAP3-ssr marker, which, in the 5′→3′ direction, has a (ga) motif, is present in the sequence having the GenBank accession number KC188337.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 29 and, in 3′, by the nucleotide sequence SEQ ID NO: 30;

the mPdIRD13 marker, which, in the 5′→3′ direction, has a (cac) motif, is present in the PDK20s1496731g0021 scaffold having the GenBank accession number GL741615.1, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 31 and, in 3′, by the nucleotide sequence SEQ ID NO: 32;

the mPdIRD31 marker, which, in the 5′→3′ direction, has a (cca) motif, is present in the PDK20s1419261g0031 scaffold, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 33 and, in 3′, by the nucleotide sequence SEQ ID NO: 34;

the mPdIRD33 marker, which, in the 5′→3′ direction, has a (cag) motif, is present in the PDK20s1569281g0011 scaffold, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 35 and, in 3′, by the nucleotide sequence SEQ ID NO: 36; and

the mPdIRD40 marker, which, in the 5′→3′ direction, has a (ccagtg) motif, is present in the PDK20s1327401g0021 scaffold, and is flanked, in 5′, by the nucleotide sequence SEQ ID NO: 37 and, in 3′, by the nucleotide sequence SEQ ID NO: 38.

3. The method as claimed in claim 2, wherein the amplifications are carried out with each of the pairs of specific primers that follow:

a forward SSR primer of sequence SEQ ID NO: 1 and a reverse SSR primer of sequence SEQ ID NO: 2;

a forward SSR primer of sequence SEQ ID NO: 3 and a reverse SSR primer of sequence SEQ ID NO: 4;

a forward SSR primer of sequence SEQ ID NO: 5 and a reverse SSR primer of sequence SEQ ID NO: 6;

a forward SSR primer of sequence SEQ ID NO: 7 and a reverse SSR primer of sequence SEQ ID NO: 8;

a forward SSR primer of sequence SEQ ID NO: 9 and a reverse SSR primer of sequence SEQ ID NO: 10;

a forward SSR primer of sequence SEQ ID NO: 11 and a reverse SSR primer of sequence SEQ ID NO: 12;

a forward SSR primer of sequence SEQ ID NO: 13 and a reverse SSR primer of sequence SEQ ID NO: 14;

a forward SSR primer of sequence SEQ ID NO: 15 and a reverse SSR primer of sequence SEQ ID NO: 16;

a forward SSR primer of sequence SEQ ID NO: 17 and a reverse SSR primer of sequence SEQ ID NO: 18;

a forward SSR primer of sequence SEQ ID NO: 19 and a reverse SSR primer of sequence SEQ ID NO: 20;

a forward SSR primer of sequence SEQ ID NO: 21 and a reverse primer of sequence SEQ ID NO: 22;

a forward SSR primer of sequence SEQ ID NO: 23 and a reverse SSR primer of sequence SEQ ID NO: 24;

a forward SSR primer of sequence SEQ ID NO: 25 and a reverse SSR primer of sequence SEQ ID NO: 26;

a forward primer of sequence SEQ ID NO: 27 and a reverse SSR primer of sequence SEQ ID NO: 28;

a forward SSR primer of sequence SEQ ID NO: 29 and a reverse SSR primer of sequence SEQ ID NO: 30;

a forward SSR primer of sequence SEQ ID NO: 31 and a reverse SSR primer of sequence SEQ ID NO: 32;

a forward SSR primer of sequence SEQ ID NO: 33 and a reverse SSR primer of sequence SEQ ID NO: 34;

a forward SSR primer of sequence SEQ ID NO: 35 and a reverse SSR primer of sequence SEQ ID NO: 36; and

a forward SSR primer of sequence SEQ ID NO: 37 and a reverse SSR primer of sequence SEQ ID NO: 38.

5. The method as claimed in claim 4, wherein the amplifications are carried out with each of the pairs of specific primers that follow:

a forward SSR primer of sequence SEQ ID NO: 17 and a reverse SSR primer of sequence SEQ ID NO: 18;

a forward SSR primer of sequence SEQ ID NO: 21 and a reverse SSR primer of sequence SEQ ID NO: 22;

a forward SSR primer of sequence SEQ ID NO: 25 and a reverse SSR primer of sequence SEQ ID NO: 26;

a forward SSR primer of sequence SEQ ID NO: 29 and a reverse SSR primer of sequence SEQ ID NO: 30;

a forward SSR primer of sequence SEQ ID NO: 33 and a reverse SSR primer of sequence SEQ ID NO: 34;

a forward SSR primer of sequence SEQ ID NO: 35 and a reverse SSR primer of sequence SEQ ID NO: 36; and

a forward SSR primer of sequence SEQ ID NO: 37 and a reverse SSR primer of sequence SEQ ID NO: 38.

6. The method as claimed in claim 4 or claim 5, wherein the identification of the genotype of the date palm tested comprises the identification or the certification of the cultivar of the date palm tested.

7. The method as claimed in claim 1, wherein the step of analyzing the amplicons obtained in order to determine the genotype of the date palm tested comprises, for each of the molecular markers:

separating, as a function of their size, the amplicons obtained by amplification of a portion of the genomic DNA of the date palm tested, and

comparing the sizes of said amplicons with the sizes of the amplicons obtained by amplification, under the same conditions, of a portion of the genomic DNA of control date palms.

8. The method as claimed in claim 1, wherein the method is carried out on genomic DNA extracted from a sample of the date palm tested, where the sample of the date palm is a protoplast, callus, embryo, leaf, stipe, root, shoot or cutting sample of the date palm.

9. A set of pairs of primers specific for minisatellite and microsatellite molecular markers for identifying the genotype of a date palm, the set consisting of the following pairs of primers:

a forward SSR primer of sequence SEQ ID NO: 1 and a reverse SSR primer of sequence SEQ ID NO: 2;

a forward SSR primer of sequence SEQ ID NO: 3 and a reverse SSR primer of sequence SEQ ID NO: 4;

a forward SSR primer of sequence SEQ ID NO: 5 and a reverse SSR primer of sequence SEQ ID NO: 6;

a forward SSR primer of sequence SEQ ID NO: 7 and a reverse SSR primer of sequence SEQ ID NO: 8;

a forward SSR primer of sequence SEQ ID NO: 9 and a reverse SSR primer of sequence SEQ ID NO: 10;

a forward SSR primer of sequence SEQ ID NO: 11 and a reverse SSR primer of sequence SEQ ID NO: 12;

a forward SSR primer of sequence SEQ ID NO: 13 and a reverse SSR primer of sequence SEQ ID NO: 14;

a forward SSR primer of sequence SEQ ID NO: 15 and a reverse SSR primer of sequence SEQ ID NO: 16;

a forward SSR primer of sequence SEQ ID NO: 17 and a reverse SSR primer of sequence SEQ ID NO: 18;

a forward SSR primer of sequence SEQ ID NO: 19 and a reverse SSR primer of sequence SEQ ID NO: 20;

a forward SSR primer of sequence SEQ ID NO: 21 and a reverse primer of sequence SEQ ID NO: 22;

a forward SSR primer of sequence SEQ ID NO: 23 and a reverse SSR primer of sequence SEQ ID NO: 24;

a forward SSR primer of sequence SEQ ID NO: 25 and a reverse SSR primer of sequence SEQ ID NO: 26;

a forward primer of sequence SEQ ID NO: 27 and a reverse SSR primer of sequence SEQ ID NO: 28;

a forward SSR primer of sequence SEQ ID NO: 29 and a reverse SSR primer of sequence SEQ ID NO: 30;

a forward SSR primer of sequence SEQ ID NO: 31 and a reverse SSR primer of sequence SEQ ID NO: 32;

a forward SSR primer of sequence SEQ ID NO: 33 and a reverse SSR primer of sequence SEQ ID NO: 34;

a forward SSR primer of sequence SEQ ID NO: 35 and a reverse SSR primer of sequence SEQ ID NO: 36; and

a forward SSR primer of sequence SEQ ID NO: 37 and a reverse SSR primer of sequence SEQ ID NO: 38.

10. A set of pairs of primers specific for minisatellite and microsatellite molecular markers for identifying or certifying the cultivar of a date palm tested, the set consisting of the following pairs of primers:

a forward SSR primer of sequence SEQ ID NO: 17 and a reverse SSR primer of sequence SEQ ID NO: 18;

a forward SSR primer of sequence SEQ ID NO: 21 and a reverse SSR primer of sequence SEQ ID NO: 22;

a forward SSR primer of sequence SEQ ID NO: 25 and a reverse SSR primer of sequence SEQ ID NO: 26;

a forward SSR primer of sequence SEQ ID NO: 29 and a reverse SSR primer of sequence SEQ ID NO: 30;

a forward SSR primer of sequence SEQ ID NO: 33 and a reverse SSR primer of sequence SEQ ID NO: 34;

a forward SSR primer of sequence SEQ ID NO: 35 and a reverse SSR primer of sequence SEQ ID NO: 36; and

a forward SSR primer of sequence SEQ ID NO: 37 and a reverse SSR primer of sequence SEQ ID NO: 38.

11. The set of pairs of primers as claimed in claim 9 or claim 10, wherein one of the primers of each of the pairs of primers comprises a detectable marker.

12. (canceled)

13. (canceled)

14. A kit for identifying the genotype of date palms, comprising a set of pairs of primers specific for minisatellite and microsatellite molecular markers and instructions for identifying the genotype using a method as claimed in claim 2, wherein the set consists of the following pairs of primers:

a forward SSR primer of sequence SEQ ID NO: 1 and a reverse SSR primer of sequence SEQ ID NO: 2;

a forward SSR primer of sequence SEQ ID NO: 3 and a reverse SSR primer of sequence SEQ ID NO: 4;

a forward SSR primer of sequence SEQ ID NO: 5 and a reverse SSR primer of sequence SEQ ID NO: 6;

a forward SSR primer of sequence SEQ ID NO: 7 and a reverse SSR primer of sequence SEQ ID NO: 8;

a forward SSR primer of sequence SEQ ID NO: 9 and a reverse SSR primer of sequence SEQ ID NO: 10;

a forward SSR primer of sequence SEQ ID NO: 11 and a reverse SSR primer of sequence SEQ ID NO: 12;

a forward SSR primer of sequence SEQ ID NO: 13 and a reverse SSR primer of sequence SEQ ID NO: 14;

a forward SSR primer of sequence SEQ ID NO: 15 and a reverse SSR primer of sequence SEQ ID NO: 16;

a forward SSR primer of sequence SEQ ID NO: 17 and a reverse SSR primer of sequence SEQ ID NO: 18;

a forward SSR primer of sequence SEQ ID NO: 19 and a reverse SSR primer of sequence SEQ ID NO: 20;

a forward SSR primer of sequence SEQ ID NO: 21 and a reverse primer of sequence SEQ ID NO: 22;

a forward SSR primer of sequence SEQ ID NO: 23 and a reverse SSR primer of sequence SEQ ID NO: 24;

a forward SSR primer of sequence SEQ ID NO: 25 and a reverse SSR primer of sequence SEQ ID NO: 26;

a forward primer of sequence SEQ ID NO: 27 and a reverse SSR primer of sequence SEQ ID NO: 28;

a forward SSR primer of sequence SEQ ID NO: 29 and a reverse SSR primer of sequence SEQ ID NO: 30;

a forward SSR primer of sequence SEQ ID NO: 31 and a reverse SSR primer of sequence SEQ ID NO: 32;

a forward SSR primer of sequence SEQ ID NO: 33 and a reverse SSR primer of sequence SEQ ID NO: 34;

a forward SSR primer of sequence SEQ ID NO: 35 and a reverse SSR primer of sequence SEQ ID NO: 36; and

a forward SSR primer of sequence SEQ ID NO: 37 and a reverse SSR primer of sequence SEQ ID NO: 38.

15. A kit for identifying or certifying the cultivar of date palms, comprising a set of pairs of primers specific for minisatellite and microsatellite molecular markers and instructions for identifying or certifying the cultivar using a method as claimed in claim 4, wherein the set consists of the following pairs of primer:

a forward SSR primer of sequence SEQ ID NO: 17 and a reverse SSR primer of sequence SEQ ID NO: 18;

a forward SSR primer of sequence SEQ ID NO: 21 and a reverse SSR primer of sequence SEQ ID NO: 22;

a forward SSR primer of sequence SEQ ID NO: 25 and a reverse SSR primer of sequence SEQ ID NO: 26;

a forward SSR primer of sequence SEQ ID NO: 29 and a reverse SSR primer of sequence SEQ ID NO: 30;

a forward SSR primer of sequence SEQ ID NO: 33 and a reverse SSR primer of sequence SEQ ID NO: 34;

a forward SSR primer of sequence SEQ ID NO: 35 and a reverse SSR primer of sequence SEQ ID NO: 36; and

a forward SSR primer of sequence SEQ ID NO: 37 and a reverse SSR primer of sequence SEQ ID NO: 38.