Patent application title:

RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Duchenne and Becker Muscular Dystrophy

Publication number:

US20180362973A9

Publication date:
Application number:

15/232,493

Filed date:

2016-08-09

Abstract:

The current invention provides an improved oligonucleotide and its use for treating, ameliorating, preventing and/or delaying DMD or BMD.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N2310/321 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the sugar 2'-O-R Modification

C12N2310/3341 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the base; Modified C 5-Methylcytosine

C12N2310/335 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the base Modified T or U

C12N2320/33 »  CPC further

Applications; Uses; Special therapeutic applications Alteration of splicing

C12N2310/315 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the backbone Phosphorothioates

C12N2310/3231 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA

C12N2310/3233 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the sugar modified ring structure Morpholino-type ring

C12N2310/11 »  CPC further

Structure or type of the nucleic acid; Type of nucleic acid Antisense

C12N15/113 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Description

CROSS REFERENCE

This application is a continuation of U.S. patent application Ser. No. 14/444,244 filed on Jul. 28, 2014 which is a continuation of international Patent Application No. PCT/NL2013/050045, filed Jan. 28, 2013, which claims the benefit of EP 12152934.1 filed Jan. 27, 2012, and U.S. Provisional Application No. 61/591,354 filed Jan. 27, 2012 and 61/612,467 filed Mar. 19, 2012, all of which are incorporated by reference in their entirety.

FIELD

The invention relates to the field of human genetics, more specifically neuromuscular disorders. The invention in particular relates to the use of an oligonucleotide with improved characteristics enhancing clinical applicability as further defined herein.

BACKGROUND OF THE INVENTION

Neuromuscular diseases are characterized by impaired functioning of the muscles due to either muscle or nerve pathology (myopathies and neuropathies). The myopathies include genetic muscular dystrophies that are characterized by progressive weakness and degeneration of skeletal, heart and/or smooth muscle. Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are the most common childhood forms of muscular dystrophy. DMD is a severe, lethal neuromuscular disorder resulting in a dependency on wheelchair support before the age of 12 and patients often die before the age of thirty due to respiratory- or heart failure. It is caused by reading frame-shifting deletions (˜67%) or duplications (˜7%) of one or more exons, or by point mutations (˜25%) in the 2.24 Mb DMD gene, resulting in the absence of functional dystrophin. BMD is also caused by mutations in the DMD gene, but these maintain the open reading frame, yield semi-functional dystrophin proteins, and result in a typically much milder phenotype and longer lifespan. During the last decade, specific modification of splicing in order to restore the disrupted reading frame of the transcript has emerged as a promising therapy for DMD (van Ommen et al., 2008; Yokota et al., 2007; van Deutekom et al., 2007; Goemans et al., 2011; Cirak et al., 2011). Using highly sequence-specific antisense oligonucleotides (AONs) which bind to the exon flanking or containing the mutation and which interfere with its splicing signals, the skipping of that exon can be induced during the processing of the DMD pre-mRNA. Despite the resulting truncated transcript, the open reading frame is restored and a protein is introduced which is similar to those found in BMD patients. AON-induced exon skipping provides a mutation-specific, and thus personalized, therapeutic approach for DMD patients. Several oligonucleotides are currently being developed for skipping most relevant exons of the dystrophin pre-mRNA such as exons 2, 8, 9, 17, 29, 43, 44, 45, 46, 47, 48, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60-63, 71-78 as described in WO 02/024906, WO2004/083446, WO2006/112705, WO2007/135105, WO 2009/139630, WO 2010/050801 or WO 2010/050802.

As the majority of the mutations cluster around exons 45 to 55, the skipping of one specific exon may be therapeutic for many patients with different mutations. The skipping of exon 51 applies to the largest subset of patients (˜13%), including those with deletions of exons 45 to 50, 48 to 50, 50, or 52. The AONs applied are chemically modified to resist endonucleases, exonucleases and RNaseH, and to promote RNA binding and duplex stability. Two different AON chemistries are currently being developed for exon 51 skipping in DMD: 2′-O-methyl phosphorothioate RNA AONs (2OMePS, GSK2402968/PRO051) and phosphorodiamidate morpholino oligomers (PMO, AVI-4658) (Goemans et al., 2011; Cirak et al., 2011). In two independent phase I/II studies, both were shown to specifically induce exon 51 skipping and at least partly restore dystrophin expression at the muscle fiber membranes after systemic administration. Although AONs are typically not well taken up by healthy muscle fibers, the dystrophin deficiency in DMD, resulting in damaged and thus more permeable fiber membranes, actually promotes uptake. In studies in the dystrophin-deficient mdx mouse model, 2′-O-methyl phosphorothioate RNA oligonucleotides have demonstrated an up to 10 times higher uptake in different muscle groups when compared to that in wild type mice (Heemskerk et al., 2010). Although the recent phase I/II results with both 2′-O-methyl phosphorothioate RNA and phosphorodiamidate morpholino AONs in DMD patients confirm this enhanced uptake in dystrophic muscle, the different chemical modifications seemed to result in a differential uptake by and distribution through muscle. The levels of novel dystrophin in both studies after 3 months of treatment were promising but still moderate and challenges the field to investigate next generation oligochemistry.

The particular characteristics of a chosen chemistry at least in part affects the delivery of an AON to the target transcript: administration route, biostability, biodistribution, intra-tissue distribution, and cellular uptake and trafficking. In addition, further optimization of oligonucleotide chemistry is conceived to enhance binding affinity and stability, enhance activity, improve safety, and/or to reduce cost of goods by reducing length or improving synthesis and/or purification procedures. Multiple chemical modifications have become generally and/or commercially available to the research community (such as 2′-O-methyl RNA and 5-substituted pyrimidines and 2,6-diaminopurines), whereas most others still present significant synthetic effort to obtain. Especially preliminary encouraging results have been obtained using 2′-O-methyl phosphorothioate RNA containing modifications on the pyrimidine and purine bases as identified herein.

In conclusion, to enhance the therapeutic applicability of AONs for DMD, there is a need for AONs with further improved characteristics.

DESCRIPTION OF THE INVENTION

Oligonucleotide

In a first aspect, the invention provides an oligonucleotide comprising a 2′-O-methyl RNA monomer and a phosphorothioate backbone or consisting of 2′-O-methyl RNA monomers linked by phosphorothioate backbones, and comprising a 5-methylpyrimidine and/or a 2,6-diaminopurine base preferably for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy. Therefore, the invention provides an oligonucleotide comprising a 2′-O-methyl RNA monomer, a phosphorothioate backbone and a 5-methylpyrimidine and/or a 2,6-diaminopurine base preferably for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.

Accordingly the invention also provides an oligonucleotide consisting of 2′-O-methyl RNA monomers and a phosphorothioate backbone and comprises a 5-methylpyrimidine and/or a 2,6-diaminopurine base preferably for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.

It is clear for the skilled person that “an RNA monomer” as present in an oligonucleotide of the invention may also be identified as being “an RNA nucleotide residue”. Both terms may be used interchangeably throughout the application.

Within the context of the invention, “a” in each of the following expressions means “at least one”: a 2′-O-methyl RNA monomer, a 2′-O-methyl RNA nucleotide residue, a 2′-O-methyl phosphorothioate RNA monomer, a 5-methylpyrimidine base, a 2,6-diaminopurine base.

Within the context of the invention, it is clear for the skilled person that “an oligonucleotide comprising a 2′-O-methyl RNA monomer, a phosphorothioate backbone” could be replaced by “an oligonucleotide comprising a 2′-O-methyl RNA monomer linked by phosphorothioate backbones”. The same holds for “an oligonucleotide consisting of 2′-O-methyl RNA monomers and a phosphorothioate backbone” that could be replaced by “an oligonucleotide consisting of 2′-O-methyl RNA monomer linked by phosphorothioate backbones”.

In the context of the invention, the expression “for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy” could be replaced by the expression “for use in the treatment of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.”

Preferably, an oligonucleotide is an oligonucleotide with less than 34 nucleotides. Said oligonucleotide may have 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Such oligonucleotide may also be identified as an oligonucleotide having from 10 to 33 nucleotides.

Accordingly, an oligonucleotide of the invention comprises a 2′-O-methyl RNA monomer and a phosphorothioate backbone and comprises less than 34 nucleotides (i.e. it comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides).

Accordingly, an oligonucleotide of the invention consists of 2′-O-methyl RNA monomers linked by phosphorothioate backbone and comprises less than 34 nucleotides (i.e. it comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides)

Accordingly, an oligonucleotide of the invention comprises a 2′-O-methyl RNA monomer, a phosphorothioate backbone, comprises less than 34 nucleotides (i.e. it comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) and a 5-methylpyrimidine and/or a 2,6-diaminopurine base.

Accordingly, an oligonucleotide of the invention consists of 2′-O-methyl RNA monomers linked by phosphorothioate backbone, and comprises less than 34 nucleotides (i.e. it comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) and a 5-methylpyrimidine and/or a 2,6-diaminopurine base.

Each of these oligonucleotides is for use or may be for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.

An oligonucleotide of the invention comprises or consists of a 2′-O-methyl phosphorothioate RNA monomer. Such oligonucleotide comprises a 2′-O-methyl RNA monomer connected through or linked by a phosphorothioate backbone or consists of 2′-O-methyl phosphorothioate RNA. Preferably, such oligonucleotide consists of a 2′-O-methyl phosphorothioate RNA. Such chemistry is known to the skilled person. Throughout the application, an oligonucleotide comprising a 2′-O-methyl RNA monomer and a phosphorothioate backbone may be replaced by an oligonucleotide comprising a 2′-O-methyl phosphorothioate RNA. Throughout the application, an oligonucleotide consisting of 2′-O-methyl RNA monomers linked by or connected through phosphorothioate backbones may be replaced by an oligonucleotide consisting of 2′-O-methyl phosphorothioate RNA.

In the context of the invention, “backbone” is used to identify the linkage between two sugar units or modified versions of a sugar unit or moiety as later defined herein (i.e. internucleoside linkage). Throughout the description, the words “backbone”, “internucleoside linkage” and “linkage” may be used interchangeably. Thus, an oligonucleotide having 10 nucleotides contains 9 backbones, linking the 10 sugar units or modified versions of a sugar unit or moiety as later defined herein together. At least one of the backbones of the oligonucleotide according to the invention consists of a phosphorothioate moiety, linking two sugar units or modified versions of a sugar unit or moiety as later defined herein. Thus, at least one phosphodiester backbones present in RNA is replaced by phosphorothioate moiety. A naturally occurring internucleoside linkage or backbone is the 3′ to 5′ phosphodiester linkage.

In addition, an oligonucleotide of the invention may comprise a base modification that increases binding affinity to target strands, increases melting temperature of the resulting duplex of said oligonucleotide with its target, and/or decreases immunostimulatory effects, and/or increases biostability, and/or improves biodistribution and/or intra-tissue distribution, and/or cellular uptake and trafficking. In a more preferred embodiment, an oligonucleotide of the invention comprises a 5-methylpyrimidine and/or a 2,6-diaminopurine base. A 5-methylpyrimidine base is selected from a 5-methylcytosine and/or a 5-methyluracil and/or a thymine, in which thymine is identical to 5-methyluracil.

Accordingly, the expression “comprises a 5-methylcytosine and/or a 5-methyluracil and/or a 2,6-diaminopurine base” in the context of the modified oligonucleotide of the invention may be replaced by “comprises a base modification selected from the group consisting of: a 5-methylcytosine, a 5-methyluracil and a 2,6-diaminopurine base”.

Where an oligonucleotide of the invention has two or more such base modifications, said base modifications may be identical, for example all such modified bases in the oligonucleotide are 5-methylcytosine, or said base modifications may be combinations of different base modifications, for example the oligonucleotide may have one or more 5-methylcytosines and one or more 5-methyluracils.

‘Thymine’ and ‘5-methyluracil’ may be interchanged throughout the document. In analogy, 2,6-diaminopurine is identical to 2-aminoadenine and these terms may be interchanged throughout the document. The use of 2,6-diaminopurine has been disclosed in another context in U.S. Pat. No. 7,745,420.

The term “base modification” or “modified base” as identified herein refers to the modification of an existing base (i.e. pyrimidine or purine base) or to the de novo synthesis of a base. This de novo synthetized base could be qualified as “modified” by comparison to an existing base. An oligonucleotide of the invention comprising a 5-methylcytosine and/or a 5-methyluracil and/or a 2,6-diaminopurine base means that at least one of the cytosine nucleobases of said oligonucleotide has been modified by substitution of the proton at the 5-position of the pyrimidine ring with a methyl group, i.e. a 5-substituted cytosine, and/or that at least one of the uracil nucleobases of said oligonucleotide has been modified by substitution of the proton at the 5-position of the pyrimidine ring with a methyl group (i.e. a 5-methyluracil), and/or that at least one of the adenine nucleobases of said oligonucleotide has been modified by substitution of the proton at the 2-position with an amino group (i.e. a 2,6-diaminopurine), respectively. Within the context of the invention, the expression “the substitution of a proton with a methyl group in position 5 of the pyrimidine ring” may be replaced by the expression “the substitution of a pyrimidine with a 5-methylpyrimidine,” with pyrimidine referring to only uracil, only cytosine or both. Likewise, within the context of the invention, the expression “the substitution of a proton with an amino group in position 2 of adenine” may be replaced by the expression “the substitution of an adenine with a 2,6-diaminopurine.” If said oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9 or more cytosines, uracils, and/or adenines, at least one, 2, 3, 4, 5, 6, 7, 8, 9 or more cytosines, uracils and/or adenines respectively have been modified this way. Preferably all cytosines, uracils and/or adenines have been modified this way or substituted by 5-methylcytosine, 5-methyluracil and/or 2,6-diaminopurine, respectively. No need to say that this aspect of the invention could only be applied to oligonucleotides comprising at least one cytosine, uracil, or adenine, respectively, in their sequence. An oligonucleotide comprising at least one 5-methylcytosine, 5-methyluracil and/or 2,6-diaminopurine may be called a modified oligonucleotide by reference to its non-modified counterpart comprising no 5-methylcytosine, no 5-methyluracil and no 2,6-diaminopurine. A non-modified counterpart may also be identified as being an oliognucleotide comprising unmodified cytosines, unmodified uraciles and unmodified adenines. Preferred non-modified sequences are represented by one of the following base or nucleotide sequences comprising or consisting of SEQ ID NO:91, 93-170.

We discovered that the presence of a 5-methylcytosine, 5-methyluracil and/or a 2,6-diaminopurine in an oligonucleotide of the invention has a positive effect on at least one of the parameters of said oligonucleotides. In this context, parameters may include: binding affinity and/or kinetics, exon skipping activity, biostability, (intra-tissue) distribution, cellular uptake and/or trafficking, and/or immunogenicity of said oligonucleotide, as explained below. Said positive effect may be correlated with the number or percentage of base modifications incorporated. For the parameter of exon skipping activity, we found for some oligonucleotides that modification of nucleobases is not needed per se to obtain relatively high levels of exon skipping. This may be related to the specific role (and strength) of the specifically targeted sequence within the exon in its splicing process.

Binding affinity and kinetics depend on the AON's thermodynamic properties. These are at least in part determined by the melting temperature of said oligonucleotide (Tm; calculated with e.g. the oligonucleotide properties calculator (http://www.unc.edu/˜cail/biotool/oligo/index.html or http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/) for single stranded RNA using the basic Tm and the nearest neighbor model), and/or the free energy of the oligonucleotide-target exon complex (using RNA structure version 4.5 or RNA mfold version 3.5). If a Tm is increased, the exon skipping activity typically increases, but when a Tm is too high, the AON is expected to become less sequence-specific. An acceptable Tm and free energy depend on the sequence of the oligonucleotide. Therefore, it is difficult to give preferred ranges for each of these parameters.

Exon skipping activity is preferably measured by analysing total RNA isolated from AON-treated muscle cell cultures or muscle tissue by reverse transcriptase polymerase chain reaction (RT-PCR) using DMD gene-specific primers flanking the targeted exon as described (Aartsma-Rus et al., 2003). RT-PCR products are analyzed on 1-2% agarose gels or with the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands). The ratio of shorter transcript fragments, representing transcripts in which the targeted exon is skipped, to the total of transcript products is assessed (calculated as percentage of exon skipping induced by an AON). Shorter fragments may also be sequenced to determine the correctness and specificity of the targeted exon skipping. An increase in percentage of exon skipping may be detected for a modified oligonucleotide of the invention (i.e. an oligonucleotide comprising a 2′-O-methyl RNA monomer, a phosphorothioate backbone and a 5-methylpyrimidine and/or a 2,6-diaminopurine base) compared to its non-modified counterpart (i.e. an oligonucleotide comprising a 2′-O-methyl RNA monomer, a phosphorothioate backbone and not comprising any 5-methylpyrimidine and any 2,6-diaminopurine base). Said increase is preferably a detectable increase assessed as explained above using RT-PCR. Said increase is preferably an increase of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 times higher, or even 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times higher or more.

Biodistribution and biostability are preferably at least in part determined by a validated hybridization ligation assay adapted from Yu et al., 2002. In an embodiment, plasma or homogenized tissue samples are incubated with a specific capture oligonucleotide probe. After separation, a DIG-labeled oligonucleotide is ligated to the complex and detection followed using an anti-DIG antibody-linked peroxidase. Non-compartmental pharmacokinetic analysis is performed using WINNONLIN software package (model 200, version 5.2, Pharsight, Mountainview, Calif.). Levels of AON (ug) per mL plasma or mg tissue are monitored over time to assess area under the curve (AUC), peak concentration (Cmax), time to peak concentration (Tmax), terminal half life and absorption lag time (tlag). Such a preferred assay has been disclosed in the experimental part.

AONs may stimulate an innate immune response by activating the Toll-like receptors (TLR), including TLR9 and TLR7 (Krieg et al., 1995). The activation of TLR9 typically occurs due to the presence of non-methylated CG sequences present in oligodeoxynucleotides (ODNs), by mimicking bacterial DNA which activates the innate immune system through TLR9-mediated cytokine release. The 2′-O-methyl modification is however suggested to markedly reduce such possible effect. TLR7 has been described to recognize uracil repeats in RNA (Diebold et al., 2006).

Activation of TLR9 and TLR7 result in a set of coordinated immune responses that include innate immunity (macrophages, dendritic cells (DC), and NK cells)(Krieg et al., 1995; Krieg, 2000). Several chemo- and cytokines, such as IP-10, TNFα, IL-6, MCP-1 and IFNα (Wagner, 1999; Popovic et al., 2006) have been implicated in this process. The inflammatory cytokines attract additional defensive cells from the blood, such as T and B cells. The levels of these cytokines can be investigated by in vitro testing. In short, human whole blood is incubated with increasing concentrations of AONs after which the levels of the cytokines are determined by standard commercially available ELISA kits. Such a preferred assay has been described in the experimental part. A decrease in immunogenicity preferably corresponds to a detectable decrease of concentration of at least one of the cytokines mentioned above by comparison to the concentration of corresponding cytokine in an assay in a cell treated with an oligonucleotide comprising at least one 5-methylcytosine compared to a cell treated with a corresponding oligonucleotide having no 5-methylcytosines.

Accordingly, a preferred oligonucleotide of the invention has an improved parameter, such as an acceptable or a decreased immunogenicity and/or a better biodistribution and/or acceptable or improved RNA binding kinetics and/or thermodynamic properties by comparison to a corresponding oligonucleotide consisting of a 2′-O-methyl phosphorothioate RNA without a 5-methylcytosine, a 5-methyluracil and a 2,6-diaminopurine (i.e. so called non-modified oligonucleotide). Said non-modified oligonucleotide may also be identified as being an oliognucleotide comprising unmodified cytosines, unmodified uraciles and unmodified adenines. Each of these parameters could be assessed using assays known to the skilled person or preferably as disclosed herein.

Below other chemistries and modifications of the oligonucleotide of the invention are defined. These additional chemistries and modifications may be present in combination with the chemistry already defined for said oligonucleotide, i.e. the presence of a 5-methylcytosine, a 5-methyluracil and/or a 2,6-diaminopurine, and the oligonucleotide comprising or consisting of a 2′-O-methyl phosphorothioate RNA.

A preferred oligonucleotide of the invention comprises or consists of an RNA molecule or a modified RNA molecule. In a preferred embodiment, an oligonucleotide is single stranded. The skilled person will understand that it is however possible that a single stranded oligonucleotide may form an internal double stranded structure. However, this oligonucleotide is still named a single stranded oligonucleotide in the context of this invention.

In addition to the modifications described above, the oligonucleotide of the invention may comprise further modifications such as different types of nucleic acid monomers or nucleotides as described below. Different types of nucleic acid monomers may be used to generate an oligonucleotide of the invention. Said oligonucleotide may have at least one backbone, and/or sugar modification and/or at least one base modification compared to an RNA-based oligonucleotide.

A base modification includes a modified version of the natural purine and pyrimidine bases (e.g. adenine, uracil, guanine, cytosine, and thymine), such as hypoxanthine, orotic acid, agmatidine, lysidine, 2-thiopyrimidine (e.g. 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5-substituted pyrimidine (e.g. 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4-ethylcytosine, or derivatives thereof, N2-cyclopentylguanine (cPent-G), N2-cyclopentyl-2-aminopurine (cPent-AP), and N2-propyl-2-aminopurine (Pr-AP), pseudouracil or derivatives thereof, and degenerate or universal bases, like 2,6-difluorotoluene or absent bases like abasic sites (e.g. 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen has been replaced with nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in U.S. Pat. No. 6,683,173 (Epoch Biosciences), which is incorporated here entirely by reference. cPent-G, cPent-AP and Pr-AP were shown to reduce immunostimulatory effects when incorporated in siRNA (Peacock H. et al. J. Am. Chem. Soc. 2011, 133, 9200).

A pseudouracil is a naturally occurring isomerized version of uracil, with a C-glycoside rather than the regular N-glycoside as in uridine. Pseudouridine-containing synthetic mRNA may have an improved safety profile compared to uridine-containing mRNA (WO 2009127230, incorporated here in its entirety by reference).

In an embodiment, an oligonucleotide of the invention comprises an abasic site or an abasic monomer. Within the context of the invention, such monomer may be called an abasic site or an abasic monomer. An abasic monomer or abasic site is a monomer or building block that lacks a nucleobase by comparison to a corresponding monomer comprising a nucleobase. Within the invention, an abasic monomer is thus a building block part of an oligonucleotide but lacking a nucleobase. Such abasic monomer may be present or linked or attached or conjugated to a free terminus of an oligonucleotide. In a more preferred embodiment, an oligonucleotide of the invention comprises 1-20 or more abasic monomers. Therefore, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more abasic monomers may be present in an oligonucleotide of the invention.

An abasic monomer may be of any type known and conceivable by the skilled person, non-limiting examples of which are depicted below:

Herein, R1 and R2 are independently H, an oligonucleotide or other abasic site(s), provided that not both R1 and R2 are H and R1 and R2 are not both an oligonucleotide. An abasic monomer(s) can be attached to either or both termini of the oligonucleotide as specified before. It should be noted that an oligonucleotide attached to one or two an abasic site(s) or abasic monomer(s) may comprise less than 10 nucleotides. In this respect, the oligonucleotide according to the invention may comprise at least 10 nucleotides, optionally including one or more abasic sites or abasic monomers at one or both termini.

Depending on its length an oligonucleotide of the invention may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 base modifications. It is also encompassed by the invention to introduce more than one distinct base modification in said oligonucleotide.

A sugar modification includes a modified version of the ribosyl moiety, such as 2′-O-modified RNA such as 2′-O-alkyl or 2′-O-(substituted)alkyl e.g. 2′-O-methyl, 2′-O-(2-cyanoethyl), 2′-O-(2-methoxy)ethyl (2′-MOE), 2′-O-(2-thiomethyl)ethyl, 2′-O-butyryl, 2′-O-propargyl, 2′-O-allyl, 2′-O-(3-amino)propyl, 2′-O-(3-(dimethylamino)propyl), 2′-O-(2-amino)ethyl, 2′-O-(2-(dimethylamino)ethyl); 2′-deoxy (DNA); 2′-O-(haloalkoxy)methyl (Arai K. et al. Bioorg. Med. Chem. 2011, 21, 6285) e.g. 2′-O-(2-chloroethoxy)methyl (MCEM), 2′-O-(2,2-dichloroethoxy)methyl (DCEM); 2′-O-alkoxycarbonyl e.g. 2′-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2′-O-[2-(N-methylcarbamoyl)ethyl] (MCE), 2′-O-[2-(N,N-dimethylcarbamoyl)ethyl](DCME); 2′-halo e.g. 2′-F, FANA (2′-F arabinosyl nucleic acid); carbasugar, sulfa and sulfosugar and azasugar modifications; 3′-O-alkyl e.g. 3′-O-methyl, 3′-O-butyryl, 3′-O-propargyl; 4′-carboxy e.g. 4′-carboxythymidine (Hari et al.); and their derivatives.

Other sugar modification includes “bridged” or “bicylic” nucleic acid (BNA), e.g. locked nucleic acid (LNA), xylo-LNA, α-L-LNA, β-D-LNA, cEt (2′-O,4′-C constrained ethyl) LNA, cMOEt (2′-O,4′-C constrained methoxyethyl) LNA, ethylene-bridged nucleic acid (ENA), tricyclo DNA (tcDNA, tc-PS-DNA e.g. US patent application 20120149756); 3′-S-phosphorothiolate DNA (e.g. Org. Biol. Chem. 2013, 11, 966); doubly constrained nucleic acid (tri-NA, e.g. Hanessian et al.); unlocked nucleic acid (UNA); cyclohexenyl nucleic acid (CeNA), altriol nucleic acid (ANA), hexitol nucleic acid (HNA), fluorinated HNA (F-HNA), pyranosyl-RNA (p-RNA), 3′-deoxypyranosyl-DNA (p-DNA); morpholino (as e.g. in PMO, PPMO, PMOPlus, PMO-X); and their derivatives. Depending on its length, an oligonucleotide of the invention may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 sugar modifications. It is also encompassed by the invention to introduce more than one distinct sugar modification in said oligonucleotide. In an embodiment, an oligonucleotide as defined herein comprises or consists of an LNA or a derivative thereof. BNA derivatives are for example described in WO 2011/097641, which is incorporated in its entirety by reference. In a more preferred embodiment, an oligonucleotide of the invention is fully 2′-O-methyl modified. Examples of PMO-X are described in WO2011150408, which is incorporated here in its entirety by reference.

A backbone modification includes a modified version of the phosphodiester present in RNA, such as phosphorothioate (PS), chirally pure phosphorothioate, phosphorodithioate (PS2), phosphonoacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate, thiophosphonoacetamide, phosphorothioate prodrug, H-phosphonate, methyl phosphonate, methyl phosphonothioate, methyl phosphate, methyl phosphorothioate, ethyl phosphate, ethyl phosphorothioate, boranophosphate, boranophosphorothioate, methyl boranophosphate, methyl boranophosphorothioate, methyl boranophosphonate, methyl boranophosphonothioate, and their derivatives. Another modification includes phosphoramidite, phosphoramidate, N3′→P5′ phosphoramidate, phosphordiamidate, phosphorothiodiamidate, sulfamate, dimethylenesulfoxide, sulfonate, triazole, oxalyl, carbamate, methyleneimino (MMI), 3′-S-phosphorothiolate (Org. Biol. Chem. 2013, 11, 966) and thioacetamido nucleic acid (TANA); and their derivatives. Depending on its length, an oligonucleotide of the invention may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 backbone modifications. It is also encompassed by the invention to introduce more than one distinct backbone modification in said oligonucleotide.

In a preferred embodiment, an oligonucleotide of the invention comprises at least one phosphorothioate modification. In a more preferred embodiment, an oligonucleotide of the invention is fully phosphorothioate modified.

Other chemical modifications of an oligonucleotide of the invention include peptide-base nucleic acid (PNA), boron-cluster modified PNA, pyrrolidine-based oxy-peptide nucleic acid (POPNA), glycol- or glycerol-based nucleic acid (GNA), threose-based nucleic acid (TNA), acyclic threoninol-based nucleic acid (aTNA), morpholino-based oligonucleotide (PMO, PPMO, PMO-X), cationic morpholino-based oligomers (PMOPlus), oligonucleotides with integrated bases and backbones (ONIBs), pyrrolidine-amide oligonucleotides (POMs); and their derivatives.

In another embodiment, an oligonucleotide comprises a peptide nucleic acid and/or a morpholino phosphorodiamidate or a derivative thereof.

In another embodiment, an oligonucleotide comprises a monothiophosphate moiety at the 5′ position of the 5′ terminal residue and/or a monothiophosphate moiety at the 3′ position of the 3′ terminal residue. These monothiophosphate groups have been shown to improve oligonucleotide stability (e.g. US patent application 20120148664-miRagen).

With the advent of nucleic acid mimicking technology it has become possible to generate molecules that have a similar, preferably the same hybridization characteristics in kind not necessarily in amount as nucleic acid itself. Such functional equivalents are of course also suitable for use in the invention.

The skilled person will understand that not each sugar, base, and/or backbone may be modified the same way. Several distinct modified sugars, bases and/or backbones may be combined into one single oligonucleotide of the invention.

A person skilled in the art will also recognize that there are many synthetic derivatives of oligonucleotides. A backbone modification includes a modified version of the phosphodiester present in RNA, such as phosphorothioate (PS), chirally pure phosphorothioate, phosphorodithioate (PS2), phosphonoacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate, thiophosphonoacetamide, phosphorothioate prodrug, H-phosphonate, methyl phosphonate, methyl phosphonothioate, methyl phosphate, methyl phosphorothioate, ethyl phosphate, ethyl phosphorothioate, boranophosphate, boranophosphorothioate, methyl boranophosphate, methyl boranophosphorothioate, methyl boranophosphonate, methyl boranophosphonothioate, and their derivatives. Another modification includes phosphoramidite, phosphoramidate, N3′→P5′ phosphoramidate, phosphordiamidate, phosphorothiodiamidate, sulfamate, dimethylenesulfoxide, sulfonate, and thioacetamido nucleic acid (TANA); and their derivatives.

Preferably, said oligonucleotide comprises RNA, as RNA/RNA duplexes are very stable. It is preferred that an RNA oligonucleotide comprises a modification providing the RNA with an additional property, for instance resistance to endonucleases, exonucleases, and RNaseH, additional hybridisation strength, increased stability (for instance in a bodily fluid), increased or decreased flexibility, increased activity, reduced toxicity, increased intracellular transport, tissue-specificity, etc. In addition, the mRNA complexed with the oligonucleotide of the invention is preferably not susceptible to RNaseH cleavage. Preferred modifications have been identified above.

Accordingly, the invention provides an oligonucleotide comprising a 2′-O-methyl phosphorothioate RNA monomer or consisting of 2′-O-methyl phosphorothioate RNA and comprising a 5-methylpyrimidine and/or a 2,6-diaminopurine base. Most preferably, this oligonucleotide consists of 2′-O-methyl RNA monomers connected through a phosphorothioate backbone and all of its cytosines and/or all of its uracils and/or all of its adenines, independently, have been substituted by 5-methylcytosine, 5-methyluracil and/or 2,6-diaminopurine, respectively. Preferred modified and non-modified oligonucleotides encompassed by the invention and disclosed herein comprises or consists of one of a base or nucleotide sequence selected from one of SEQ ID NO: 14-90 as identified in table 1. The expression “oligonucleotide represented by a nucleotide or base sequence selected from SEQ ID NO: 14-90” could be replaced by the expression “oligonucleotide represented by a nucleotide or base sequence selected from one of SEQ ID NO:14-90” or by the expression “oligonucleotide represented by a nucleotide or base sequence selected from the list of SEQ ID NO:14-90”. The same holds for other groups of SEQ ID NO referred herein. Preferred non-modified oligonucleotides are derived from one of SEQ ID NO: 14-90 and encompassed by the present invention and disclosed herein comprises or consists of one of a base or nucleotide sequences selected from SEQ ID NO: 91, 93-170.

Modified oligonucleotides are preferably derived from one of SEQ ID NO:14-90 and encompassed by the present invention and disclosed herein comprises or consists of one of a base or nucleotide sequences selected from SEQ ID NO: 92, 171-213, 215.

Please note that two SEQ ID NO present in the sequence listing are identical: SEQ ID NO:91 is identical with SEQ ID NO: 132. SEQ ID NO: 92 is identical with SEQ ID NO:199.

The sequence representing each of these oligonucleotides is disclosed in Tables 1-3 and in the sequence listing. Later on in the description, most preferred oligonucleotides are described in more detail.

Thus, an oligonucleotide of the invention may have:

At least one and preferably all cytosines substituted with 5-methylcytosines,

At least one and preferably all cytosines substituted with 5-methylcytosines and at least one and preferably all uracils substituted with 5-methyluracils,

At least one and preferably all cytosines substituted with 5-methylcytosines and at least one and preferably all adenines substituted with 2,6-diaminopurines,

At least one and preferably all cytosines substituted with 5-methylcytosines and at least one and preferably all uracils substituted with 5-methyluracils and at least one and preferably all adenines substituted with 2,6-diaminopurines,

At least one and preferably all uracils substituted with 5-methyluracils,

At least one and preferably all uracils substituted with 5-methyluracils and at least one and preferably all adenines substituted with 2,6-diaminopurines, or

At least one and preferably all adenines substituted with 2,6-diaminopurines.

However, an oligonucleotide may also have at least one or at least two or at least half or all its cytosines substituted with 5-methylcytosines. If a non-modified oligonucleotide of the invention preferably based on SEQ ID NO:14-90 has x cytosines, x being an integer ranged from 1 to 33, a corresponding modified oligonucleotide of the invention may have 1, 2, 3, . . . (x-2), (x-1), x 5-methylcytosines.

If x is 3 in such a non-modified oligonucleotide, the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2 or 3.

If x is 4 in such a non-modified oligonucleotide, the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3 or 4.

If x is 5 in such a non-modified oligonucleotide, the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3, 4 or 5.

If x is 6 in such a non-modified oligonucleotide, the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3, 4, 5 or 6.

If x is 7 in such a non-modified oligonucleotide, the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3, 4, 5, 6 or 7.

If x is 8 in such a non-modified oligonucleotide, the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3, 4, 5, 6, 7, or 8.

The same holds for uracils substituted with 5-methyluracils and adenines substituted with 2,6-diaminopurines.

Preferably, an oligonucleotide of the invention is for use as a medicament for DMD, more preferably said oligonucleotide is for use in therapeutic RNA modulation. Therefore, an oligonucleotide is an antisense oligonucleotide (AON). An antisense oligonucleotide is an oligonucleotide which is reverse complementary to a specific sequence of the DMD or dystrophin pre-mRNA derived from the coding sense strand of a DNA of an individual. This oligonucleotide binds to and/or targets and/or hybridizes and/or is able to bind to and/or is able to target and/or is able to hybridize said sequence of said pre-mRNA. The objective of RNA modulation for DMD is to skip one or more specific exons in the DMD or dystrophin pre-mRNA in order to restore the open reading frame of the transcript and to induce the expression of a shorter but (more) functional dystrophin protein, with the ultimate goal to be able to interfere with the course of the disease

In a preferred embodiment, an oligonucleotide of the invention is thus used for inducing exon-skipping in the DMD or dystrophin pre-mRNA in a cell, in an organ, in a tissue and/or in an individual. Exon-skipping results in a mature DMD or dystrophin mRNA that does not contain a skipped exon and thus, when said exon codes for amino acids, can lead to the expression of a shorter protein product. The skipping of an exon is preferably induced by the binding of an AON to specific exon-internal sequences comprising splicing regulatory elements, the splice sites and/or intronic branchpoint sequences.

As defined herein a DMD pre-mRNA preferably means a pre-mRNA of a DMD gene coding for a dystrophin protein. A mutated DMD pre-mRNA corresponds to a pre-mRNA of a BMD or DMD patient with a mutation when compared to a wild type DMD pre-mRNA of a non-affected person, resulting in (reduced levels of) an aberrant protein (BMD), or the absence of functional dystrophin (DMD). A DMD pre-mRNA is also named a dystrophin pre-mRNA. A DMD gene may also be named a dystrophin gene. Dystrophin and DMD may be used interchangeably throughout the application.

A patient is preferably intended to mean a patient having DMD or BMD as later defined herein or a patient susceptible to develop DMD or BMD due to his or her genetic background. In the case of a DMD patient, an oligonucleotide used will preferably correct one mutation as present in the DMD gene of said patient and create a protein that will look like a BMD protein: said protein will preferably be a functional or semi-functional dystrophin as later defined herein. In the case of a BMD patient, an oligonucleotide as used will preferably correct one mutation as present in the BMD gene of said patient and create a dystrophin which will be more functional than the dystrophin which was originally present in said BMD patient.

As defined herein, a functional dystrophin is preferably a wild type dystrophin corresponding to a protein having the amino acid sequence as identified in SEQ ID NO: 1. As defined herein, a semi-functional dystrophin is preferably a BMD-like dystrophin corresponding to a protein having an acting binding domain in its N terminal part (first 240 amino acids at the N terminus), a cysteine-rich domain (amino acid 3361 till 3685) and a C terminal domain (last 325 amino acids at the C terminus) each of these domains being present in a wild type dystrophin as known to the skilled person. The amino acids indicated herein correspond to amino acids of the wild type dystrophin being represented by SEQ ID NO: 1. In other words, a functional or a semi-functional dystrophin is a dystrophin which exhibits at least to some extent an activity of a wild type dystrophin. “At least to some extent” preferably means at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of a corresponding activity of a wild type functional dystrophin. In this context, an activity of a functional dystrophin is preferably binding to actin and to the dystrophin-associated glycoprotein complex (DGC or DAPC) (Ehmsen J et al, 2002).

Binding of dystrophin to actin and to the DGC or DAPC complex may be visualized by either co-immunoprecipitation using total protein extracts or immunofluorescence analysis of cross-sections using various antibodies reacting with the different members of the complex, from a control (non-DMD) biopsy of one from a muscle suspected to be dystrophic, pre- and/or post-treatment, as known to the skilled person.

Individuals or patients suffering from Duchenne muscular dystrophy typically have a mutation in the gene encoding dystrophin (the DMD or dystrophin gene) that prevents synthesis of the complete protein, i.e a premature stop codon prevents the synthesis of the C-terminus. In Becker muscular dystrophy the dystrophin gene also comprises a mutation compared to the wild type but the mutation does typically not result in a premature stop codon and the C-terminus is typically synthesized. As a result a functional or semi-functional dystrophin protein is synthesized that has at least the same activity in kind as the wild type protein, although not necessarily the same amount of activity. The genome of a BMD patient typically encodes a dystrophin protein comprising the N terminal part (first 240 amino acids at the N terminus), a cysteine-rich domain (amino acid 3361 till 3685) and a C-terminal domain (last 325 amino acids at the C-terminus) but in the majority of cases its central rod shaped domain is shorter than the one of a wild type dystrophin (Monaco et al., 1988). Antisense oligonucleotide-induced exon skipping for the treatment of DMD is typically directed to overcome a premature stop in the pre-mRNA by skipping an exon, preferably in the central rod-domain shaped domain, to correct the open reading frame and allow synthesis of remainder of the dystrophin protein including the C-terminus, albeit that the protein is somewhat smaller as a result of a smaller rod domain. In a preferred embodiment, an individual having DMD and being treated by an oligonucleotide as defined herein will be provided a dystrophin which exhibits at least to some extent an activity of a wild type dystrophin. More preferably, if said individual is a Duchenne patient or is suspected to be a Duchenne patient, a functional or a semi-functional dystrophin is a dystrophin of an individual having BMD: typically said dystrophin is able to interact with both actin and the DGC or DAPC, but its central rod shaped domain may be shorter than the one of a wild type dystrophin (Monaco et al., 1988). The central rod domain of wild type dystrophin comprises 24 spectrin-like repeats. For example, a central rod shaped domain of a dystrophin as provided herein may comprise 5 to 23, 10 to 22 or 12 to 18 spectrin-like repeats as long as it can bind to actin and to DGC.

Alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual using an oligonucleotide of the invention may be assessed by any of the following assays: prolongation of time to loss of walking, improvement of muscle strength, improvement of the ability to lift weight, improvement of the time taken to rise from the floor, improvement in the nine-metre walking time, improvement in the time taken for four-stairs climbing, improvement of the leg function grade, improvement of the pulmonary function, improvement of cardiac function, improvement of the quality of life. Each of these assays is known to the skilled person. As an example, the publication of Manzur et al (2008) gives an extensive explanation of each of these assays. For each of these assays, as soon as a detectable improvement or prolongation of a parameter measured in an assay has been found, it will preferably mean that one or more symptoms of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy has been alleviated in an individual using an oligonucleotide of the invention. Detectable improvement or prolongation is preferably a statistically significant improvement or prolongation as described in Hodgetts et al. (2006). Alternatively, the alleviation of one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy may be assessed by measuring an improvement of a muscle fiber function, integrity and/or survival. In a preferred method, one or more symptom(s) of a DMD or a BMD patient is/are alleviated and/or one or more characteristic(s) of one or more muscle cells from a DMD or a BMD patient is/are improved. Such symptoms or characteristics may be assessed at the cellular, tissue level or on the patient self.

An alleviation of one or more characteristics of a muscle cell from a patient may be assessed by any of the following assays on a myogenic cell or muscle cell from a patient: reduced calcium uptake by muscle cells, decreased collagen synthesis, altered morphology, altered lipid biosynthesis, decreased oxidative stress, and/or improved muscle fiber function, integrity, and/or survival. These parameters are usually assessed using immunofluorescence and/or histochemical analyses of cross sections of muscle biopsies.

The improvement of muscle fiber function, integrity and/or survival may be assessed using at least one of the following assays: a detectable decrease of creatine kinase in blood, a detectable decrease of necrosis of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic, and/or a detectable increase of the homogeneity of the diameter of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic. Each of these assays is known to the skilled person.

Creatine kinase may be detected in blood as described in Hodgetts et al. (2006). A detectable decrease in creatine kinase may mean a decrease of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the concentration of creatine kinase in a same DMD or BMD patient before treatment.

A detectable decrease of necrosis of muscle fibers is preferably assessed in a muscle biopsy, more preferably as described in Hodgetts et al. (2006), using biopsy cross-sections. A detectable decrease of necrosis may be a decrease of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the area wherein necrosis has been identified using biopsy cross-sections. The decrease is measured by comparison to the necrosis as assessed in a same DMD or BMD patient before treatment.

A detectable increase of the homogeneity of the diameter of a muscle fiber is preferably assessed in a muscle biopsy cross-section, more preferably as described in Hodgetts et al. (2006). The increase is measured by comparison to the homogeneity of the diameter of a muscle fiber in a same DMD or BMD patient before treatment

Preferably, an oligonucleotide of the invention provides said individual with a functional or a semi-functional dystrophin protein (typically in the case of DMD) and is able to, for at least in part decrease the production of an aberrant dystrophin protein in said individual (typically in the case of BMD).

Decreasing the production of an aberrant dystrophin mRNA, or aberrant dystrophin protein, preferably means that 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less of the initial amount of aberrant dystrophin mRNA, or aberrant dystrophin protein, is still detectable by RT PCR (mRNA) or immunofluorescence or western blot analysis (protein). An aberrant dystrophin mRNA or protein is also referred to herein as a less functional (compared to a wild type functional dystrophin protein as earlier defined herein) or a non-functional dystrophin mRNA or protein. A non functional dystrophin protein is preferably a dystrophin protein which is not able to bind actin and/or members of the DGC protein complex. A non-functional dystrophin protein or dystrophin mRNA does typically not have, or does not encode a dystrophin protein with an intact C-terminus of the protein. The detection of a functional or semi-functional dystrophin mRNA or protein may be done as for an aberrant dystrophin mRNA or protein.

Once a DMD patient is provided with a functional or a semi-functional dystrophin protein, at least part of the cause of DMD is taken away. Hence, it would then be expected that the symptoms of DMD are at least partly alleviated. The enhanced skipping frequency also increases the level of functional or a semi-functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.

Exons contain one or more specific sequences comprising splicing regulatory elements which have shown to be effective targets for antisense oligonucleotides (Aartsma-Rus et al, 2010). One embodiment therefore provides an oligonucleotide for providing said individual with a functional or semi-functional dystrophin protein wherein said oligonucleotide comprises a sequence which is specifically binding, targeting and/or hybridizing with and/or blocking these splicing regulatory elements in a dystrophin pre-mRNA exon. Such oligonucleotide is also able to bind and/or target and/or hybridize with and/or block these splicing regulatory elements in a dystrophin pre-mRNA. In addition, since an exon will only be included into the resulting mRNA when both the splice sites are recognized by the spliceosome complex, splice sites are other targets for an oligonucleotide of the invention. One embodiment therefore provides an oligonucleotide for providing said individual with a functional or semi-functional dystrophin protein wherein said oligonucleotide comprises a sequence which is specifically binding and/or targeting and/or hybridizing with, and/or blocking one of or both the splice sites of an exon of a dystrophin pre-mRNA. Such oligonucleotide is also able to bind and/or target, hybridize with and/or block one or both of these splice sites of an exon of a dystrophin pre-mRNA. Usually a splice site of an exon comprises 1, 2, 3, or more nucleotides present in said exon and 1, 2, 3, or more nucleotides present in an adjacent or neighboring intron. In one embodiment an oligonucleotide is used which is solely binding to and/or targeting and/or hybridizing with an intron region of a dystrophin pre-mRNA. Such oligonucleotide is able to bind and/or able to target and/or able to hybridize with said intron region. This is however not necessary: it is also possible to use an oligonucleotide which targets and/or binds and/or hybridizes with and/or is able to target and/or is able to binds and/or is able to hybridizes with an intron-specific sequence as well as exon-specific sequence. Of course, an oligonucleotide is not necessarily binding to and/or targeting and/or hybridizing with the entire sequence of a dystrophin exon or intron. Such oligonucleotide is also not necessary able to bind to and/or able to target and/or able to hybridize with the entire sequence of a dystrophin exon or intron. Oligonucleotides which are specifically binding, targeting and/or hybridizing with and/or which are specifically able to bind and/or able to target and/or able to hybridize part of such exon or intron are preferred. An oligonucleotide is used, said oligonucleotide is preferably reverse complementary to, and/or binds to, and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with at least part of a dystrophin exon and/or intron, said part having at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.

Splicing of a dystrophin pre-mRNA occurs via two sequential transesterification reactions involving an intronic branch point and a splice site of an adjacent intron. Hence, an oligonucleotide is used for exon skipping, wherein said oligonucleotide comprises a sequence which is binding to and/or targeting and/or hybridizing with or is able to bind to and/or is able to target and/or is able to hybridize with such branch point and/or splice site. Preferably said splice site and/or branch point is present in a dystrophin pre-mRNA.

Since splice sites contain consensus sequences, the use of an oligonucleotide part or a functional equivalent thereof comprising a sequence which is capable of binding to and/or able to bind to and/or able to target and/or able to hybridize and/or binds to and/or target and/or hybridizes with a splice site involves the risk of promiscuous hybridization. Hybridization of said oligonucleotide to other splice sites than the sites of the exon to be skipped could easily interfere with the accuracy of the splicing process. To overcome these and other potential problems related to the use of an oligonucleotide which is binding and/or hybridizing and/or targeting and/or is able to bind to and/or is able to target and/or is able to hybridize a splice site, most preferred embodiment provides an oligonucleotide for providing said individual with a functional or a semi-functional dystrophin protein, wherein said oligonucleotide or a functional equivalent thereof, binding to and/or hybridizing with and/or targeting and/or is able to bind to and/or is able to hybridize and/or is able to target a specific part of a dystrophin pre-mRNA exon. Exons contain coding sequences which are typically more specific that the non-coding intron sequences. Preferably, said oligonucleotide binding to and/or hybridizing with and/or targeting and/or able to bind to and/or able to hybridize with and/or able to target a specific part of a dystrophin pre-mRNA exon is capable of specifically blocking, interfering and/or inhibiting a splicing regulatory sequence and/or structure of the anticipated exon(s) in said dystrophin pre-mRNA. Interfering with such splicing regulatory sequence and/or structure has the advantage that such elements are located within the exon. The risk for sequence-related off-target effects is therefore limited. By providing an oligonucleotide for the interior of the exon to be skipped, it is possible to mask the exon from the splicing apparatus. The failure of the splicing apparatus to recognize the exon to be skipped thus leads to exclusion of the exon from the final mRNA. This embodiment does not interfere directly with the enzymatic process of the splicing machinery (the joining of the exons). It is thought that this allows the method to be more specific and/or reliable. It has been found that an oligonucleotide capable of binding to and/or able to bind to and/or able to target and/or able to hybridize and/or binding to and/or hybridizing with and/or targeting an exon at any point may be able to induce the skipping of said exon.

Within the context of the invention, an oligonucleotide of the invention may comprise a functional equivalent or an equivalent of an oligonucleotide. A functional equivalent or an equivalent of an oligonucleotide preferably means an oligonucleotide as defined herein wherein one or more nucleotides have been substituted and wherein an activity of said functional equivalent or equivalent is retained to at least some extent. Preferably, an activity of said oligonucleotide comprising a functional equivalent or equivalent of an oligonucleotide is providing a functional or a semi-functional dystrophin protein. Said activity of said oligonucleotide comprising a functional equivalent or an equivalent of an oligonucleotide is therefore preferably assessed by quantifying the amount of a functional or a semi-functional dystrophin protein. A functional or semi-functional dystrophin is herein preferably defined as being a dystrophin able to bind actin and members of the DGC (or DAPC) protein complex. The assessment of said activity of said functional equivalent of an oligonucleotide is preferably done by RT-PCR and sequencing (on RNA level; for detection of specific exon skipping), or by immunofluorescence and Western blot analyses (on protein level: for detection of protein restoration). Said activity is preferably retained to at least some extent when it represents at least 50%, or at least 60%, or at least 70% or at least 80% or at least 90% or at least 95% or more of corresponding activity of said oligonucleotide the functional equivalent or equivalent derives from. Throughout this application, when the word oligonucleotide is used it may be replaced by a functional equivalent thereof or an equivalent thereof as defined herein. In an embodiment, an equivalent or a functional equivalent of an oligonucleotide of the invention comprises a modification. Throughout this application, when the word oligonucleotide is used it may be replaced by an antisense oligonucleotide as defined herein unless otherwise indicated.

Hence, the use of an oligonucleotide or a functional equivalent thereof, or an equivalent thereof comprising a 2′-O-methyl phosphorothioate RNA monomer or consisting of 2′-O-methyl phosphorothioate RNA and comprising a 5-methylpyrimidine (i.e. a 5-methylcytosine and/or a 5-methyluracil) and/or a 2,6-diaminopurine base and being represented by a nucleotide sequence comprising or consisting of a sequence which is reverse complementary to, and/or binds to and/or targets and/or hybridizes and/or is able to bind to and/or is able to target and/or is able to hybridize with a dystrophin pre-mRNA exon is assumed to have a positive effect on at least one of the parameters of said oligonucleotide, as has already been defined herein, when compared to their counterparts which do not comprise any 5-methylcytosine, 5-methyluracil and 2,6-diaminopurine (i.e. so called non-modified oligonucleotide) as indicated earlier herein, and is therefore assumed to exhibit an improved therapeutic result in a DMD or a BMD cell of a patient and/or in a DMD or a BMD patient. Such a therapeutic result may be characterized by:

    • alleviating one or more symptom(s) of DMD or BMD and/or
    • alleviating one or more characteristics of a muscle cell from a patient and/or
    • providing said individual with a functional or semi-functional dystrophin protein and/or
    • at least in part decreasing the production of an aberrant dystrophin protein in said individual.

Each of these features has already been defined herein.

Preferably, an oligonucleotide is represented by a nucleotide sequence which comprises or consists of a sequence which is binding to and/or targeting and/or being reverse complementary to and/or is hybridizing with and/or which is able to bind to and/or is able to target and/or is able to hybridize with and/or is reverse complementary to at least a part of dystrophin pre-mRNA exons 44 to 55, said oligonucleotide having a length of at least 10 nucleotides. However, the length of said oligonucleotide may be at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Throughout the invention, said sequence representing the oligonucleotide may also be called a base or a nucleotide sequence.

Preferably, an oligonucleotide of the invention is represented by a nucleotide sequence or a base sequence comprising or consisting of a sequence that is capable of binding to, and/or targeting and/or being reverse complementary to and/or hybridizing with and/or being able to bind to and/or being able to hybridize with and/or being able to target a part of an exon of dystrophin pre-mRNA. Said binding or targeted part may be at least 50% of the length of the oligonucleotide of the invention, or at least 60%, or at least 70%, or at least 80%, or at least 90% or at least 95%, or 98% and up to 100%. An oligonucleotide may be represented by a nucleotide or a base sequence, said nucleotide or base sequence comprising a sequence that binds and/or targets and/or is reverse complementary to and/or hybridizes with and/or is able to bind to and/or is able to hybridize with and/or is able to target at least a part of an exon selected from the group consisting of exons 44 to 55 of dystrophin pre-mRNA as defined herein and additional flanking sequences. In a more preferred embodiment, the length of said binding or targeted part of said oligonucleotide is of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Several types of flanking sequences may be used. Preferably, flanking sequences are used to modify the binding of a protein to said oligonucleotide, or to modify a thermodynamic property of said oligonucleotide, more preferably to modify target RNA binding affinity. In another preferred embodiment, additional flanking sequences are reverse complementary to sequences of the dystrophin pre-mRNA which are not present in said exon. Such flanking sequences are preferably capable of binding to and/or targeting sequences comprising or consisting of the branchpoint and/or the splice site acceptor or donor consensus sequences of said exon. In a preferred embodiment, such flanking sequences are capable of binding to and/or targeting sequences comprising or consisting of sequences of an intron of the dystrophin pre-mRNA which is adjacent to said exon.

One preferred embodiment provides an oligonucleotide for providing said individual with a functional or a semi-functional dystrophin protein, said oligonucleotide or a functional equivalent thereof or an equivalent thereof, being represented by a sequence or a base sequence which comprises:

    • a sequence which binds, is able to bind, targets, hybridizes or is reverse complementary to a region of a dystrophin pre-mRNA exon that is hybridized to another part of a dystrophin pre-mRNA exon (closed structure), and
    • a sequence which binds and/or targets and/or hybridizes and/or is reverse complementary to and/or is able to bind and/or is able to target and/or is able to hybridize with a region of a dystrophin pre-mRNA exon that is not hybridized in said dystrophin pre-mRNA (open structure).

For this embodiment, reference is made to the WO 2004/083446 patent application. RNA molecules exhibit strong secondary structures, mostly due to base pairing of complementary or partly complementary stretches within the same RNA. It has long since been thought that structures in the RNA play a role in the function of the RNA. Without being bound by theory, it is believed that the secondary structure of the RNA of an exon plays a role in structuring the splicing process. Through its structure, an exon is recognized as a part that needs to be included in the mRNA. In an embodiment, an oligonucleotide is capable of interfering with the structure of the exon and therefore capable of interfering with the splicing apparatus of said exon, masking the exon from the splicing apparatus and thereby inducing the skipping of said exon. It has been found that many oligonucleotides indeed comprise this capacity, some more efficient than others. Without being bound by theory it is thought that the overlap with an open structure improves the invasion efficiency of the oligonucleotide (i.e. increases the efficiency with which the oligonucleotide can enter the structure), whereas the overlap with the closed structure subsequently increases the efficiency of interfering with the secondary structure of the RNA of the exon. It is found that the length of the partial reverse complementarity to both the closed and the open structure is not extremely restricted. We have observed high efficiencies with compounds comprising oligonucleotides with variable lengths of reverse complementarity in either structure. The term (reverse) complementarity is used herein to refer to a stretch of nucleic acids that can hybridise to another stretch of nucleic acids under physiological conditions. Hybridization conditions are later defined herein. It is thus not absolutely required that all the bases in the region of complementarity are capable of pairing with bases in the opposing strand. For instance, when designing an antisense oligonucleotide, one may want to incorporate for instance a residue that does not base pair with the base on the complementary strand. Mismatches may to some extent be allowed, if under the circumstances in the cell, the stretch of nucleotides is capable of hybridizing to the complementary part.

In a preferred embodiment a reverse complementary part of an antisense oligonucleotide (either to said open or to said closed structure) comprises at least 3, and more preferably at least 4 consecutive nucleotides. The reverse complementary regions are preferably designed such that, when combined, they are specific for an exon in a pre-mRNA. Such specificity may be created with various lengths of reverse complementary regions as this depends on the actual sequences in other (pre-)mRNA in the system. The risk that also one or more other pre-mRNA will be able to hybridise to an oligonucleotide decreases with increasing size of said oligonucleotide.

It is clear that an antisense oligonucleotide comprising mismatches in the region of reverse complementarity but that retain the capacity to hybridise to the targeted region(s) in the pre-mRNA, can be used in the present invention. However, preferably at least the reverse complementary parts do not comprise such mismatches as these typically have a higher efficiency and a higher specificity than oligonucleotide having such mismatches in one or more reverse complementary regions. It is thought that higher hybridisation strengths, (i.e. increasing number of interactions with the opposing strand) are favourable in increasing the efficiency of the process of interfering with the splicing machinery of the system. Preferably, the reverse complementarity is from 90 to 100%. In general this allows for 1 or 2 mismatch(es) in an oligonucleotide of 20 nucleotides or 1 to 4 mismatches in an oligonucleotide of 40 nucleotides. Therefore, we may have 1, 2, 3, 4, 5 mismatches in an oligonucleotide of 10 to 50 nucleotides. Preferably, 0, 1 or 2 mismatches are present in an oligonucleotide of 10 to 50 nucleotides.

The structure (i.e. open and closed structures) is best analyzed in the context of the pre-mRNA wherein the exon resides. Such structure may be analyzed in the actual RNA. However, it is currently possible to predict the secondary structure of an RNA molecule (at lowest energy costs) quite well using structure-modeling programs. Non-limiting examples of a suitable program are RNA structure version 4.5 or RNA mfold version 3.5 (Zuker et al., 2003). A person skilled in the art will be able to predict, with suitable reproducibility, a likely structure of an exon, given a nucleotide sequence.

Best predictions are obtained when providing such modeling programs with both said exon and flanking intron sequences. It is typically not necessary to model the structure of the entire pre-mRNA.

The open and closed structure to which the oligonucleotide of an oligonucleotide is directed, are preferably adjacent to one another. It is thought that in this way the annealing of the oligonucleotide to the open structure induces opening of the closed structure whereupon annealing progresses into this closed structure. Through this action the previously closed structure assumes a different conformation. However, when potential (cryptic) splice acceptor and/or donor sequences are present within the targeted exon, occasionally a new exon inclusion signal or splicing regulatory sequence, element, structure, or signal is generated defining a different (neo) exon, i.e. with a different 5′ end, a different 3′ end, or both. This type of activity is within the scope of the present invention as the targeted exon is excluded from the mRNA. The presence of a new exon, containing part of the targeted exon, in the mRNA does not alter the fact that the targeted exon, as such, is excluded. The inclusion of a neo-exon can be seen as a side effect which occurs only occasionally. There are two possibilities when exon skipping is used to restore (part of) an open reading frame of dystrophin that is disrupted as a result of a mutation. One is that the neo-exon is functional in the restoration of the reading frame, whereas in the other case the reading frame is not restored. When selecting a compound comprising an oligonucleotide for restoring dystrophin reading frames by means of exon-skipping it is of course clear that under these conditions only those compounds comprising those oligonucleotide are selected that indeed result in exon-skipping that restores the dystrophin open reading frame, with or without a neo-exon.

Further provided is an oligonucleotide for providing said individual with a functional or a semi-functional dystrophin protein, wherein said oligonucleotide or a functional equivalent thereof or an equivalent thereof comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base and is represented by a nucleotide or a base sequence comprising a sequence that is reverse complementary to and/or binds to and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with a binding site for a serine-arginine (SR) protein in RNA of an exon of a dystrophin pre-mRNA. In WO 2006/112705 patent application we have disclosed the presence of a correlation between the affectivity of an exon-internal antisense oligonucleotide in inducing exon skipping and the presence of a (for example by ESEfinder) predicted SR binding site in the target pre-mRNA site of said AON. Therefore, in one embodiment an oligonucleotide is generated comprising determining a (putative) binding site for an SR (Ser-Arg) protein in RNA of a dystrophin exon and producing a corresponding compound comprising oligonucleotide that is reverse complementary to and/or binds to and/or targets and/or hybridizes with and/or is able to bind and/or is able to target and/or is able to hybridize with said RNA and that at least partly overlaps said (putative) binding site. The term “at least partly overlaps” is defined herein as to comprise an overlap of only a single nucleotide of an SR binding site as well as multiple nucleotides of said binding site as well as a complete overlap of said binding site. This embodiment preferably further comprises determining from a secondary structure of said RNA, a region that is hybridized to another part of said RNA (closed structure) and a region that is not hybridized in said structure (open structure), and subsequently generating an oligonucleotide that at least partly overlaps said (putative) binding site and that overlaps at least part of said closed structure and overlaps at least part of said open structure. In this way we increase the chance of obtaining an oligonucleotide that is capable of interfering with the exon inclusion from the pre-mRNA into mRNA. It is possible that a first selected SR-binding region does not have the requested open-closed structure in which case another (second) SR protein binding site is selected which is then subsequently tested for the presence of an open-closed structure. This process is continued until a sequence is identified which contains an SR protein binding site as well as a(n) (partly overlapping) open-closed structure. This sequence is then used to design an oligonucleotide which is reverse complementary to said sequence.

Such a method for generating an antisense oligonucleotide is also performed by reversing the described order, i.e. first generating an oligonucleotide comprising determining, from a secondary structure of RNA from a dystrophin exon, a region that assumes a structure that is hybridised to another part of said RNA (closed structure) and a region that is not hybridised in said structure (open structure), and subsequently generating an oligonucleotide, of which at least a part of said oligonucleotide is reverse complementary to said closed structure and of which at least another part of said oligonucleotide is reverse complementary to said open structure. This is then followed by determining whether an SR protein binding site at least overlaps with said open/closed structure. In this way the method of WO 2004/083446 is improved. In yet another embodiment the selections are performed simultaneously.

Without wishing to be bound by any theory it is currently thought that use of an oligonucleotide directed to or targeting an SR protein binding site results in (at least partly) impairing the binding of an SR protein to the binding site of an SR protein which results in disrupted or impaired splicing.

Preferably, an open/closed structure and an SR protein binding site partly overlap and even more preferred an open/closed structure completely overlaps an SR protein binding site or an SR protein binding site completely overlaps an open/closed structure. This allows for an improved disruption of exon inclusion.

Besides consensus splice site and branchpoint intronic sequences, many (if not all) exons contain splicing regulatory sequences such as but not limited to exonic splicing enhancer (ESE) sequences to facilitate the recognition of genuine splice sites by the spliceosome (Cartegni et al., 2002; and Cartegni et al., 2003). A subgroup of splicing factors, called the SR proteins, can bind to these ESEs and recruit other splicing factors, such as U1 and U2AF to (weakly defined) splice sites. The binding sites of the four most abundant SR proteins (SF2/ASF, SC35, SRp40 and SRp55) have been analyzed in detail and these results are implemented in ESEfinder, a web source that predicts potential binding sites for these SR proteins (Cartegni et al., 2002; and Cartegni et al., 2003). There is a correlation between the effectiveness of an oligonucleotide and the presence/absence of an SF2/ASF, SC35 and SRp40 binding site in the site targeted by said oligonucleotide. In a preferred embodiment, the invention thus provides an oligonucleotide as described above, which is reverse complementary to and/or targets and/or binds to and/or hybridizes with and/or is able to target and/or is able to bind and/or is able to hybridize with a binding site for a SR protein. Preferably, said SR protein is SF2/ASF or SC35 or SRp40.

In one embodiment a DMD patient is provided with a functional or a semi-functional dystrophin protein by using an oligonucleotide or a functional equivalent thereof or an equivalent thereof comprising a 2′-O-methyl phosphorothioate RNA monomer or consisting of 2′-O-methyl phosphorothioate RNA and comprising a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base and being capable of specifically binding or targeting and/or being able to bind and/or being able to target and/or being able to hybridize a regulatory RNA sequence which is required for the correct splicing of a dystrophin exon in a transcript. Several cis-acting RNA sequences are required for the correct splicing of exons in a transcript. In particular, elements such as an exonic splicing enhancer (ESE), an exon recognition sequence (ERS), and/or an exonic splicing silencer (ESS) are identified to regulate specific and efficient splicing of constitutive and alternative exons. Using a sequence-specific antisense oligonucleotide or a base-specific antisense oligonucleotide (AON) that binds to and/or targets and/or is reverse complementary to and/or hybridizes with and/or is able to bind and/or is able to hybridize with and/or is able to target the elements, their regulatory function is disturbed so that the exon is skipped, as shown for DMD. Hence, in one preferred embodiment, an oligonucleotide or a functional equivalent thereof or an equivalent thereof is used which is reverse complementary to and/or binds to and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with an exonic splicing enhancer (ESE), an exon recognition sequence (ERS), and/or an exonic splicing silencer (ESS).

In a preferred embodiment, an oligonucleotide of the invention comprises or consists of a sequence or a base sequence that is reverse complementary to and/or binds to and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with at least a part of dystrophin pre-mRNA exon 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55, said part having at least 10 nucleotides. However, said part may also have at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or, 33 nucleotides. For the dystrophin exons identified above, we provide the stretch of nucleotides (SEQ ID NO: 2 to 13 identified below) of said exon to which an oligonucleotide binds to and/or is reverse complementary to and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with.

(SEQ ID NO: 2)
5′-GCGAUUUGACAGAUCUGUUGAGAAAUGGCGGCGUUUUCAUUAUGAU
AUAAAGAUAUUUAAUCAGUGGCUAACAGAAGCUGAACAGUUUCUCAGAA
AGACACAAAUUCCUGAGAAUUGGGAACAUGCUAAAUACAAAUGGUAUCU
UAAG-3′
for skipping of exon 44;
(SEQ ID NO: 3)
5′-GAACUCCAGGAUGGCAUUGGGCAGCGGCAAACUGUUGUCAGAACAU
UGAAUGCAACUGGGGAAGAAAUAAUUCAGCAAUCCUCAAAAACAGAUGC
CAGUAUUCUACAGGAAAAAUUGGGAAGCCUGAAUCUGCGGUGGCAGGAG
GUCUGCAAACAGCUGUCAGACAGAAAAAAGAG-3′
for skipping of exon 45:
(SEQ ID NO: 4)
5′-GCUAGAAGAACAAAAGAAUAUCUUGUCAGAAUUUCAAAGAGAUUUA
AAUGAAUUUGUUUUAUGGUUGGAGGAAGCAGAUAACAUUGCUAGUAUCC
CACUUGAACCUGGAAAAGAGCAGCAACUAAAAGAAAAGCUUGAGCAAGU
CAAG-3′
for skipping of exon 46;
(SEQ ID NO: 5)
5′-UUACUGGUGGAAGAGUUGCCCCUGCGCCAGGGAAUUCUCAAACAAU
UAAAUGAAACUGGAGGACCCGUGCUUGUAAGUGCUCCCAUAAGCCCAGA
AGAGCAAGAUAAACUUGAAAAUAAGCUCAAGCAGACAAAUCUCCAGUGG
AUAAAG-3′
for skipping of exon 47
(SEQ ID NO: 6)
5′-GUUUCCAGAGCUUUACCUGAGAAACAAGGAGAAAUUGAAGCUCAAA
UAAAAGACCUUGGGCAGCUUGAAAAAAAGCUUGAAGACCUUGAAGAGCA
GUUAAAUCAUCUGCUGCUGUGGUUAUCUCCUAUUAGGAAUCAGUUGGAA
AUUUAUAACCAACCAAACCAAGAAGGACCAUUUGACGUUCAG-3′
for skipping of exon 48
(SEQ ID NO: 7)
5′-GAAACUGAAAUAGCAGUUCAAGCUAAACAACCGGAUGUGGAAGAGA
UUUUGUCUAAAGGGCAGCAUUUGUACAAGGAAAAACCAGCCACUCAGCC
AGUGAAG-3′
for skipping of exon 49
(SEQ ID NO: 8)
5′-AGGAAGUUAGAAGAUCUGAGCUCUGAGUGGAAGGCGGUAAACCGUU
UACUUCAAGAGCUGAGGGCAAAGCAGCCUGACCUAGCUCCUGGACUGAC
CACUAUUGGAGCCU-3′
for skipping of exon 50;
(SEQ ID NO: 9)
5′-CUCCUACUCAGACUGUUACUCUGGUGACACAACCUGUGGUUACUAA
GGAAACUGCCAUCUCCAAACUAGAAAUGCCAUCUUCCUUGAUGUUGGAG
GUACCUGCUCUGGCAGAUUUCAACCGGGCUUGGACAGAACUUACCGACU
GGCUUUCUCUGCUUGAUCAAGUUAUAAAAUCACAGAGGGUGAUGGUGGG
UGACCUUGAGGAUAUCAACGAGAUGAUCAUCAAGCAGAAG-3′
for skippthg of exon 51;
(SEQ ID NO: 10)
5′-GCAACAAUGCAGGAUUUGGAACAGAGGCGUCCCCAGUUGGAAGAAC
UCAUUACCGCUGCCCAAAAUUUGAAAAACAAGACCAGCAAUCAAGAGGC
UAGAACAAUCAUUACGGAUCGAA-3′
for skipping of exon 52;
(SEQ ID NO: 11)
5′-UUGAAAGAAUUCAGAAUCAGUGGGAUGAAGUACAAGAACACCUUCA
GAACCGGAGGCAACAGUUGAAUGAAAUGUUAAAGGAUUCAACACAAUGG
CUGGAAGCUAAGGAAGAAGCUGAGCAGGUCUUAGGACAGGCCAGAGCCA
AGCUUGAGUCAUGGAAGGAGGGUCCCUAUACAGUAGAUGCAAUCCAAAA
GAAAAUCACAGAAACCAAG-3′
for skipping of exon 53;
(SEQ ID NO: 12)
5′-CAGUUGGCCAAAGACCUCCGCCAGUGGCAGACAAAUGUAGAUGUGG
CAAAUGACUUGGCCCUGAAACUUCUCCGGGAUUAUUCUGCAGAUGAUAC
CAGAAAAGUCCACAUGAUAACAGAGAAUAUCAAUGCCUCUUGGAGAAGC
AUUCAUAAAAG-3′
for skipping of exon 54;
(SEQ ID NO: 13)
5′-GGUGAGUGAGCGAGAGGCUGCUUUGGAAGAAACUCAUAGAUUACUG
CAACAGUUCCCCCUGGACCUGGAAAAGUUUCUUGCCUGGCUUACAGAAG
CUGAAACAACUGCCAAUGUCCUACAGGAUGCUACCCGUAAGGAAAGGCU
CCUAGAAGACUCCAAGGGAGUAAAAGAGCUGAUGAAACAAUGGCAA-3′
for skipping of exon 55.

Therefore, a preferred oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base and binds to and/or is reverse complementary to and/or targets and/or hybridizes with and/or is able to bind and/or is able to target and/or is able to hybridize with a continuous stretch of at least 10 and up to 33 nucleotides within one of the following exon nucleotide sequences selected from SEQ ID NO: 2 to 13.

Preferred oligonucleotides are also defined as follows:

    • comprise a 2′-O-methyl phosphorothioate RNA monomer or consist of 2′-O-methyl phosphorothioate RNA and
    • bind to and/or are reverse complementary to and/or target and/or hybridize with and/or is able to bind to and/or is able to target and/or is able to hybridize with a continuous stretch of at least 10 and up to 33 nucleotides within one of the following exon nucleotide sequences selected from SEQ ID NO: 2 to 13 as identified above.

More preferably, such oligonucleotides comprise a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.

More preferred oligonucleotides comprise a 2′-O-methyl phosphorothioate RNA monomer or consist of 2′-O-methyl phosphorothioate RNA and more preferably comprise a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base and are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 14-90 or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 14-90. SEQ ID NO:14-90 are identified in Table 1. In this context, “a 5-methylpyrimidine” means at least one 5-methylpyrimidine. Accordingly “at least one 5-methylpyrimindine” means at least one 5-methylcytosine and/or at least one 5-methyluracile.

Accordingly, preferred non-modified oligonucleotides are preferably derived from one of the nucleotide or base sequences SEQ ID NO:14-90 with X=C, Y=U, Z=A), and/or are represented by SEQ ID NO:91, 93, 94-170. Each of these non-modified oligonucleotides comprises no 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and no 2,6-diaminopurine. Please note that SEQ ID NO:91 is identical with SEQ ID NO: 132.

Accordingly, preferred modified oligonucleotides are derived from one of the nucleotide or base sequences SEQ ID NO: 14-90 and comprise at least one 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or at least one 2,6-diaminopurine (i.e. at least one X is m5C=X1 and/or at least one Y is m5U=Y1 and/or at least one Z is a2A=Z1). Please note that SEQ ID NO: 92 is identical with SEQ ID NO: 199. More preferred modified oligonucleotides are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 92, 171-213, 215, 217, 218, 219. Even more preferred modified oligonucleotides (all X=m5C=X1 and/or all Y=m5U=Y1 and/or all Z=a2A=Z1) are derived from the most preferred nucleotide or base sequences (SEQ ID NO:15, 21, 31, 40, 52, and 57) and are represented by SEQ ID NO: 92, 171-174, 185-188, 199, 200, 202-215, 217, 218, 219. The most preferred modified oligonucleotides are disclosed in Table 3.

Within the context of the invention, a fragment of SEQ ID NO: 14-90, or a fragment of SEQ ID NO:91-219, preferably means a nucleotide or a base sequence comprising or consisting of at least 10 contiguous nucleotides from said SEQ ID NO:14-90 or from said SEQ ID NO:91-219.

Such more preferred oligonucleotides are also defined as follows:

    • comprise a 2′-O-methyl phosphorothioate RNA monomer or consist of 2′-O-methyl phosphorothioate RNA and
    • are represented by a nucleotide or base sequence comprising or consisting of SEQ ID NO: 14-90, 91, 93-170 or by a nucleotide or base sequence comprising or consisting of a fragment of SEQ ID NO: 14-90, 91, 93-170.

More preferably, such oligonucleotides comprise a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.

Even more preferred oligonucleotides comprise a 2′-O-methyl phosphorothioate RNA monomer or consist of 2′-O-methyl phosphorothioate RNA and more preferably comprise a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 14-90, 92, 171-215, 217, 218, 219 or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO:14-90, 92, 171-215, 217, 218, 219 and having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Preferred sequences (i.e. preferred nucleotide or base sequences) among SEQ ID NO:14-90, 92, and 171-215, 217, 218, 219 include SEQ ID NO: 15, 21, 31, 40, 43, 52, 57, 59, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219 more preferably SEQ ID NO: 40, 43, 52, 57, 59, 208, 207, 200, 210, 206, 171, 173, 199, 213, 185, 187.

Such even more preferred oligonucleotides are also defined as follows:

    • comprise a 2′-O-methyl phosphorothioate RNA monomer or consist of 2′-O-methyl phosphorothioate RNA and
      are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 14-90, 91, 93-170, 216 or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 14-90, 91, 93-170 and have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. More preferably, such oligonucleotides comprise a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.

Even more preferably, such modified oligonucleotides are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 92, 171-213, 215 217, 218, 219 or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 92, 171-213, 215, 217, 218, 219 and have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Even more preferred modified oligonucleotides are derived from the most preferred nucleotide or base sequences (SEQ ID NO:15, 21, 31, 40, 52, and 57) and are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 92, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219 or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 92, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219 and having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Preferred oligonucleotides for inducing the skipping of exon 44 from the dystrophin pre-mRNA are as follows below.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 14 and has a length of 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:14 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:14.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:14 is represented by SEQ ID NO:94 and a preferred fragment of SEQ ID NO:94 is represented by SEQ ID NO:143.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and is represented by a nucleotide or a base sequence comprising SEQ ID NO: 94 and has a length of 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:94 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:94.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:14 comprises SEQ ID NO: 63 and a preferred fragment of SEQ ID NO:94 comprises SEQ ID NO: 143, and each of said preferred fragments has a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 15 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:15 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:15.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:15 is represented by SEQ ID NO:95.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or base sequence comprising SEQ ID NO: 95 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:95 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:95.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:15 comprises SEQ ID NO: 64 and a preferred fragment of SEQ ID NO:95 comprises SEQ ID NO:144 and each of said fragments has a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Such preferred oligonucleotide is also defined as follows:

    • comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and
    • is represented by a nucleotide or base sequence comprising or consisting of SEQ ID NO: 15 or 95 or 64 or 144 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide or base sequence comprising or consisting of a fragment of SEQ ID NO: 15 or 95 or 64 or 144, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:15 or 95 or 64 or 144.

More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or base sequence comprising SEQ ID NO: 15 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:15 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:15. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or base sequence comprising SEQ ID NO: 204 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:204 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:204. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or base sequence comprising SEQ ID NO: 208 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:208 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:208. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its uraciles have been replaced by 5-methyluraciles and all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or base sequence comprising SEQ ID NO: 205 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:205 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:205. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines,
    • such oligonucleotide is represented by a nucleotide or base sequence comprising SEQ ID NO: 207 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:207 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:207. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or base sequence comprising SEQ ID NO: 16 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:16 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:16.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:16 is represented by SEQ ID NO:96.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 96 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:96 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:96.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 17 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:17 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:17.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:17 is represented by SEQ ID NO:97 and a preferred fragment of SEQ ID NO:97 is represented by SEQ ID NO:145.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 97 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:97 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:97.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:17 comprises SEQ ID NO: 65 and a preferred fragment of SEQ ID NO: 97 comprises SEQ ID NO: 145, each of said fragments has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 18 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:18 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:18.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:18 is represented by SEQ ID NO:98 and a preferred fragment of SEQ ID NO:98 is represented by SEQ ID NO:146.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:18 comprises SEQ ID NO: 66 and a preferred fragment of SEQ ID NO: 98 comprises SEQ ID NO: 146, each of said fragments has a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 98 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:98 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:98.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 19 and has a length of 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:19 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:19.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:19 is represented by SEQ ID NO:99.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 99 and has a length of 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:99 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:99.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 20 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:20 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:20.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:20 is represented by SEQ ID NO:100 and a preferred fragment of SEQ ID NO:100 is represented by SEQ ID NO:147, 148 or 149.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 100 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:100 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:100.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:20 comprises SEQ ID NO: 67 and a preferred fragment of SEQ ID NO:100 comprises SEQ ID NO:147, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:20 comprises SEQ ID NO: 68 and another preferred fragment of SEQ ID NO:100 comprises SEQ ID NO: 148, each of said fragments has a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:20 comprises SEQ ID NO: 69 and another preferred fragment of SEQ ID NO:100 comprises SEQ ID NO: 149, each of said fragments has a length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Preferred oligonucleotides for inducing the skipping of exon 45 from the dystrophin pre-mRNA are as follows below.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 21 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:21 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:21.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:21 is represented by SEQ ID NO:101 and a preferred fragment of SEQ ID NO:101 is represented by SEQ ID NO:150, 151 or 152.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 101 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:101 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:101.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:21 comprises SEQ ID NO: 70 and a preferred fragment of SEQ ID NO:101 comprises SEQ ID NO:150, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:21 comprises SEQ ID NO: 71 and another preferred fragment of SEQ ID NO:101 comprises SEQ ID NO:151, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:21 comprises SEQ ID NO: 72 and a preferred fragment of SEQ ID NO:101 comprises SEQ ID NO:152, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Such preferred oligonucleotide is also defined as follows:

    • comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and
    • is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 21 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 21, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:21.

More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 21 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:21 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:21.

Accordingly, said oligonucleotide is particularly represented by a nucleotide or a base sequence comprising SEQ ID NO: 200 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:200 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:200.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its uraciles have been replaced by 5-methyluraciles and all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 21 or SEQ ID NO:209 in particular, and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:21 or 209 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 21 or 209. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 21 or SEQ ID NO: 210 in particular, and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:21 or 210 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:21 or 210. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 22 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:22 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:22.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:22 is represented by SEQ ID NO:102.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 102 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:102 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:102.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 23 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:23 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:23.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:23 is represented by SEQ ID NO:103.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or base sequence comprising SEQ ID NO: 103 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:103 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:103.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 24 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:24 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:24.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:24 is represented by SEQ ID NO:104.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or base sequence comprising SEQ ID NO: 104 and has a length 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:104 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:104.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 25 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:25 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:25.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:25 is represented by SEQ ID NO:105.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 105 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:105 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:105.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 26 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:26 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:26.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:26 is represented by SEQ ID NO:106.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 106 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:106 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:106.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 27 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:27 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:27.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:27 is represented by SEQ ID NO:107.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 107 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:107 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:107.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 28 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:28 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:28.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:28 is represented by SEQ ID NO:108. Each of SEQ ID NO:28 and SEQ ID NO:108 identified in table 1 comprises an hypoxanthine base at position 7.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 108 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO: 108 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:108.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 29 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:29 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:29.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:29 is represented by SEQ ID NO:109.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 109 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO: 109 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:109.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 30 and has a length of 30, 31, 32 or 33 nucleotides or by a fragment of SEQ ID NO:30 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:30.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:30 is represented by SEQ ID NO:110.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 110 and has a length 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:110 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:110.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Preferred oligonucleotides for inducing the skipping of exon 51 from the dystrophin pre-mRNA are as follows below.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 31 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:31 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:31.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:31 is represented by SEQ ID NO:111 and a preferred fragment of SEQ ID NO:111 is represented by SEQ ID NO:153 or 154.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 111 and has a length 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:111 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:111.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:31 comprises SEQ ID NO: 73 and a preferred fragment of SEQ ID NO: 111 comprises SEQ ID NO: 153, and each of said fragments has a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:31 comprises SEQ ID NO: 74 and another preferred fragment of SEQ ID NO: 111 comprises SEQ ID NO: 154, and each of said fragments has a length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Such preferred oligonucleotide is also defined as follows:

    • comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and
    • is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 31 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 31, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:31.

More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 31 or SEQ ID NO: 215 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:31 or SEQ ID NO:215 comprising or consisting of at least 10 contiguous nucleotides of SEQ ID NO:31 or of SEQ ID NO: 215. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 202 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:202 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:202. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 203 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:203 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:203. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 206 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:206 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:206. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 32 and has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:32 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:32.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:32 is represented by SEQ ID NO:112.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 112 and has a length 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:112 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:112.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 33 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:33 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:33.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:33 is represented by SEQ ID NO:113.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 113 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:113 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:113.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In another embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and is represented by a nucleotide or a base sequence comprising SEQ ID NO: 34 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:34 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:34.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:34 is represented by SEQ ID NO:114.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consist of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide sequence comprising SEQ ID NO: 114 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:114 comprising or consisting of at least 10 contiguous nucleotides of SEQ ID NO:114.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO: 34 comprises or consists of SEQ ID NO: 93 (PS1116: 5′-CAACAUCAAGGAAGAUGGCAUUUCU-3′).

Such preferred oligonucleotide is also defined as follows:

    • comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and
    • is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 34 or 93 or 114 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 34 or 93 or 114, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:34 or 93 or 114.

More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 34 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:34 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:34. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 34 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:34 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:34. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 35 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:35 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:35.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:35 is represented by SEQ ID NO:115.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 115 and has a length 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:115 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:115.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 36 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:36 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:36.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:36 is represented by SEQ ID NO:116 and a preferred fragment of SEQ ID NO:116 is represented by SEQ ID NO:155 or 156 or 157.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 116 and has a length 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:116 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:116.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:36 comprises SEQ ID NO: 75 or a preferred fragment of SEQ ID NO: 116 comprises SEQ ID NO: 155, and each of said fragments has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:36 comprises SEQ ID NO: 76 or another preferred fragment of SEQ ID NO: 116 comprises SEQ ID NO: 156, and each of said fragments has a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:36 comprises SEQ ID NO: 77 or another preferred fragment of SEQ ID NO: 116 comprises SEQ ID NO: 157, and each of said fragments has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 37 and has a length of 30, 31, 32 or 33 nucleotides or by a fragment of SEQ ID NO:37 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:37.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:37 is represented by SEQ ID NO:117.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 117 and has a length 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:117 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:117.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 38 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:38 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:38.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:38 is represented by SEQ ID NO: 118.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 118 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:118 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:118.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Preferred oligonucleotides for inducing the skipping of exon 52 from the dystrophin pre-mRNA are as follows below.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 39 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:39 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:39.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:39 is represented by SEQ ID NO:119.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 119 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:119 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:119.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 201 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:201 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:201. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 40 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:40 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:40. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:40 is represented by SEQ ID NO:120 and a preferred fragment of SEQ ID NO:120 is represented by SEQ ID NO:158 or 159 or 160.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 120 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:120 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:120.

A preferred fragment of SEQ ID NO:40 comprises SEQ ID NO: 78 and a preferred fragment of SEQ ID NO:120 comprises SEQ ID NO:158, and each fragment has a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:40 comprises SEQ ID NO: 79 and another preferred fragment of SEQ ID NO:120 comprises SEQ ID NO:159, and each fragment has a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:40 comprises SEQ ID NO: 80 and another preferred fragment of SEQ ID NO:120 comprises SEQ ID NO:160, and each fragment has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Such preferred oligonucleotide is also defined as follows:

    • comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and
    • is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 40 or 120 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 40 or 120, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:40 or 120.

More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 40 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:40 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:40. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 171 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:171 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 171. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 4 cytosines of SEQ ID NO:40 are modified as represented in SEQ ID NO:171. It is encompassed that 1, 2 or 3 of these cytosines are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO:172 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO: 172 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 172. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 7 uraciles of SEQ ID NO:40 are modified as represented in SEQ ID NO:172. It is encompassed that 1, 2, 3, 4, 5 or 6 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 173 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:173 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 173. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 5 adenines of SEQ ID NO:40 are modified as represented in SEQ ID NO:173. It is encompassed that 1, 2, 3 or 4 of these adenines are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 174 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:174 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:174. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 174 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:174 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 174. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 4 cytosines and not all the 7 uraciles of SEQ ID NO:40 are modified as represented in SEQ ID NO:174. It is encompassed that 1, 2 or 3 of these cytosines and-or 1, 2, 3, 4, 5 or 6 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines and all its adenines have been replaced by 2,6-diaminopurines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 175 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:175 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:175. Accordingly, said oligonucleotide is represented by a nucleotide sequence comprising SEQ ID NO: 175 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:175 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 175. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides It is also encompassed that not all the 4 cytosines and not all the 5 adenines of SEQ ID NO:40 are modified as represented in SEQ ID NO:175. It is encompassed that 1, 2 or 3 of these cytosines and-or 1, 2, 3 or 4 of these adenines are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 176 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:176 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 176. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 5 adenines and not all the 7 uraciles of SEQ ID NO: 40 are modified as represented in SEQ ID NO:176. It is encompassed that 1, 2, 3 or 4 of these adenines and-or 1, 2, 3, 4, 5 or 6 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines, all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 177 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:177 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 177. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 4 cytosines and not all the 7 uraciles and not all the 5 adenines of SEQ ID NO:40 are modified as represented in SEQ ID NO:177. It is encompassed that 1, 2 or 3 of these cytosines and-or 1, 2, 3, 4, 5 or 6 of these uraciles and-or 1, 2, 3 or 4 of these adenines are modified.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide sequence or a base comprising SEQ ID NO: 41 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:41 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:41.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:41 is represented by SEQ ID NO:121.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 121 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:121 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:121.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 42 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:42 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:42.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:42 is represented by SEQ ID NO:122.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 122 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:122 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:122.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 43 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:43 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:43.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Such preferred oligonucleotide is also defined as follows:

    • comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and
    • is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 43 or 123 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 43 or 123, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:43 or 123. Accordingly a non-modified oligonucleotide derived from SEQ ID NO:43 is represented by SEQ ID NO:123 and a preferred fragment of SEQ ID NO:123 is represented by SEQ ID NO: 161.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 123 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:123 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:123.

More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein. Even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 43 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:43 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:43. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 178 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:178 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 178. It is also encompassed that not all the 6 cytosines of SEQ ID NO:43 are modified as represented in SEQ ID NO:178. It is encompassed that 1, 2, 3, 4 or 5 of these cytosines are modified.

A preferred fragment of SEQ ID NO:43 comprises SEQ ID NO: 81 and a preferred fragment of SEQ ID NO:123 comprises SEQ ID NO:161, each of said fragments has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO:179 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:179 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:179. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 11 uraciles of SEQ ID NO:43 are modified as represented in SEQ ID NO:179. It is encompassed that 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 180 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:180 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 180. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 2 adenines of SEQ ID NO:43 are modified as represented in SEQ ID NO:180. It is encompassed that 1 of these adenines are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 181 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:181 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:181. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 181 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:181 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 181. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 cytosines and not all the 11 uraciles of SEQ ID NO: 43 are modified as represented in SEQ ID NO:181. It is encompassed that 1, 2, 3, 4 or 5 of these cytosines and-or 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines and all its adenines have been replaced by 2,6-diaminopurines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 182 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:182 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:182. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 182 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:182 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 182. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 cytosines and not all the 2 adenines of SEQ ID NO:43 are modified as represented in SEQ ID NO:182. It is encompassed that 1, 2, 3, 4 or 5 of these cytosines and-or 1 of these adenines are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 183 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:183 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:183. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 2 adenines and not all the 11 uraciles of SEQ ID NO:43 are modified as represented in SEQ ID NO:183. It is encompassed that 1 of these adenines and/or 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines, all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 184 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:184 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:184. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 cytosines and not all the 11 uraciles and not all the 2 adenines of SEQ ID NO:43 are modified as represented in SEQ ID NO:184. It is encompassed that 1, 2, 3, 4 or 5 of these cytosines and-or 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 of these uraciles and-or 1 of these adenines are modified.

Preferred oligonucleotides for inducing the skipping of exon 53 from the dystrophin pre-mRNA are as follows below.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 44 and has a length of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:44 comprising or consisting of at least 10 contiguous or bases nucleotides of SEQ ID NO:44.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:44 is represented by SEQ ID NO:124.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 124 and has a length 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:124 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:124.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 45 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:45 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:45.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:45 is represented by SEQ ID NO:125.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 125 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:125 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:125.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base.

Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 46 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:46 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:46.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:46 is represented by SEQ ID NO:126.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 126 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:126 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 126.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 47 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:47 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:47.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:47 is represented by SEQ ID NO:127.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 127 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:127 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 127.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 48 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:48 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:48.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:48 is represented by SEQ ID NO:128.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 128 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:128 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:128.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 49 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:49 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:49.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:49 is represented by SEQ ID NO:129.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 129 and has a length 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:129 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 129.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 50 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:50 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:50.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:50 is represented by SEQ ID NO:130.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 130 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:130 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:130.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 51 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:51 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:51.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:51 is represented by SEQ ID NO:131.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 131 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:131 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:131.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 52 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:52 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:52.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:52 is represented by SEQ ID NO: 91 and a preferred fragment of SEQ ID NO:91 is represented by SEQ ID NO:162, 163 or 164. SEQ ID NO: 91 is identical with SEQ ID NO: 132.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 91 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:191 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:91.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Such preferred oligonucleotide is also defined as follows:

    • comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and
    • is represented by a nucleotide or base sequence comprising or consisting of SEQ ID NO: 52 or 91 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 52 or 91, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:52 or 91.

More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or base sequence comprising SEQ ID NO: 52 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:52 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:52. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

A preferred fragment of SEQ ID NO:52 comprises SEQ ID NO: 82 and a preferred fragment of SEQ ID NO:91 comprises SEQ ID NO:162, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:52 comprises SEQ ID NO: 83 and another preferred fragment of SEQ ID NO:91 comprises SEQ ID NO:163, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:52 comprises SEQ ID NO: 84 and another preferred fragment of SEQ ID NO:91 comprises SEQ ID NO:164, each of said fragments has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A most preferred fragment of SEQ ID NO: 52 comprises or consists of SEQ ID NO: 91 (PS229L: 5′-GUUGCCUCCGGUUCUGAAGGUGUUC-3′). Another most preferred fragment of SEQ ID NO: 52 comprises or consists of SEQ ID NO: 92 (PS524: 5′-GUUGXXUXXGGUUXUGAAGGUGUUX-3′; wherein X is 5-methylcytosine).

Such preferred oligonucleotide is also defined as follows:

    • comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and
    • is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 82, 83, 84, 91 or 92 or 162 or 163 or 164 and has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 82, 83, 84, 91 or 92, or 162 or 163 or 164, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:82, 83, 84, 91, or 92 or 162, 163 or 164.

More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 82, 83, 84 or 92 and has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:82, 83, 84, or 92 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:82, 83, 84, or 92. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. SEQ ID NO: 92 is identical with SEQ ID NO: 199. It is also encompassed that not all the 6 cytosines of SEQ ID NO:52 are modified as represented in SEQ ID NO:92. It is encompassed that 1, 2, 3, 4 or 5 of these cytosines are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • two of its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 218 and has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:218 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:218. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • three of its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 219 and has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:219 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:219. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • four of its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 217 and has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:217 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:217. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 211 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:211 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:211. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 211 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:211 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:211. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 9 uraciles of SEQ ID NO:52 are modified as represented in SEQ ID NO:211. It is encompassed that 1, 2, 3, 4, 5, 6, 7, or 8 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 212 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:212 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:212. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 212 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:212 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:212. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 cytosines and not all the 9 uraciles of SEQ ID NO:52 are modified as represented in SEQ ID NO:212. It is encompassed that 1, 2, 3, 4, or 5 of these cytosines and/or 1, 2, 3, 4, 5, 6, 7, or 8 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 213 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:213 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:213. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 2 adenines of SEQ ID NO:52 are modified as represented in SEQ ID NO:213. It is encompassed that 1 of these adenines are modified.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 53 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:53 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:53.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:53 is represented by SEQ ID NO:133.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 133 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO: 133 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:133.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 54 and has a length of 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO:54 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:54.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:54 is represented by SEQ ID NO:134.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 134 and has a length 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:134 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:134.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 55 and has a length of 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO:55 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:55.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:55 is represented by SEQ ID NO:135.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 135 and has a length 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:135 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:135.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 56 and has a length of 33, 34 or 35 nucleotides or by a fragment of SEQ ID NO:56 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:56.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:56 is represented by SEQ ID NO:136.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 136 and has a length 33, 34 or 35 nucleotides, or by a fragment of SEQ ID NO: 136 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 136.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Preferred oligonucleotides for inducing the skipping of exon 55 from the dystrophin pre-mRNA are as follows below.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 57 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:57 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:57. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Such preferred oligonucleotide is also defined as follows:

    • comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and
    • is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 57 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 57, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:57.
    • Accordingly a non-modified oligonucleotide derived from SEQ ID NO:57 is represented by SEQ ID NO:137 and a preferred fragment of SEQ ID NO:137 is represented by SEQ ID NO:165 or 166.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and is represented by a nucleotide or a base sequence comprising SEQ ID NO: 137 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:137 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:137.

More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein. Even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 57 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:57 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:57.

Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 185 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:185 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:185. It is also encompassed that not all the 8 cytosines of SEQ ID NO:57 are modified as represented in SEQ ID NO:185. It is encompassed that 1, 2, 3, 4, 5, 6, or 7 of these cytosines are modified.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

A preferred fragment of SEQ ID NO:57 comprises SEQ ID NO: 85 and a preferred fragment of SEQ ID NO:137 comprises SEQ ID NO: 165, each of said fragments has a length of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:57 comprises SEQ ID NO: 86 and another preferred fragment of SEQ ID NO:137 comprises SEQ ID NO: 166, each of said fragments has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO:186 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO: 186 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 186. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 7 uraciles of SEQ ID NO:57 are modified as represented in SEQ ID NO:186. It is encompassed that 1, 2, 3, 4, 5 or 6 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 187 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:187 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 187. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 5 adenines of SEQ ID NO:57 are modified as represented in SEQ ID NO:187. It is encompassed that 1, 2, 3 or 4 of these adenines are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 188 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:188 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:188. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 188 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:188 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 188. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 8 cytosines and not all the 7 uraciles of SEQ ID NO:57 are modified as represented in SEQ ID NO:188. It is encompassed that 1, 2, 3, 4, 5, 6 or 7 of these cytosines and-or 1, 2, 3, 4, 5 or 6 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines and all its adenines have been replaced by 2,6-diaminopurines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 189 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:189 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:189. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 189 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:189 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 189. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides It is also encompassed that not all the 8 cytosines and not all the 5 adenines of SEQ ID NO:57 are modified as represented in SEQ ID NO:189. It is encompassed that 1, 2, 3, 4, 5, 6 or 7 of these cytosines and-or 1, 2, 3 or 4 of these adenines are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 190 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:190 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 190. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 5 adenines and not all the 7 uraciles of SEQ ID NO:57 are modified as represented in SEQ ID NO: 190. It is encompassed that 1, 2, 3 or 4 of these adenines and-or 1, 2, 3, 4, 5 or 6 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines, all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 191 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:191 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 191. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 8 cytosines and not all the 7 uraciles and not all the 5 adenines of SEQ ID NO:57 are modified as represented in SEQ ID NO:191. It is encompassed that 1, 2, 3, 4, 5, 6 or 7 of these cytosines and-or 1, 2, 3, 4, 5 or 6 of these uraciles and-or 1, 2, 3 or 4 of these adenines are modified.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 58 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:58 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:58.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:58 is represented by SEQ ID NO:138.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 138 and has a length 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO:138 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:138.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Such preferred oligonucleotide is also defined as follows:

    • comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and
    • is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 58 or 138 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 58 or 138, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:58 or 138.

More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 58 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:58 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:58. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 59 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:59 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:59. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Such preferred oligonucleotide is also defined as follows:

    • comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and
    • is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 59 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 59, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:59.
    • Accordingly a non-modified oligonucleotide derived from SEQ ID NO:59 is represented by SEQ ID NO:139 and a preferred fragment of SEQ ID NO:139 is represented by SEQ ID NO: 167 or 168 or 169 or 170.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and is represented by a nucleotide or a base sequence comprising SEQ ID NO: 139 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:139 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:139.

More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein. Even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 59 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:59 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:59.

Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 192 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:192 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:192. It is also encompassed that not all the 5 cytosines of SEQ ID NO:59 are modified as represented in SEQ ID NO:192. It is encompassed that 1, 2, 3 or 4 of these cytosines are modified.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

A preferred fragment of SEQ ID NO:59 comprises SEQ ID NO: 87 and a preferred fragment of SEQ ID NO:139 comprises SEQ ID NO:167, each of said fragments has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:59 comprises SEQ ID NO: 88 and another preferred fragment of SEQ ID NO:139 comprises SEQ ID NO:168, each of said fragments has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:59 comprises SEQ ID NO: 89 and another preferred fragment of SEQ ID NO:139 comprises SEQ ID NO:169, each of said fragments has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:59 comprises SEQ ID NO: 90 and another preferred fragment of SEQ ID NO:139 comprises SEQ ID NO:170, each of said fragmentshas a length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO:193 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:193 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 193. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 uraciles of SEQ ID NO:59 are modified as represented in SEQ ID NO:193. It is encompassed that 1, 2, 3, 4 or 5 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 194 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:194 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 194. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 adenines of SEQ ID NO:59 are modified as represented in SEQ ID NO:194. It is encompassed that 1, 2, 3, 4 or 5 of these adenines are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 195 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:195 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:195. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 195 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:195 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 195. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 5 cytosines and not all the 6 uraciles of SEQ ID NO:59 are modified as represented in SEQ ID NO: 195. It is encompassed that 1, 2, 3 or 4 of these cytosines and-or 1, 2, 3, 4 or 5 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its cytosines have been replaced by 5-methylcytosines and all its adenines have been replaced by 2,6-diaminopurines,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 196 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:196 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:196. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 196 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:196 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 196. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides It is also encompassed that not all the 5 cytosines and not all the 6 adenines of SEQ ID NO:59 are modified as represented in SEQ ID NO:196. It is encompassed that 1, 2, 3 or 4 of these cytosines and/or 1, 2, 3, 4 or 5 of these adenines are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 197 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:197 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 197. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 adenines and not all the 6 uraciles of SEQ ID NO:59 are modified as represented in SEQ ID NO: 197. It is encompassed that 1, 2, 3, 4 or 5 of these adenines and/or 1, 2, 3, 4 or 5 of these uraciles are modified.

More preferably, an oligonucleotide:

    • consists of 2′-O-methyl phosphorothioate RNA,
    • all its adenines have been replaced by 2,6-diaminopurines, all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles,
    • such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 198 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:198 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 198. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 5 cytosines and not all the 6 uraciles and not all the 6 adenines of SEQ ID NO:59 are modified as represented in SEQ ID NO:198. It is encompassed that 1, 2, 3 or 4 of these cytosines and/or 1, 2, 3, 4 or 5 of these uraciles and/or 1, 2, 3, 4 or 5 of these adenines are modified.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 60 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:60 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:60.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:60 is represented by SEQ ID NO:140.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 140 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO:140 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 140.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 61 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:61 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:61.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:61 is represented by SEQ ID NO:141.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 141 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides or by a fragment of SEQ ID NO:141 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:141.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

In a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 62 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:62 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:62.

Accordingly a non-modified oligonucleotide derived from SEQ ID NO:62 is represented by SEQ ID NO:142.

Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2′-O-methyl phosphorothioate RNA monomer or consists of 2′-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 142 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides or by a fragment of SEQ ID NO:142 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 142.

Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Composition

In a second aspect, there is provided a composition comprising an oligonucleotide as described in the previous section entitled “Oligonucleotide”. This composition preferably comprises or consists of an oligonucleotide as described above.

In a preferred embodiment, said composition is for use as a medicament. Said composition is therefore a pharmaceutical composition. A pharmaceutical composition usually comprises a pharmaceutically accepted carrier, diluent and/or excipient. In a preferred embodiment, a composition of the current invention comprises a compound as defined herein and optionally further comprises a pharmaceutically acceptable formulation, filler, preservative, solubilizer, carrier, diluent, excipient, salt, adjuvant and/or solvent. Such pharmaceutically acceptable carrier, filler, preservative, solubilizer, diluent, salt, adjuvant, solvent and/or excipient may for instance be found in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, Md.: Lippincott Williams & Wilkins, 2000. The compound as described in the invention may possess at least one ionizable group. An ionizable group may be a base or acid, and may be charged or neutral. An ionizable group may be present as ion pair with an appropriate counterion that carries opposite charge(s). Examples of cationic counterions are sodium, potassium, cesium, Tris, lithium, calcium, magnesium, trialkylammonium, triethylammonium, and tetraalkylammonium. Examples of anionic counterions are chloride, bromide, iodide, lactate, mesylate, acetate, trifluoroacetate, dichloroacetate, and citrate. Examples of counterions have been described [e.g. Kumar, 2008, which is incorporated here in its entirety by reference].

In a preferred embodiment, a composition comprises the oligonucleotide of the invention and sodium as counterion. Said oligonucleotide present in said composition may also be named as an oligonucleotide in its sodium form.

In another preferred embodiment, a composition comprises the oligonucleotide of the invention and calcium and/or magnesium as counterion. Siad oligonucleotide present in said composition may also be named as an oligonucleotide in its calcium or magnesium or mixed calcium/magnesium form.

Such type of composition comprising an oligonucleotide of the invention and a counterion may be obtained through either formulating the counterion salt of the oligonucleotide or by adding appropriate amounts of said salt to an oligonucleotide. A positive effect of calcium salts present in composition comprising an oligonucleotide with respect to immunostimulatory effects of said oligonucleotides has been described (e.g. patent application WO 2012021985 (Replicor), incorporated here in its entirety by reference).

A pharmaceutical composition may comprise an aid in enhancing the stability, solubility, absorption, bioavailability, activity, pharmacokinetics, pharmacodynamics and cellular uptake of said compound, in particular an excipient capable of forming complexes, nanoparticles, microparticles, nanotubes, nanogels, hydrogels, poloxamers or pluronics, polymersomes, colloids, microbubbles, vesicles, micelles, lipoplexes, and/or liposomes. Examples of nanoparticles include polymeric nanoparticles, gold nanoparticles, magnetic nanoparticles, silica nanoparticles, lipid nanoparticles, sugar particles, protein nanoparticles and peptide nanoparticles.

A preferred composition comprises at least one excipient that may further aid in enhancing the targeting and/or delivery of said composition and/or said oligonucleotide to a tissue and/or a cell and/or into a tissue and/or a cell. A preferred tissue or cell is a muscle tissue or cell.

Many of these excipients are known in the art (e.g. see Bruno, 2011) and may be categorized as a first type of excipient. Examples of first type of excipients include polymers (e.g. polyethyleneimine (PEI), poly-2-hydroxypropyleneimine (pHP), polypropyleneimine (PPI), dextran derivatives, butylcyanoacrylate (PBCA), hexylcyanoacrylate (PHCA), poly(lactic-co-glycolic acid) (PLGA), polyamines (e.g. spermine, spermidine, putrescine, cadaverine), chitosan, poly(amido amines) (PAMAM), poly(ester amine), polyvinyl ether, polyvinyl pyrrolidone (PVP), polyethylene glycol (PEG) cyclodextrins, hyaluronic acid, colominic acid, and derivatives thereof), dendrimers (e.g. poly(amidoamine)), lipids {e.g. 1,2-dioleoyl-3-dimethylammonium propane (DODAP), dioleoyldimethylammonium chloride (DODAC), phosphatidylcholine derivatives [e.g 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC)], lyso-phosphatidylcholine derivatives [e.g. 1-stearoyl-2-lyso-sn-glycero-3-phosphocholine (S-LysoPC)], sphingomyeline, 2-{3-[Bis-(3-amino-propyl)-amino]-propylamino}-N-ditetracedyl carbamoyl methylacetamide (RPR209120), phosphoglycerol derivatives [e.g. 1,2-dipalmitoyl-sn-glycero-3-phosphoglycerol, sodium salt (DPPG-Na), phosphaticid acid derivatives [1,2-distearoyl-sn-glycero-3-phosphaticid acid, sodium salt (DSPA), phosphatidylethanolamine derivatives [e.g. dioleoyl-L-R-phosphatidylethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE),2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE),], N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTAP), N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium (DOTMA), 1,3-di-oleoyloxy-2-(6-carboxy-spermyl)-propylamid (DOSPER), (1,2-dimyristyolxypropyl-3-dimethylhydroxy ethyl ammonium (DMRIE), (N1-cholesteryloxycarbonyl-3,7-diazanonane-1,9-diamine (CDAN), dimethyldioctadecylammonium bromide (DDAB), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (POPC), (b-L-Arginyl-2,3-L-diaminopropionic acid-N-palmityl-N-olelyl-amide trihydrochloride (AtuFECT01), 1, , N,N-dimethyl-3-aminopropane derivatives [e.g. 1,2-distearoyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (DoDMA), 1,2-Dilinoleyloxy-N,N-3-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl [1,3]-dioxolane (DLin-K-DMA), phosphatidylserine derivatives [1,2-dioleyl-sn-glycero-3-phospho-L-serine, sodium salt (DOPS)], cholesterol}proteins (e.g. albumin, gelatins, atellocollagen), and peptides (e.g. protamine, PepFects, NickFects, polyarginine, polylysine, CADY, MPG).

Another preferred composition may comprise at least one excipient categorized as a second type of excipient. A second type of excipient may comprise or contain a conjugate group as described herein to enhance targeting and/or delivery of the composition and/or of the oligonucleotide of the invention to a tissue and/or cell and/or into a tissue and/or cell, as for example muscle tissue or cell. Both types of excipients may be combined together into one single composition as identified herein.

The skilled person may select, combine and/or adapt one or more of the above or other alternative excipients and delivery systems to formulate and deliver a compound for use in the present invention.

Such a pharmaceutical composition of the invention may be administered in an effective concentration at set times to an animal, preferably a mammal. More preferred mammal is a human being. An oligonucleotide or a composition as defined herein for use according to the invention may be suitable for direct administration to a cell, tissue and/or an organ in vivo of individuals affected by or at risk of developing a disease or condition as identified herein, and may be administered directly in vivo, ex vivo or in vitro. Administration may be via topical, systemic and/or parenteral routes, for example intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, ocular, nasal, urogenital, intradermal, dermal, enteral, intravitreal, intracavernous, intracerebral, intrathecal, epidural or oral route.

Preferably, such a pharmaceutical composition of the invention may be encapsulated in the form of an emulsion, suspension, pill, tablet, capsule or soft-gel for oral delivery, or in the form of aerosol or dry powder for delivery to the respiratory tract and lungs.

In an embodiment an oligonucleotide of the invention may be used together with another compound already known to be used for the treatment of said disease. Such other compounds may be used for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival and/or improve, increase or restore cardiac function. Examples are, but not limited to, a steroid, preferably a (gluco)corticosteroid, an ACE inhibitor (preferably perindopril), an angiotensin II type 1 receptor blocker (preferably losartan), a tumor necrosis factor-alpha (TNFα) inhibitor, a TGFβ inhibitor (preferably decorin), human recombinant biglycan, a source of mIGF-1, a myostatin inhibitor, mannose-6-phosphate, an antioxidant, an ion channel inhibitor, a protease inhibitor, a phosphodiesterase inhibitor (preferably a PDE5 inhibitor, such as sildenafil or tadalafil), a histone deacetylase inhibitor (HDAC inhibitor, androgen receptor modulator, creatine, creatine phosphate, and/or L-arginine. Such combined use may be a sequential use: each component is administered in a distinct composition. Alternatively each compound may be used together in a single composition.

Use

In a further aspect, there is provided the use of a composition or an oligonucleotide as described in the previous sections for use as a medicament or part of therapy, or applications in which said oligonucleotide exerts its activity intracellularly.

Preferably, an oligonucleotide or composition of the invention is for use as a medicament or part of a therapy for preventing, delaying, curing, ameliorating and/or treating DMD or BMD.

Method

In a further aspect, there is provided a method for preventing, treating, curing, ameliorating and/or delaying a condition or disease as defined in the previous section in an individual, in a cell, tissue or organ of said individual. The method comprising administering an oligonucleotide or a composition of the invention to said individual or a subject in the need thereof.

The method according to the invention wherein an oligonucleotide or a composition as defined herein may be suitable for administration to a cell, tissue and/or an organ in vivo of individuals affected by any of the herein defined diseases, and may be administered in vivo, ex vivo or in vitro. An individual or a subject in need is preferably a mammal, more preferably a human being.

In a further aspect, there is provided a method for diagnosis wherein the oligonucleotide of the invention is provided with a radioactive label or fluorescent label.

In an embodiment, in a method of the invention, a concentration of an oligonucleotide or composition is ranged from 0.01 nM to 1 μM. More preferably, the concentration used is from 0.05 to 500 nM, or from 0.1 to 500 nM, or from 0.02 to 500 nM, or from 0.05 to 500 nM, even more preferably from 1 to 200 nM.

Dose ranges of an oligonucleotide or composition according to the invention are preferably designed on the basis of rising dose studies in clinical trials (in vivo use) for which rigorous protocol requirements exist. An oligonucleotide as defined herein may be used at a dose which is ranged from 0.01 to 200 mg/kg or 0.05 to 100 mg/kg or 0.1 to 50 mg/kg or 0.1 to 20 mg/kg, preferably from 0.5 to 10 mg/kg.

The ranges of concentration or dose of oligonucleotide or composition as given above are preferred concentrations or doses for in vitro or ex vivo uses. The skilled person will understand that depending on the identity of the oligonucleotide used, the target cell to be treated, the gene target and its expression levels, the medium used and the transfection and incubation conditions, the concentration or dose of oligonucleotide used may further vary and may need to be optimised any further.

In this document and in its claims, the verb “to comprise” and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition the verb “to consist” may be replaced by “to consist essentially of” meaning that an oligonucleotide or a composition as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention. In addition, reference to an element by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article “a” or “an” thus usually means “at least one”.

Each embodiment as identified herein may be combined together unless otherwise indicated. All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.

DEFINITIONS

Throughout the application, the word “binds”, “targets”, “hybridizes” could be used interchangeably when used in the context of an antisense oligonucleotide which is reverse complementary to a part of a pre-mRNA as identified herein.

In addition, throughout the application, the expression “able to bind”, “able to target”, “able to hybridize” could be used interchangeably when used in the context of an antisense oligonucleotide which is reverse complementary to a part of a pre-mRNA as identified herein and for which conditions could be found wherein said oligonucleotide could bind, target or hybridize with said part of said pre-mRNA.

As used herein, “hybridization” refers to the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases). For example, the natural base adenine is nucleobase complementary to the natural nucleobases thymine and uracil which pair through the formation of hydrogen bonds. The natural base guanine is nucleobase complementary to the natural bases cytosine and 5-methylcytosine. Hybridization can occur under varying circumstances.

As used herein, “specifically hybridizes” refers to the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site. In certain embodiments, an anti sense oligonucleotide specifically hybridizes to more than one target site.

In the context of the invention, “hybridizes” is used under physiological conditions in a cell, preferably a muscular cell unless otherwise indicated.

As used herein, “nucleoside” refers to a compound comprising a heterocyclic base moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA), abasic nucleosides, modified nucleosides, and sugar-modified nucleosides. Nucleosides may be modified with any of a variety of substituents.

As used herein, “sugar moiety” means a natural (furanosyl), a modified sugar moiety or a sugar surrogate.

As used herein, “modified sugar moiety” means a chemically-modified furanosyl sugar or a non-furanosyl sugar moiety. Also, embraced by this term are furanosyl sugar analogs and derivatives including tricyclic sugars, bicyclic sugars, tetrahydropyrans, morpholinos, 2′-modified sugars, 4′-modified sugars, 5′-modified sugars, and 4′-substituted sugars.

As used herein, “sugar-modified nucleoside” means a nucleoside comprising a modified sugar moiety.

As used herein the term “sugar surrogate” refers to a structure that is capable of replacing the furanose ring of a naturally occurring nucleoside. In certain embodiments, sugar surrogates are non-furanose (or 4′-substituted furanose) rings or ring systems or open systems. Such structures include simple changes relative to the natural furanose ring, such as a six membered ring or may be more complicated as is the case with the non-ring system used in peptide nucleic acid. Sugar surrogates includes without limitation morpholinos and cyclohexenyls and cyclohexitols. In most nucleosides having a sugar surrogate group the heterocyclic base moiety is generally maintained to permit hybridization.

As used herein, “nucleotide” refers to a nucleoside further comprising a modified or unmodified phosphate linking group or a non-phosphate internucleoside linkage.

As used herein, “linked nucleosides” may or may not be linked by phosphate linkages and thus includes “linked nucleotides”.

As used herein, “nucleobase” refers to the heterocyclic base portion of a nucleoside. Nucleobases may be naturally occurring or may be modified and therefore include, but are not limited to adenine, cytosine, guanine, uracil, thymine and analogues thereof such as 5-methylcytosine. In certain embodiments, a nucleobase may comprise any atom or group of atoms capable of hydrogen bonding to a base of another nucleic acid.

As used herein, “modified nucleoside” refers to a nucleoside comprising at least one modification compared to naturally occurring RNA or DNA nucleosides. Such modification may be at the sugar moiety and/or at the nucleobases.

As used herein, “Tm” means melting temperature which is the temperature at which the two strands of a duplex nucleic acid separate. Tm is often used as a measure of duplex stability or the binding affinity of an antisense compound toward a complementary RNA molecule.

As used herein, “2′-modified” or “2′-substituted” refers to a nucleoside comprising a sugar comprising a substituent at the 2′ position other than H or OH. 2′-modified nucleosides include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2′ carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2′-substituents, such as allyl, amino, azido, thio, O-allyl, O—C1-C10 alkyl, —OCF3, O—(CH2)2—O—CH3, 2′—O(CH2)2SCH3, O—(CH2)2—O—N(Rm)(Rn), or O—CH2—C(═O)—N(Rm)(Rn), wherein each Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl. 2′-modified nucleosides may further comprise other modifications, for example at other positions of the sugar and/or at the nucleobase.

As used herein, “2′-OMe” or “2′-OCH3” or “2′-O-methyl” each refers to a nucleoside comprising a sugar comprising an —OCH3 group at the 2′ position of the sugar ring.

As used herein, “MOE” or “2′-MOE” or “2′-OCH2CH2OCH3” or “2′-O-methoxyethyl” each refers to a nucleoside comprising a sugar comprising a —OCH2CH2OCH3 group at the 2′ position of the sugar ring.

As used herein, the term “adenine analogue” means a chemically-modified purine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with either a thymine or uracil of a complementary strand of RNA or DNA.

As used herein, the term “uracil analogue” means a chemically-modified pyrimidine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with either a adenine of a complementary strand of RNA or DNA.

As used herein, the term “thymine analogue” means a chemically-modified pyrimidine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with an adenine of a complementary strand of RNA or DNA.

As used herein, the term “cytosine analogue” means a chemically-modified pyrimidine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with a guanine of a complementary strand of RNA or DNA. For example, cytosine analogue can be a 5-methylcytosine.

As used herein, the term “guanine analogue” means a chemically-modified purine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with a cytosine of a complementary strand of RNA or DNA.

As used herein, the term “guanosine” refers to a nucleoside or sugar-modified nucleoside comprising a guanine or guanine analog nucleobase.

As used herein, the term “uridine” refers to a nucleoside or sugar-modified nucleoside comprising a uracil or uracil analog nucleobase.

As used herein, the term “thymidine” refers to a nucleoside or sugar-modified nucleoside comprising a thymine or thymine analog nucleobase.

As used herein, the term “cytidine” refers to a nucleoside or sugar-modified nucleoside comprising a cytosine or cytosine analog nucleobase.

As used herein, the term “adenosine” refers to a nucleoside or sugar-modified nucleoside comprising an adenine or adenine analog nucleobase.

As used herein, “oligonucleotide” refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).

As used herein “oligonucleoside” refers to an oligonucleotide in which none of the internucleoside linkages contains a phosphorus atom. As used herein, oligonucleotides include oligonucleosides.

As used herein, “modified oligonucleotide” or “chemically-modified oligonucleotide” refers to an oligonucleotide comprising at least one modified sugar, a modified nucleobase and/or a modified internucleoside linkage or backbone.

As used herein, “internucleoside linkage” or “backbone” refers to a covalent linkage between adjacent nucleosides.

As used herein “naturally occurring internucleoside linkage” refers to a 3′ to 5′ phosphodiester linkage.

As used herein, “modified internucleoside linkage” refers to any internucleoside linkage other than a naturally occurring internucleoside linkage.

As used herein, “oligomeric compound” refers to a polymeric structure comprising two or more sub-structures. In certain embodiments, an oligomeric compound is an oligonucleotide. In certain embodiments, an oligomeric compound is a single-stranded oligonucleotide. In certain embodiments, an oligomeric compound is a double-stranded duplex comprising two oligonucleotides. In certain embodiments, an oligomeric compound is a single-stranded or double-stranded oligonucleotide comprising one or more conjugate groups and/or terminal groups.

As used herein, “conjugate” refers to an atom or group of atoms bound to an oligonucleotide or oligomeric compound. In general, conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional linking moiety or linking group to the parent compound such as an oligomeric compound. In certain embodiments, conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. In certain embodiments, conjugates are terminal groups. In certain embodiments, conjugates are attached to a 3′ or 5′ terminal nucleoside or to an internal nucleosides of an oligonucleotide.

As used herein, “conjugate linking group” refers to any atom or group of atoms used to attach a conjugate to an oligonucleotide or oligomeric compound. Linking groups or bifunctional linking moieties such as those known in the art are amenable to the present invention.

As used herein, “antisense compound” refers to an oligomeric compound, at least a portion of which is at least partially complementary to a target nucleic acid to which it hybridizes and modulates the activity, processing or expression of said target nucleic acid.

As used herein, “expression” refers to the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, splicing, post-transcriptional modification, and translation.

As used herein, “antisense oligonucleotide” refers to an antisense compound that is an oligonucleotide.

As used herein, “antisense activity” refers to any detectable and/or measurable activity attributable to the hybridization of an anti sense compound to its target nucleic acid. In certain embodiments, such activity may be an increase or decrease in an amount of a nucleic acid or protein. In certain embodiments, such activity may be a change in the ratio of splice variants of a nucleic acid or protein. Detection and/or measuring of antisense activity may be direct or indirect. In certain embodiments, antisense activity is assessed by observing a phenotypic change in a cell or animal.

As used herein, “target nucleic acid” refers to any nucleic acid molecule the expression, amount, or activity of which is capable of being modulated by an antisense compound. In certain embodiments, the target nucleic acid is DNA or RNA. In certain embodiments, the target RNA is mRNA, pre-mRNA, non-coding RNA, pri-microRNA, pre-microRNA, mature microRNA, promoter-directed RNA, or natural antisense transcripts. For example, the target nucleic acid can be a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In certain embodiments, target nucleic acid is a viral or bacterial nucleic acid.

As used herein, “target mRNA” refers to a pre-selected RNA molecule that encodes a protein.

As used herein, “targeting” or “targeted to” refers to the association of an antisense compound to a particular target nucleic acid molecule or a particular region of nucleotides within a target nucleic acid molecule. An anti sense compound targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.

As used herein, “target site” refers to a region of a target nucleic acid that is bound by an antisense compound. In certain embodiments, a target site is at least partially within the 3′ untranslated region of an RNA molecule. In certain embodiments, a target site is at least partially within the 5′ untranslated region of an RNA molecule. In certain embodiments, a target site is at least partially within the coding region of an RNA molecule. In certain embodiments, a target site is at least partially within an exon of an RNA molecule. In certain embodiments, a target site is at least partially within an intron of an RNA molecule. In certain embodiments, a target site is at least partially within a microRNA target site of an RNA molecule. In certain embodiments, a target site is at least partially within a repeat region of an RNA molecule.

As used herein, “target protein” refers to a protein, the expression of which is modulated by an antisense compound. In certain embodiments, a target protein is encoded by a target nucleic acid. In certain embodiments, expression of a target protein is otherwise influenced by a target nucleic acid.

As used herein, “complementarity” in reference to nucleobases refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair. Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.

As used herein, “non-complementary” in reference to nucleobases refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.

As used herein, “complementary” in reference to linked nucleosides, oligonucleotides, or nucleic acids, refers to the capacity of an oligomeric compound to hybridize to another oligomeric compound or nucleic acid through nucleobase complementarity. In certain embodiments, an antisense compound and its target are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleobases that can bond with each other to allow stable association between the anti sense compound and the target. One skilled in the art recognizes that the inclusion of mismatches is possible without eliminating the ability of the oligomeric compounds to remain in association. Therefore, described herein are antisense compounds that may comprise up to about 20% nucleotides that are mismatched (i.e., are not nucleobase complementary to the corresponding nucleotides of the target). Preferably the antisense compounds contain no more than about 15%, more preferably not more than about 10%, most preferably not more than 5% or no mismatches. The remaining nucleotides are nucleobase complementary or otherwise do not disrupt hybridization (e.g., universal bases). One of ordinary skill in the art would recognize the compounds provided herein are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to a target nucleic acid.

As used herein, “modulation” refers to a perturbation of amount or quality of a function or activity when compared to the function or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression. As a further example, modulation of expression can include perturbing splice site selection of pre-mRNA processing, resulting in a change in the amount of a particular splice-variant present compared to conditions that were not perturbed. As a further example, modulation includes perturbing translation of a protein.

As used herein, “motif” refers to a pattern of modifications in an oligomeric compound or a region thereof. Motifs may be defined by modifications at certain nucleosides and/or at certain linking groups of an oligomeric compound.

As used herein, “nucleoside motif” refers to a pattern of nucleoside modifications in an oligomeric compound or a region thereof. The linkages of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only nucleosides are intended to be nucleoside motifs. Thus, in such instances, the linkages are not limited.

As used herein, “linkage motif” refers to a pattern of linkage modifications in an oligomeric compound or region thereof. The nucleosides of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only linkages are intended to be linkage motifs. Thus, in such instances, the nucleosides are not limited.

As used herein, “the same modifications” refer to modifications relative to naturally occurring molecules that are the same as one another, including absence of modifications. Thus, for example, two unmodified DNA nucleoside have “the same modification,” even though the DNA nucleoside is unmodified.

As used herein, “type of modification” in reference to a nucleoside or a nucleoside of a “type” refers to the modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a “nucleoside having a modification of a first type” may be an unmodified nucleoside.

As used herein, “separate regions” refers to a portion of an oligomeric compound wherein the nucleosides and internucleoside linkages within the region all comprise the same modifications; and the nucleosides and/or the internucleoside linkages of any neighboring portions include at least one different modification.

As used herein, “pharmaceutically acceptable salts” refers to salts of active compounds that retain the desired biological activity of the active compound and do not impart undesired toxicological effects thereto.

As used herein, “cap structure” or “terminal cap moiety” refers to chemical modifications incorporated at either terminus of an anti sense compound.

As used herein, the term “independently” means that each occurrence of a repetitive variable within a claimed oligonucleotide is selected independent of one another. For example, each repetitive variable can be selected so that (i) each of the repetitive variables are the same, (ii) two or more are the same, or (iii) each of the repetitive variables can be different.

General Chemistry Definitions

As used herein, “alkyl” refers to a saturated straight or branched hydrocarbon substituent or radical, typically containing up to twenty four carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to 24 carbon atoms, more typically from 1 to 12 carbon atoms (C1-C12 alkyl) with from 1 to 6 carbon atoms (C1-C6 alkyl) being more preferred. The term “lower alkyl” as used herein includes from 1 to 6 carbon atoms (C1-C6 alkyl). Alkyl groups as used herein may optionally include one or more further substituent groups.

As used herein, “alkenyl” refers to a straight or branched hydrocarbon chain radical or substituent, typically containing up to twenty four carbon atoms, and having at least one carbon-carbon double bond. Examples of alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadienyl and the like. Alkenyl groups typically include from 2 to 24 carbon atoms, more typically from 2 to 12 carbon atoms with from 2 to 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally include one or more further substituent groups.

As used herein, “alkynyl” refers to a straight or branched hydrocarbon radical or substituent, typically containing up to twenty four carbon atoms, and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, but are not limited to, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include from 2 to 24 carbon atoms, more typically from 2 to 12 carbon atoms with from 2 to 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally include one or more further substituent groups.

As used herein, “aminoalkyl” refers to an amino substituted alkyl radical or substituent. This term is meant to include C1-C12 alkyl groups having an amino substituent at any position and wherein the aminoalkyl group is attached to the parent molecule via its alkyl moiety. The alkyl and/or amino portions of the aminoalkyl group can be further substituted with substituent groups.

As used herein, “aliphatic” refers to a straight or branched hydrocarbon radical or substituent, typically containing up to twenty four carbon atoms, wherein the saturation between any two carbon atoms is a single, double or triple bond. An aliphatic group preferably contains from 1 to 24 carbon atoms, more typically from 1 to 12 carbon atoms with from 1 to 6 carbon atoms being more preferred. The straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by heteroatoms include without limitation polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein may optionally include further substituent groups.

As used herein, “alicyclic” or “alicyclyl” refers to a cyclic radical or substituent, wherein the ring system is aliphatic. The ring system can comprise one or more rings wherein at least one ring is aliphatic. Preferred alicyclic moieties include rings having from 5 to 9 carbon atoms in the ring. Alicyclic groups as used herein may optionally include further substituent groups.

As used herein, “alkoxy” refers to a radical or substituent comprising an alkyl group and an oxygen atom, wherein the alkoxy group is attached to a parent molecule via its oxygen atom. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may optionally include further substituent groups.

As used herein, “halo”, “halide” and “halogen” refer to an atom, radical or substituent selected from fluorine, chlorine, bromine and iodine.

As used herein, “aryl” and “aromatic” refer to a radical or substituent comprising a mono- or polycyclic carbocyclic ring system having one or more aromatic rings. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl ring systems have from 5 to 20 carbon atoms in one or more rings. Aryl groups as used herein may optionally include further substituent groups.

As used herein, “aralkyl” and “arylalkyl” refer to a radical or substituent comprising an alkyl group and an aryl group, wherein the aralkyl or arylalkyl group is attached to a parent molecule via its alkyl moiety. Examples include, but are not limited to, benzyl, phenethyl and the like. Aralkyl groups as used herein may optionally include further substituent groups attached to the alkyl, the aryl or both groups that form the radical or substituent.

As used herein, “heterocyclyl” refers to a radical or substituent comprising a mono- or polycyclic ring system that includes at least one heteroatom and is unsaturated, partially saturated or fully saturated, thereby including heteroaryl groups. Heterocyclyl is also meant to include fused ring system moieties wherein one or more of the fused rings contain at least one heteroatom and the other rings can contain one or more heteroatoms or optionally contain no heteroatoms. A heterocyclic group typically includes at least one atom selected from sulfur, nitrogen or oxygen. Examples of heterocyclic groups include [1,3]dioxolane, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and the like. Heterocyclic groups as used herein may optionally include further substituent groups.

As used herein, “heteroaryl” and “heteroaromatic” refer to a radical or substituent comprising a mono- or polycyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatom. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen. Examples of heteroaryl groups include, but are not limited to, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl, and the like. Heteroaryl radicals or substituents can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or a heteroatom. Heteroaryl groups as used herein may optionally include further substituent groups.

As used herein, “heteroarylalkyl” refers to a radical or substituent comprising a heteroaryl group as previously defined and an alkyl moiety, wherein the heteroarylalkyl group is attached to a parent molecule via its alkyl moiety. Examples include, but are not limited to, pyridinylmethyl, pyrimidinylethyl, napthyridinylpropyl and the like. Heteroarylalkyl groups as used herein may optionally include further substituent groups on one or both of the heteroaryl or alkyl portions.

As used herein, “mono or polycyclic” refers to any ring systems, such as a single ring or a polycyclic system having rings that are fused or linked, and is meant to be inclusive of single and mixed ring systems individually selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl, heteroaromatic and heteroarylalkyl. Such mono and polycyclic structures can contain rings that have a uniform or varying degree of saturation, including fully saturated, partially saturated or fully unsaturated rings. Each ring can comprise ring atoms selected from C, N, O and S to give rise to heterocyclic rings as well as rings comprising only C ring atoms. Heterocyclic and all-carbon rings can be present in a mixed motif, such as for example benzimidazole wherein one ring of the fused ring system has only carbon ring atoms and the other ring has two nitrogen atoms. The mono or polycyclic structures can be further substituted with substituent groups such as for example phthalimide which has two oxo groups (═O) attached to one of the rings. In another aspect, mono or polycyclic structures can be attached to a parent molecule directly through a ring atom, through a substituent group or a bifunctional linking moiety.

As used herein, “acyl” refers to a radical or substituent comprising a carbonyl moiety (C═O or —C(O)—) and a further substituent X, wherein the acyl group is attached to a parent molecule via its carbonyl moiety. As such, an acyl group is formally obtained by removal of a hydroxyl group from an organic acid and has the general formula —C(O)—X, wherein X is typically aliphatic, alicyclic or aromatic. The term “acyl” is also meant to include heteroacyl radicals or substituents with general formula —Y(O)n—X, wherein X is as defined above and Y(O)n is typically sulfonyl, sulfinyl or phosphate. Examples of acyl groups include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like. Acyl groups as used herein may optionally include further substituent groups.

As used herein, “substituent” and “substituent group” include groups that are typically added to other substituents or parent compounds to enhance desired properties or give desired effects. Substituent groups can be protected or unprotected and can be attached to one available site or to many available sites in a parent compound. Substituent groups may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound. Herein, “hydrocarbyl” refers to any group comprising C, O and H. Included are straight, branched and cyclic groups having any degree of saturation. Such hydrocarbyl groups can include one or more heteroatoms selected from N, O and S and can be further substituted with one or more substituent groups.

Unless otherwise indicated, the term substituted or “optionally substituted” refers to the optional presence of any of the following substituents: halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (—C(O)Raa), carboxyl (—C(O)O—Raa), aliphatic groups, alicyclic groups, alkoxy, substituted oxo (—O—Raa), aryl, aralkyl, heterocyclic, heteroaryl, heteroarylalkyl, amino (—NRbbRcc), imino (═NRbb), amido (—C(O)NRbbRcc or —N(Rbb)C(O)Raa), azido (—N3), nitro (—NO2), cyano (—CN), carbamido (—OC(O)NRbbRcc or —N(Rbb)C(O)ORaa), ureido (—N(Rbb)C(O)NRbbRcc), thioureido (—N(Rbb)C(S)NRbbRcc), guanidinyl (—N(Rbb)C(═NRbb)NRbbRcc), amidinyl (—C(═NRbb)NRbbRcc or —N(Rbb)C(NRbb)Raa), thiol (—SRbb), sulfinyl (—S(O)Rbb), sulfonyl (—S(O)2Rbb), sulfonamidyl (—S(O)2NRbbRcc or —N(Rbb)S(O)2Rbb) and conjugate groups. Herein, each Raa, Rbb and Rcc is, independently, H, an optionally linked chemical functional group or a further substituent group, preferably but without limitation chosen from the group consisting of H, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl. Selected substituents within the compounds described herein are present to a recursive degree.

In this context, “recursive substituent” means that a substituent may recite another instance of itself. Because of the recursive nature of such substituents, theoretically, a large number may be present in any given claim. One of ordinary skill in the art of medicinal chemistry and organic chemistry understands that the total number of such substituents is reasonably limited by the desired properties of the compound intended. Such properties include, by way of example and not limitation, physical properties such as molecular weight, solubility or log P, application properties such as activity against the intended target and practical properties such as ease of synthesis.

Recursive substituents are an intended aspect of the invention. One of ordinary skill in the art of medicinal and organic chemistry understands the versatility of such substituents. To the degree that recursive substituents are present in a claim of the invention, the total number will be determined as set forth above.

The terms “stable compound” and “stable structure” as used herein are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. Only stable compounds are contemplated herein.

As used herein, a zero (0) in a range indicating number of a particular unit means that the unit may be absent. For example, an oligomeric compound comprising 0-2 regions of a particular motif means that the oligomeric compound may comprise one or two such regions having the particular motif, or the oligomeric compound may not have any regions having the particular motif. In instances where an internal portion of a molecule is absent, the portions flanking the absent portion are bound directly to one another. Likewise, the term “none” as used herein, indicates that a certain feature is not present.

As used herein, “analogue” or “derivative” means either a compound or moiety similar in structure but different in respect to elemental composition from the parent compound regardless of how the compound is made. For example, an analogue or derivative compound does not need to be made from the parent compound as a chemical starting material.

The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

LEGENDS TO THE FIGURE

FIG. 1.

Comparison of AONs with or without cytosine to 5-methylcytosine substitution in differentiated healthy muscle cells in vitro after transfection with (A) PS229L/PS524, SEQ ID NO:52 (corresponding to SEQ ID NO: 91 for the non-modified sequence, corresponding to SEQ ID NO: 92 wherein all cytosines are modified) or (B) PS220/PS339 (SEQ ID NO:21, corresponding to SEQ ID NO:101 for the non-modified sequence, corresponding to SEQ ID NO:200 wherein all cytosines are modified) or (C) PS524/PS1317/PS1318/PS1319, SEQ ID NO:52 (corresponding to SEQ ID NO: 92 (PS524) wherein all 6 cytosines are modified, to SEQ ID NO: 217 (PS1317) wherein 4 of the 6 cytosines are modified, to SEQ ID NO: 218 (PS1318) wherein 2 of the 6 cytosines are modified and to SEQ ID NO:219 (PS1319) wherein 3 of the 6 cytosines are modified SEQ ID NO:217). Average skipping percentages were calculated from triplo (n=3) (A,B) or duplo (n=2) (C) transfections per concentration. Solid lines refer to AONs with 5-methylcytosines, dotted lines to AONs with non-substituted cytosines (A,B).

FIG. 2.

Summary of the pharmacokinetic study in wild type (control) and mdx mice, comparing plasma and muscle tissue profiles of AONs with 5-methylcytosines (PS524, SEQ ID NO:52 (i.e. corresponding to SEQ ID NO: 92 wherein all cytosines are modified) and PS652, SEQ ID NO:57 (i.e. corresponding to SEQ ID NO: 185 wherein all cytosines are modified) and AONs with unmodified (non-methylated) cytosines (PS229L, SEQ ID NO:52 corresponding to SEQ ID NO: 91 for the non-modified sequence, and PS531, SEQ ID NO:57 corresponding to SEQ ID NO: 137 for the non-modified sequence). (A) Pharmacokinetic tissue analysis of: 1) the ratio between the average levels of AON in muscle in mdx mice versus control mice after one single sc injection; 2) the levels of the AONs (μg/g) in several mdx muscles (dia=diaphragm, gastroc=gastrocnemius, quadr=quadriceps, tric=triceps) at 14 days; 3) the relative muscle/kidney and muscle/liver levels at day 14, and 4) the estimated half-life of the different AONs in triceps. B) Pharmacokinetic plasma analysis of 1) Tmax (time at which Cmax was reached, only two time points of analysis included (15 or 60 min), 2) Cmax (highest plasma concentration reached), 3) AUC (area under curve; indicative for bioavailability) an 4) Cl (plasma clearance at 24 h.

FIG. 3.

Analysis of cytokine levels in human whole blood upon incubation with 0, 10, 25, or 50 μg/ml of AONs with unmodified cytosines PS232 (SEQ ID NO: 39, corresponding to SEQ ID NO: 119 for the non-modified sequence) and PS534 (SEQ ID NO:59, corresponding to SEQ ID NO: 139 for the non-modified sequence) (black bars) or AONs with 5-methylcytosines PS648 (SEQ ID NO: 39, corresponding to SEQ ID NO: 201 wherein all cytosines are modified) and PS653 (SEQ ID NO:59, to SEQ ID NO: 192 wherein all cytosines are modified) (grey bars). The levels of TNFα(A, B), MCP-1 (D, E), IP-10 (E, F), and IL6 (G, H) were determined using commercially available ELISA kits. Each experiment was repeated four times (n=4). Data is shown for the most pronounced response of each cytokine.

FIG. 4.

Activity comparisons of AONs with 5-methylcytosines and/or 5-methyluracils with corresponding AONs without these base modifications, (A) Transfection of 200 nM, in duplo, into differentiated healthy muscle cells in vitro. Activity was expressed as average percentage exon 51 (PS43, non-modified sequence represented by SEQ ID NO: 111, PS559 corresponding to SEQ ID NO: 202, wherein all uraciles are modified, PS1106 corresponding to SEQ ID NO:203, wherein all cytosines and all uraciles are modified. All sequences are derived from SEQ ID NO: 31), exon 44 (PS188, non-modified sequence represented by SEQ ID NO: 95, PS785, corresponding to SEQ ID NO: 204, wherein all uraciles are modified, PS1107: corresponding to SEQ ID NO:205, wherein all cytosines and all uraciles are modified. All sequences are derived from SEQ ID NO 15); or exon 52 (PS235, non-modified sequence represented by SEQ ID NO: 120, PS786: corresponding to SEQ ID NO: 172, wherein all uraciles are modified. All sequences are derived from SEQ ID NO 40) skipping (n=2). AON sequences (5′ to 3′) and base modifications (bold, underlined nucleotides) are shown in the table underneath. (B) Intramuscular injection of 20 μg of PS49 (non-modified sequence, SEQ ID NO: 216) or PS959 (modified sequence wherein all uracils are modified, SEQ ID NO:214) in the gastrocnemius muscles of mdx mice. Activity was expressed as average percentage murine exon 23 skipping (n=4). AON sequences (5′ to 3′) and base modifications (bold, underlined nucleotides) are shown in the table underneath.

FIG. 5.

Activity comparisons of AONs with 2,6-diaminopurines with corresponding AONs without this base modification. (A), Transfection of 200 nM, in duplo, into differentiated healthy muscle cells in vitro. Activity was expressed as average percentage exon 51 (PS43, non-modified sequence represented by SEQ ID NO: 111, PS403, corresponding to SEQ ID NO: 206, wherein all adenines have been modified. All sequences are derived from SEQ ID NO: 31), exon 52 (PS235, non-modified sequence represented by SEQ ID NO: 120, PS897: corresponding to SEQ ID NO: 173, wherein all adenines have been modified. All sequences are derived from SEQ ID NO: 40), or exon 44 (PS188, non-modified sequence represented by SEQ ID NO: 95, PS733: corresponding to SEQ ID NO: 207, wherein all adenines have been modified. All sequences are derived from SEQ ID NO: 15) skipping (n=2). AON sequences (5′ to 3′) and base modifications (bold, underlined nucleotides) are shown in the table underneath. (B) and (C) The effect of substituting all unmodified adenines (PS188; SEQ ID NO: 95) with 2,6-diaminopurines (PS733; SEQ ID NO:207) on in vitro safety. As markers for activation of the alternative complement pathway, split factors C3a (B) and Bb (C) were measured in monkey plasma.

EXAMPLES

TABLE 1
General structures of AONs. X = C or m5C, Y = U 
or m5U, Z = A or a2A; I = inosine
(hypoxanthine base), X1 = m5C, Y1 = m5U, Z1 = a2A
DMD SEQ ID
Exon AON Sequence (5′→3′) NO
44 GXXZYYYXYXZZXZGZYXY  14
GCCAUUUCUCAACAGAUCU  94
44 YXZGXYYXYGYYZGXXZXYG  15
UCAGCUUCUGUUAGCCACUG  95
Y1CAGCY1Y1CY1GY1Y1AGCCACY1G 204
UX1AGX1UUX1UGUUAGX1X1AX1UG 208
Y1X1AGX1Y1Y1X1Y1GY1Y1AGX1X1AX1Y1G 205
UCZ1GCUUCUGUUZ1GCCZ1CUG 207
44 YYYGYZYYYZGXZYGYYXXX  16
UUUGUAUUUAGCAUGUUCCC  96
44 ZYYXYXZGGZZYYYGYGYXYYYX  17
AUUCUCAGGAAUUUGUGUCUUUC  97
44 XXZYYYGYZYYYZGXZYGYYXXX  18
CCAUUUGUAUUUAGCAUGUUCCC  98
44 YXYXZGGZZYYYGYGYXYYYX  19
UCUCAGGAAUUUGUGUCUUUC  99
44 GXXZYYYXYXZZXZGZYXYGYXZ  20
GCCAUUUCUCAACAGAUCUGUCA 100
45 YYYGXXGXYGXXXZZYGXXZYXXYG  21
UUUGCCGCUGCCCAAUGCCAUCCUG 101
UUUGX1X1GX1UGX1X1X1AAUGX1X1AUX1X1UG 200
Y1Y1Y1GX1X1GX1Y1GX1X1X1AAY1GX1X1AY1X1X1Y1G 209
UUUGCCGCUGCCCZ1Z1UGCCZ1UCCUG 210
45 YYGXXGXYGXXXZZYGXXZYXXYG  22
UUGCCGCUGCCCAAUGCCAUCCUG 102
45 YYGXXGXYGXXXZZYGXXZYXXYGG  23
UUGCCGCUGCCCAAUGCCAUCCUGG 103
45 YGXXGXYGXXXZZYGXXZYXXYG  24
UGCCGCUGCCCAAUGCCAUCCUG 104
45 YGXXGXYGXXXZZYGXXZYXXYGG  25
UGCCGCUGCCCAAUGCCAUCCUGG 105
45 GXXGXYGXXXZZYGXXZYXXYG  26
GCCGCUGCCCAAUGCCAUCCUG 106
45 XXGXYGXXXZZYGXXZYXXYGG  27
CCGCUGCCCAAUGCCAUCCUGG 107
45 YYYGXXIXYGXXXZZYGXXZYXXYG  28
UUUGCCICUGCCCAAUGCCAUCCUG 108
45 XZGYYYGXXGXYGXXXZZYGXXZYX  29
CAGUUUGCCGCUGCCCAAUGCCAUC 109
45 XZGYYYGXXGXYGXXXZZYGXXZYXXYGGZ  30
CAGUUUGCCGCUGCCCAAUGCCAUCCUGGA 110
51 YXZZGGZZGZYGGXZYYYXY  31
UCAAGGAAGAUGGCAUUUCU 111
Y1CAAGGAAGAY1GGCAY1Y1Y1CY1 202
Y1X1AAGGAAGAY1GGX1AY1Y1Y1X1Y1 203
UCZ1Z1GGZ1Z1GZ1UGGCZ1UUUCU 206
UX1AAGGAAGAUGGX1AUUUX1U 215
51 YGGXZYYYXYZGYYYGG  32
UGGCAUUUCUAGUUUGG 112
51 XZYXZZGGZZGZYGGXZYYYXY  33
CAUCAAGGAAGAUGGCAUUUCU 113
51 XZZXZYXZZGGZZGZYGGXZYYYXY  34
CAACAUCAAGGAAGAUGGCAUUUCU 114
51 XXYXYGYGZYYYYZYZZXYYGZY  35
CCUCUGUGAUUUUAUAACUUGAU 115
51 XXZGZGXZGGYZXXYXXZZXZYX  36
CCAGAGCAGGUACCUCCAACAUC 116
51 ZXZYXZZGGZZGZYGGXZYYYXYZGYYYGG  37
ACAUCAAGGAAGAUGGCAUUUCUAGUUUGG 117
51 ZXZYXZZGGZZGZYGGXZYYYXYZG  38
ACAUCAAGGAAGAUGGCAUUUCUAG 118
52 XYXYYGZYYGXYGGYXYYGYYYYYX  39
CUCUUGAUUGCUGGUCUUGUUUUUC 119
X1UX1UUGAUUGX1UGGUX1UUGUUUUUX1 201
52 GGYZZYGZGYYXYYXXZZXYGG  40
GGUAAUGAGUUCUUCCAACUGG 120
GGUAAUGAGUUX1UUX1X1AAX1UGG 171
GGY1AAY1GAGY1Y1CY1Y1CCAACY1GG 172
GGUZ1Z1UGZ1GUUCUUCCZ1Z1CUGG 173
GGY1AAY1GAGY1Y1X1Y1Y1X1X1AAX1Y1GG 174
GGUZ1Z1UGZ1GUUX1UUX1X1Z1Z1X1UGG 175
GGY1Z1Z1Y1GZ1GY1Y1CY1Y1CCZ1Z1CY1GG 176
GGY1Z1Z1Y1GZ1GY1Y1X1Y1Y1X1X1Z1Z1X1Y1GG 177
52 YXYYGZYYGXYGGYXYYGYYYYYXZ  41
UCUUGAUUGCUGGUCUUGUUUUUCA 121
52 YYXXZZXYGGGGZXGXXYXYGYYXX  42
UUCCAACUGGGGACGCCUCUGUUCC 122
52 YGYYXYZGXXYXYYGZYYGXYGGYX  43
UGUUCUAGCCUCUUGAUUGCUGGUC 123
UGUUX1UAGX1X1UX1UUGAUUGX1UGGUX1 178
Y1GY1Y1CY1AGCCY1CY1Y1GAY1Y1GCY1GGY1C 179
UGUUCUZ1GCCUCUUGZ1UUGCUGGUC 180
Y1GY1Y1X1Y1AGX1X1Y1X1Y1Y1GAY1Y1GX1Y1GGY1X1 181
UGUUX1UZ1GX1X1UX1UUGZ1UUGX1UGGUX1 182
Y1GY1Y1CY1Z1GCCY1CY1Y1GZ1Y1Y1GCY1GGY1C 183
Y1GY1YAN1Z1GX1X1Y1X1Y1Y1GZ1Y1Y1GX1Y1GGY1X1 184
53 XYGYYGXXYXXGGYYXYG  44
CUGUUGCCUCCGGUUCUG 124
53 XZZXYGYYGXXYXXGGYYXYGZ  45
CAACUGUUGCCUCCGGUUCUGA 125
53 XZZXYGYYGXXYXXGGYYXYGZZ  46
CAACUGUUGCCUCCGGUUCUGAA 126
53 XZZXYGYYGXXYXXGGYYXYGZZG  47
CAACUGUUGCCUCCGGUUCUGAAG 127
53 XYGYYGXXYXXGGYYXYGZZGG  48
CUGUUGCCUCCGGUUCUGAAGG 128
53 XYGYYGXXYXXGGYYXYGZZGGY  49
CUGUUGCCUCCGGUUCUGAAGGU 129
53 XYGYYGXXYXXGGYYXYGZZGGYG  50
CUGUUGCCUCCGGUUCUGAAGGUG 130
53 XYGYYGXXYXXGGYYXYGZZGGYGY  51
CUGUUGCCUCCGGUUCUGAAGGUGU 131
53 GYYGXXYXXGGYYXYGZZGGYGYYX  52
GUUGCCUCCGGUUCUGAAGGUGUUC  91
GUUGX1X1UX1X1GGUUX1UGAAGGUGUUX1  92
GUUGX1X1UCCGGUUX1UGAAGGUGUUX1 217
GUUGX1X1UCCGGUUCUGAAGGUGUUC 218
GUUGCX1UCCGGUUX1UGAAGGUGUUX1 219
GY1Y1GCCY1CCGGY1Y1CY1GAAGGY1GY1Y1C 211
GY1Y1GX1XY1X1X1GGY1Y1X1Y1GAAGGY1GY1Y1X1 212
GUUGCCUCCGGUUCUGZ1Z1GGUGUUC 213
53 GXXYXXGGYYXYGZZGGYGYYXYYG  53
GCCUCCGGUUCUGAAGGUGUUCUUG 133
53 YYGXXYXXGGYYXYGZZGGYGYYXYYGYZX  54
UUGCCUCCGGUUCUGAAGGUGUUCUUGUAC 134
53 XYGYYGXXYXXGGYYXYGZZGGYGYYXYYG  55
CUGUUGCCUCCGGUUCUGAAGGUGUUCUUG 135
53 XZZXYGYYGXXYXXGGYYXYGZZGGYGYYXYYG  56
CAACUGUUGCCUCCGGUUCUGAAGGUGUUCUUG 136
55 GZGYYYXYYXXZZZGXZGXXYXYX  57
GAGUUUCUUCCAAAGCAGCCUCUC 137
GAGUUUX1UUX1X1AAAGX1AGX1X1UX1UX1 185
GAGY1Y1Y1CY1Y1CCAAAGCAGCCY1CY1C 186
GZ1GUUUCUUCCZ1Z1Z1GCZ1GCCUCUC 187
GAGY1Y1Y1X1Y1Y1X1X1AAAGX1AGX1X1Y1X1Y1X1 188
GZ1GUUUX1UUX1X1Z1Z1Z1GX1Z1GX1X1UX1UX1 189
GZ1GY1Y1Y1CY1Y1CCZ1Z1Z1GCZ1GCCY1CY1C 190
GZ1GY1Y1Y1X1Y1Y1X1X1Z1Z1Z1GX1Z1GX1X1Y1X1Y1X1 191
55 YZYGZGYYYXYYXXZZZGXZGXXYX  58
UAUGAGUUUCUUCCAAAGCAGCCUC 138
55 ZGXZYXXYGYZGGZXZYYGGXZGY  59
AGCAUCCUGUAGGACAUUGGCAGU 139
AGX1AUX1X1UGUAGGAX1AUUGGX1AGU 192
AGCAY1CCY1GY1AGGACAY1Y1GGCAGY1 193
Z1GCZ1UCCUGUZ1GGZ1CZ1UUGGCZ1GU 194
AGX1AY1X1X1Y1GY1AGGAX1AY1Y1GGX1AGY1 195
Z1GX1Z1UX1X1UGUZ1GGZ1X1Z1UUGGX1Z1GU 196
Z1GCZ1Y1CCY1GY1Z1GGZ1CZ1Y1Y1GGCZ1GY1 197
Z1GX1Z1Y1X1X1Y1GY1Z1GGZ1X1Z1Y1Y1GGX1Z1GY1 198
55 XZYXXYGYZGGZXZYYGGXZGYYG  60
CAUCCUGUAGGACAUUGGCAGUUG 140
55 YXXYGYZGGZXZYYGGXZGYYGYY  61
UCCUGUAGGACAUUGGCAGUUGUU 141
55 XYGYZGGZXZYYGGXZGYYGYYYX  62
CUGUAGGACAUUGGCAGUUGUUUC 142

TABLE 2
General structures of AONs. X = C or m5C, Y = U 
or m5U, Z = A or a2A; I = inosine
(hypoxanthine base), X1 = m5C, Y1 =2 m5U, Z1 = a2A
DMD  SEQ ID
Exon AON Sequence (5′→3′) NO
44 ZYYYXYXZZXZGZ  63
AUUUCUCAACAGA 143
44 ZGXYYXYGYYZGXXZ  64
AGCUUCUGUUAGCCA 144
44 ZYYXYXZGGZZ  65
AUUCUCAGGAA 145
44 ZYYYGYZYYYZGXZ  66
AUUUGUAUUUAGCA 146
44 ZYYYXYXZZXZGZYXYGYXZ  67
AUUUCUCAACAGAUCUGUCA 147
44 ZYYYXYXZZXZGZ  68
AUUUCUCAACAGA 148
44 ZXZGZYXYGYXZ  69
ACAGAUCUGUCA 149
45 YYYGXXGXYGXXXZZYGXXZ  70
UUUGCCGCUGCCCAAUGCCA 150
45 XGXYGXXXZZYGXXZYXXYG  71
CGCUGCCCAAUGCCAUCCUG 151
45 GXXGXYGXXXZZYGXXZYXX  72
GCCGCUGCCCAAUGCCAUCC 152
51 ZZGGZZGZYGGXZ  73
AAGGAAGAUGGCA 153
51 ZGGZZGZYGGXZ  74
AGGAAGAUGGCA 154
51 ZGZGXZGGYZ  75
AGAGCAGGUA 155
51 ZGXZGGYZXXYXXZ  76
AGCAGGUACCUCCA 156
51 ZXXYXXZZXZ  77
ACCUCCAACA 157
52 ZZYGZGYYXYYXXZZ  78
AAUGAGUUCUUCCAA 158
52 ZYGZGYYXYYXXZ  79
AUGAGUUCUUCCA 159
52 ZGYYXYYXXZ  80
AGUUCUUCCA 160
52 ZGXXYXYYGZ  81
AGCCUCUUGA 161
53 GYYGXXYXXGGYYXYGZZGG  82
GUUGCCUCCGGUUCUGAAGG 162
53 XYXXGGYYXYGZZGGYGYYX  83
CUCCGGUUCUGAAGGUGUUC 163
53 XXYXXGGYYXYGZZGGY  84
CCUCCGGUUCUGAAGGU 164
55 ZGYYYXYYXXZZZGXZ  85
AGUUUCUUCCAAAGCA 165
55 ZGYYYXYYXXZ  86
AGUUUCUUCCA 166
55 ZGXZYXXYGYZGGZXZYYGGXZ  87
AGCAUCCUGUAGGACAUUGGCA 167
55 ZGXZYXXYGYZ  88
AGCAUCCUGUA 168
55 ZYXXYGYZGGZ  89
AUCCUGUAGGA 169
55 ZGGZXZYYGGXZ  90
AGGACAUUGGCA 170

TABLE 3
Most preferred AONs
General structures of AONs. X = C or m5C, Y = U or m5U, Z = A or a2A;
 I = inosine (hypoxanthine base), X1 = m5C, Y1 = m5U, Z1 = a2A
DMD SEQ ID
Exon AON Sequence (5′→3′) NO
44 YXZGXYYXYGYYZGXXZXYG  15
UCAGCUUCUGUUAGCCACUG  95 PS188 FIG.4,5
Y1CAGCY1Y1CY1GY1Y1AGCCACY1G 204 PS785 FIG.4
UX1AGX1UUX1UGUUAGX1X1AX1UG 208 PS658
Y1X1AGX1Y1Y1X1Y1GY1Y1AGX1X1AX1Y1G 205 PS1107 FIG.4
UCZ1GCUUCUGUUZ1GCCZ1CUG 207 PS733 FIG.5
45 YYYGXXGXYGXXXZZYGXXZYXXYG  21
UUUGCCGCUGCCCAAUGCCAUCCUG 101 PS220 FIG.1b
UUUGX1X1GX1UGX1X1X1AAUGX1X1AUX1X1UG 200 PS399 FIG.1b
Y1Y1Y1GX1X1GX1Y1GX1X1X1AAY1GX1X1AY1X1X1Y1G 209 PS1108
UUUGCCGCUGCCCZ1Z1UGCCZ1UCCUG 210 PS1229
YYYGXXIXYGXXXZZYGXXZYXXYG  28
UUUGCCICUGCCCAAUGCCAUCCUG 108 PS305
51 YXZZGGZZGZYGGXZYYYXY  31
UCAAGGAAGAUGGCAUUUCU 111 PS43 FIG.4,5
Y1CAAGGAAGAY1GGCAY1Y1Y1CY1 202 PS559 FIG.4
Y1X1AAGGAAGAY1GGX1AY1Y1Y1X1Y1 203 PS1106 FIG.4
UCZ1Z1GGZ1Z1GZ1UGGCZ1UUUCU 206 PS403 FIG.5
UX1AAGGAAGAUGGX1AUUUX1U 215 PS401
52 GGYZZYGZGYYXYYXXZZXYGG  40
GGUAAUGAGUUCUUCCAACUGG 120 PS235 FIG.4,5
GGUAAUGAGUUX1UUX1X1AAX1UGG 171 PS650
GGY1AAY1GAGY1Y1CY1Y1CCAACY1GG 172 PS786 FIG.4
GGUZ1Z1UGZ1GUUCUUCCZ1Z1CUGG 173 PS897 FIG.5
GGY1AAY1GAGY1Y1X1Y1Y1X1X1AAX1Y1GG 174 PS1110
53 GYYGXXYXXGGYYXYGZZGGYGYYX  52
GUUGCCUCCGGUUCUGAAGGUGUUC  91 PS229L FIG.1a,2
GUUGX1X1UX1X1GGUUX1UGAAGGUGUUX1  92 PS524 FIG.1a,c,2
GUUGX1X1UCCGGUUX1UGAAGGUGUUX1 217 PS1317 FIG.1c
GUUGX1X1UCCGGUUCUGAAGGUGUUC 218 PS1318 FIG.1c
GUUGCX1UCCGGUUX1UGAAGGUGUUX1 219 PS1319 FIG.1c
GY1Y1GCCY1CCGGY1Y1CY1GAAGGY1GY1Y1C 211
GY1Y1GX1X1Y1X1X1GGY1Y1X1Y1GAAGGY1GY1Y1X1 212 PS1109
GUUGCCUCCGGUUCUGZ1Z1GGUGUUC 213
55 GZGYYYXYYXXZZZGXZGXXYXYX  57
GAGUUUCUUCCAAAGCAGCCUCUC 137 PS531 FIG.2
GAGUUUX1UUX1X1AAAGX1AGX1X1UX1UX1 185 PS652 FIG.2
GAGY1Y1Y1CY1Y1CCAAAGCAGCCY1CY1C 186
GZ1GUUUCUUCCZ1Z1Z1GCZ1GCCUCUC 187
GAGY1Y1Y1X1Y1Y1X1X1AAAGX1AGX1X1Y1X1Y1X1 188 PS1112

Preferred non modified oligonucleotides (X=C, Y=U, Z=A) are more preferably derived from each of the oligonucleotide basis sequence (SEQ ID NO:14-90) and are represented by a nucleotide or base sequence SEQ ID NO:91, 93-170 Preferred modified oligonucleotides derived from one of the nucleotide or base sequences SEQ ID NO:14-90 and comprising at least one X is m5C and/or at least one Y is m5U and/or at least one Z is a2A are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 92, 171-213, 215, 217, 218, 219. Even more preferred modified oligonucleotides (all X=m5C=X1 and/or all Y=m5U=Y1 and/or all Z=a2A=Z1) are derived from the most preferred nucleotide or base sequences (SEQ ID NO:15, 21, 31, 40, 52, and 57) and are represented by SEQ ID NO: 92, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219. The most preferred modified oligonucleotides are disclosed in Table 3.

Example 1

Material and Methods

AONs

All oligonucleotides (PS220/PS399, based on SEQ ID NO:21 corresponding to SEQ ID NO:101 for the non-modified sequence (PS220) and to SEQ ID NO:200 wherein all cytosines are modified (PS399); PS229L/PS524/PS1317/PS1318/PS1319, based on SEQ ID NO:52 corresponding to SEQ ID NO:91 for the non-modified sequence (PS229L), to SEQ ID NO:92 (PS524) wherein all 6 cytosines are modified, to SEQ ID NO: 217 (PS1317) wherein 4 of the 6 cytosines are modified, to SEQ ID NO: 218 (PS1318) wherein 2 of the 6 cytosines are modified and to SEQ ID NO:219 (PS1319) wherein 3 of the 6 cytosines are modified; PS232/PS648, based on SEQ ID NO: 39 corresponding to SEQ ID NO:119 for the non-modified sequence (PS232) and to SEQ ID NO:201 wherein all cytosines are modified (PS648); PS531/PS652, based on SEQ ID NO:57 corresponding to SEQ ID NO:137 for the non-modified sequence (PS531) and to SEQ ID NO:185 wherein all cytosines are modified (PS652); PS534/PS653, based on SEQ ID NO:59 corresponding to SEQ ID NO:139 for the non-modified sequence (PS534) and to SEQ ID NO:192 wherein all cytosines are modified (PS653)) were 2′-O-methyl phosphorothioate RNA, and synthesized using an OP-10 synthesizer (GE/ÄKTA Oligopilot), through standard phosphoramidite protocols, or obtained from commercial suppliers, in 40 nmol-4.5 mmol synthesis scale. Prosensa-synthesized oligonucleotides were cleaved and deprotected in a two step sequence (DIEA followed by conc. NH4OH treatment), purified by HPLC and dissolved in water and an excess of NaCl was added to exchange ions. After evaporation, compounds were redissolved in water, desalted by FPLC or ultrafiltration and lyophilized. Mass spectrometry confirmed the identity of all compounds, and purity (determined by UPLC) was found acceptable for all compounds (>75-80%); compounds obtained from commercial sources were used as received: PS399 (ChemGenes, 1 μmol synthesis scale, used as received), PS1317, PS1318, and PS1319 (ChemGenes, 200 nmol synthesis scale, used as received), PS229L, PS232, PS524, and PS648 (EuroGentec, 40 nmol synthesis scale, used as received), PS229L (Prosensa, 5.9 g obtained material, purity 81%), PS524 (Avecia, 4.5 mmol synthesis scale, purity 93%), PS534 (Prosensa, 2 μmol synthesis scale, purity 86%), PS653 (Prosensa, 40 nmol synthesis scale, purity 77%), PS531 (Avecia, 4.6 g obtained material, purity 85%), PS652 (Avecia, 2.4 g obtained material, purity 84% and 3.8 g obtained material, purity 82%). For the in vitro transfection experiments described herein, 50 μM working solutions of the AONs were prepared in 20 mM phosphate buffer (pH 7.0). For the whole blood cytokine release assays in this example, the concentrations of the stock solutions (prepared in DNase/RNase-free distilled water (Invitrogen)) varied: PS232 (8.75 mg/mL), PS534 (7.02 mg/mL), PS648 (8.55 mg/mL), PS653 (8.12 mg/mL).

Transfection and RT-PCR Analysis

Differentiated human healthy control muscle cells (myotubes) were transfected in 6-wells plates with a triplo AON concentration series of 0-100-200-400 nM (FIG. 1a, PS229L/PS524, SEQ ID NO:91/92) or 0-50-100-200-400-800 nM (FIG. 1b, PS220/PS399, SEQ ID NO: 101/200) or with an in duplo concentration of 400 nM (FIG. 1c, PS524/PS1317/PS1318/PS1319, SEQ ID NO:92/217/218/219), according to non-GLP standard operating procedures. For transfection polyethylenimine (ExGen500, Fermentas) was used (2 μl per μg AON, in 0.15M NaCl). Aforementioned transfection procedures were adapted from previously reported material and methods (Aartsma-Rus et al., 2003). At 24 hrs after transfection, RNA was isolated and analyzed by RT-PCR. Briefly, to generate dystrophin-specific cDNA, a DMD gene specific reverse primer in exon 47 (PS220/PS399) or exon 55 (PS229L/PS524/PS1317/PS1318/PS1319) was used in the reverse transcriptase (RT) reaction on 1000 ng input RNA. The PCR analysis was subsequently done on 3 μl of dystrophin cDNA for each sample, and included a first and nested PCR using DMD gene specific primers in exons flanking exon 45 (PS220/PS399) or 53 (PS229L/PS524/PS1317/PS1318/PS1319). The RNA isolation and RT-PCR analysis were performed according to non-GLP standard operating procedures as described (Aartsma-Rus et al., 2003). RT-PCR products were analyzed by gel electrophoresis (2% agarose gels). The resulting RT-PCR fragments were quantified through DNA Lab-on-a-Chip analysis (Agilent). The data was processed by “Agilent 2100 Bioanalyzer” software and Excel 2007. The ratio of the smaller transcript product (containing the exon 45(PS220/PS399) or 53 skip (PS229L/PS524/PS1317/PS1318/PS1319)) to the total amount of transcript products was assessed (representing the exon 45 or 53 skipping efficiencies in percentages) and directly compared to that in non-transfected cells.

Pharmacokinetic Study in Wild Type and Mdx Mice

Mdx (C57Bl/10ScSn-Dmdmdx/J) and wild-type (C57Bl/10ScSnJ) mice at 5 weeks of age were obtained from Jackson Laboratory (Maine USA). The AONs (PS229L/PS524 corresponding to SEQ ID NO: 91/92, PS531/PS652 corresponding to SEQ ID NO: 137/185) were administered in physiological saline at a dose of 100 mg/kg by subcutaneous injections three times per week for two weeks. To determine the plasma profile of the AONs, plasma samples were taken from 2 animals per time-point (per AON group) at the following times for the animals: 15 min, 1 h, 2 h, 6 h and 24 hours after dosing. To obtain plasma, venous whole blood was collected into Li-Heparin tubes, centrifuged and kept at −80° C. until analysis. For distribution analysis 7 organs (heart, kidney cortex, liver, diaphragm, gastrocnemius, quadriceps & triceps) were harvested upon sacrifice of the animals. The tissues were snap frozen and stored at −80° C. until analysis.

AON Hybridisation Assay

To determine the concentration of the AONs (PS229L/PS524 corresponding to SEQ ID NO: 91/92, PS531/PS652 corresponding to SEQ ID NO: 137/185) in plasma and tissue an AON hybridization assay was used, which is based on the assay described by Yu et al., 2002. For the tissue distribution analysis, tissues were homogenized, using a MagNaLyzer (Roche) to a concentration of 60 mg/ml in protK buffer (100 mmol/l Tris-HCl pH8.5, 200 mmol/l NaCl, 5 mmol/l EDTA, 0.2% SDS) containing 2 mg/ml proteinase K, followed by a 2 hours incubation (liver) or 4 hours incubation (all other organs) in a rotating hybridization oven at 55° C. and then stored −20° C. until use. All tissue homogenates and calibration curves were diluted (fit to criteria of the assay) in 60 times diluted pooled mdx control tissue homogenate (kidney, liver, several muscle groups). A template probe specific for each AON (5′ gaatagacg-anti-AON-biotin 3′, DNA phosphate oligonucleotide) and a ligation probe (p-cgtctattc-DIG DNA phosphate oligonucleotide) were used in the hybridization assay. The homogenates were incubated for 1 h at 37° C. with template probe (50 nmol/1) and the hybridized samples were transferred to streptavidin coated 96-well plates and incubated for 30 min at 37° C. Subsequently, the plate was washed 4 times and the digoxigenin-labeled ligation (2 nmol/l) was added and incubated for 30 min at ambient temperature. The DIG-label was detected using an anti-DIG-POD (1:7,500-1:30,000; Roche Diagnostics), which was visualized with a 3,3′, 5,5′-tetramethylbenzidine substrate (Sigma Aldrich, the Netherlands), and the reaction was stopped using an acidic solution (Sigma Aldrich). The absorption was measured at 450 nm using a BioTek Synergy HT plate reader (Beun de Ronde, Abcoude, The Netherlands). Plasma samples were analyzed according to the same protocol, using 100 times diluted pooled mdx plasma.

Whole Blood Cytokine Release Assay

For the detection of possible cytokine stimulation induced by selected AONs (PS232/PS648 corresponding to SEQ ID NO: 119/201 and PS534/PS653 corresponding to SEQ ID NO: 139/192) whole blood (anticoagulant CPD) from healthy human volunteers was used. Varying AON concentrations (ranging from 0 to 50 μg/ml, in a dilution of approximately 1:0.01 (v/v)) were added to the blood and the samples were incubated for 4 hours at 37° C. under 5% CO2 atmosphere. After incubation, the samples were centrifuged at 3200×g for 15 minutes at 4° C. and plasma supernatants were collected and stored at −20° C. until cytokine quantification. MCP-1, IL-6, TNF-α, and IP-10 concentrations were determined by sandwich ELISA (human MCP-1, IL-6, TNF-α, IP-10 ELISA kits (R&D Systems). The experiments with human whole blood were repeated three to four times. FIG. 3 is based on one experiment only, but considered representative.

Results

The effect on AON activity (i.e. inducing exon skipping efficiency) of substituting all cytosines with 5-methylcytosines (m5C) was tested in cultured, differentiated, healthy muscle cells in vitro. In FIGS. 1a and 1b two examples are shown. When comparing PS229L and PS524 (=PS229L−m5C) (i.e. non-modified sequence SEQ ID NO: 91 compared with the modified sequence SEQ ID NO: 92 wherein all cytosines have been modified) in a dose-response transfection experiment using 0-100-200-400 nM, PS524 was clearly more efficient than PS229L at 200 and 400 nM (1.9-fold higher exon 53 skipping levels) (FIG. 1a). Similarly, when comparing PS220 and PS399 (=PS220−m5C) (i.e. non-modified sequence SEQ ID NO: 101 compared with the modified sequence SEQ ID NO: 200 wherein all cytosines have been modified) in a dose-response transfection experiment using 0-50-100-200-400-800 nM, PS399 was clearly more efficient than PS220, especially at lower concentrations (up to 10-fold higher exon 45 skipping levels at 50 nM) (FIG. 1b). These results demonstrate that the presence of 5-methylcytosines has a positive effect on the activity of the AONs. In PS524 (SEQ ID NO:92) all 6 cytosines are substituted with 5-methylcytosines (m5C) which had a positive effect on the exon skipping activity when compared to the non-modified counterpart oligonucleotide PS229L (SEQ ID NO:91) (FIG. 1a). To test whether such positive effect may be correlated with the number or percentage of base modifications incorporated, PS1317, PS1318, and PS1319, with respectively 4, 2, and 3 of the 6 cytosines substituted with 5-methylcytosines (m5C), were tested and directly compared to PS524 in cultured, differentiated, healthy muscle cells in vitro. PS1317, PS1318, and PS1319 were all effective in inducing exon 53 skipping (47%, 37%, and 45% respectively) (FIG. 1c). When compared to the levels obtained with PS524 however (64%), these results indeed suggest that reducing the number of 5-methylcytosines (m5C), from 6 to 4, 3, or 2 5-methylcytosines, leads to a reduced positive effect on exon skipping activity of the AON.

To investigate whether 5-methylcytosines affect bio-stability, -distribution, and/or -availability, a pharmacokinetic study was performed both in wild type (control) and mdx mice. The mdx mouse model for DMD has a natural nonsense mutation in exon 23 and is therefore dystrophin-deficient. The lack of dystrophin at the membranes increases the permeability of the muscle fibers for relatively small molecules as AONs, and has indeed been demonstrated to enhance 2′-O-methyl phosphorothioate RNA AON uptake by muscle up to 10-fold (Heemskerk et al., 2010). The mice were injected subcutaneously with 100 mg/kg of either 5-methylcytosine-containing AONs (PS524, PS652 corresponding to SEQ ID NO: 92, 185) or their counterparts with unmodified cytosines (PS229L, PS531 corresponding to SEQ ID NO: 91, 137), three times per week for two weeks. At different time-points (day 1, 7, 14) after the last injection, the mice were sacrificed and different muscle groups (heart, diaphragm, gastrocnemius, quadriceps, and triceps) and liver and kidney were isolated to determine AON concentrations therein (FIG. 2A). As anticipated, for all compounds the concentrations in mdx muscles (average of all samples) was higher than those in control mice. The ratio mdx to control AON levels appeared relatively higher for the AONs with 5-methylcytosines. More specifically, in the mdx mice, the levels of PS524 and PS652 were 2- to 3-fold higher than that of PS229L and PS531. (FIG. 2A). When monitoring the levels of AON in kidney and liver (known toxicity organs), the ratios between muscle tissue and toxicity tissues remained similar, or were even favorable for PS524. These results suggest that AONs with 5-methylcytosine are taken up better by or more stable in muscle than AONs with unmodified cytosines. Indeed the half life in muscle was longer for PS524 (>20 days) and PS652 (25 days) when compared to PS229L (7 days) and PS531 (10 days). In plasma, the Cmax values of the AONs injected were similar, which confirms that the mice received equal doses (FIG. 2B). Remarkably, the AUC values (as indicator for bioavailability) were 1.5 to 2.3-fold higher for the 5-methylcytosine containing AONs. This was associated with a lower clearance which supports their higher muscle tissue levels. The results from this pharmacokinetic study thus demonstrate that the presence of 5-methylcytosines has a positive effect on the bio-stability, -distribution, and/or -availability of the AONs, while the muscle/toxicity organ ratios were similar to those with the AONs with unmodified cytosines.

The in vitro safety profile of AONs with 5-methylcytosines (PS648, PS653 corresponding to SEQ ID NO: 201, 192) was compared to that of AONs with unmodified cytosines (PS232, PS534, corresponding to SEQ ID NO: 119, 139). AONs may stimulate an innate immune response by activating the Toll-like receptors (including TLR7, TLR8, TLR9), which results in set of coordinated immune responses that include innate immunity. Several chemo- and cytokines, such as IP-10, TNFα, IL-6 and MCP-1 play a role in this process, and were therefore monitored in human whole blood incubated with 0 to 50 μg/ml of each AON (using commercially available ELISA kits). PS232 and PS534 both have unmodified cytosines and induced the release of TNF-α (FIG. 3A, B), MCP-1 (FIG. 3C, D), IP-10 (FIG. 3E, F), and IL-6 (FIG. 3G, H) at increasing doses. In contrast, both PS648 and PS653 (with 5-methylcytosines) did not have any effect on TNF-α, IP-10 and IL-6. PS653, not PS648, seemed to induce a minor release of MCP-1 only. In conclusion, the presence of 5-methylcytosines improved the safety profile of these AONs in vitro.

Example 2

Material and Methods

AONs

All oligonucleotides (PS43/PS559/PS1106, all based on SEQ ID NO:31, and corresponding to SEQ ID NO: 111 (PS43) non modified sequence, SEQ ID NO: 202 (PS559) wherein all uraciles have been modified, and SEQ ID NO: 203 (PS1106) wherein all uraciles and all cytosines have been modified; PS188/PS785/PS1107, all based on SEQ ID NO:15, and corresponding to SEQ ID NO: 95 (PS188) non-modified sequence, SEQ ID NO: 204 (PS785) wherein all uraciles have been modified, and SEQ ID NO: 205 (PS1107) wherein all uraciles and all cytosines have been modified; PS235/PS786, both based on SEQ ID NO:40, and corresponding to SEQ ID NO: 120 (PS235) non-modified sequence and SEQ ID NO: 172 (PS786) wherein all uraciles have been modified), and PS49 (SEQ ID NO:216) non-modified sequence and PS959 (SEQ ID NO:214) wherein all cytosines have been modified, were 2′-O-methyl phosphorothioate RNA, and synthesized using an OP-10 synthesizer (GE/ÄKTA Oligopilot) through standard phosphoramidite protocols, or obtained from commercial suppliers, in 200 nmol-286.1 g scale. Prosensa-synthesized oligonucleotides were cleaved and deprotected in a two step sequence (DIEA followed by conc. NH4OH treatment), purified by HPLC and dissolved in water and an excess of NaCl was added to exchange ions. After evaporation, compounds were redissolved in water, desalted by FPLC or ultrafiltration and lyophilized. Mass spectrometry confirmed the identity of all compounds, and purity (determined by UPLC) was found acceptable for all compounds (>75-80%); compounds obtained from commercial sources were used as received: PS188 (Girindus, 286.1 g obtained product, purity 93%), PS785, PS786, PS1106, and PS1107 (ChemGenes, 200 nmol synthesis scale, used as received), PS43 (Prosensa, 1 μmol synthesis scale, purity 90%), PS559 (ChemGenes, 1 μmol synthesis scale, used as received), PS235 (Prosensa, 1.92 mmol synthesis scale, purity 91%). For the in vitro transfection experiments described herein, 50 μM working solutions of the AONs were prepared in 20 mM phosphate buffer (pH 7.0).

Transfection and RT-PCR Analysis

Differentiated human healthy control muscle cells (myotubes) were transfected in 6-wells plates with a fixed AON concentration of 200 nM, according to non-GLP standard operating procedures. For transfection polyethylenimine (ExGen500, Fermentas) was used (2 μl per μg AON, in 0.15M NaCl). Aforementioned transfection procedures were adapted from previously reported material and methods (Aartsma-Rus et al., 2003). At 24 hrs after transfection, RNA was isolated and analyzed by RT-PCR. Briefly, to generate dystrophin-specific cDNA, a DMD gene specific reverse primer in exon 53 (PS43/PS559/PS1106, SEQ ID NO: 111, 202, 203), exon 46 (PS188/PS785/PS1107 SEQ ID NO: 95, 204, 205) or exon 54 (PS235/PS786, SEQ ID NO: 120, 172) was used in the reverse transcriptase (RT) reaction on 1000 ng input RNA. The PCR analysis was subsequently done on 3 μl of dystrophin cDNA for each sample, and included a first and nested PCR using DMD gene specific primers in exons flanking exon 51 (PS43/PS559/PS1106), exon 44 (PS188/PS785/PS1107) or exon 52 (PS235/PS786). The RNA isolation and RT-PCR analysis were performed according to non-GLP standard operating procedures as described [Aartsma-Rus et al., Hum Mol Genet 2003; 12(8):907-14]. RT-PCR products were analyzed by gel electrophoresis (2% agarose gels). The resulting RT-PCR fragments were quantified through DNA Lab-on-a-Chip analysis (Agilent). The data was processed by “Agilent 2100 Bioanalyzer” software and Excel 2007. The ratio of the smaller transcript product (containing the exon 51 (PS43/PS559/PS1106), exon 44 (PS188/PS785/PS1107), or exon 52 skip (PS235/PS786) to the total amount of transcript products was assessed (representing the exon 51, 44, or 52 skipping efficiencies in percentages) and directly compared to that in non-transfected cells.

In Vivo Administration and RT-PCR

The experiments with the mdx mouse model (C57Bl/10ScSn-mdx/J; Charles River Laboratories) were approved by the local LUMC Animal Ethics Committee (DEC number 11145). Two mdx mice per group were anaesthetized using isoflurane and then injected intramuscularly in both gastrocnemius muscles, with 20 ug PS49 (SEQ ID NO: 216) or PS959 (SEQ ID NO:214), diluted in sterile saline to a total volume of 50 μl per injection, on two consecutive days. Animals were sacrificed 1 week after the last injection by cervical dislocation and muscles were isolated and snap frozen in magnalyzer greenbead tubes (Roche). Six-hundred μl Tripure (Roche) was added to the tubes and muscles were homogenized using the bullet blender machine, 3×1 min speed 10. The lysate was transferred to a clean tube to which 120 μl of chloroform was added. Samples were vigorously shaken en incubated on ice for 5 minutes, then centrifuged for 15 minutes at maximum speed at 4° C. The supernatant was transferred to another tube and 1 volume of isopropanol was added. Samples were mixed and incubated at 4 degrees for at least 30 minutes. Then samples were centrifuged for 15 minutes at maximum speed at 4° C., washed with 70% ethanol followed by a second centrifugation step of 10 minutes at maximum speed at 4° C. RNA pellets were air dried and solved in DEPC treated water. cDNA was generated using 400 ng total RNA with random hexamer primers using Transcriptor reverse transcriptase (RT) (Roche Diagnostics) according to the manufacturer's instructions. PCRs were performed by 30 cycles of 94 degrees for 30 s, 60 degrees for 30 s and 72 degrees for 30 s in a 50 μl reaction using 1.5 μl cDNA as template using primers specific for mouse exon 22 and exon 24. PCR products were visualized on 2% agarose gels quantified the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, Calif., USA).

Results

The effect on AON activity (i.e. inducing exon skipping efficiency) of substituting all unmodified cytosines with 5-methylcytosines and substituting all unmodified uracils with 5-methyluracils (as in PS1106, PS1107, SEQ ID NO: 203, 205), and of only substituting all unmodified uracils with 5-methyluracils (as in PS559, PS785, PS786, SEQ ID NO: 202, 204, 172), was first tested at a fixed 200 nM AON concentration in cultured, differentiated, healthy muscle cells in vitro (FIG. 4A). The AONs with 5-methyluracils (PS559, PS785, and PS786) increased the exon skipping efficiencies 1.3- to 3-fold when compared to their counterparts with unmodified uracils. When also replacing the unmodified cytosines by 5-methylcytosines, the skipping levels were further increased (PS1106 versus PS559, SEQ ID NO: 203 versus 202) or similar (PS1107 versus PS785, SEQ ID NO: 205 versus 204). The effect on AON activity (i.e. inducing exon skipping efficiency) of substituting all unmodified uracils (as in PS49; SEQ ID NO:216) with 5-methyluracils (as in PS959; SEQ ID NO:214) was then also tested in muscle of the mdx mouse model. PS959 with all 5-methyluracils increased the exon 23 skipping efficiencies approximately 3-fold when compared to PS49 with unmodified uracils (n=4 per AON) (FIG. 4B). These results demonstrate that not only 5-methylcytosines may have a positive effect on exon skipping activity (as also shown in FIG. 1) but also, 5-methyluracils, both in vitro and in vivo. In addition the combined use of these 5-methylpyrimidines may even further increase activity.

Example 3

Material and Methods

AONs

All oligonucleotides (PS43/PS403, based on SEQ ID NO:31, and corresponding to SEQ ID NO: 111 (PS43) for the non-modified and SEQ ID NO: 206 (PS403) for the sequence wherein all adenines have been modified; PS188/PS733, based on SEQ ID NO:15, and corresponding to SEQ ID NO: 95 (PS188) for the non-modified and SEQ ID NO: 207 (PS733) for the sequence wherein all adenines have been modified; PS235/PS897, based on SEQ ID NO:40, and corresponding to SEQ ID NO: 120 (PS235) for the non-modified and SEQ ID NO: 173 (PS897) for the sequence wherein all adenines have been modified) were 2′-O-methyl phosphorothioate RNA, and synthesized using an OP-10 synthesizer (GE/ÄKTA Oligopilot) through standard phosphoramidite protocols, or obtained from commercial suppliers, in 200 nmol-151 g scale. Prosensa-synthesized oligonucleotides were cleaved and deprotected in a two step sequence (DIEA followed by conc. NH4OH treatment), purified by HPLC and dissolved in water and an excess of NaCl was added to exchange ions. After evaporation, compounds were redissolved in water, desalted by FPLC or ultrafiltration and lyophilized. Mass spectrometry confirmed the identity of all compounds, and purity (determined by UPLC) was found acceptable for all compounds (>75-80%); compounds obtained from commercial sources were used as received: PS188 (Girindus, 151 g obtained, purity 92%), PS733 (TriLink or ChemGenes, 200 nmol/1 mg synthesis scale, used as received, PS43 (Prosensa, 10 mol synthesis scale, purity 86%), PS403 (ChemGenes, 1 μmol synthesis scale, used as received), PS235 (Prosensa, 1.92 mmol synthesis scale, purity 91%), PS897 (ChemGenes, 200 nmol synthesis scale, used as received). For the in vitro transfection experiments described herein, 50 μM working solutions of the AONs were prepared in 20 mM phosphate buffer (pH 7.0). For the in vitro complement activation assays described herein, 3 mg/mL stock solutions of PS188 and PS733 were prepared in 20 mM phosphate buffer (pH 7.0).

Transfection and RT-PCR Analysis

Differentiated human healthy control muscle cells (myotubes) were transfected in 6-wells plates with a fixed AON concentration of 200 nM, according to non-GLP standard operating procedures. For transfection polyethylenimine (ExGen500, Fermentas) was used (2 μl per g AON, in 0.15M NaCl). Aforementioned transfection procedures were adapted from previously reported material and methods (Aartsma-Rus et al., 2003). At 24 hrs after transfection, RNA was isolated and analyzed by RT-PCR. Briefly, to generate dystrophin-specific cDNA, a DMD gene specific reverse primer in exon 53 (PS43/PS403, SEQ ID NO: 111/206), exon 46 (PS188/PS733, SEQ ID NO: 95/207) or exon 54 (PS235/PS897, SEQ ID NO: 120/173) was used in the reverse transcriptase (RT) reaction on 1000 ng input RNA. The PCR analysis was subsequently done on 3 μl of dystrophin cDNA for each sample, and included a first and nested PCR using DMD gene specific primers in exons flanking exon 51 (PS43/PS403), exon 44 (PS188/PS733) or exon 52 (PS235/PS897). The RNA isolation and RT-PCR analysis were performed according to non-GLP standard operating procedures as described [Aartsma-Rus et al., Hum Mol Genet 2003; 12(8):907-14]. RT-PCR products were analyzed by gel electrophoresis (2% agarose gels). The resulting RT-PCR fragments were quantified through DNA Lab-on-a-Chip analysis (Agilent). The data was processed by “Agilent 2100 Bioanalyzer” software and Excel 2007. The ratio of the smaller transcript product (containing the exon 51 (PS43/PS403), exon 44 (PS188/PS733), or exon 52 skip (PS235/PS897) to the total amount of transcript products was assessed (representing the exon 51, 44, or 52 skipping efficiencies in percentages) and directly compared to that in non-transfected cells.

Complement Activation Assay

Antisense oligonucleotides may activate the alternative complement pathway, which contains several split factors, such as C3a and factor Bb (the latter is unique to the alternative pathway). The ability of AONs to possibly activate the complement pathway was assessed in plasma from Cynomolgus monkeys (LiHe plasma, CIT, France). Increasing concentrations (from 0 to 300 μg/mL) of PS188 (SEQ ID NO: 95) and PS733 (PS207), in a dilution of 1:10 (v/v)), were added to the plasma and incubated at 37° C. for 30 min. The reaction was terminated by transferring the samples to ice and making dilutions in ice-cold diluent. Bb and C3a concentrations were determined by ELISA (Quidel, San Diego, Calif.).

Results

The effect on AON activity (i.e. inducing exon skipping efficiency) of substituting all unmodified adenines with 2,6-diaminopurines was tested at a fixed AON concentration (200 nM) in cultured, differentiated, healthy muscle cells in vitro. In FIG. 5A examples for three different AON sequences are shown. The AONs with 2,6-diaminopurines (PS403, PS897, and PS733, SEQ ID NO: 206, 207, 173) increased the exon skipping efficiencies 2- to 4-fold when compared to their counterparts with unmodified adenines (compared to SEQ ID NO: 111, 95, 120). There seemed to be a correlation with the number of 2,6-diaminopurines in each AON.

The effect of substituting all unmodified adenines (as in PS188; SEQ ID NO: 95) with 2,6-diaminopurines (as in PS733; SEQ ID NO:207) on in vitro safety, i.e. possible activation of the alternative complement pathway, was tested in monkey plasma. Whereas PS188 induced relatively high levels of both split factors Bb and C3a, the 2,6-diaminopurines in PS733 completely abolished the effect on the alternative pathway, showing no increase in either Bb or C3a levels (FIG. 5B). Thus the presence of 2,6-diaminopurines seemed to improve the safety profile of PS188 in vitro.

These results demonstrate the positive effect of 2,6-diaminopurines on the exon skipping activity and safety of AONs.

LIST OF REFERENCES

  • van Ommen, van Deutekom, Aartsma-Rus, Curr Opin Mol Ther. 2008; 10(2):140-9.
  • Yokota, Duddy, Partidge, Acta Myol. 2007; 26(3):179-84.
  • van Deutekom et al., N Engl J Med. 2007; 357(26):2677-86.
  • Goemans et al., N Engl J Med. 2011; 364(16):1513-22.
  • Cirak et al., Lancet 2011; 378: 595-605.
  • Heemskerk et al., Mol Ther 2010; 18(6):1210-7.
  • Aartsma-Rus et al., Hum Mol Gen 2003; 12(8):907-14.
  • Yu R Z., Anal Biochem 2002; 304: 19-25.
  • Krieg A M. et al., Nature 1995; 374: 546-549.
  • Diebold S. S., et. al., Eur J Immunol. 2006; December; 36(12):3256-67.
  • Krieg, A. M., Curr. Opin. Immunol. 2000; 12: 35-43.
  • Wagner, H., Adv. Immunol. 1999; 73: 329-368.
  • Popovic P J. et al. J of Immunol 2006; 177: 8701-8707.
  • Peacock H et al. J. Am. Chem. Soc. 2011, 133, 9200
  • Arai K et al. Bioorg. Med. Chem. 2011, 21, 6285
  • Ehmsen J. et al, J. Cell Sci. 2002, 115 (Pt14): 2801-2803.
  • Monaco A. P., et al., Genomics 1988; 2: 90-95.
  • Manzur A. Y. et al., Wiley publishers, 2008. The Cochrane collaboration.
  • Hodgetts S., et al, Neuromuscular Disorders 2006; 16: 591-602.
  • Aartsma-Rus et al, Oligonucleotides 2010, 20(2): 69-77
  • Zuker M., et al, Nucleic Acids Res. 2003; 31(13):3406-15.
  • Cartegni L, et al, Nat Rev Genet 2002; 3(4):285-98.
  • Cartegni L, et al, Nucleic Acids Res 2003; 31(13):3568-71
  • Remington: The Science and Practice of Pharmacy, 20th Edition.
  • Baltimore, Md.: Lippincott Williams & Wilkins, 2000
  • Kumar L, Pharm. Technol. 2008, 3, 128
  • Bruno, K., Advanced Drug Delivery Reviews 2011; 63: 1210.
  • Hari et al. Org. Biomol. Chem. 2012, 10, 9639);
  • Hanessian et al. Angew. Chem. Intl Ed. 2012, 45, 11242

Claims

1. An isolated antisense oligonucleotide of length 13-33 nucleotides, wherein the oligonucleotide comprises a sequence which is complementary to a dystrophin pre-mRNA exon, said oligonucleotide being a 2′-O-methyl ribose and 5′methylcytosine or 5′methyluracil modified oligonucleotide, and wherein the antisense oligonucleotide is capable of exon-skipping.

2. The isolated antisense oligonucleotide of claim 1, wherein the oligonucleotide comprises 16-22 nucleotides.

3. The isolated antisense oligonucleotide of claim 1, wherein said oligonucleotide is a 2′-O-methyl-phosphorothioate oligonucleotide.

4. The isolated antisense oligonucleotide of claim 1, wherein the isolated antisense oligonucleotide comprises a peptide nucleic acid, a locked nucleic acid and a morpholino phosphorodiamidate or a combination thereof.

5. The isolated antisense oligonucleotide of claim 1, wherein the isolated antisense oligonucleotide comprises a locked nucleic acid.

6. The isolated antisense oligonucleotide of claim 1, wherein said exon comprises exon 44, 45, 46, 50, 51, 52, and 55.

7. The isolated antisense oligonucleotide of claim 1, said oligonucleotide being RNA.

8. The isolated antisense oligonucleotide of claim 1, wherein the isolated antisense oligonucleotide is a 5-methyl cytosine oligonucleotide.

9. The isolated antisense oligonucleotide of claim 1, wherein the isolated antisense oligonucleotide is a 5-methyl uracil oligonucleotide.

10. The isolated antisense oligonucleotide of claim 1, wherein said oligonucleotide comprises a 2, 6-diaminopurine base.

11. The isolated antisense oligonucleotide of claim 1, wherein said oligonucleotide is at least 16 nucleotides in length and comprises 5-methyl cytosine, a locked nucleic acid, and 2′-O-methyl-phosphorothioate modification.

12. A pharmaceutical composition comprising at least two distinct isolated antisense oligonucleotides as defined claim 1, wherein said pharmaceutical composition further comprises a pharmaceutically acceptable carrier, adjuvant, diluent and/or excipient.

13. A method for treating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual, the method comprising administering to said individual a pharmaceutical composition of claim 12, wherein said composition induces skipping of exons of dystrophin pre-mRNA.

14. A method for treating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in a cell, the method comprising administering to said cell a pharmaceutical composition of claim 12, wherein said composition induces skipping of exons of dystrophin pre-mRNA.

15. A method for inducing skipping of an exon of human dystrophin pre-mRNA in a muscle cell, the method comprising contacting said cell with an oligonucleotide of claim 1 for a time and under conditions which permit exon skipping.

16. A method for inducing skipping of an exon of human dystrophin pre-mRNA in a human subject, the method comprising administering an oligonucleotide of claim 1 to said subject in an amount and for a time which is effective to induce exon skipping.

17. A method for treating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual, the method comprising administering to said individual an oligonucleotide of claim 1, wherein said oligonucleotide induces skipping of an exon of a dystrophin pre-mRNA.

18. A method for treating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in a cell, the method comprising administering to said cell one or more isolated oligonucleotides of claim 1.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: