US20210340569A1
2021-11-04
17/373,485
2021-07-12
Provided herein are AAV8 mutant capsids and rAAV comprising the same. In one embodiment, vectors employing the AAV8 mutant capsid show increased transduction in a selected tissue as compared to AAV8.
Get notified when new applications in this technology area are published.
C12N2750/14143 » CPC further
ssDNA viruses; Details; Parvoviridae; Dependovirus, e.g. adenoassociated viruses; Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
C12N2710/10045 » CPC further
dsDNA viruses; Details; Adenoviridae; Use of virus, viral particle or viral elements as a vector Special targeting system for viral vectors
C12N2810/6027 » CPC further
Vectors comprising a targeting moiety; Vectors comprising as targeting moiety peptide derived from defined protein from viruses ssDNA viruses
C12N2710/10032 » CPC further
dsDNA viruses; Details; Adenoviridae Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
C12N2710/10033 » CPC further
dsDNA viruses; Details; Adenoviridae Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
C12N2750/14122 » CPC further
ssDNA viruses; Details; Parvoviridae; Dependovirus, e.g. adenoassociated viruses New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
C12N15/86 » CPC main
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for animal cells Viral vectors
C07K14/005 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
This application is a divisional of U.S. patent application Ser. No. 16/093,800, filed Oct. 15, 2018, which is a National Stage Entry under 35 USC 371 of International Patent Application No. PCT/US2017/027392, filed Apr. 13, 2017, which claims the benefit under 35 USC 119(e) of U.S. Provisional Patent Application No. 62/323,389, filed Apr. 15, 2016. These applications are incorporated herein by reference.
Applicant hereby incorporates by reference the Sequence Listing material filed in electronic form herewith. This file is labeled “UPN-16-7726PCT_ST25.txt”.
Adeno-associated viruses (AAV) hold great promise in human gene therapy and have been widely used to target liver, muscle, heart, brain, eye, kidney and other tissues in various studies due to its ability to provide long-term gene expression and lack of pathogenicity. AAVs belong to the parvovirus family and each contains a single strand DNA flanked by two inverted terminal repeats. Dozens of naturally occurring AAV capsids have been reported their unique capsid structures enable them to recognize and transduce different cell types and organs.
Since the first trial which started in 1981, there has not been any vector-related toxicity reported in clinical trials of adeno-associated virus (AAV) vector based gene therapy. The ever-accumulating safety records of AAV vector in clinical trials, combined with demonstrated efficacy, show that AAV is a good platform to work with. Another attractive feature is that AAV is relatively easy to be manipulated as AAV is a single-stranded DNA virus with a small genome (˜4.7 kb) and simple genetic components-inverted terminal repeats (ITR), the Rep and Cap genes. Only the ITRs and AAV capsid protein are required in AAV vectors, with the ITRs serving as replication and packaging signals for vector production and the capsid proteins playing a central role by forming capsids to accommodate vector genome DNA, determining tissue tropism and delivering vector genomic DNA into target cells. There have been mainly four ways to obtain AAV capsid genes: isolating AAVs from cultures or tissues samples, AAV directed evolution, shuffling, and rational design.
AAV8 has been shown to effectively transduce liver, muscle. In addition, AAV8-mediated hFIX gene transfer by a single peripheral-vein infusion consistently leads to long-term expression of the FIX transgene at therapeutic levels without acute or long-lasting toxicity in patients with severe hemophilia B.
AAV vectors possess many advantages in gene transfer, but there are still some problems to be solved. Thus, more effective AAV vectors are needed.
In one aspect, an adeno-associated virus is provided. The virus comprises an AAV8 mutant capsid. In one embodiment, the capsid has the sequence of SEQ ID NO: 18 and is termed AAV3G1. In another embodiment, the capsid has the sequence of SEQ ID NO: 20 and is termed AAV8.T20. In yet another embodiment, the capsid has the sequence of SEQ ID NO: 22 and is termed AAV8.TR1. In another aspect, a nucleic acid encoding a capsid as described herein is provided. In one embodiment, the capsid is encoded by SEQ ID NO: 17 or a sequence sharing at least 95% identity therewith. In another embodiment, the capsid is encoded by SEQ ID NO: 19 or a sequence sharing at least 95% identity therewith. In another embodiment, the capsid is encoded by SEQ ID NO: 21 or a sequence sharing at least 95% identity therewith.
In another embodiment, the AAV which includes an AAV8 mutant capsid, includes at least a vp3 capsid having a mutation in at least one of the following regions, as compared to native AAV8 (SEQ ID NO: 34): i. aa 263 to 267 (SEQ ID NO: 78); ii. aa 457 to aa 459; iii. aa 455 to aa 459 (SEQ ID NO: 81); or iv. aa 583 to aa 597 (SEQ ID NO: 69). In one embodiment, the AAV having the AAV8 mutant capsid has increased transduction in a target tissue as compared to AAV8. In one embodiment, the target tissue is muscle, liver, lung, airway epithelium, neurons, eye, or heart. In another embodiment, the AAV having the AAV8 mutant capsid has an increased ability to escape AAV neutralizing antibodies as compared to native AAV8.
In one embodiment, the vp1 and or vp2 unique regions are derived from a different AAV than the AAV supplying the vp3 unique region (i.e., AAV8). In one embodiment, the AAV supplying the vp1 and vp2 sequences is rh.20. In one embodiment, the rh.20 vp1 sequence is SEQ ID NO: 88.
In another embodiment, the AAV further includes AAV inverted terminal repeats and a heterologous nucleic acid sequence operably linked to regulatory sequences which direct expression of a product encoded by the heterologous nucleic acid sequence in a target cell.
In another aspect, a method of transducing a target tissue is provided. In one embodiment, the method includes administering an AAV having a capsid as described herein. In one embodiment, a method of transducing liver tissue is provided, comprising administering an AAV having the AAV3G1 capsid. In another embodiment, a method of transducing muscle tissue is provided, comprising administering an AAV having the AAV3G1 capsid. In yet another embodiment, a method of transducing airway epithelium is provided, comprising administering an AAV having the AAV3G1 or AAV8.T20 capsid. In another embodiment, a method of transducing liver tissue is provided, comprising administering an AAV having the AAV8.TR1 capsid. In yet another embodiment, a method of transducing ocular cells is provided, comprising administering an AAV having the AAV3G1 capsid.
In yet another aspect, a method of generating a mutant AAV capsid having increased transduction for a target tissue, as compared to the wild type capsid is provided. The method includes performing mutagenesis at the contact region of a neutralizing antibody to the wild type capsid; and performing in vitro selection in the presence of the monoclonal antibody. In one embodiment, the method includes performing an additional mutation at a hypervariable region of the capsid. In another embodiment, the method further includes substituting the vp1 and/or vp2 unique sequences with the vp1 and/or vp2 sequences from a different AAV capsid.
In another aspect, a method of generating a recombinant adeno-associated virus (AAV) comprising an AAV capsid is provided. In one embodiment, the method includes culturing a host cell containing: (a) a molecule encoding an AAV capsid protein a capsid having a mutation in at least one of the following regions, as compared to native AAV8 (SEQ ID NO: 34): i. aa 263 to 267 (SEQ ID NO: 78); ii. aa 457 to aa 459; iii. aa 455 to aa 459 (SEQ ID NO: 81); or iv. aa 583 to aa 597 (SEQ ID NO: 69); (b) a functional rep gene; (c) a minigene comprising AAV inverted terminal repeats (ITRs) and a transgene; and (d) sufficient helper functions to permit packaging of the minigene into the AAV capsid protein.
In yet another aspect, a recombinant adeno-associated virus (AAV) is provided. In one embodiment, the rAAV includes an AAV capsid having an amino acid sequence selected from: SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32. Such capsids are sometimes referred to herein as the “AAV8 mutant capsid(s)”. The rAAV further includes a non-AAV nucleic acid sequence. In another aspect, a nucleic acid molecule encoding an AAV capsid sequence is provided. In one embodiment, the nucleic acid sequence is selected from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, and 31.
In another aspect, an AAV capsid protein is provided. The AAV capsid has a mutation in at least one of the following regions, as compared to native AAV8 (SEQ ID NO: 34): i. aa 263 to 267 (SEQ ID NO: 78); ii. aa 457 to aa 459; iii. aa 455 to aa 459 (SEQ ID NO: 81); or iv. aa 583 to aa 597 (SEQ ID NO: 69). In another aspect, a nucleic acid sequence encoding an AAV capsid as described herein, is provided.
In yet another aspect, a host cell transfected with an adeno-associated virus as described herein, is provided.
In another aspect, a composition is provided which includes at least an AAV as described herein and a physiologically compatible carrier, buffer, adjuvant, and/or diluent.
In yet another aspect, a method of delivering a transgene to a cell is provided. The method includes the step of contacting the cell with an AAV as described herein, wherein said rAAV comprises the transgene.
FIG. 1A provides a map of the plasmid used for AAV mutant library construction.
FIG. 1B illustrates the selection process of the AAV mutant library construction.
FIG. 2A is a bar graph demonstrating that mutagenesis at the antibody-capsid contact sites confers Nab resistance in vitro. The HEK 293 cells were infected by AAV8 and mutants carrying CMV.eGFP, mixed with medium (No Ab), antibody ADK8, ADK8/9 or ADK9. The M.O.I. was around 1e4. Two days later, GFP images were taken and analyzed. See Example 2B2.
FIG. 2B is a scatter plot demonstrating mutagenesis at the antibody-capsid contact sites confers Nab resistance in vivo. AAV8 mutants were packed with TBG.canine F9-WPRE cassette and tested in B6 in the presence/absence of antibody ADK8 through i.v. injection. 100 uL of diluted ADK8 was injected i.v. 2 hours prior to vector injection. AAV8 was used as control. Canine F9 level was measured with ELISA from plasma collected 1 week after administration. The percent of F9 from ADK8-present animal to ADK8-absent animal and p value (t-test) are shown above. See Example 2B6.
FIGS. 3A-3B are a protein Alignment of AAV8, AAV3G1, AAV8.T20 and AAV8.TR1 as described herein.
FIG. 4A demonstrates that AAV3G1 is resistant to pooled human IVIG (hIVIG), compared to AAV8. AAV8 (filled bar) or AAV3G1 (open bar) carrying CB7.CI.luciferase cassette were incubated with various dilution of pooled human IVIG before applied to Huh7 cells in 96 well plates (M.O.I., ˜1e4). Luciferase level was read 72 hours after infection. The x-axis is the dilution fold of hIVIG. The y-axis represents the percentage of luciferase expression compared to “vector alone” control. The gray dot line indicates 50% expression level.
FIG. 4B demonstrates that all three mutations in AAV3G1 contribute to Nab resistance. AAV8, AAV3G1 and mutants carrying all the combinations of the three mutations comprising AAV3G1 were tested in vitro with human plasmas (4 samples) and anti-AAV8 monkey sera (4 samples). AAV8 and the variants were incubated with diluted sera/plasma (final anti-AAV8 Nab titer in the mix, 1:4) before applied to Huh7 cells in 96-well plates. Luciferase expression was read 72 hours later and converted to the percentage of the expression level of each “vector alone” control. for each serum/plasma, a ranking number was assigned to each vector according to their residual expression (the ranking number of the highest residual expression was 1 and the lowest was 8). See Example 2C.
FIG. 5A are photographs of mice injected i.m. with AAV8 or AAV3G1 carrying a CB7.CI.luciferase cassette. Vector was administered into B6 muscle at a dose of 3×1010 gc/mouse, 4 mice/group. Luciferase activity was monitored 2 weeks and 4 weeks after dosing. These findings demonstrate that, through intramuscular injection, AAV3G1 prefers muscle to liver, compared to AAV8. See Example 2C.
FIG. 5B are photographs of muscle tissue after i.m. injection of AAV vectors carrying a different transgene cassette from that shown in FIG. 5a. These experiments show similar muscle preference of AAV3G1 in B6 mice. Dose, 1×109 gc/animal, 5×108 gc/25 uL/leg, both legs. Week 3 after vector injection, muscle section, X-gal staining, the best section of each group, 4×.
FIG. 5C. I.m. injection of AAV vectors carrying a third transgene cassette, tMCK.human F9, shows similar muscle preference of AAV3G1 in B6 mice. tMCK is a muscle-specific promoter. Dose, 3e10 gc/mouse, 3 mice/group. Plasma and muscle were collected 28 and 30 days after dosing, respectively. Human F9 was measured by ELISA from plasma and muscle lysate. The muscle F9 expression level of AAV3G1 was 11.2 folds of AAV8. See Example 2B6.
FIG. 5D. The neutralizing antibody titer of the day 28 plasma shows that the antigenecity of AAV8 and AAV3G1 is different. The plasma samples were from the study of FIG. 5c. See Example 2B6.
FIG. 6A. Overview of X-gal stained sections from heart, muscle and liver of mice received AAV8 or AAV3G1 vector. MPS 3A Het mice (B6 background) received Sell gc of AAV.CMV.Lac/mouse, i.v. Tissues were collected 14 days later. Representative muscle sections of each animal at 4×. See Example 2C.
FIG. 6B. Representative image of in vivo luciferase imaging, to compare AAV8 and AAV3G1 with CB7.CI.ffluciferase transgene cassette, i.v., in B6 mice. Dose, 3e11 gc/mouse, week 2 after vector injection. The left is AAV8; the right is AAV3G1. See Example 2C.
FIG. 7A. AAV3G1 has a higher transduction to mouse airway epithelial cells and the transduction is improved further by replacing VP12 region with rh.20. B6 mice received 1e11 gc/mouse of AAV.CB7.CI.luciferase, i.n.. The luciferase activity was monitored 2, 3 and 4 week after vector administration. The right panel is a representative image (week 4) of the study. The left panel is quantification with Living Image® 3.2 and normalized by the average value of AAV8 group at week 2. See Example 2C.
FIG. 7B. Airway epithelia cell transduction comparison of AAV8, AAV8.T20, AAV9 and AAV6.2. B6 mice received 1e11 gc/mouse of AAV.CB7.CI.luciferase, i.n., 4 mice/vector. The luciferase activity was monitored 1, 2 and 3 week after vector administration. Living Image® 3.2 was used for quantification and normalized by the average value of AAV8 group at week 1. See Example 2C.
FIG. 8A. The heparin affinity of AAV3G1 is increased. AAV vectors were diluted in DPBS and 2e11 gc of the vector was loaded to Heparin column, followed by washing with DPBS and DPBS with various concentrations of NaCl. Dot blot was performed with PVDF membrane with antibody B1.
FIG. 8B. The charge reduction in AAV8.TR1 decreases its heparin affinity. Equal gc of AAV8.TR1.TBG.hF9co.WPRE.bGH and AAV3G1.CB7.CI.luciferase.RBG were mixed together in Tris buffer (pH 7.4, 0.01 M), loaded onto heparin column and washed sequentially with various buffers. Fractions were collected during the process: FT+W, flow-through plus wash with Tris buffer, 0.05 M-2.0 M, Tris buffer plus 0.05-2.0 M NaCl. Vector distributions were measured by qPCR with bGH and RBG probes.
FIG. 8C shows charge reduction of AAV3G1, resulting the in the mutant AAV8.TR1, restores liver transduction partially. B6 mice were administrated intravenously with AAV.TBG.hF9co.WPRE.RBG at a dose of 1e10 gc/mouse, 5 mouse/group. Plasma was collected week 1, 2 and 4 after vector injection and measured by human F9 ELISA.
FIG. 8D provides results of in vitro Huh7 Nab assy. Reporter:CB7.CI.ffluciferase; M.O.I. ˜1e3. The samples were Week 4 plasma from 3 animals each group of the same study as FIG. 8C.
FIG. 8E provides the vector genome copy distribution from the mice of FIG. 8C.
FIG. 9 provides a map of pAAV.DE.0.
FIG. 10 provides a map of pAAV.DE.1.
FIG. 11 provides a map of pAAV.DE.1.HVR.I.
FIG. 12 provides a map of pAAV.DE.1.HVR.IV.
FIG. 13A is a graph showing human F9 expression (ng/mL) in mice (5 mice/group) injected with AAV.TBG.human F9 at 1e10 gc/mouse, i.v. Plasma was collected 1, 2 and 4 weeks after treatment.
FIG. 13B is a graph showing neutralizing antibody titer against AAV8 at week 4 in the mice of FIG. 13A. Huh7 cells were used with AAV8.CB7.Luciferase at a final concentration of 1e9 gc/mL. The average of each group is indicated.
FIG. 14 provides a map of pAAVinvivo.
FIG. 15 are photographs of male B6 mice, 3 mice/group, injected i.m. with 3e9 or 3e10 gc/mouse, 1 leg/mouse with AAV3G1.tMCK.PI.ffluc.bGH, dd-PCR(PK). Week 1 results are shown. For each figure, the left is AAV8-treated, the right AAV3G1.
Adeno-associated virus (AAV)-based gene therapy is showing increasing promise, stimulated by encouraging results from clinical trials in recent years. Until now, AAV vectors utilizing the capsid have shown a tremendous potential for in vivo gene delivery with nearly complete transduction of many tissues in rodents after intravascular infusion. Thus, AAV8 is a logical starting point for designing improved vectors. To advance the platform, provided herein are AAV8 mutants having increased resistance to neutralizing antibodies, yield, expression, or transduction. The methods are directed to use of the AAV to target various tissues and treat various conditions.
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and by reference to published texts, which provide one skilled in the art with a general guide to many of the terms used in the present application. The following definitions are provided for clarity only and are not intended to limit the claimed invention. As used herein, the terms “a” or “an”, refers to one or more, for example, “an ocular cell” is understood to represent one or more ocular cells. As such, the terms “a” (or “an”), “one or more,” and “at least one” are used interchangeably herein. As used herein, the term “about” means a variability of 10% from the reference given, unless otherwise specified. While various embodiments in the specification are presented using “comprising” language, under other circumstances, a related embodiment is also intended to be interpreted and described using “consisting of” or “consisting essentially of” language.
With regard to the following description, it is intended that each of the compositions herein described, is useful, in another embodiment, in the methods of the invention. In addition, it is also intended that each of the compositions herein described as useful in the methods, is, in another embodiment, itself an embodiment of the invention.
As used herein, the term “target tissue” can refer to any cell or tissue which is intended to be transduced by the subject AAV vector. The term may refer to any one or more of muscle, liver, lung, airway epithelium, neurons, eye (ocular cells), or heart. In one embodiment, the target tissue is liver. In another embodiment, the target tissue is the eye.
As used herein, the term “ocular cells” refers to any cell in, or associated with the function of, the eye. The term may refer to any one or more of photoreceptor cells, including rod, cone and photosensitive ganglion cells, retinal pigment epithelium (RPE) cells, Mueller cells, bipolar cells, horizontal cells, amacrine cells. In one embodiment, the ocular cells are bipolar cells. In another embodiment, the ocular cells are horizontal cells. In another embodiment, the ocular cells are ganglion cells.
As used herein, the term “mammalian subject” or “subject” includes any mammal in need of the methods of treatment described herein or prophylaxis, including particularly humans. Other mammals in need of such treatment or prophylaxis include dogs, cats, or other domesticated animals, horses, livestock, laboratory animals, including non-human primates, etc. The subject may be male or female.
As used herein, the term “host cell” may refer to the packaging cell line in which the rAAV is produced from the plasmid. In the alternative, the term “host cell” may refer to the target cell in which expression of the transgene is desired.
A recombinant AAV capsid protein as described herein is characterized by a variable protein 3 (vp3) having a mutation in at least one of the following regions, as compared to the native full length (vp1) AAV8 capsid sequence (SEQ ID NO: 34): i. aa 263 to 267 (SEQ ID NO: 78); ii. aa 457 to aa 459; iii. aa 455 to aa 459 (SEQ ID NO: 81); or iv. aa 583 to aa 597 (SEQ ID NO: 69). An AAV having such a capsid has increased transduction in a target tissue as compared to AAV8. Also encompassed by the invention are nucleic acid sequences encoding the novel AAV, capsids, and fragments thereof which are described herein.
As used herein, the term “native” refers to the native AAV sequence without mutation in i. aa 263 to 267; ii. aa 457 to aa 459; iii. aa 455 to aa 459; or iv. aa 583 to aa 597 (using AAV8 numbering) of the capsid protein. However it is not intended that only naturally occurring AAV8 be the source of the wild type sequence. Useful herein are non-naturally occurring AAV, including, without limitation, recombinant, modified or altered, shuffled, chimeric, hybrid, evolved, synthetic, artificial, etc., AAV. This includes AAV with mutations in regions of the capsid other than in i. aa 263 to 267; ii. aa 457 to aa 459; iii. aa 455 to aa 459; or iv. aa 583 to aa 597 (using AAV8 numbering), provided they are used as the “starting sequence” for generating the mutant capsid described herein.
The AAV capsid consists of three overlapping coding sequences, which vary in length due to alternative start codon usage. These variable proteins are referred to as VP1, VP2 and VP3, with VP1 being the longest and VP3 being the shortest. The AAV particle consists of all three capsid proteins at a ratio of ˜1:1:10 (VP1:VP2:VP3). VP3, which is comprised in VP1 and VP2 at the N-terminus, is the main structural component that builds the particle. The capsid protein can be referred to using several different numbering systems. For convenience, as used herein, the AAV sequences are referred to using VP1 numbering, which starts with aa 1 for the first residue of VP1. However, the capsid proteins described herein include VP1, VP2 and VP3 (used interchangeably herein with vp1, vp2 and vp3) with mutations in the corresponding region of the protein. In AAV8, the variable proteins correspond to VP1 (aa 1 to 738), VP2 (aa 138 to 738), and VP3 (aa 204 to 738) using the numbering of the full length VP1. The amino acid sequence of native AAV8 vp1 is shown in SEQ ID NO: 34.
The AAV capsid contains 9 hypervariable regions (HVR) which show the most sequence divergence throughout AAV isolates. See, Govindasamy et al, J Virol. 2006 December; 80(23):11556-70. Epub 2006 Sep. 13, which is incorporated herein by reference. Thus, when rationally designing new vectors, the HVRs are a rich target. In one embodiment, the AAV capsid has a mutation in the HVRVIII region. In one embodiment, an AAV capsid is provided which has a mutation in aa 583-aa597 as compared to the AAV8 native sequence. In one embodiment, the AAV capsid has an aa 583-597 sequence as shown below in Table 1. Encompassed herein are capsid proteins and rAAV having capsid proteins having vp1, vp2 and/or vp3 sequences which include one of the amino acid sequences shown in Table 1.
| TABLE 1 |
| capsid mutations |
| SEQ ID NO | |
| CONTAINING | |
| AA583-597 | |
| MUTATION | aa593 to aa597 Mutation |
| 2 | 583ADNLQQQNTAPQIGT597 (SEQ ID NO: 69) -- |
| >GDNLQLYNTAPGSVF (SEQ ID NO: 70) | |
| 4 | 583ADNLQQQNTAPQIGT597 (SEQ ID NO: 69) -- |
| >SDNLQFRNTAPLWSS (SEQ ID NO: 71) | |
| 6 | 583ADNLQQQNTAPQIGT597 (SEQ ID NO: 69) -- |
| >NDNLQVCNTAPDDVM (SEQ ID NO: 72) | |
| 8 | 583ADNLQQQNTAPQIGT597 (SEQ ID NO: 69) -- |
| >CDNLQGYNTAPLCVA (SEQ ID NO: 73) | |
| 10 | 583ADNLQQQNTAPQIGT597 (SEQ ID NO: 69) -- |
| >VDNLQFLNTAPAGEA (SEQ ID NO: 74) | |
| 12 | 583ADNLQQQNTAPQIGT597 (SEQ ID NO: 69) -- |
| >LDNLQDGNTAPGACG (SEQ ID NO: 75) | |
| 14 | 583ADNLQQQNTAPQIGT597 (SEQ ID NO: 69) -- |
| >WDNLQSENTAPSETS (SEQ ID NO: 76) | |
| 16 | 583ADNLQQQNTAPQIGT597 (SEQ ID NO: 69) -- |
| >SDNLQSCNTAPFAGA (SEQ ID NO: 77) | |
| 18 | 583ADNLQQQNTAPQIGT597 (SEQ ID NO: 69) -- |
| >GDNLQLYNTAPGSVF (SEQ ID NO: 70) | |
Additional mutations were made at the HVR.1 and HVR.IV regions. Thus, in one embodiment, the AAV capsid has a mutation in aa263 to aa267. In one embodiment, the AAV capsid has the mutation 263NGTSG267 (SEQ ID NO: 78)->SGTH (SEQ ID NO: 79). In another embodiment, the AAV capsid has the mutation 263NGTSG267 (SEQ ID NO: 78)->SDTH (SEQ ID NO: 80). Encompassed herein are capsid proteins and rAAV having capsid proteins having vp1, vp2 and/or vp3 sequences which include one of the amino acid sequences of SEQ ID NO: 79 or SEQ ID NO 80.
In one embodiment, the AAV capsid has a mutation in aa457 to aa459. In another embodiment, the AAV capsid has a mutation in aa455 to aa459. In one embodiment, the AAV capsid has the mutation 457TAN459->SRP. In one embodiment, the AAV capsid has the mutation 455GGTAN459 (SEQ ID NO: 81)->DGSGL (SEQ ID NO: 82). Encompassed herein are capsid proteins and rAAV having capsid proteins having vp1, vp2 and/or vp3 sequences which include one of the amino acid sequences of SEQ ID NO: 79 or SEQ ID NO 80.
In another embodiment, the vp1/vp2 unique regions of the AAV8 capsid (or other AAV capsid described herein) can be replaced with the vp1/vp2 regions from a different capsid. In one embodiment, the vp1/vp2 unique regions are replaced with the vp1/vp2 unique region of rh.20. In AAV8, the vp2 starts at amino acid 138, and the vp3 starts at amino acid 204, using AAV8 vp1 numbering. Thus, in one embodiment, the vp1/2 region of AAV8 (amino acids 1 to 203) is swapped for the corresponding portion (vp1/2) of another capsid. The vp1/2 regions in the swapped capsids may be of the same or different amino acid lengths. For example, in AAVrh.20, the vp1/2 region spans amino acids 1 to 202 of that sequence (SEQ ID NO: 88). See, Limberis et al, Mol Ther. 2009 February; 17(2): 294-301 (which is incorporated herein by reference). In another embodiment, the vp1/vp2 unique regions are replaced the vp1/vp2 unique region of AAV1, 6, 9, rh.8, rh.10, rh.20, hu.37, rh.2R, rh.43, rh.46, rh.64R1, hu.48R3, or cy.5R4. The vp1/2 regions can be readily determined based on alignments available in the art. See, e.g., WO 2006/110689, which is incorporated herein by reference.
The AAV capsid vp1 ORF includes a second ORF, which encodes the AAV assembly-activating protein (AAP). The AAP coding sequence of ORF2 initiates prior to the VP3 coding sequence. The AAV8 AAP native coding sequence is shown in SEQ ID NO: 35. The native AAP amino acid sequence is shown in SEQ ID NO: 36. In one embodiment, the AAV VP1 ORF is mutated to result in an alternative AAP amino acid sequence. Thus, in one embodiment, the AAV vp1 nucleic acid sequence shares at least 95% identity with the native AAV8 coding sequence. In another embodiment, the AAV vp1 nucleic acid sequence includes the ORF2 (AAP coding sequence) shown in SEQ ID NO: 37. In another embodiment, the AAV AAP amino acid sequence is shown in SEQ ID NO: 38. See, Sonntag et al, A viral assembly factor promotes AAV2 capsid formation in the nucleolus, Proc Natl Acad Sci USA. 2010 Jun. 1; 107(22): 10220-10225, which is incorporated herein by reference.
As shown in the examples below, the inventors have shown that the AAV termed AAV3G1 (also sometimes called AAV8.Triple or Triple) effectively transduces liver, muscle and airway epithelium. In fact, AAV3G1 shows about a 10 fold increase in transduction as compared to native AAV8, both i.m. and i.v., with various transgene cassettes such as CB7.CI.ffluciferase, CMV.LacZ and tMCK.human F9. A further recognized benefit of the AAV3G1 mutant is that it shows resistance to various antisera of monkey and human, as well as human IVIG (at levels 2 to 4 fold that of AAV8, with respect to human IVIG). Further, intranasal administration of AAV3G1 resulted in a transduction efficiency of airway epithelium 2 to 3 fold greater than that of AAV8. Thus, in one embodiment, the AAV capsid has a sequence of AAV3G1, as shown in SEQ ID NO: 18.
As shown in the examples below, the AAV termed AAV8.T20 transduces airway epithelium at levels approximately 10 fold greater than AAV8. Thus, in one embodiment, the AAV capsid has a sequence of AAV8.T20, as shown in SEQ ID NO: 20.
As shown in the examples below, the AAV termed AAV8.TR1 effectively transduces liver. Thus, in one embodiment, the AAV capsid has a sequence of AAV8.TR1, as shown in SEQ ID NO: 22.
In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 2. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 4. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 6. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 8. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 10. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 12. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 14. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 16. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 18. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 20. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 22. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 24. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 26. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 28. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 30. In another embodiment, an AAV capsid is provided which has the sequence shown in SEQ ID NO: 32. In another embodiment, the AAV capsid has a vp1, vp2 or vp3 protein as shown in any of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 (which show the vp1 sequences).
In another aspect, nucleic acid sequences encoding the AAV viruses, capsids and fragments described herein are provided. Thus, in one embodiment, a nucleic acid encoding SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 is provided. In one embodiment, a nucleic acid encoding the AAV3G1 capsid (SEQ ID NO: 18) is provided. In another embodiment, a nucleic acid encoding the AAV8.T20 capsid (SEQ ID NO: 20) is provided. In another embodiment, a nucleic acid encoding the AAV8.TR1 capsid (SEQ ID NO: 22) is provided. In one embodiment, the nucleic acid sequence encoding AAV3G1 is shown in SEQ ID NO: 17. In one embodiment, the nucleic acid sequence encoding AAV8.T20 is shown in SEQ ID NO: 19. In one embodiment, the nucleic acid sequence encoding AAV8.TR1 is shown in SEQ ID NO: 21. In another embodiment, the nucleic acid sequence encoding the capsid is shown in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 or 31, or a sequence sharing at least 80% identity with any of these sequences. In another embodiment, the nucleic acid molecular also encodes a functional AAV rep protein.
In another aspect, described herein are molecules which utilize the AAV capsid sequences described herein, including fragments thereof, for production of viral vectors useful in delivery of a heterologous gene or other nucleic acid sequences to a target cell. In one embodiment, the vectors useful in compositions and methods described herein contain, at a minimum, sequences encoding a selected AAV capsid as described herein, e.g., an AAV3G1, AAV8.T20 or AAV.TR1 capsid, or a fragment thereof. In another embodiment, useful vectors contain, at a minimum, sequences encoding a selected AAV serotype rep protein, e.g., AAV8 rep protein, or a fragment thereof. Optionally, such vectors may contain both AAV cap and rep proteins. In vectors in which both AAV rep and cap are provided, the AAV rep and AAV cap sequences can both be of one serotype origin, e.g., all AAV8 origin. Alternatively, vectors may be used in which the rep sequences are from an AAV which differs from the wild type AAV providing the cap sequences. In one embodiment, the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector). In another embodiment, these rep sequences are fused in frame to cap sequences of a different AAV serotype to form a chimeric AAV vector, such as AAV2/8 described in U.S. Pat. No. 7,282,199, which is incorporated by reference herein. Optionally, the vectors further contain a minigene comprising a selected transgene which is flanked by AAV 5′ ITR and AAV 3′ ITR. In another embodiment, the AAV is a self-complementary AAV (sc-AAV) (See, US 2012/0141422 which is incorporated herein by reference). Self-complementary vectors package an inverted repeat genome that can fold into dsDNA without the requirement for DNA synthesis or base-pairing between multiple vector genomes. Because scAAV have no need to convert the single-stranded DNA (ssDNA) genome into double-stranded DNA (dsDNA) prior to expression, they are more efficient vectors. However, the trade-off for this efficiency is the loss of half the coding capacity of the vector, ScAAV are useful for small protein-coding genes (up to ˜55 kd) and any currently available RNA-based therapy.
In one aspect, the vectors described herein contain nucleic acid sequences encoding an intact AAV capsid as described herein. In one embodiment, the capsid comprises amino acids 1 to 738 of SEQ ID NO: 18, 20 or 22. In another embodiment, the AAV has a recombinant AAV capsid comprising a mutation in at least one of the following regions, as compared to native AAV8 (SEQ ID NO: 34): i. aa 263 to 267 (SEQ ID NO: 78); ii. aa 457 to aa 459; iii. aa 455 to aa 459 (SEQ ID NO: 81); or iv. aa 583 to aa 597 (SEQ ID NO: 69). In one embodiment, the AAV has increased transduction in a target tissue as compared to AAV8. In one embodiment, the AAV has a mutation which comprises 263NGTSG267 (SEQ ID NO: 78)->SGTH (SEQ ID NO: 79) or 263NGTSG267 (SEQ ID NO: 78)->SDTH (SEQ ID NO: 80). In another embodiment, the AAV has a mutation which comprises 457TAN459->SRP or 455GGTAN459 (SEQ ID NO: 81)->DGSGL (SEQ ID NO: 82). In yet another embodiment, the AAV has a mutation which comprises 583ADNLQQQNTAPQIGT597 (SEQ ID NO: 69)->GDNLQLYNTAPGSVF (SEQ ID NO: 70). In another embodiment, the AAV has the following mutations: 263NGTSG267 (SEQ ID NO: 78)->SGTH (SEQ ID NO: 79), 457TAN459->SRP, and 583ADNLQQQNTAPQIGT597 (SEQ ID NO: 69)->GDNLQLYNTAPGSVF (SEQ ID NO: 70).
In another embodiment, the AAV has a capsid protein in which the VP1/VP2 unique regions have been replaced with the VP1/VP2 unique regions from a capsid different than AAV8. In one embodiment, the VP1/VP2 unique regions are from AAVrh.20. In one embodiment, the rh.20 vp1 sequence is SEQ ID NO: 88.
Pseudotyped vectors, wherein the capsid of one AAV is replaced with a heterologous capsid protein, are useful herein. For illustrative purposes, AAV vectors utilizing the AAV8 mutant capsids described herein, with AAV2 ITRs are used in the examples described below. See, Mussolino et al, cited above. Unless otherwise specified, the AAV ITRs, and other selected AAV components described herein, may be individually selected from among any AAV serotype, including, without limitation, AAV1, AAV2, AAV3, AAV4, AAVS, AAV6, AAV7, AAV8, AAV9 or other known and unknown AAV serotypes. In one desirable embodiment, the ITRs of AAV serotype 2 are used. However, ITRs from other suitable serotypes may be selected. These ITRs or other AAV components may be readily isolated using techniques available to those of skill in the art from an AAV serotype. Such AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, Va.). Alternatively, the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like. In one embodiment, the AAV comprises the sequence of SEQ ID NO: 17, which corresponds to the full length DNA coding sequence of AAV3G1. In another embodiment, the AAV comprises the sequence of SEQ ID NO: 19, which corresponds to the full length DNA sequence of AAV8.T20. In another embodiment, the AAV comprises the sequence of SEQ ID NO: 21, which corresponds to the full length DNA sequence of AAV8.TR1.
The rAAV described herein also comprise a minigene. The minigene is composed of, at a minimum, a heterologous nucleic acid sequence (the transgene), as described below, and its regulatory sequences, and 5′ and 3′ AAV inverted terminal repeats (ITRs). It is this minigene which is packaged into a capsid protein and delivered to a selected target cell.
The transgene is a nucleic acid sequence, heterologous to the vector sequences flanking the transgene, which encodes a polypeptide, protein, or other product, of interest. The nucleic acid coding sequence is operatively linked to regulatory components in a manner which permits transgene transcription, translation, and/or expression in a target cell. The heterologous nucleic acid sequence (transgene) can be derived from any organism. The AAV may comprise one or more transgenes.
The composition of the transgene sequence will depend upon the use to which the resulting vector will be put. For example, one type of transgene sequence includes a reporter sequence, which upon expression produces a detectable signal. Such reporter sequences include, without limitation, DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), enhanced GFP (EGFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane bound proteins including, for example, CD2, CD4, CD8, the influenza hemagglutinin protein, and others well known in the art, to which high affinity antibodies directed thereto exist or can be produced by conventional means, and fusion proteins comprising a membrane bound protein appropriately fused to an antigen tag domain from, among others, hemagglutinin or Myc.
These coding sequences, when associated with regulatory elements which drive their expression, provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectrographic assays, fluorescent activating cell sorting assays and immunological assays, including enzyme linked immunosorbent assay (ELISA), radioimmunoassay (MA) and immunohistochemistry. For example, where the marker sequence is the LacZ gene, the presence of the vector carrying the signal is detected by assays for beta-galactosidase activity. Where the transgene is green fluorescent protein or luciferase, the vector carrying the signal may be measured visually by color or light production in a luminometer.
However, desirably, the transgene is a non-marker sequence encoding a product which is useful in biology and medicine, such as proteins, peptides, RNA, enzymes, dominant negative mutants, or catalytic RNAs. Desirable RNA molecules include tRNA, dsRNA, ribosomal RNA, catalytic RNAs, siRNA, small hairpin RNA, trans-splicing RNA, and antisense RNAs. One example of a useful RNA sequence is a sequence which inhibits or extinguishes expression of a targeted nucleic acid sequence in the treated animal. Typically, suitable target sequences include oncologic targets and viral diseases. See, for examples of such targets the oncologic targets and viruses identified below in the section relating to immunogens.
The transgene may be used to correct or ameliorate gene deficiencies, which may include deficiencies in which normal genes are expressed at less than normal levels or deficiencies in which the functional gene product is not expressed. Alternatively, the transgene may provide a product to a cell which is not natively expressed in the cell type or in the host. A preferred type of transgene sequence encodes a therapeutic protein or polypeptide which is expressed in a host cell. The invention further includes using multiple transgenes. In certain situations, a different transgene may be used to encode each subunit of a protein, or to encode different peptides or proteins. This is desirable when the size of the DNA encoding the protein subunit is large, e.g., for an immunoglobulin, the platelet-derived growth factor, or a dystrophin protein. In order for the cell to produce the multi-subunit protein, a cell is infected with the recombinant virus containing each of the different subunits. Alternatively, different subunits of a protein may be encoded by the same transgene. In this case, a single transgene includes the DNA encoding each of the subunits, with the DNA for each subunit separated by an internal ribozyme entry site (IRES). This is desirable when the size of the DNA encoding each of the subunits is small, e.g., the total size of the DNA encoding the subunits and the IRES is less than five kilobases. As an alternative to an IRES, the DNA may be separated by sequences encoding a 2A peptide, which self-cleaves in a post-translational event. See, e.g., M. L. Donnelly, et al, J. Gen. Virol., 78(Pt 1):13-21 (January 1997); Furler, S., et al, Gene Ther., 8(11):864-873 (June 2001); Klump H., et al., Gene Ther., 8(10):811-817 (May 2001). This 2A peptide is significantly smaller than an IRES, making it well suited for use when space is a limiting factor. More often, when the transgene is large, consists of multi-subunits, or two transgenes are co-delivered, rAAV carrying the desired transgene(s) or subunits are co-administered to allow them to concatamerize in vivo to form a single vector genome. In such an embodiment, a first AAV may carry an expression cassette which expresses a single transgene and a second AAV may carry an expression cassette which expresses a different transgene for co-expression in the host cell. However, the selected transgene may encode any biologically active product or other product, e.g., a product desirable for study.
Useful therapeutic products encoded by the transgene include hormones and growth and differentiation factors including, without limitation, insulin, glucagon, growth hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GRF), follicle stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angiopoietins, angiostatin, granulocyte colony stimulating factor (GCSF), erythropoietin (EPO), connective tissue growth factor (CTGF), basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), transforming growth factor α (TGFα), platelet-derived growth factor (PDGF), insulin growth factors I and II (IGF-I and IGF-II), any one of the transforming growth factor β superfamily, including TGF β, activins, inhibins, or any of the bone morphogenic proteins (BMP) BMPs 1-15, any one of the heregluin/neuregulin/ARIA/neu differentiation factor (NDF) family of growth factors, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins NT-3 and NT-4/5, ciliary neurotrophic factor (CNTF), glial cell line derived neurotrophic factor (GDNF), neurturin, agrin, any one of the family of semaphorins/collapsins, netrin-1 and netrin-2, hepatocyte growth factor (HGF), ephrins, noggin, sonic hedgehog and tyrosine hydroxylase.
Other useful transgene products include proteins that regulate the immune system including, without limitation, cytokines and lymphokines such as thrombopoietin (TPO), interleukins (IL) IL-1 through IL-25 (including, IL-2, IL-4, IL-12, and IL-18), monocyte chemoattractant protein, leukemia inhibitory factor, granulocyte-macrophage colony stimulating factor, Fas ligand, tumor necrosis factors α and β, interferons α, β, and γ, stem cell factor, flk-2/flt3 ligand. Gene products produced by the immune system are also useful in the invention. These include, without limitations, immunoglobulins IgG, IgM, IgA, IgD and IgE, chimeric immunoglobulins, humanized antibodies, single chain antibodies, T cell receptors, chimeric T cell receptors, single chain T cell receptors, class I and class II MHC molecules, as well as engineered immunoglobulins and MHC molecules. Useful gene products also include complement regulatory proteins such as complement regulatory proteins, membrane cofactor protein (MCP), decay accelerating factor (DAF), CR1, CF2 and CD59.
Still other useful gene products include any one of the receptors for the hormones, growth factors, cytokines, lymphokines, regulatory proteins and immune system proteins. The invention encompasses receptors for cholesterol regulation, including the low density lipoprotein (LDL) receptor, high density lipoprotein (HDL) receptor, the very low density lipoprotein (VLDL) receptor, and the scavenger receptor. The invention also encompasses gene products such as members of the steroid hormone receptor superfamily including glucocorticoid receptors and estrogen receptors, Vitamin D receptors and other nuclear receptors. In addition, useful gene products include transcription factors such as jun, fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD and myogenin, ETS-box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, HNF-4, C/EBP, SP1, CCAAT-box binding proteins, interferon regulation factor (IRF-1), Wilms tumor protein, ETS-binding protein, STAT, GATA-box binding proteins, e.g., GATA-3, and the forkhead family of winged helix proteins.
Other useful gene products include, carbamoyl synthetase I, ornithine transcarbamylase, arginosuccinate synthetase, arginosuccinate lyase, arginase, fumarylacetacetate hydrolase, phenylalanine hydroxylase, alpha-1 antitrypsin, glucose-6-phosphatase, porphobilinogen deaminase, factor VIII, factor IX, cystathione beta-synthase, branched chain ketoacid decarboxylase, albumin, isovaleryl-coA dehydrogenase, propionyl CoA carboxylase, methyl malonyl CoA mutase, glutaryl CoA dehydrogenase, insulin, beta-glucosidase, pyruvate carboxylate, hepatic phosphorylase, phosphorylase kinase, glycine decarboxylase, H-protein, T-protein, a cystic fibrosis transmembrane regulator (CFTR) sequence, and a dystrophin cDNA sequence. Still other useful gene products include enzymes such as may be useful in enzyme replacement therapy, which is useful in a variety of conditions resulting from deficient activity of enzyme. For example, enzymes that contain mannose-6-phosphate may be utilized in therapies for lysosomal storage diseases (e.g., a suitable gene includes that encodes β-glucuronidase (GUSB)).
Other useful gene products include non-naturally occurring polypeptides, such as chimeric or hybrid polypeptides having a non-naturally occurring amino acid sequence containing insertions, deletions or amino acid substitutions. For example, single-chain engineered immunoglobulins could be useful in certain immunocompromised patients. Other types of non-naturally occurring gene sequences include antisense molecules and catalytic nucleic acids, such as ribozymes, which could be used to reduce overexpression of a target.
Reduction and/or modulation of expression of a gene is particularly desirable for treatment of hyperproliferative conditions characterized by hyperproliferating cells, as are cancers and psoriasis. Target polypeptides include those polypeptides which are produced exclusively or at higher levels in hyperproliferative cells as compared to normal cells. Target antigens include polypeptides encoded by oncogenes such as myb, myc, fyn, and the translocation gene bcr/abl, ras, src, P53, neu, trk and EGRF. In addition to oncogene products as target antigens, target polypeptides for anti-cancer treatments and protective regimens include variable regions of antibodies made by B cell lymphomas and variable regions of T cell receptors of T cell lymphomas which, in some embodiments, are also used as target antigens for autoimmune disease. Other tumor-associated polypeptides can be used as target polypeptides such as polypeptides which are found at higher levels in tumor cells including the polypeptide recognized by monoclonal antibody 17-1A and folate binding polypeptides.
Other suitable therapeutic polypeptides and proteins include those which may be useful for treating individuals suffering from autoimmune diseases and disorders by conferring a broad based protective immune response against targets that are associated with autoimmunity including cell receptors and cells which produce self-directed antibodies. T cell mediated autoimmune diseases include Rheumatoid arthritis (RA), multiple sclerosis (MS), Sjögren's syndrome, sarcoidosis, insulin dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative colitis. Each of these diseases is characterized by T cell receptors (TCRs) that bind to endogenous antigens and initiate the inflammatory cascade associated with autoimmune diseases.
Alternatively, or in addition, the vectors of the invention may contain AAV sequences of the invention and a transgene encoding a peptide, polypeptide or protein which induces an immune response to a selected immunogen. For example, immunogens may be selected from a variety of viral families. Example of desirable viral families against which an immune response would be desirable include, the picornavirus family, which includes the genera rhinoviruses, which are responsible for about 50% of cases of the common cold; the genera enteroviruses, which include polioviruses, coxsackieviruses, echoviruses, and human enteroviruses such as hepatitis A virus; and the genera apthoviruses, which are responsible for foot and mouth diseases, primarily in non-human animals. Within the picornavirus family of viruses, target antigens include the VP1, VP2, VP3, VP4, and VPG. Another viral family includes the calcivirus family, which encompasses the Norwalk group of viruses, which are an important causative agent of epidemic gastroenteritis. Still another viral family desirable for use in targeting antigens for inducing immune responses in humans and non-human animals is the togavirus family, which includes the genera alphavirus, which include Sindbis viruses, RossRiver virus, and Venezuelan, Eastern & Western Equine encephalitis, and rubivirus, including Rubella virus. The flaviviridae family includes dengue, yellow fever, Japanese encephalitis, St. Louis encephalitis and tick borne encephalitis viruses. Other target antigens may be generated from the Hepatitis C or the coronavirus family, which includes a number of non-human viruses such as infectious bronchitis virus (poultry), porcine transmissible gastroenteric virus (pig), porcine hemagglutinating encephalomyelitis virus (pig), feline infectious peritonitis virus (cats), feline enteric coronavirus (cat), canine coronavirus (dog), and human respiratory coronaviruses, which may cause the common cold and/or non-A, B or C hepatitis. Within the coronavirus family, target antigens include the E1 (also called M or matrix protein), E2 (also called S or Spike protein), E3 (also called HE or hemagglutin-elterose) glycoprotein (not present in all coronaviruses), or N (nucleocapsid). Still other antigens may be targeted against the rhabdovirus family, which includes the genera vesiculovirus (e.g., Vesicular Stomatitis Virus), and the general lyssavirus (e.g., rabies). Within the rhabdovirus family, suitable antigens may be derived from the G protein or the N protein. The family filoviridae, which includes hemorrhagic fever viruses such as Marburg and Ebola virus may be a suitable source of antigens. The paramyxovirus family includes parainfluenza Virus Type 1, parainfluenza Virus Type 3, bovine parainfluenza Virus Type 3, rubulavirus (mumps virus, parainfluenza Virus Type 2, parainfluenza virus Type 4, Newcastle disease virus (chickens), rinderpest, morbillivirus, which includes measles and canine distemper, and pneumovirus, which includes respiratory syncytial virus. The influenza virus is classified within the family orthomyxovirus and is a suitable source of antigen (e.g., the HA protein, the N1 protein). The bunyavirus family includes the genera bunyavirus (California encephalitis, La Crosse), phlebovirus (Rift Valley Fever), hantavirus (puremala is a hemahagin fever virus), nairovirus (Nairobi sheep disease) and various unassigned bungaviruses. The arenavirus family provides a source of antigens against LCM and Lassa fever virus. The reovirus family includes the genera reovirus, rotavirus (which causes acute gastroenteritis in children), orbiviruses, and cultivirus (Colorado Tick fever, Lebombo (humans), equine encephalosis, blue tongue).
The retrovirus family includes the sub-family oncorivirinal which encompasses such human and veterinary diseases as feline leukemia virus, HTLVI and HTLVII, lentivirinal (which includes human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine infectious anemia virus, and spumavirinal). Between the HIV and SIV, many suitable antigens have been described and can readily be selected. Examples of suitable HIV and SIV antigens include, without limitation the gag, pol, Vif, Vpx, VPR, Env, Tat and Rev proteins, as well as various fragments thereof. In addition, a variety of modifications to these antigens have been described. Suitable antigens for this purpose are known to those of skill in the art. For example, one may select a sequence encoding the gag, pol, Vif, and Vpr, Env, Tat and Rev, amongst other proteins. See, e.g., the modified gag protein which is described in U.S. Pat. No. 5,972,596. See, also, the HIV and SIV proteins described in D. H. Barouch et al, J. Virol., 75(5):2462-2467 (March 2001), and R. R. Amara, et al, Science, 292:69-74 (6 Apr. 2001). These proteins or subunits thereof may be delivered alone, or in combination via separate vectors or from a single vector.
The papovavirus family includes the sub-family polyomaviruses (BKU and JCU viruses) and the sub-family papillomavirus (associated with cancers or malignant progression of papilloma). The adenovirus family includes viruses (EX, AD7, ARD, O.B.) which cause respiratory disease and/or enteritis. The parvovirus family feline parvovirus (feline enteritis), feline panleucopeniavirus, canine parvovirus, and porcine parvovirus. The herpesvirus family includes the sub-family alphaherpesvirinae, which encompasses the genera simplexvirus (HSVI, HSVII), varicellovirus (pseudorabies, varicella zoster) and the sub-family betaherpesvirinae, which includes the genera cytomegalovirus (HCMV, muromegalovirus) and the sub-family gammaherpesvirinae, which includes the genera lymphocryptovirus, EBV (Burkitts lymphoma), infectious rhinotracheitis, Marek's disease virus, and rhadinovirus. The poxvirus family includes the sub-family chordopoxvirinae, which encompasses the genera orthopoxvirus (Variola (Smallpox) and Vaccinia (Cowpox)), parapoxvirus, avipoxvirus, capripoxvirus, leporipoxvirus, suipoxvirus, and the sub-family entomopoxvirinae. The hepadnavirus family includes the Hepatitis B virus. One unclassified virus which may be suitable source of antigens is the Hepatitis delta virus. Still other viral sources may include avian infectious bursal disease virus and porcine respiratory and reproductive syndrome virus. The alphavirus family includes equine arteritis virus and various Encephalitis viruses.
The present invention may also encompass immunogens which are useful to immunize a human or non-human animal against other pathogens including bacteria, fungi, parasitic microorganisms or multicellular parasites which infect human and non-human vertebrates, or from a cancer cell or tumor cell. Examples of bacterial pathogens include pathogenic gram-positive cocci include pneumococci; staphylococci; and streptococci. Pathogenic gram-negative cocci include meningococcus; gonococcus. Pathogenic enteric gram-negative bacilli include enterobacteriaceae; pseudomonas, acinetobacteria and eikenella; melioidosis; salmonella; shigella; haemophilus; moraxella; H. ducreyi (which causes chancroid); Brucella; Franisella tularensis (which causes tularemia); Yersinia (pasteurella); streptobacillus moniliformis and spirillum; Gram-positive bacilli include Listeria monocytogenes; erysipelothrix rhusiopathiae; Corynebacterium diphtheria (diphtheria); cholera; B. anthracis (anthrax); donovanosis (granuloma inguinale); and bartonellosis. Diseases caused by pathogenic anaerobic bacteria include tetanus; botulism; other clostridia; tuberculosis; leprosy; and other mycobacteria. Pathogenic spirochetal diseases include syphilis; treponematoses: yaws, pinta and endemic syphilis; and leptospirosis. Other infections caused by higher pathogen bacteria and pathogenic fungi include actinomycosis; nocardiosis; cryptococcosis, blastomycosis, histoplasmosis and coccidioidomycosis; candidiasis, aspergillosis, and mucormycosis; sporotrichosis; paracoccidiodomycosis, petriellidiosis, torulopsosis, mycetoma and chromomycosis; and dermatophytosis. Rickettsial infections include Typhus fever, Rocky Mountain spotted fever, Q fever, and Rickettsialpox. Examples of mycoplasma and chlamydial infections include: Mycoplasma pneumoniae; lymphogranuloma venereum; psittacosis; and perinatal chlamydial infections. Pathogenic eukaryotes encompass pathogenic protozoans and helminths and infections produced thereby include: amebiasis; malaria; leishmaniasis; trypanosomiasis; toxoplasmosis; Pneumocystis carinii; Trichans; Toxoplasma gondii; babesiosis; giardiasis; trichinosis; filariasis; schistosomiasis; nematodes; trematodes or flukes; and cestode (tapeworm) infections.
Many of these organisms and/or toxins produced thereby have been identified by the Centers for Disease Control [(CDC), Department of Health and Human Services, USA], as agents which have potential for use in biological attacks. For example, some of these biological agents, include, Bacillus anthracis (anthrax), Clostridium botulinum and its toxin (botulism), Yersinia pestis (plague), variola major (smallpox), Francisella tularensis (tularemia), and viral hemorrhagic fever, all of which are currently classified as Category A agents; Coxiella burnetti (Q fever); Brucella species (brucellosis), Burkholderia mallei (glanders), Ricinus communis and its toxin (ricin toxin), Clostridium perfringens and its toxin (epsilon toxin), Staphylococcus species and their toxins (enterotoxin B), all of which are currently classified as Category B agents; and Nipan virus and hantaviruses, which are currently classified as Category C agents. In addition, other organisms, which are so classified or differently classified, may be identified and/or used for such a purpose in the future. It will be readily understood that the viral vectors and other constructs described herein are useful to deliver antigens from these organisms, viruses, their toxins or other by-products, which will prevent and/or treat infection or other adverse reactions with these biological agents.
Administration of the vectors of the invention to deliver immunogens against the variable region of the T cells elicit an immune response including CTLs to eliminate those T cells. In rheumatoid arthritis (RA), several specific variable regions of T cell receptors (TCRs) which are involved in the disease have been characterized. These TCRs include V-3, V-14, V-17 and Vα-17. Thus, delivery of a nucleic acid sequence that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in RA. In multiple sclerosis (MS), several specific variable regions of TCRs which are involved in the disease have been characterized. These TCRs include V-7 and Vα-10. Thus, delivery of a nucleic acid sequence that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in MS. In scleroderma, several specific variable regions of TCRs which are involved in the disease have been characterized. These TCRs include V-6, V-8, V-14 and Vα-16, Vα-3C, Vα-7, Vα-14, Vα-15, Vα-16, Vα-28 and Vα-12. Thus, delivery of a nucleic acid molecule that encodes at least one of these polypeptides will elicit an immune response that will target T cells involved in scleroderma.
In one desirable embodiment, the transgene is selected to provide optogenetic therapy. In optogenetic therapy, artificial photoreceptors are constructed by gene delivery of light-activated channels or pumps to surviving cell types in the remaining retinal circuit. This is particularly useful for patients who have lost a significant amount of photoreceptor function, but whose bipolar cell circuitry to ganglion cells and optic nerve remains intact. In one embodiment, the heterologous nucleic acid sequence (transgene) is an opsin. The opsin sequence can be derived from any suitable single- or multicellular-organism, including human, algae and bacteria. In one embodiment, the opsin is rhodopsin, photopsin, L/M wavelength (red/green)-opsin, or short wavelength (S) opsin (blue). In another embodiment, the opsin is channelrhodopsin or halorhodopsin.
In another embodiment, the transgene is selected for use in gene augmentation therapy, i.e., to provide replacement copy of a gene that is missing or defective. In this embodiment, the transgene may be readily selected by one of skill in the art to provide the necessary replacement gene. In one embodiment, the missing/defective gene is related to an ocular disorder. In another embodiment, the transgene is NYX, GRM6, TRPM1L or GPR179 and the ocular disorder is Congenital Stationary Night Blindness. See, e.g., Zeitz et al, Am J Hum Genet. 2013 Jan. 10; 92(1):67-75. Epub 2012 Dec. 13 which is incorporated herein by reference. In another embodiment, the transgene is RPGR.
In another embodiment, the transgene is selected for use in gene suppression therapy, i.e., expression of one or more native genes is interrupted or suppressed at transcriptional or translational levels. This can be accomplished using short hairpin RNA (shRNA) or other techniques well known in the art. See, e.g., Sun et al, Int J Cancer. 2010 Feb. 1; 126(3):764-74 and O'Reilly M, et al. Am J Hum Genet. 2007 July; 81(1):127-35, which are incorporated herein by reference. In this embodiment, the transgene may be readily selected by one of skill in the art based upon the gene which is desired to be silenced.
In another embodiment, the transgene comprises more than one transgene. This may be accomplished using a single vector carrying two or more heterologous sequences, or using two or more AAV each carrying one or more heterologous sequences. In one embodiment, the AAV is used for gene suppression (or knockdown) and gene augmentation co-therapy. In knockdown/augmentation co-therapy, the defective copy of the gene of interest is silenced and a non-mutated copy is supplied. In one embodiment, this is accomplished using two or more co-administered vectors. See, Millington-Ward et al, Molecular Therapy, April 2011, 19(4):642-649 which is incorporated herein by reference. The transgenes may be readily selected by one of skill in the art based on the desired result.
In another embodiment, the transgene is selected for use in gene correction therapy. This may be accomplished using, e.g., a zinc-finger nuclease (ZFN)-induced DNA double-strand break in conjunction with an exogenous DNA donor substrate. See, e.g., Ellis et al, Gene Therapy (epub January 2012) 20:35-42 which is incorporated herein by reference. The transgenes may be readily selected by one of skill in the art based on the desired result.
In one embodiment, the capsids described herein are useful in the CRISPR-Cas dual vector system described in U.S. Provisional Patent Application Nos. 61/153,470, 62/183,825, 62/254,225 and 62/287,511, each of which is incorporated herein by reference. The capsids are also useful for delivery homing endonucleases or other meganucleases.
In another embodiment, the transgenes useful herein include reporter sequences, which upon expression produce a detectable signal. Such reporter sequences include, without limitation, DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), red fluorescent protein (RFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane bound proteins including, for example, CD2, CD4, CD8, the influenza hemagglutinin protein, and others well known in the art, to which high affinity antibodies directed thereto exist or can be produced by conventional means, and fusion proteins comprising a membrane bound protein appropriately fused to an antigen tag domain from, among others, hemagglutinin or Myc.
These coding sequences, when associated with regulatory elements which drive their expression, provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectrographic assays, fluorescent activating cell sorting assays and immunological assays, including enzyme linked immunosorbent assay (ELISA), radioimmunoassay (MA) and immunohistochemistry. For example, where the marker sequence is the LacZ gene, the presence of the vector carrying the signal is detected by assays for beta-galactosidase activity. Where the transgene is green fluorescent protein or luciferase, the vector carrying the signal may be measured visually by color or light production in a luminometer.
Desirably, the transgene encodes a product which is useful in biology and medicine, such as proteins, peptides, RNA, enzymes, or catalytic RNAs. Desirable RNA molecules include shRNA, tRNA, dsRNA, ribosomal RNA, catalytic RNAs, and antisense RNAs. One example of a useful RNA sequence is a sequence which extinguishes expression of a targeted nucleic acid sequence in the treated animal.
The regulatory sequences include conventional control elements which are operably linked to the transgene in a manner which permits its transcription, translation and/or expression in a cell transfected with the vector or infected with the virus produced as described herein. As used herein, “operably linked” sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A great number of expression control sequences, including promoters, are known in the art and may be utilized.
The regulatory sequences useful in the constructs provided herein may also contain an intron, desirably located between the promoter/enhancer sequence and the gene. One desirable intron sequence is derived from SV-40, and is a 100 bp mini-intron splice donor/splice acceptor referred to as SD-SA. Another suitable sequence includes the woodchuck hepatitis virus post-transcriptional element. (See, e.g., L. Wang and I. Verma, 1999 Proc. Natl. Acad. Sci., USA, 96:3906-3910). PolyA signals may be derived from many suitable species, including, without limitation SV-40, human and bovine.
Another regulatory component of the rAAV useful in the methods described herein is an internal ribosome entry site (IRES). An IRES sequence, or other suitable systems, may be used to produce more than one polypeptide from a single gene transcript. An IRES (or other suitable sequence) is used to produce a protein that contains more than one polypeptide chain or to express two different proteins from or within the same cell. An exemplary IRES is the poliovirus internal ribosome entry sequence, which supports transgene expression in photoreceptors, RPE and ganglion cells. Preferably, the IRES is located 3′ to the transgene in the rAAV vector.
In one embodiment, the AAV comprises a promoter (or a functional fragment of a promoter). The selection of the promoter to be employed in the rAAV may be made from among a wide number of constitutive or inducible promoters that can express the selected transgene in the desired target cell. In one embodiment, the target cell is an ocular cell. The promoter may be derived from any species, including human. Desirably, in one embodiment, the promoter is “cell specific”. The term “cell-specific” means that the particular promoter selected for the recombinant vector can direct expression of the selected transgene in a particular cell tissue. In one embodiment, the promoter is specific for expression of the transgene in muscle cells. In another embodiment, the promoter is specific for expression in lung. In another embodiment, the promoter is specific for expression of the transgene in liver cells. In another embodiment, the promoter is specific for expression of the transgene in airway epithelium. In another embodiment, the promoter is specific for expression of the transgene in neurons. In another embodiment, the promoter is specific for expression of the transgene in heart.
The expression cassette typically contains a promoter sequence as part of the expression control sequences, e.g., located between the selected 5′ ITR sequence and the immunoglobulin construct coding sequence. In one embodiment, expression in liver is desirable. Thus, in one embodiment, a liver-specific promoter is used. Tissue specific promoters, constitutive promoters, regulatable promoters [see, e.g., WO 2011/126808 and WO 2013/04943], or a promoter responsive to physiologic cues may be used may be utilized in the vectors described herein. In another embodiment, expression in muscle is desirable. Thus, in one embodiment, a muscle-specific promoter is used. In one embodiment, the promoter is an MCK based promoter, such as the dMCK (509-bp) or tMCK (720-bp) promoters (see, e.g., Wang et al, Gene Ther. 2008 November; 15(22):1489-99. doi: 10.1038/gt.2008.104. Epub 2008 Jun. 19, which is incorporated herein by reference). Another useful promoter is the SPc5-12 promoter (see Rasowo et al, European Scientific Journal June 2014 edition vol. 10, No. 18, which is incorporated herein by reference). In one embodiment, the promoter is a CMV promoter. In another embodiment, the promoter is a TBG promoter. In another embodiment, a CB7 promoter is used. CB7 is a chicken β-actin promoter with cytomegalovirus enhancer elements. Alternatively, other liver-specific promoters may be used [see, e.g., The Liver Specific Gene Promoter Database, Cold Spring Harbor, rulai.schl.edu/LSPD, alpha 1 anti-trypsin (A1AT); human albumin Miyatake et al., J. Virol., 71:5124 32 (1997), humAlb; and hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002 9 (1996)]. TTR minimal enhancer/promoter, alpha-antitrypsin promoter, LSP (845 nt) 25 (requires intron-less scAAV).
The promoter(s) can be selected from different sources, e.g., human cytomegalovirus (CMV) immediate-early enhancer/promoter, the SV40 early enhancer/promoter, the JC polymovirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoters, herpes simplex virus (HSV-1) latency associated promoter (LAP), rouse sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet derived growth factor (PDGF) promoter, hSYN, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and the chicken beta-actin promoter.
The expression cassette may contain at least one enhancer, i.e., CMV enhancer. Still other enhancer elements may include, e.g., an apolipoprotein enhancer, a zebrafish enhancer, a GFAP enhancer element, and brain specific enhancers such as described in WO 2013/1555222, woodchuck post hepatitis post-transcriptional regulatory element. Additionally, or alternatively, other, e.g., the hybrid human cytomegalovirus (HCMV)-immediate early (IE)-PDGR promoter or other promoter—enhancer elements may be selected. Other enhancer sequences useful herein include the IRBP enhancer (Nicoud 2007, J Gene Med. 2007 December; 9(12):1015-23), immediate early cytomegalovirus enhancer, one derived from an immunoglobulin gene or SV40 enhancer, the cis-acting element identified in the mouse proximal promoter, etc.
In addition to a promoter, an expression cassette and/or a vector may contain other appropriate transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A variety of suitable polyA are known. In one example, the polyA is rabbit beta globin, such as the 127 bp rabbit beta-globin polyadenylation signal (GenBank #V00882.1). In other embodiments, an SV40 polyA signal is selected. Still other suitable polyA sequences may be selected. In certain embodiments, an intron is included. One suitable intron is a chicken beta-actin intron. In one embodiment, the intron is 875 bp (GenBank #X00182.1). In another embodiment, a chimeric intron available from Promega is used. However, other suitable introns may be selected. In one embodiment, spacers are included such that the vector genome is approximately the same size as the native AAV vector genome (e.g., between 4.1 and 5.2 kb). In one embodiment, spacers are included such that the vector genome is approximately 4.7 kb. See, Wu et al, Effect of Genome Size on AAV Vector Packaging, Mol Ther. 2010 January; 18(1): 80-86, which is incorporated herein by reference.
Selection of these and other common vector and regulatory elements are conventional and many such sequences are available. See, e.g., Sambrook et al, and references cited therein at, for example, pages 3.18-3.26 and 16.17-16.27 and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989. Of course, not all vectors and expression control sequences will function equally well to express all of the transgenes as described herein. However, one of skill in the art may make a selection among these, and other, expression control sequences without departing from the scope of this invention.
In another embodiment, a method of generating a recombinant adeno-associated virus is provided. A suitable recombinant adeno-associated virus (AAV) is generated by culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid protein as described herein, or fragment thereof; a functional rep gene; a minigene composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a heterologous nucleic acid sequence encoding a desirable transgene; and sufficient helper functions to permit packaging of the minigene into the AAV capsid protein. The components required to be cultured in the host cell to package an AAV minigene in an AAV capsid may be provided to the host cell in trans. Alternatively, any one or more of the required components (e.g., minigene, rep sequences, cap sequences, and/or helper functions) may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art.
Also provided herein are host cells transfected with an AAV as described herein. Most suitably, such a stable host cell will contain the required component(s) under the control of an inducible promoter. However, the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein, in the discussion below of regulatory elements suitable for use with the transgene. In still another alternative, a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters. For example, a stable host cell may be generated which is derived from 293 cells (which contain E1 helper functions under the control of a constitutive promoter), but which contains the rep and/or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art. In another embodiment, the host cell comprises a nucleic acid molecule as described herein.
The minigene, rep sequences, cap sequences, and helper functions required for producing the rAAV described herein may be delivered to the packaging host cell in the form of any genetic element which transfers the sequences carried thereon. The selected genetic element may be delivered by any suitable method, including those described herein. The methods used to construct any embodiment of this invention are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g., K. Fisher et al, 1993 J. Virol., 70:520-532 and U.S. Pat. No. 5,478,745, among others. These publications are incorporated by reference herein.
Also provided herein, are plasmids for use in producing the vectors described herein. Such plasmids are described in the Examples section.
In one embodiment, the recombinant AAV containing the desired transgene and cell-specific promoter for use in the target cells as detailed above is optionally assessed for contamination by conventional methods and then formulated into a pharmaceutical composition intended for administration to a subject in need thereof. Such formulation involves the use of a pharmaceutically and/or physiologically acceptable vehicle or carrier, such as buffered saline or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels, and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier will typically be a liquid. Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free, phosphate buffered saline. A variety of such known carriers are provided in U.S. Pat. No. 7,629,322, incorporated herein by reference. In one embodiment, the carrier is an isotonic sodium chloride solution. In another embodiment, the carrier is balanced salt solution. In one embodiment, the carrier includes tween. If the virus is to be stored long-term, it may be frozen in the presence of glycerol or Tween20. In another embodiment, the pharmaceutically acceptable carrier comprises a surfactant, such as perfluorooctane (Perfluoron liquid). The vector is formulated in a buffer/carrier suitable for infusion in human subjects. The buffer/carrier should include a component that prevents the rAAV from sticking to the infusion tubing but does not interfere with the rAAV binding activity in vivo.
In certain embodiments of the methods described herein, the pharmaceutical composition described above is administered to the subject intramuscularly. In other embodiments, the pharmaceutical composition is administered by intravenously. Other forms of administration that may be useful in the methods described herein include, but are not limited to, direct delivery to a desired organ (e.g., the eye), including subretinal or intravitreal delivery, oral, inhalation, intranasal, intratracheal, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration. Routes of administration may be combined, if desired.
Furthermore, in certain embodiments it is desirable to perform certain examinations prior to vector administration to identify areas requiring cells to be targeted for therapy. In one embodiment, where delivery to the eye is desired, non-invasive retinal imaging and functional studies to identify areas of specific ocular cells to be targeted for therapy. See, e.g., WO 2014/124282, which is incorporated herein by reference. See also, International Patent Application No. PCT/US2013/022628 which is incorporated herein by reference.
The composition may be delivered in a volume of from about 0.1 μL to about 10 mL, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 70 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In yet another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 250 μL. In another embodiment, the volume is about 300 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 750 μL. In another embodiment, the volume is about 850 μL. In another embodiment, the volume is about 1000 μL. In another embodiment, the volume is about 1.5 mL. In another embodiment, the volume is about 2 mL. In another embodiment, the volume is about 2.5 mL. In another embodiment, the volume is about 3 mL. In another embodiment, the volume is about 3.5 mL. In another embodiment, the volume is about 4 mL. In another embodiment, the volume is about 5 mL. In another embodiment, the volume is about 5.5 mL. In another embodiment, the volume is about 6 mL. In another embodiment, the volume is about 6.5 mL. In another embodiment, the volume is about 7 mL. In another embodiment, the volume is about 8 mL. In another embodiment, the volume is about 8.5 mL. In another embodiment, the volume is about 9 mL. In another embodiment, the volume is about 9.5 mL. In another embodiment, the volume is about 10 mL.
An effective concentration of a recombinant adeno-associated virus carrying a nucleic acid sequence encoding the desired transgene under the control of the regulatory sequences desirably ranges from about 107 and 1014 vector genomes per milliliter (vg/mL) (also called genome copies/mL (GC/mL)). In one embodiment, the rAAV vector genomes are measured by real-time PCR. In another embodiment, the rAAV vector genomes are measured by digital PCR. See, Lock et al, Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR, Hum Gene Ther Methods. 2014 April; 25(2):115-25. doi: 10.1089/hgtb.2013.131. Epub 2014 Feb. 14, which are incorporated herein by reference. In another embodiment, the rAAV infectious units are measured as described in S.K. McLaughlin et al, 1988 J. Virol., 62:1963, which is incorporated herein by reference.
Preferably, the concentration is from about 1.5×109 vg/mL to about 1.5×1013 vg/mL, and more preferably from about 1.5×109 vg/mL to about 1.5×1011 vg/mL. In one embodiment, the effective concentration is about 1.4×108 vg/mL. In one embodiment, the effective concentration is about 3.5×1010 vg/mL. In another embodiment, the effective concentration is about 5.6×1011 vg/mL. In another embodiment, the effective concentration is about 5.3×1012 vg/mL. In yet another embodiment, the effective concentration is about 1.5×1012 vg/mL. In another embodiment, the effective concentration is about 1.5×1013 vg/mL. All ranges described herein are inclusive of the endpoints.
In one embodiment, the dosage is from about 1.5×109 vg/kg of body weight to about 1.5×1013 vg/kg, and more preferably from about 1.5×109 vg/kg to about 1.5×1011 vg/kg. In one embodiment, the dosage is about 1.4×108 vg/kg. In one embodiment, the dosage is about 3.5×1010 vg/kg. In another embodiment, the dosage is about 5.6×1011 vg/kg. In another embodiment, the dosage is about 5.3×1012 vg/kg. In yet another embodiment, the dosage is about 1.5×1012 vg/kg. In another embodiment, the dosage is about 1.5×1013 vg/kg. In another embodiment, the dosage is about 3.0×1013 vg/kg. In another embodiment, the dosage is about 1.0×1014 vg/kg. All ranges described herein are inclusive of the endpoints.
In one embodiment, the effective dosage (total genome copies delivered) is from about 107 to 1013 vector genomes. In one embodiment, the total dosage is about 108 genome copies. In one embodiment, the total dosage is about 109 genome copies. In one embodiment, the total dosage is about 1010 genome copies. In one embodiment, the total dosage is about 1011 genome copies. In one embodiment, the total dosage is about 1012 genome copies. In one embodiment, the total dosage is about 1013 genome copies. In one embodiment, the total dosage is about 1014 genome copies. In one embodiment, the total dosage is about 1015 genome copies.
It is desirable that the lowest effective concentration of virus be utilized in order to reduce the risk of undesirable effects, such as toxicity. Still other dosages and administration volumes in these ranges may be selected by the attending physician, taking into account the physical state of the subject, preferably human, being treated, the age of the subject, the particular disorder and the degree to which the disorder, if progressive, has developed. Intravenous delivery, for example may require doses on the order of 1.5×1013 vg/kg.
As discussed herein, the vectors comprising the AAV8 mutant capsids are capable of transducing target tissues at high levels. Thus, provided herein is a method of delivering a transgene to a liver cell. The method includes contacting the cell with an rAAV having the AAV3G1 capsid, wherein said rAAV comprises the transgene. In another embodiment, the method includes contacting the cell with an rAAV having the AAV8.TR1 capsid, wherein said rAAV comprises the transgene. In another embodiment, the method includes contacting the cell with an rAAV having any capsid described herein, wherein the rAAV comprises the transgene. In another aspect, the use of an rAAV having the AAV3G1 capsid is provided for delivering a transgene to liver. In another aspect, the use of an rAAV having the AAV8.TR1 capsid is provided for delivering a transgene to liver.
Also provided herein is a method of delivering a transgene to a muscle cell. The method includes contacting the cell with an rAAV having the AAV3G1 capsid, wherein said rAAV comprises the transgene. In another embodiment, the method includes contacting the cell with an rAAV having any capsid described herein, wherein the rAAV comprises the transgene. In another aspect, the use of an rAAV having the AAV3G1 capsid is provided for delivering a transgene to muscle.
Further, a method of delivering a transgene to the airway epithelium is provided. The method includes contacting the cell with an rAAV having the AAV3G1 capsid, wherein said rAAV comprises the transgene. In another embodiment, the method includes contacting the cell with an rAAV having the AAV8.T20 capsid, wherein said rAAV comprises the transgene. In another embodiment, the method includes contacting the cell with an rAAV having any capsid described herein, wherein the rAAV comprises the transgene. In another aspect, the use of an rAAV having the AAV3G1 capsid is provided for delivering a transgene to airway epithelium. In another aspect, the use of an rAAV having the AAV8.T20 capsid is provided for delivering a transgene to airway epithelium.
Further, a method of delivering a transgene to ocular cells is provided. The method includes contacting the cell with an rAAV having the AAV3G1 capsid, wherein said rAAV comprises the transgene. In another embodiment, the method includes contacting the cell with an rAAV having any capsid described herein, wherein the rAAV comprises the transgene. In another aspect, the use of an rAAV having the AAV3G1 capsid is provided for delivering a transgene to ocular cells.
As described in the examples below, in vitro, the AAV3G1 mutant showed resistance to various antisera of monkey and human, as well as human IVIG (at levels 2 to 4 fold that of AAV8, with respect to human IVIG). All three mutations contributed to the observed resistance. In mice, the liver transduction efficiency of AAV3G1 was reduced compared with AAV8, however its muscle transduction was higher than that of AAV8 by approximately 10 fold. In addition, AAV3G1 demonstrated a higher heparin affinity than AAV8. Interestingly, reducing the positive charges of the HVR.IV mutation decreased the vector's heparin affinity while liver transduction was partially restored. Similar to the trend observed in muscle, intranasal administration of AAV3G1 resulted in a transduction efficiency 2 to 3 fold greater than that of AAV8, which was further improved to levels approximately 10 fold greater than AAV8 by swapping the VP1 unique region of AAV3G1 with that of another AAV serotype. These findings are relevant to disease models where high-efficiency intramuscular, ocular or intranasal gene delivery and resistance to pre-existing neutralizing antibodies are desired.
As shown herein, the capsid described herein (e.g., the AAV3G1, AAVT20 or AAVTR1 capsid) is, in one embodiment, able to evade neutralization by pre-existing neutralizing antibodies (NAbs) to AAV8. In one embodiment, the rAAV having the capsid described shows at least about a 2 fold increase in resistance to neutralization by an AAV8 neutralizing antibody as compared to native AAV8. In one embodiment, the rAAV having the capsid described shows at least about a 3 fold increase in resistance to neutralization by an AAV8 neutralizing antibody as compared to native AAV8. In one embodiment, the rAAV having the capsid described shows at least about a 4 fold increase in resistance to neutralization by an AAV8 neutralizing antibody as compared to native AAV8. In one embodiment, the rAAV having the capsid described shows at least about a 5 fold increase in resistance to neutralization by an AAV8 neutralizing antibody as compared to native AAV8. In one embodiment, the rAAV having the capsid described shows at least about a 10 fold increase in resistance to neutralization by an AAV8 neutralizing antibody as compared to native AAV8. In one embodiment, the rAAV having the capsid described shows at least about a 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 220, 240, 260 or greater fold increase in resistance to neutralization by an AAV8 neutralizing antibody as compared to native AAV8. Methods of assessing antibody neutralization are known in the art and described herein. See, e.g., Lochrie et al, J Virol., January 2006, 80(2):821-34, which is incorporated herein by reference. In one embodiment, the AAV8 neutralizing antibody is ADK8. See, Gurda et al, J. Virol, 2012 August; 86(15):7739-51. doi: 10.1128/JVI.00218-12. Epub 2012 May 16, which is incorporated herein by reference. In another embodiment, the AAV8 neutralizing antibody is ADK8/9.
This reduction in neutralization by an AAV8 antibody provides the advantage of escaping pre-existing AAV8 antibodies which may be present in the subject. This is useful in instances where an AAV8 vector was used in treating the subject for a certain condition, and a booster dosage is required or second treatment requiring use of an AAV vector.
Saturation mutagenesis was performed on the AAV8 hyper-variable region (HVR) VIII guided by antibody-capsid structure information. It was demonstrated that the capsid mutants were capable of escaping AAV8 neutralizing antibodies and maintained liver transduction. Saturation mutagenesis was performed on HVR.I and HVR.IV regions, beginning with one of the capsid mutants described above—AAV8.C41—as the backbone, followed by three rounds of in vivo enrichment in mouse liver, resulting in an AAV8 mutant, termed AAV3G1 (also called AAV8.Triple or Triple). AAV3G1 showed resistance to various antisera of monkey and human, as well as human IVIG (at levels 2 to 4 fold that of AAV8, with respect to human IVIG). All the three mutations contributed to the observed resistance. Unexpectedly, AAV83G1 demonstrated decreased liver transduction efficiency of as compared to AAV8 native (˜1/6×AAV8) while its muscle transduction was increased (˜10×AAV8). AAV3G1 demonstrated a higher heparin affinity than AAV8. Reducing the positive charges of the HVR.IV and HVR.I mutation decreased the vector's heparin affinity accompanied by partially restored liver transduction (the resulting mutant is called AAV8.TR1). Intranasal administration of AAV3G1 resulted in a transduction efficiency 2 to 3 fold greater than that of AAV8. A new mutant, AAV8.T20, was created by swapping the VP1/2-unique region of one of the high transduction members, rh.20, into AAV3G1, resulting in AAV8.T20. I.e., amino acids 1-202 of AAVrh.20 (SEQ ID NO: 88) were swapped in for amino acids 1 to 203 of the AAV3G1 capsid. AAV8.T20's transduction was approximately 10 fold greater than AAV8 in mice by intranasal administration.
Several AAV8 mutants were generated c41, c42, c46, g110, g113, g115 and g117 with mutations in the HVR.VIII region. As discussed in Gurda et al, cited above, the major ADK8 epitope lies in the HVR.VIII region (amino acids 586 to 591 using AAV8 vp1 numbering). Those mutants were tested in vitro for ADK8 resistance and some of them were tested in vivo for ADK8 resistance. See, e.g., Lochrie 2006 cited above.
| Name | Amino acid sequence (583-597) | |
| AAV8 | ADNLQQQNTAPQIGT; SEQ ID NO: 69 | |
| C41 | GDNLQLYNTAPGSVF; SEQ ID NO: 70 | |
| C42 | SDNLQFRNTAPLWSS; SEQ ID NO: 71 | |
| C46 | NDNLQVCNTAPDDVM; SEQ ID NO: 72 | |
| G110 | CDNLQGYNTAPLCVA; SEQ ID NO: 73 | |
| G112 | VDNLQFLNTAPAGEA; SEQ ID NO: 74 | |
| G113 | LDNLQDGNTAPGACG; SEQ ID NO: 75 | |
| G115 | WDNLQSENTAPSETS; SEQ ID NO: 76 | |
| G117 | SDNLQSCNTAPFAGA; SEQ ID NO: 77 | |
The mutant c41 was picked as the backbone for further mutagenesis at HVR.I and HVR.IV region. Mutant c41 has the sequence shown in SEQ ID NO: 2 (DNA sequence shown in SEQ ID NO: 1). The c41 amino acid sequence is that of AAV8, with the following mutation in the HVR.VIII region: 583ADNLQQQNTAPQIGT597 (SEQ ID NO: 69)->GDNLQLYNTAPGSVF (SEQ ID NO: 70).
For HVR.I or HVR.IV mutagenesis, three rounds of in vivo selection were done. HVR.I mutation SGTH and HVR.IV mutation GGSRP were then incorporated into clone c41 backbone to generate AAV3G1. In vitro Nab tests show that AAV3G1 showed some degree of hIVIG resistance; all the three mutations (c41, SGTH and GGSRP) contribute to the resistance. AAV3G1 shows a higher muscle transduction than AAV8, both i.m. and i.v., with various transgene cassettes such as CB7.CI.ffluciferase, CMV.LacZ and tMCK.human F9.
AAV3G1 also shows higher transduction in murine airway epithelia cells than AAV8. By replacing the VP1/2 region with that of rh.20, the resulting mutant, AAV8.T20, shows transduction, ˜10 times of AAV8. In nasal administration to B6 mice, normalized to AAV8 (100%, CB7.CI.luciferase), AAV3G1 transduced at 375% while AAV8.T20 transduced at 988%.
AAV3G1 has heparin affinity higher than AAV8. A new mutant was designed to introduce negative-charged residues in HVR.I and HVR.IV (HVRI: SGTH→SDTH. HVR.IV: GGSRP is replaced by another mutation, DGSGL (SEQ ID NO: 82), showed up during the selection process. The resulting mutant, AAV8.TR1, shows decreased heparin affinity and its liver transduction was partially restored. As compared to AAV8 (100%, TBG.human F9), AAV3G1 transduces liver at 18%, while AAV.TR1 transduces at 52%.
1. pAAV.DE.0
The plasmid pAAV.DE.0 was constructed by placing the following components between the two AAV ITRs-ZsGreen expression cassette, followed by CMV promoter, followed by fragment 1883-2207 of AAV2 genome (NC 001401), followed by restriction sites AarI and SpeI (for inserting AAV VP1 ORF). pAAV.DE.0 is shown in SEQ ID NO: 39 and FIG. 9.
2. pAAV.DE.1
The plasmid pAAV.DE.1 was based on pAAV.DE.0 with modifications: 1) the NheI fragment was removed; 2) a rabbit beta-globin polyadenylation signal sequence was inserted between the 3′ ITR and the SpeI restriction recognition site. pAAV.DE.1 is shown in SEQ ID NO: 40 and FIG. 10.
3. pAAV.DE.1.HVR.I
The plasmid was based on pAAV.DE.1 with 1) the VP1 ORF of AAV8.c41 was inserted in pAAV.DE.1 between AarI and SpeI; 2) the two BsmBI restriction recognition sites were removed by silent mutagenesis; 3) a small DNA fragment carrying two BsmBI sites at its ends was inserted at HVR.I region of AAV8.c41 VP1 ORF to create a cloning site for HVR.I mutagenesis. pAAV.DE.1.HVRI is shown in SEQ ID NO: 41 and FIG. 11.
4. pAAV.DE.1.HVR.IV
The plasmid was based on pAAV.DE.1 with 1) the VP1 ORF of AAV8.c41 was inserted in pAAV.DE.1 between AarI and SpeI; 2) the two BsmBI restriction recognition sites were removed by silent mutagenesis; 3) a small DNA fragment carrying two BsmBI sites at its ends was inserted at HVR.IV region of AAV8.c41 VP1 ORF to create a cloning site for HVR.IV mutagenesis. pAAV.DE.1.HVRIV is shown in SEQ ID NO: 42 and FIG. 12.
5. pRep
The plasmid was based on pAAV2/8 plasmid (SEQ ID NO: 43). The plasmid pAAV2/8 was digested with AfeI, then partially digested with BbsI, end-polishing and then self-ligated.
1. HVR.VIII Library
Three PCRs were set up: PCR1: primer031 (SEQ ID NO: 49), primer032 (SEQ ID NO: 50) and primer009 (SEQ ID NO: 45); PCR2: primer016 (SEQ ID NO: 46) and primer030 (SEQ ID NO: 48), with the plasmid pAAV2/8 as template; PCR3: primer033 (SEQ ID NO: 49) and primer017 (SEQ ID NO: 47), with the plasmid pAAV2/8 as template. Primers shown in Table 2 below. The three PCR products were purified QIAquick PCR purification Kit (Qiagen), combined together, digested with BsmBI (New England Biolabs) and purified again, followed by ligation at 16° C. with T4 DNA ligase (Roche). A 428-bp fragment was gel-extracted and ligated with the 6908-bp BsmBI fragment of pAAV2/8. The ligation product served as PCR template with primer.AAV8start and primer AAV8 END nd5R. The PCR product was purified, cloned into pAAV.DE.0 through AarI and SpeI and transformed into Stb14 (Invitrogen). Plasmid was extracted from the overnight culture of the transformation and it was the plasmid library of AAV8 HVR.VIII mutagenesis.
The plasmid library was mixed with helper plasmid (pAdAF6) and pRep, and then transfected into 293 cells by Calcium-phosphate method. Three days after transfection, cell lysate was harvest, re-suspended in DPBS and treated with Benzonase (Merck). The lysate was then spun down to remove debris. The supernatant was the AAV mutagenesis library and stored at −20° C. for further uses. The titration was done with real-time PCR.
1×109 genome copies (gc) of the AAV mutagenesis library was mixed with 0.54, of ADK8 (AAV8 Nab titer—1:2560) and added up to 1 mL with complete medium. The mixture was incubated at 37° C. for 30 min, and then applied to the 293 cells (MOI, 1×104). Two days later, the cell was split at a ratio of 1:5. Two days later, the cells were transfected with the plasmid pAdAF6 and pRep. Two days later, RNA and genomic DNA were extracted from the cells as templates for RT-PCR or PCR. The PCR primers were primer016 (SEQ ID NO: 46) and primer017 (SEQ ID NO: 47). The PCR product was cloned into Topo vector (Invitrogen) and sequenced. AAV fragments were cut out from the Topo plasmids and cloned into pAAV2/8 at the BsmBI sites to make trans plasmids. Individual trans plasmids were packed into regular AAV vectors with pAAV.CMV.eGFP as the cis-plasmid for further analysis.
| TABLE 2 |
| Primer list |
| Seq | ||
| Name | Sequence | ID |
| primer009 | ctacagaggaatacggtatcgtgnnkgataact | 45 |
| tgcagnnknnkaacacggctcctnnknnknnkn | ||
| nkgtcaacagccagggggccttac | ||
| primer016 | Tggaccggctgatgaatcct | 46 |
| primer017 | Cggtgctgtattgcgtgatg | 47 |
| primer030 | ggctcacgtctctgtagccacagggttagtggt | 48 |
| t | ||
| primer031 | cggacacgtctcgctacagaggaatacggtatc | 49 |
| gtg | ||
| primer032 | ggctcacgtctcggtaaggccccctggctg | 50 |
| primer033 | cggacacgtctccttacccggtatggtctggca | 51 |
| gaa | ||
| primer035 | Cacgcagaatgaaggcacca | 52 |
| primer042 | Cacgataccgtattcctctgtagccac | 53 |
| primer084 | gctggtttagtgaaccgtcagatcctgcat | 54 |
| primer098 | Aaggtgcgcgtggaccagaa | 55 |
| primer113 | Acaggtactggtcaatcagagg | 56 |
| primer155 | caaccacctctacaagcaaatctccnnknnknn | 57 |
| knnknnkggagccaccaacgacaacacctact | ||
| primer156 | agtaggtgttgtcgttggtggaccmnnmnnmnn | 58 |
| mnnmnnggagatttgcttgtagaggtggttg | ||
| primer157 | ctacttgtctcggactcaaacaacannknnknn | 59 |
| knnknnkacgcagactctgggcttcagccaa | ||
| primer158 | ttggctgaagcccagagtctgcgtmnnmnnmnn | 60 |
| mnnmnntgttgtttgagtccgagacaagtag | ||
| primer159 | gatttttggcaaacaaaatgctgccnnknnknn | 61 |
| knnknnktacagcgatgtcatgctcaccagcg | ||
| primer160 | cgctggtgagcatgacatcgctgtamnnmnnmn | 62 |
| nmnnmnnggcagcattttgtttgccaaaaatc | ||
| primer175 | cggtcacgtctcggtcatcaccaccagcacccg | 63 |
| aac | ||
| primer200 | gccagtcgtctccgttgtcgttggtggctcc | 64 |
| primer201 | cggtcacgtctcg cctctgattgaccagtacc | 65 |
| tgtactacttgtctcggactcaa | ||
| primer202 | gccagtcgtaccgccattgtattaggcccacct | 66 |
| tggctgaagcccagagtc | ||
| primer.AAV8 | ttaccccacaggaagcacgccacctgcaaatca | 67 |
| start | ggtatggctgccgatggttatcttc | |
| primer.AAV8 | ctcgttactgccgtgtgggactagttacagatt | 68 |
| end | acgggtgaggtaacgggtgcca | |
2. In Vitro Nab Assay
1×109 gc of each AAV mutant carrying eGFP cassette was mixed with different monoclonal antibodies (ADK8, [Nab]AAV8=1:2560, 0.5 μL/well; ADK8/9, [Nab]AAV8=1:2560, 0.5 μL/well; ADK9, [Nab]AAV8=5, 0.5 μL/well; No Ab: medium), up to 100 μL with media, incubated at 37° C. for 30 minutes and then applied to 293 cells (5×104 cells/well seeded one day before infection in a 96-well plate). GFP expression was monitored and quantified with Image J. FIG. 2a.
3. HVR.I and HVR.IV Libraries
Three rounds of selection were performed in vivo. For each round, the AAV libraries were injected into B6 mice, i.v., in the presence of pooled human IVIG (hIVIG).
For round 1, HVR.I:
Two fragments were made through PCR with pAAV2/8.c41 as the template and primer098 (SEQ ID NO: 55)+primer156 (SEQ ID NO: 58), primer155 (SEQ ID NO: 57)+primer as the primer sets, respectively. The two fragments were assembled together by PCR with primer098 (SEQ ID NO: 55)+primer.AAV8end (SEQ ID NO: 68). The resulting fragments were then cloned into pAAV.DE.1 through HindIII and SpeI sites as the plasmid libraries for the production of AAV libraries. The library production was similar to HVR.VIII library except that it was purified with iodixanol gradient, the same way as regular AAV vector.
For round 1, HVR.IV:
The process was very similar to HVR.I except that the primer sets were primer098 (SEQ ID NO: 55)+primer158 (SEQ ID NO: 60), primer157 (SEQ ID NO: 59)+primer.AAV8end (SEQ ID NO: 68).
The libraries were then injected into mice in the presence of human IVIG, i.v. Two weeks later, liver was harvested. Genomic DNA and RNA were extracted. AAV DNA fragments were retrieved through PCR and cloned into plasmids for new library production.
Round 2 and round 3 were similar to round 1, except that:
For HVR.I, primer175 (SEQ ID NO: 63) and primer200 (SEQ ID NO: 64) were used and the cloning vector was pAAV.DE.1.HVR.I; for HVR.IV, primer201 (SEQ ID NO: 65) and primer202 (SEQ ID NO: 66) were used and the cloning vector was pAAV.DE.1.HVR.IV.
After round 3, genomic DNA was extract from mouse liver, amplified through PCR and cloned into trans plasmid backbone for further analysis.
4. The Generation of AAV3G1, AAV8.T20 and AAV8.TR1
The trans plasmid pAAV2/8.Triple was based on pAAV2/8.c41 (SEQ ID NO: 44), in which the HVR.I region was replaced by DNA coding SGTH and the HVR.IV region was replaced by DNA coding GGSRP.
The trans plasmid pAAV2/8.T20 was based on pAAV2/8.Triple, in which the VP12 region was replaced with the corresponding region of AAVrh.20.
The trans plasmid pAAV2/8.TR was based on pAAV2/8.Triple, in which the HVR.I region was replaced by DNA coding SDTH (SEQ ID NO: 80) and the HVR.IV region was replaced by DNA coding DGSGL (SEQ ID NO: 82).
5. AAV Vector Production
AAV vectors were made according the method described by Lock, M, Alvira, M, Vandenberghe, L H, Samanta, A, Toelen, J, Debyser, Z, et al. (2010). Rapid, Simple, and Versatile Manufacturing of Recombinant Adeno-Associated Viral Vectors at Scale. Human Gene Therapy 21: 1259-1271.
6. ELISA for Canine F9 and Human F9
The ELISA for measuring canine F9 was described by Wang, L L, Calcedo, R, Nichols, T C, Bellinger, D A, Dillow, A, Verma, I M, et al. (2005). Sustained correction of disease in naive and AAV2-pretreated hemophilia B dogs: AAV2/8-mediated, liver-directed gene therapy. Blood 105: 3079-3086 which is incorporated herein by reference. Briefly, AAV8 mutants were packed with TBG.canine F9-WPRE cassette and tested in B6 mice in the presence/absence of antibody ADK8 through i.v. injection. 100 uL of diluted ADK8 was injected i.v. 2 hours prior to vector injection. AAV8 was used as control. Canine F9 level was measured with ELISA from plasma collected 1 week after administration. The percent of F9 from ADK8-treated animal to ADK8-naïve animal and p value (t-test) is shown in FIG. 2b.
A similar experiment was done using human F9. I.m. injection of AAV vectors carrying a third transgene cassette, tMCK.human F9, shows similar muscle preference of AAV3G1 in B6 mice. tMCK is a muscle-specific promoter. Dose was 3×1010 gc/mouse, n=3 mice/group. Plasma and muscle were collected 28 and 30 days after dosing, respectively. Human F9 was measured by ELISA from plasma and muscle lysate. The muscle F9 expression level after transduction with AAV3G1 was 11.2 folds higher than after transduction with AAV8. FIG. 5c. Measurement of the neutralizing antibody titer of the day 28 plasma shows that the antigenicity of AAV8 and AAV3G1 is different. FIG. 5d.
C. In Vitro Nab Assay, with Luciferase as the Reporter Gene
AAV8, AAV3G1 and mutants carrying all the combinations of the three mutations comprising AAV3G1 were tested in vitro with human plasmas (4 samples) and anti-AAV8 monkey sera (4 samples). Huh7 cells were seeded in 96-well black plates with clear bottom (Corning), 5×104 cells/well. Two days later, AAV8 and the variants were diluted in complete medium and incubated with diluted sera/plasma (final anti-AAV8 Nab titer in the mix, 1:4) before being applied to Huh7 cells in 96-well plates. The mixture was incubated at 37° C. for 30 minutes before being transferred to the Huh7 plates.
Luciferase expression was read 72 hours later and converted to the percentage of the expression level of each “vector alone” control. For each serum/plasma, a ranking number was assigned to each vector according to their residual expression (the ranking number of the highest residual expression was 1 and the lowest was 8). FIG. 4b. These data show that all the three mutations in AAV3G1 contribute to Nab resistance.
1. Luciferase Assay, In Vivo
AAV8 or AAV3G1 carrying CB7.CI.luciferase cassette was administrated intramuscularly into C57BL6 mice at a dose of 3×1010 gc/mouse, 4 mice/group. Luciferase activity was monitored 2 weeks and 4 weeks after dosing. Through intramusclar injection, AAV3G1 prefers muscle to liver, compared to AAV8. FIG. 5a.
A second experiment was performed in which AAV8 and AAV3G1 vectors carrying a different transgene were administered i.m. in C57BL6 mice at a dose of 1×109 gc/animal (5×108 gc/25 uL/leg, both legs). Week 3 after vector injection, muscle section, X-gal staining, the best section of each group, is shown in FIG. 5b (4× magnification). These studies show that i.m. injection of AAV vectors carrying another transgene cassette shows similar muscle preference of AAV3G1 in B6 mice.
MPS 3A Het mice (C57BL6 background) received 5×1011 gc of AAV.CMV.Lac/mouse, i.v. Tissues were collected 14 days later. X-gal stained sections from heart, muscle and liver of mice received AAV8 or AAV3G1 vector were made (data not shown). These studies show that i.v. injection shows increased muscle preference in AAV8. Triple as compared to AAV8. Representative muscle sections of each animal at 4× are shown in FIG. 6a.
AAV8 and AAV3G1 were compared with CB7.CI.ffluciferase transgene cassette. B6 mice were injected, i.v., at a dose of 3×1011 gc/mouse. Two weeks after vector injection, luciferase was imaged. FIG. 6b. The left is AAV8; the right is AAV3G1.
AAV3G1 has a higher transduction to mouse airway epithelial cells and the transduction is improved further by replacing VP1/2 region with rh.20. B6 mice received 1×1011 gc/mouse of AAV.CB7.CI.luciferase, i.n. 4 mice received each vector. The luciferase activity was monitored 2, 3 and 4 week after vector administration. FIG. 7a, right panel, is a representative image (week 4) of the study. The left panel is quantification with Living Image® 3.2 and normalized by the average value of AAV8 group at week 2.
Airway epithelia cell transduction comparison of AAV8, AAV8.T20, AAV9 and AAV6.2. B6 mice received 1×1011 gc/mouse of AAV.CB7.CI.luciferase, i.n., 4 mice/vector. The luciferase activity was monitored 1, 2 and 3 weeks after vector administration. Living Image® 3.2 was used for quantification and normalized by the average value of AAV8 group at week 1. FIG. 7b.
Mice were anaesthetized. D-luciferin (Xenogen) was instilled into the mouse nostril at 15 ug/uL, 10 uL/nostril, 20 uL/mouse. Five minutes later, luminescent images were taken by IVIS® Imaging Systems (Xenogen) and quantified with the software Living Image® 3.2.
2. Heparin Binding Assay
AAV vectors were diluted in desired buffers and loaded to vector-dilution-buffer-prebalanced HiTrap Heparin HP column (GE Healthcare Life Sciences) by ÄKTA™ FPLC System (GE). The column was then washed sequentially with vector dilution buffer and buffers with increasing amount of sodium chloride. Fractions were collected during the whole process. Dot blot protocol was described by Tenney, R M, Bell, C L, and Wilson, J M (2014). AAV8 capsid variable regions at the two-fold symmetry axis contribute to high liver transduction by mediating nuclear entry and capsid uncoating. Virology 454: 227-236, which is incorporated herein by reference. See FIGS. 8a-8d. Yield for each vector is shown below.
| TABLE 3 |
| Yield table (total gc of purified vector/cell stack. DIY) |
| Transgene cassette |
| AAV types | CB7.CI.ffluciferase.RBG | LSP. cF9.W | TBG.hF9.W | tMCK.hF9.W |
| AAV8 | 4.93E+12 | 4.65E+13 | 4.47E+13 | 1.84E+13 |
| 2.07E+13 | 2.04E+13 | |||
| 2.10E+13 | ||||
| AAV8.C41 | 1.46E+13 | 1.69E+13 | ||
| AAV8.C41.I-SGTH | 3.64E+12 | |||
| 5.63E+12 | ||||
| 6.64E+12 | ||||
| AAV8.C41.IV-GGSRP | 1.40E+13 | |||
| AAV8.G112 | 7.14E+12 | |||
| AAV8.G113 | 1.93E+13 | |||
| AAV8.G115 | 1.86E+13 | |||
| AAV8.I-SGTH | 1.78E+13 | |||
| AAV8.IV-GGSRP | 2.24E+13 | |||
| AAV8.T20 | 5.60E+12 | |||
| AAV8.TR1 | 4.64E+13 | |||
| AAV3G1 | 3.95E+12 | 2.12E+13 | 1.63E+13 | 1.98E+13 |
| 8.43E+12 | ||||
| 1.04E+13 | ||||
AAV mutant library preparation. A plasmid, termed pAAVinvivo, was used for the library preparation. The plasmid contains CMV promoter, partial Rep sequence (AAV2, NC 001401,1881-2202)18, AAV8 VP1 gene and rabbit beta globin (RBG) polyadenylation signal, flanked by two AAV ITRs (FIG. 14). The saturation mutagenesis was done with primers carrying NNK degenerate codons at the desired sites. Both NNS and NNK covers all 20 amino acids. For human codon usage, NNS is slightly higher than NNK (FIG. 15A); however, too many GCs may not be good for PCR and/or virus replication—the average GC % of NNS is 67% while NNK 50% (FIG. 15B). Taken together, NNK was chosen. Two helper plasmids, pAdAF6 (carrying adenovirus components) and pRep (carrying AAV Rep genes), and the plasmid library were transfected into HEK293 cells for AAV library production. The downstream steps utilized AAV vector manufacturing techniques previously described. The plasmid library size was around 1×106-3×107. The yield of AAV libraries was around 1.52×1011-2.56×1013 gc.
Structure-guided saturation mutagenesis quickly abolished vector neutralization by the antibody. We first picked residues 583, 588, 589, 594-597 (AAV8 VP1 numbering, SEQ ID NO: 34) for mutagenesis, because they're within the contact region between monoclonal neutralizing antibody ADK8 and AAV8 capsid, according to the structure resolved by Gurda et al. After one round of in vitro selection in HEK293 cells in the presence of ADK8, mutants were randomly picked and tested with Nab assay. The mutation sequences are listed in Table 1. As shown in FIG. 2A, all the mutants were resistant to ADK8 in comparison to AAV8. They also show resistance to ADK8/9, implying epitope overlapping between the two antibodies. One mutant, C42, showed much higher 293 cell transduction than AAV8, probably due to the change of residue 589 to arginine. Huh7 cells showed similar result (data not shown).
Liver transduction was evaluated in B6 mice. Mice received CB7.CI.eGFP vectors at a dose of 1×1011 GC/animal, i.v., and liver was harvested two weeks later. The dosage of G112 was 3.5×1010 per animal. Liver transduction in B6 mice with CB7.CI.eGFP reporter showed that GFP expression of C41, G110 and G112 was better than AAV8; G113 and G115 were roughly equal to AAV8; in contrast to its high 293 cell transduction, C42 expressed less GFP in mouse liver (Data not shown).
The resistance remained in in vivo testing when LSP.canine F9 transgene cassette was packed into those AAV8 mutants and administrated intravenously into mice 2 hours after ADK8 i.v. injection (FIG. 2B). No mutants showed clear resistance to several AAV8 Nab-positive human plasmas (data not shown), which was expected because those mutants are single-epitope ablated and AAV antisera are likely polyclonal, as demonstrated by the broad neutralizing spectrum of AAV Nab in chimpanzees.
Further mutagenesis and the generation of AAV3G1. One mutant, C41, showed some resistance to two AAV8 Nab-positive human plasmas, when tested in vivo with CB7.CI.eGFP transgene cassette (data not shown). This mutant was used as the backbone for further mutagenesis. HVR.I and HVR.IV region were picked for the next round of mutagenesis, respectively, because protrusions of a protein are likely to be more antigenic. (NNK)5 were loaded into pAAVinvivo.C41 backbone (pAAVinvivo.C41 is the same as pAAVinvivo with AAV8 VP1 replaced with AAV8.C41 VP1) at position 263-267 and 455-459 respectively to make libraries and then go through three round of in vivo selection in mice. For each round, AAV libraries were intravenously injected into mice 2 hour after pooled human Intravenous Immunoglobulin (hIVIG) injection. AAV sequences were retrieved with PCR from mouse livers two weeks after vector injection and loaded into pAAVinvivo.C41 to make libraries for the next round of selection with increased amount of hIVIG. After three rounds of selection, SGTH was the only mutant recovered from the highest IVIG group among all PCR positive animals. It's interesting that it's a three-bp deletion mutant which doesn't disrupt the ORFs of VP123 and assembly activation protein (the DNA change is: AACGGGACATCGGGA (SEQ ID NO: 83)->TCTGGTACTCAT (SEQ ID NO: 84). HVR.IV's signal was still diverse, implying that it's conformationally flexible and may not be the dominant epitope in pooled hIVIG. AAV3G1 was generated by combining the three mutations, C41 (HVR.VIII mutation), SGTH (HVR.I mutation) and GGSRP (HVR.IV mutation) together into AAV8 backbone. GSRP was picked because it showed the highest resistance to hIVIG in in vitro Nab assay, among all HVR.IV mutants tested (data not shown).
AAV3G1 showed Nab resistance and all the three mutations contributed to the resistance. AAV3G1 showed resistance to hIVIG (FIG. 4A). To figure out each mutation's contribution to the resistance, we made a series of AAV8 mutants plus AAV8 and AAV3G1 to cover all the combinations and tested them with anti-AAV primate sera or plasma. As shown in FIG. 4B, all the three mutations comprising AAV3G1 contributed to Nab resistance.
The liver transduction of AAV3G1 is down while its muscle transduction is up. We evaluated liver transduction of AAV3G1 in mice with TBG.human F9 (hF9) as the reporter gene. At a dose of 1×1010 gc/animal, i.v., F9 expressed in plasma was around 18% of AAV8, at weeks 1, 2 and 4 after vector administration (FIG. 13A). The neutralizing antibody titer against AAV8 from AAV3G1 injected mice was 12 fold less than AAV8 injected animals (FIG. 13B). Consistent to F9 expression data, the vector genome copies in liver of AAV3G1 was 20% of AAV8. For both treatments, the liver/spleen ratio of vector genome DNA was similar, with AAV3G1 being 285 and AAV8 being 237 (FIG. 8E). We then evaluated muscle transduction of AAV3G1 in mice. Three reporter gene cassettes were used: CB7.CI.luciferase, CMV.LacZ and tMCK.hF9. As in FIG. 5a, intramuscular injection of 3e10 gc of CB7.luciferase clearly showed that a large amount of AAV8 vectors went to liver, consistent to previous study; in contrast, for AAV3G1, the muscle transduction was much higher than AAV8 and a smaller proportion of vectors went to liver. Intravenous injection showed similar results (FIG. 6c). So did CMV.LacZ with both i.m. and i.v (FIGS. 5B, 6A) and tMCK.hF9 with i.m. (FIG. 5C). For tMCK.hF9 i.m. injection, F9 level in the muscle lysate from AAV3G1 injected mice was about 10 fold higher than AAV8; in contrast, plasma F9 level of the two vectors was similar, consistent with previous report that muscle is not an ideal tissue for F9 expression. We also measured the Nab in the tMCK.hF9 study. Consistent with the study described previously in the paper, AAV8 Nab in AAV8-injected mice was higher than AAV3G1-injected mice (around 12 fold) while AAV3G1 Nab in AAV8-injected mice was lower than AAV3G1-injected mice (around 4 fold) (FIG. 5D). The results show that AAV3G1 has better muscle transduction than AAV8 and indicates that the two capsids are serologically different.
The heparin affinity of AAV3G1 is increased and the rational design of reducing its surface charges successfully reduced its heparin affinity and partially restored its murine liver transduction. Liver transduction of AAV3G1 is decreased despite two of its three mutations identified in three rounds of in vivo selection in mouse liver on the AAV8.C41 backbone. Heparin binding assay showed that the affinity of AAV3G1 is increased (FIG. 8A). Binding to heparin or some other negative charged macromolecules could cause the vectors become trapped/captured before they reach hepatocytes. To eliminate heparin binding, we introduced negative charges onto AAV3G1 capsid, by changing SGTH, the HVR.I mutation, to SDTH, and replacing GGSRP, the HVR.IV mutation, to another negative-charged mutation showing up during the selection process, DGSGL, resulting in a new mutant—AAV8.TR1. The modifications successfully reduced heparin binding (FIG. 8B), and the liver transduction was partially restored (FIG. 13A). The AAV8 Nab titer was 19 fold less than AAV8-treated mice (FIG. 13B). Surprisingly, spleen vector DNA of AAV8.TR1 treated mice was higher than AAV8-treated ones (FIG. 8E). The transduction of AAV3G1 was higher than AAV8 in mice through intranasal vector administration and the rational design of replacing its VP1/2 region with rh.20 improved the transduction further. As shown in FIG. 7a, AAV3G1's transduction was higher than AAV8 in mice through intranasal administration. A previous comprehensive study showed various airway transduction among AAVs. By analyzing the data from Table 1 in Limberis, M P et al, (2009). Transduction efficiencies of novel AAV vectors in mouse airway epithelium in vivo and human ciliated airway epithelium in vitro. Mol Ther 17: 294-301, which is incorporated herein by reference, we found that codon 24 is distinct between low score members and high score members of AAV clade E (data not shown), especially between rh.39 and hu.37—the two have only one amino acid difference (A24D) while their scores are quite different (4 vs 13). We reasoned that VP1/2 region may play some role in AAV airway transduction.
By replacing VP1/2 region (1-202) of AAV3G1 with rh.20, we created another mutant called AAV8.T20. Indeed, AAV8.T20's transduction was 8-12 fold higher than AAV8 (FIG. 7B), approaching to AAV9 level (FIG. 7B).
All mice for the study were housed in an Association for Assessment and Accreditation of Laboratory Animal Care-accredited and Public Health Service-assured facility at the University of Pennsylvania. All animal procedures complied with protocols approved by the Institute of Animal Care and Use Committees at the University of Pennsylvania. All mice were bought from the Jackson Laboratory (Bar Harbor, Me.). The mice were C57BL/6J mice (male, 6-8 weeks old) unless specifically described. Plasmid Library construction.
The starting plasmid, pAAVinvivo, is shown in FIG. 14. HVR.VIII mutagenesis library was constructed by PCR with Phusion (Thermo Fisher Scientific, MA) and a degenerate oligo CTACAGAGGAATACGGTATCGTGNNKGATAACTTGCAGNNKNNKAACACGGCTCCT NNKNNKNNKNNKGTCAAC AGCCAGGGGGCCTTAC (SEQ ID NO: 85), followed by cloning into pAAVinvivo and transformation into Stb14 competent cells (Invitrogen, CA) by electroporation. The initial libraries of HVR.I and HVR.IV were constructed in the same way, with the degenerate oligo CAACCACCTCTACAAGCAAATCTCCNNKNNKNNKNNKNNKGGAGCCACCAACGAC AACACCTACT (SEQ ID NO: 86) for HVR.I and CTACTTGTCTCGGACTCAAACAACANNKNNKNNKNNKNNKACGCAGACTCTGGGCT TCAGCCAA (SEQ ID No:87) for HVR.IV.
The cloning plasmid was pAAVinvivo.C41—AAV8 VP1 replaced with AAV8.C41 VP1. After round one selection, AAV sequences were retrieved with primers flanked with BsmBI sites and cloned into two new cloning plasmids constructed on pAAVinvivo.C41 by removing the two endogenous BsmBI sites by silent mutations and then introducing two BsmBI sites flanking HVR.I and HVR.IV, respectively. The competent cells used here was MegaX DH10B™ T1R Electrocomp™ Cells (Invitrogen, CA) instead. The virus libraries were made the same way as regular AAV vector preps.
AAV Library Production.
For HVR.VIII, The plasmid library was mixed with pdeltaF6 and pRep and transfected into EK293 cells with Calcium-phosphate method. Three days after transfection, cell lysate was harvest, re-suspended in DPBS and treated with Benzonase (Merck). The lysate was then spinned down to remove debris. The supernatant was the AAV mutagenesis library and stored at −20° C. for further uses. For HVR.I and HVR.IV, the libraries were made the same way as regular AAV vectors (see below). The titration was done with real-time PCR.
Selection.
HVR.VIII went through one round of in vitro selection. Specifically, 1e9 genome copies (gc) of the AAV mutagenesis library was mixed with 0.5 μL of ADK8 (AAV8 Nab titer—1:2560) and added up to 1 mL with complete medium. The mixture was incubated at 37° C. for 30 min, and then applied to the 293 cells (MOI, ˜1e4). Two days later, the cell was split followed by transfection with the plasmid pAdAF6 and pRep two days later. Two days after the transfection, AAV fragments were retrieved from the cells by PCR, cloned into Topo vector (Invitrogen) for sequencing, and then cloned into trans plasmids to make AAV.CMV.eGFP vector for further analysis.
HVR.I and HVR.IV went through three rounds of in vivo selection in B6 mice, with a dose of 2.53e10 gc/mouse for HVR.I and 4e10 gc/mouse for HVR.IV, 3 mice/group, i.v. injection. Two hours before library injection, 100 uL of hIVIG diluted with DPBS was injection intravenously. For round one, one group of mice was for each HVR, with hIVIG titer 1:40; for round two, two groups were for each HVR, with hIVIG titer 1:40 for group 1 and 1:80 for group 2; for round three, three groups were for each HVR, with hIVIG titer 1:80 for group 1, 1:160 for group 2 and 1:320 for group 3. Two weeks after vector injection, AAV sequences were retrieved from liver by PCR for next library construction described above. AAV vector production AAV vectors were made as described by Lock et al, 2010.
ELISA for canine F9 and human F9. The ELISA for measuring canine F9 was described by Wang et al., 2005. The human F9 ELISA protocol was a modified version of canine F9 ELISA, also developed by Wang et al.
In vitro Nab assay with eGFP as the reporter gene. 1e9 gc of each AAV mutant carrying eGFP cassette was mixed with different monoclonal antibodies (ADK8, AAV8 Nab titer 1:2560, 0.5 μL/well; ADK8/9, AAV8 Nab titer 1:2560, 0.5 μL/well; ADK9, AAV8 Nab titer 1:5, 0.5 μL/well), up to 100 μL with media, incubated at 37° C. for 30 minutes and then applied to 293 cells (5e4 cells/well seeded one day before infection in a 96-well plate). GFP expression was monitored and quantified with Image J. In vitro Nab assay with Luciferase as the reporter gene. Huh7 cells were seeded in 96-well black plates with clear bottom (Corning), 5e4 cells/well. Two days later, AAV vectors were diluted in complete medium and then mixed serum/plasma samples with various dilutions. The mixture was incubated at 37° C. for 30 minutes before transferred to the Huh7 plates. Three days after vector infection, luminescence was read with Clarity™ Luminescence Microplate Reader (BioTek).
Luciferase Assay, In Vivo
For studies with intranasal administration, mice were anaesthetized. D-luciferin (Xenogen) was instilled into the mouse nostril at 15 ug/uL, 10 uL/nostril, 20 uL/mouse. Five minutes later, luminescent images were taken by IVIS® Imaging Systems (Xenogen) and quantified with the software Living Image® 3.2. For other studies, mice were treated the same way except that D-luciferin was given i.p., 10 uL/gram of mouse body weight and that the luminescence was measured 20 minutes after luciferin injection.
Heparin Binding Assay
AAV vectors were diluted in desired buffers (DPBS or Tris buffer) and loaded to HiTrap Heparin HP column (GE Healthcare Life Sciences) by ÄKTA™ FPLC System (GE). The column was then washed sequentially with vector dilution buffer and dilution buffers plus increasing amount of sodium chloride. Fractions were collected during the whole process. Dot blot protocol was described by Tenney et al, 2014.
Another aspect of this study was replacing VP1/2 region (1-202) of AAV3G1 with h.20. By combining the data from Limberis et al.'s study (Limberis, M P et al, (2009). Transduction efficiencies of novel AAV vectors in mouse airway epithelium in vivo and human ciliated airway epithelium in vitro. Mol Ther 17: 294-301, which is incorporated herein by reference) and our sequence analysis, we found the codon 24 differentiation between high lung transduction members and low-lung transduction members within AAV clade E. Because the amino acids of the 1-202 region of the three highest Clade E member, rh.64R1, rh.10 and rh.20, are identical, we replaced this region into AAV3G1, leading to further improvement of AAV3G1's nasal transduction.
Male B6 mice, 3 mice/group, were injected i.m. with 3e9 or 3e10 gc/mouse, 1 leg/mouse with AAV3G1.tMCK.PI.ffluc.bGH, dd-PCR(PK), manufactured and titrated by Vector Core. Week 1 results are shown in FIG. 15. For each figure, the left is AAV8-treated, the right AAV3G1.
Substantial proportion of AAV8 vectors went to liver even though the vectors were injected intramuscularly, consistent to previous studies, and the transgene was expressed in the liver even when controlled by the muscle-specific promoter tMCK. AAV3G1's muscle transduction is much better than AAV8.
Neutralizing antibody titers were determined for AAV8, AV83G1 and AAV9 using serum from naïve NHPs. The results confirm that AAV8 and AAV3G1 are serologically distinct.
| Animal | AAV NAb in HEK293 cells1,2 |
| # | ID | Time Point | AAV8 | AAV83G1 | AAV9 |
| 1 | RA2125 | Screening | <5 | <5 | <5 |
| 2 | RA2145 | Screening | <5 | <5 | <5 |
| 3 | RA2150 | Screening | <5 | <5 | <5 |
| 4 | RA2153 | Screening | 5* | <5 | <5 |
| 5 | RA2152 | Screening | <5 | <5 | <5 |
| 6 | RA2172 | Screening | <5 | 5* | 5* |
| 7 | RA2309 | Screening | 10* | <5 | <5 |
| 8 | RA2334 | Screening | <5 | <5 | <5 |
| 9 | RA2343 | Screening | <5 | <5 | <5 |
| 10 | RA1971 | Screening | <5 | <5 | <5 |
| 11 | RA0549 | Screening | <5 | <5 | <5 |
| 12 | RA1875 | Screening | <5 | <5 | <5 |
| 13 | RA0875 | Screening | <5 | <5 | <5 |
| 14 | RA1915 | Screening | <5 | <5 | <5 |
| 15 | RA1156 | Screening | <5 | <5 | <5 |
| 16 | BD957KB | Screening | <5 | <5 | <5 |
| 17 | RA0472 | Screening | 10* | <5 | <5 |
| 18 | RA0760 | Screening | >20* | 5* | 5* |
The following information is provided for sequences containing free text under numeric identifier <223>.
| SEQ ID NO: | ||
| (containing | ||
| free text) | Free text under <223> | |
| 1 | <223> constructed sequence | |
| 2 | <223> constructed sequence | |
| 3 | <223> constructed sequence | |
| 4 | <223> constructed sequence | |
| 5 | <223> constructed sequence | |
| 6 | <223> constructed sequence | |
| 7 | <223> constructed sequence | |
| 8 | <223> constructed sequence | |
| 9 | <223> constructed sequence | |
| 10 | <223> constructed sequence | |
| 11 | <223> constructed sequence | |
| 12 | <223> constructed sequence | |
| 13 | <223> constructed sequence | |
| 14 | <223> constructed sequence | |
| 15 | <223> constructed sequence | |
| 16 | <223> constructed sequence | |
| 17 | <223> constructed sequence | |
| 18 | <223> constructed sequence | |
| 19 | <223> constructed sequence | |
| 20 | <223> constructed sequence | |
| 21 | <223> constructed sequence | |
| 22 | <223> constructed sequence | |
| 23 | <223> constructed sequence | |
| 24 | <223> constructed sequence | |
| 25 | <223> constructed sequence | |
| 26 | <223> constructed sequence | |
| 27 | <223> constructed sequence | |
| 28 | <223> constructed sequence | |
| 29 | <223> constructed sequence | |
| 30 | <223> constructed sequence | |
| 31 | <223> constructed sequence | |
| 32 | <223> constructed sequence | |
| 33 | <223> constructed sequence | |
| 34 | <223> constructed sequence | |
| 35 | <223> constructed sequence | |
| 36 | <223> constructed sequence | |
| 37 | <223> constructed sequence | |
| 38 | <223> constructed sequence | |
| 39 | <223> constructed sequence | |
| 40 | <223> constructed sequence | |
| 41 | <223> constructed sequence | |
| 42 | <223> constructed sequence | |
| 43 | <223> constructed sequence | |
| 44 | <223> constructed sequence | |
| 45 | <223> Constructed sequence | |
| <220> | ||
| <221> misc_feature | ||
| <222> (24)..(25) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (39)..(40) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (42)..(43) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (57)..(58) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (60)..(61) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (63)..(64) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (66)..(67) | ||
| <223> n is a, c, g, or t | ||
| 46 | <223> Constructed sequence | |
| 47 | <223> Constructed sequence | |
| 48 | <223> Constructed sequence | |
| 49 | <223> Constructed sequence | |
| 50 | <223> Constructed sequence | |
| 51 | <223> Constructed sequence | |
| 52 | <223> Constructed sequence | |
| 53 | <223> Constructed sequence | |
| 54 | <223> Constructed sequence | |
| 55 | <223> Constructed sequence | |
| 56 | <223> constructed sequence | |
| 57 | <223> Constructed sequence | |
| <220> | ||
| <221> misc_feature | ||
| <222> (26)..(27) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (29)..(30) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (32)..(33) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (35)..(36) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (38)..(39) | ||
| <223> n is a, c, g, or t | ||
| 58 | <223> Constructed sequence | |
| <220> | ||
| <221> misc_feature | ||
| <222> (27)..(28) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (30)..(31) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (33)..(34) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (36)..(37) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (39)..(40) | ||
| <223> n is a, c, g, or t | ||
| 59 | <223> Constructed sequence | |
| <220> | ||
| <221> misc_feature | ||
| <222> (26)..(27) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (29)..(30) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (32)..(33) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (35)..(36) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (38)..(39) | ||
| <223> n is a, c, g, or t | ||
| 60 | <223> Constructed sequence | |
| <220> | ||
| <221> misc_feature | ||
| <222> (26)..(27) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (29)..(30) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (32)..(33) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (35)..(36) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (38)..(39) | ||
| <223> n is a, c, g, or t | ||
| 61 | <223> Constructed sequence | |
| <220> | ||
| <221> misc_feature | ||
| <222> (26)..(27) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (29)..(30) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (32)..(33) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (35)..(36) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (38)..(39) | ||
| <223> n is a, c, g, or t | ||
| 62 | <223> Constructed sequence | |
| <220> | ||
| <221> misc_feature | ||
| <222> (27)..(28) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> 30)..(31) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (33)..(34) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (36)..(37) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (39)..(40) | ||
| <223> n is a, c, g, or t | ||
| 63 | <223> Constructed sequence | |
| 64 | <223> Constructed sequence | |
| 65 | <223> Constructed sequence | |
| 66 | <223> Constructed sequence | |
| 67 | <223> Constructed sequence | |
| 68 | <223> Constructed sequence | |
| 69 | <223> major ADK8 epitope in AAV8 | |
| HVR.VIII region | ||
| 70 | <223> mutated c41 ADK8 epitope in AAV8 | |
| HVR.VIII region | ||
| 71 | <223> mutated c42 ADK8 epitope in AAV8 | |
| HVR.VIII region | ||
| 72 | <223> mutated c46 ADK8 epitope in AAV8 | |
| HVR.VIII region | ||
| 73 | <223> mutated g110 ADK8 epitope in AAV8 | |
| HVR.VIII region | ||
| 74 | <223> mutated g112 ADK8 epitope in AAV8 | |
| HVR.VIII region | ||
| 75 | <223> mutated g113 ADK8 epitope in AAV8 | |
| HVR.VIII region | ||
| 76 | <223> mutated g115 ADK8 epitope in AAV8 | |
| HVR.VIII region | ||
| 77 | <223> mutated g117 ADK8 epitope in AAV8 | |
| HVR.VIII region | ||
| 78 | <223> Constructed sequence | |
| 79 | <223> Constructed sequence | |
| 80 | <223> Constructed sequence | |
| 81 | <223> Constructed sequence | |
| 82 | <223> Constructed sequence | |
| 83 | <223> Constructed sequence | |
| 84 | <223> Constructed sequence | |
| 85 | <223> Constructed sequence | |
| <220> | ||
| <221> misc_feature | ||
| <222> (24)..(25) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (39)..(40) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (42)..(43) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (57)..(58) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (60)..(61) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (63)..(64) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (66)..(67) | ||
| <223> n is a, c, g, or t | ||
| 86 | <223> constructed sequence | |
| <220> | ||
| <221> misc_feature | ||
| <222> (26)..(27) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (29)..(30) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (32)..(33) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (35)..(36) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (38)..(39) | ||
| <223> n is a, c, g, or t | ||
| 87 | <223> Constructed sequence | |
| <220> | ||
| <221> misc_feature | ||
| <222> (26)..(27) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (29)..(30) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (32)..(33) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (35)..(36) | ||
| <223> n is a, c, g, or t | ||
| <220> | ||
| <221> misc_feature | ||
| <222> (38)..(39) | ||
| <223> n is a, c, g, or t | ||
| 88 | <223> AAV rh.20 capsid protein | |
All publications cited in this specification are incorporated herein by reference in their entireties, as is U.S. Provisional Patent Application No. 62/323,389, filed Apr. 15, 2016. Similarly, the SEQ ID NOs which are referenced herein and which appear in the appended Sequence Listing are incorporated by reference. While the invention has been described with reference to particular embodiments, it will be appreciated that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.
1. An adeno-associated virus comprising a capsid having the sequence of SEQ ID NO: 18 (AAV3G1), SEQ ID NO: 20 (AAV8.T20); or SEQ ID NO: 22 (AAV8.TR1).
2. A nucleic acid encoding the capsid according to claim 1.
3. The AAV according to claim 1, wherein the capsid is encoded by SEQ ID NO: 17, SEQ ID NO: 19 or SEQ ID NO: 21, or a sequence sharing at least 80% identity therewith.
4. A recombinant adeno-associated virus (AAV) comprising an AAV capsid having an amino acid sequence selected from: SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32 and 34, further comprising a non-AAV nucleic acid sequence.
5. A nucleic acid molecule comprising a nucleic acid sequence encoding an AAV capsid protein, wherein said nucleic acid sequence is selected from SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31 and 33.