US20210371856A1
2021-12-02
17/392,366
2021-08-03
Methods, compositions, and kits for high throughput DNA assembly reactions in vitro. Modular CRISPR DNA constructs comprising modular insert DNA parts flanked by cloning tag segments comprising pre-validated CRISPR protospacer/protospacer adjacent motif sequence combinations.
Get notified when new applications in this technology area are published.
C12N15/1003 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Processes for the isolation, preparation or purification of DNA or RNA Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
C12N2310/3517 » CPC further
Structure or type of the nucleic acid; Chemical structure; Nature of the modification; Conjugate Marker; Tag
C12N2310/20 » CPC further
Structure or type of the nucleic acid; Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
C12N15/11 » CPC main
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology DNA or RNA fragments; Modified forms thereof
C12N15/10 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Processes for the isolation, preparation or purification of DNA or RNA
C12N15/66 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
This application a Divisional of U.S. application Ser. No. 16/535,245, filed on Aug. 8, 2019, which is a Continuation U.S. Utility Application under 35 U.S.C. § 111, which claims the benefit of International PCT Application No. PCT/US2018/017573, filed on Feb. 9, 2018, which itself claims the benefit of priority to U.S. Provisional Application No. 62/457,493, filed on Feb. 10, 2017, each of which is hereby incorporated by reference in its entirety for all purposes.
This invention was made with Government support under Agreement No. HR0011-15-9-0014, awarded by DARPA. The Government has certain rights in the invention.
The present disclosure relates to systems, methods, and compositions used for guided genetic sequence editing in vitro. The disclosure describes, inter alia, methods of using guided sequence editing complexes for improved DNA cloning, assembly of oligonucleotides, and for the improvement of microorganisms.
The contents of the text file submitted electronically herewith are incorporated herein by reference in their entirety: A computer readable format copy of the Sequence Listing (filename: ZYMR_010_01WO_SeqList_ST25.txt, date recorded: Jan. 30, 2018; file size: 817,847 bytes).
A major area of interest in biology is the in vitro and in vivo targeted modification of genetic sequences. Indeed, one of the most significant bottlenecks to academic and commercial genetic research has been the speed with which novel genetic constructs could be generated or later modified prior to testing.
The currently available cloning techniques relying on restriction site recognition or DNA hybridization and amplification have proven to be slow, unreliable, and intractable to later modifications. The discovery of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) gene editing systems have provided researchers with additional avenues for genetic modification. Even these new approaches, however, remain impractical for high throughput modular cloning applications.
CRISPR editing locations for example, are often limited by the location of protospacer adjacent motifs (PAMs). De novo CRISPR guide RNA design and gene targeting can be both time consuming and expensive, and is also susceptible to low efficiencies, and potential for off-target mutations.
Thus, there is a need for improved compositions and methods for targeted alteration of genetic sequences.
In some embodiments, the present disclosure teaches methods, compositions, and kits for high-throughput DNA assembly reactions in vivo and in vitro utilizing modular CRISPR DNA constructs.
Thus, in some embodiments, the present disclosure teaches CRISPR DNA constructs comprising modular insert DNA parts flanked by cloning tag segments comprising pre-validated CRISPR protospacer/protospacer adjacent motif (PAM) sequence combinations. In some embodiments the present disclosure teaches digesting DNA with CRISPR endonucleases. In some embodiments, the present disclosure teaches digesting DNA with Type II-Class 2 CRISPR endonucleases (e.g. Cas9). In some embodiments, the present disclosure teaches digesting DNA with Type V-Class 2 CRISPR endonucleases. In some embodiments, the present disclosure teaches digesting DNA with Cpf1 endonucleases.
In some embodiments, the present disclosure teaches a recombinant modular CRISPR DNA construct comprising a CRISPR multi-clonal site, said multi-clonal site comprising: a) at least two distinct cloning tags (cTAG), wherein each cTAG comprises: i) one or more validated CRISPR landing sites, each comprising a protospacer sequence operably linked to a protospacer adjacent motif (PAM); wherein at least one of said validated CRISPR landing sites is unique within the modular CRISPR DNA construct; and b) one or more DNA insert sequences; i) wherein each of said cTAGs are distributed in flanking positions around each of the one or more DNA insert sequences; and ii) wherein at least one of said DNA insert sequences comprises a selection marker.
In some embodiments, the present disclosure teaches a recombinant modular CRISPR DNA construct, wherein said modular CRISPR DNA construct is circular.
In some embodiments, the present disclosure teaches a recombinant modular CRISPR DNA construct, wherein said modular CRISPR DNA construct is linear.
In some embodiments, the present disclosure teaches a recombinant modular CRISPR DNA construct, wherein said modular CRISPR DNA construct is integrated into the genome of an organism.
In some embodiments, the present disclosure teaches a recombinant modular CRISPR DNA construct, wherein at least one of said distinct cTAGs comprises at least two validated CRISPR landing sites.
In some embodiments, the present disclosure teaches a recombinant modular CRISPR DNA construct, wherein at least one of the CRISPR landing sites is for a Cas9 endonuclease.
In some embodiments, the present disclosure teaches a recombinant modular CRISPR DNA construct, wherein at least one of the CRISPR landing sites is for a Cpf1 endonuclease.
In some embodiments, the present disclosure teaches a recombinant modular CRISPR DNA construct, wherein at least one of said distinct cTAGs comprises a rare (>8 bases long) restriction endonuclease site.
In some aspects, the disclosure refers to a recombinant modular CRISPR DNA construct as a âMegaModularâ construct.
In some embodiments, the present disclosure teaches a method for preparing a recombinant nucleic acid molecule, the method comprising: a) forming a mixture comprising: i) a plurality of DNA insert parts, wherein each DNA insert part is flanked by two cloning tags (cTAGs), each cTAG comprising: 1) one or more validated CRISPR landing sites, each comprising a protospacer sequence operably linked to a protospacer adjacent motif (PAM); ii) one or more CRISPR complexes targeting at least one of said cTAGs present in at least two of the plurality of DNA insert parts, each CRISPR complex comprising; 1) a CRISPR endonuclease, and 2) a guide RNA or guide RNAs capable of recruiting said CRISPR endonuclease to one of said targeted cTAGs; wherein the mixture is incubated under conditions which allow for digestion of the targeted cTAG(s) in at least two of the plurality of DNA insert parts to generate overhanging ends, and b) incubating the digestion products generated in (a) in conditions which allow for hybridization of compatible overhanging ends and covalent joining of the hybridized ends; wherein the resulting recombinant nucleic acid molecule comprises the complete cTAG sequences of the original insert parts that are ligated in the method.
In some embodiments, the present disclosure teaches a method for preparing a recombinant nucleic acid molecule, wherein the CRISPR endonuclease is Cpf1.
In some embodiments, the present disclosure teaches a method for preparing a recombinant nucleic acid molecule, wherein the CRISPR endonuclease is Cas9.
In some embodiments, the present disclosure teaches a method for preparing a recombinant nucleic acid molecule, wherein the method comprises the step of: i) separating the digested cTAG sequences from the CRISPR complexes prior to ligation, or ii) inactivating the CRISPR complexes prior to ligation.
In some embodiments, the present disclosure teaches a method for preparing a recombinant nucleic acid molecule, wherein the separation step comprises a DNA purification step.
In some embodiments, the present disclosure teaches a method for preparing a recombinant nucleic acid molecule, wherein the inactivation step comprises heat or chemical inactivation of said CRISPR complexes.
In some embodiments, the present disclosure teaches a method for preparing a recombinant nucleic acid molecule, wherein the two cTAGs for each of the plurality of DNA insert parts form a cTAG pair, and wherein said cTAG pair is unique from all other cTAG pairs of the DNA insert parts that are ligated in the method.
In some embodiments, the present disclosure teaches a method for preparing a recombinant nucleic acid molecule, wherein at least one of the cTAGs in each cTAG pair is the same as at least one other cTAG in a different cTAG pair.
In some embodiments, the present disclosure teaches a method for DNA sequence editing, said method comprising: a) introducing into a reaction: i) the modular CRISPR DNA construct of the present disclosure: ii) a replacement DNA insert part, wherein said replacement DNA insert part is flanked by a first and second insert cTAG; 1) wherein the first insert cTAG comprises the validated CRISPR landing site(s) of one of the distinct cTAGs of the modular CRISPR DNA construct, and the second insert cTAG comprises the validated CRISPR landing site(s) of another distinct cTAG of the modular CRISPR DNA construct; and iii) a first and second CRISPR complex targeting the first and second insert cTAGs, respectively, each CRISPR complex comprising: 1) a CRISPR endonuclease, and 2) a guide RNA capable of recruiting said CRISPR endonuclease to one of said targeted insert cTAGs; wherein the first and second CRISPR complexes cleave the first and second insert cTAGs and their corresponding distinct cTAGs to generate overhanging ends, and b) incubating the replacement DNA insert part and modular CRISPR DNA construct with digested cTAGs generated: (a) under conditions which allow for hybridization of compatible overhanging ends and covalent joining of the hybridized ends; wherein the resulting edited modular CRISPR DNA construct comprises the complete cTAG sequences of the original insert part that is ligated by the method.
In some embodiments, the present disclosure teaches a method for DNA sequence editing, wherein the reaction of step (b) comprises a functional ligase.
In some embodiments, the present disclosure teaches a method for DNA sequence editing, said method comprising: a) introducing into a reaction: i) the modular CRISPR DNA construct of the present disclosure; ii) at least two CRISPR complexes targeting two distinct cTAGs in the modular CRISPR DNA construct, each CRISPR complex comprising; 1) a CRISPR endonuclease, and 2) a guide RNA capable of recruiting said CRISPR endonuclease to one of said targeted distinct cTAGs; wherein the first and second CRISPR complexes cleave the two distinct cTAGs in the modular CRISPR DNA construct, wherein the resulting distinct cTAGs comprise overhang ends, and b) introducing into a second reaction: i) the modular CRISPR DNA construct with digested cTAGs generated in (a); and ii) a replacement DNA insert part, wherein said replacement DNA insert part is flanked by a first and second insert cTAG; 1) wherein the first insert cTAG comprises the polynucleotide sequence of one of the undigested distinct cTAGs that is cleaved in (a), and the second insert cTAG comprises the polynucleotide sequence of another undigested distinct cTAG that is cleaved in (a); and 2) wherein the first and second insert cTAGs comprise overhang ends that are compatible with the overhang ends of the distinct cTAGs from (a); under conditions which allow for hybridization of compatible the overhanging ends and covalent joining of the hybridized ends; wherein the resulting edited modular CRISPR DNA construct comprises the complete sequences of the original undigested distinct cTAGs that were targeted in (a).
In some embodiments, the present disclosure teaches a method for DNA sequence editing, wherein the reaction of step (b) comprises a functional ligase.
In some embodiments, the present disclosure teaches a method for DNA sequence editing, wherein the CRISPR endonuclease is Cpf1.
In some embodiments, the present disclosure teaches a method for DNA sequence editing, wherein step (a) further comprises digesting the two cleaved distinct cTAGs with a single stranded exonuclease, thereby producing the distinct cTAGs with overhang ends. In some aspects, one may add a ligase and polymerase to repair the junctions with a polymerase and ligase after the exonuclease step. In some aspects, this reaction can also be done with Cas9 digested, blunt-end cuts.
In some embodiments, the present disclosure teaches a method for DNA sequence editing, wherein the CRISPR endonuclease is Cas9.
In some embodiments, the disclosure provides for a host cell genome comprising a recombinant modular CRISPR DNA construct comprising a CRISPR multi-clonal site, said multi-clonal site comprising: a) at least two distinct cloning tag (cTAG), wherein each cTAG comprises: i) one or more validated CRISPR landing sites, each comprising a protospacer sequence operably linked to a protospacer adjacent motif (PAM); wherein at least one of said validated CRISPR landing sites is unique within the modular CRISPR DNA construct; and b) one or more DNA insert part(s); i) wherein each of said distinct cTAGs are distributed in flanking positions around each of the one or more DNA insert part(s).
In some embodiments, the disclosure provides for a method for preparing a recombinant nucleic acid molecule, the method comprising: a) incubating a mixture comprising: i) a plurality of DNA insert parts flanked by two cloning tags (cTAGs), each cTAG comprising: 1) one or more validated CRISPR landing sites, each comprising a protospacer sequence operably linked to a protospacer adjacent motif (PAM); and 2) a rare (âĽ8 base) restriction enzyme recognition site; wherein at least one of the cTAGs of at least two insert parts comprise the same restriction enzyme site; ii) one or more restriction enzymes targeting the rare restriction enzyme sites in at least two of the plurality of DNA insert parts; under conditions which allow for digestion of the targeted cTAG by the one or more restriction enzymes in at least two of the plurality of DNA insert parts to generate insert parts with digested DNA ends; and b) incubating the DNA insert part(s) with digested DNA ends generated in step (a) under conditions which allow for the covalent joining of the digested DNA ends; wherein the resulting recombinant nucleic acid molecule comprises the complete cTAG sequences of the original insert parts that are covalently joined in the method.
In some embodiments, the disclosure provides for a method for DNA sequence editing, said method comprising: a) providing: i) the modular CRISPR DNA construct of claim 1, wherein at least two of the distinct cTAGs comprise a rare (âĽ8 base) restriction enzyme recognition site; ii) a replacement DNA insert part, wherein said replacement DNA insert part is flanked by a first and second insert cTAG; 1) wherein the first insert cTAG comprises the rare restriction enzyme recognition site of one of the distinct cTAGs of the modular CRISPR DNA construct, and the second insert cTAG comprises the rare restriction enzyme recognition site of another distinct cTAG of the modular CRISPR DNA construct; and iii) one or more restriction enzymes targeting the rare restriction enzyme sites in the first and second insert cTAGs; wherein parts (i) and (ii) are each incubated with part (iii) in a single or separate reactions; wherein the one or more restriction enzymes cleave the rare restriction enzyme recognition sites of first and second insert cTAGs and their corresponding distinct cTAGs to generate digested DNA ends, and b) incubating the replacement DNA insert part and modular CRISPR DNA construct with digested DNA ends generated in step (a) under conditions which allow for the covalent joining of the digested DNA ends; wherein the resulting edited modular CRISPR DNA construct comprises the complete cTAG sequences of the original insert part that is covalently joined by the method.
In some embodiments, the disclosure provides for a method for preparing a recombinant nucleic acid molecule, the method comprising: a) incubating a mixture comprising: i) a plurality of DNA insert parts, wherein each DNA insert part is flanked by two cloning tags (cTAGs), each cTAG comprising: 1) one or more validated CRISPR landing sites, each comprising a protospacer sequence operably linked to a protospacer adjacent motif (PAM); wherein at least two of the DNA insert parts share the same cTAG; ii) a single stranded DNA (ssDNA) exonuclease; under conditions which allow for digestion of the shared cTAG in the least two DNA insert parts, thereby generating compatible overhang DNA ends in the at least two DNA insert parts, and b) incubating the DNA insert parts with digested cTAGs generated in (a) under conditions which allow for the hybridization and covalent joining of the compatible overhang DNA ends of the least two DNA insert parts; wherein the resulting recombinant nucleic acid molecule comprises the complete cTAG sequences of the shared cTAG before digestion. This reaction can also be conducted with a polymerase and or ligase that are used to fix junctions. Further, this can be carried out with a predigested vector.
FIGS. 1A-1C illustrates a comparison of the CRISPR/Cas9 and CRISPR/Cpf1 systems of the present disclosure. FIG. 1AâCas9 endonucleases are recruited to target dsDNA by tracrRNA and crRNA complexes. FIG. 1BâCas9 endonucleases may also be recruited to target dsDNA by artificially fused tracrRNA and crRNA sequences known as single-guide RNAs (sgRNAs). Cas9 endonuc lease produces blunt ends. FIG. 1CâCpf1 endonucleases only require crRNA guide poly-ribonucleotides. Cpf1 endonuclease cleavage produces double stranded breaks with 5Ⲡoverhangs.
FIGS. 2A-2C illustrates an embodiment of the present cloning methods utilizing modular CRISPR constructs of the present disclosure. FIG. 2Aâdiagrams a modular CRISPR plasmid that can be easily altered with Cas9 or Cpf1 nucleases, according to the present disclosure. As aforementioned, the modular CRISPR constructs of the disclosure can be termed âMegaModularâ constructs. Interchangeable parts represented by numbers are flanked by invariant cTAG sequences represented by letters. Parts may come pre-assembled, or may be assembled in vitro based on cTAG sequence identity. Example insert parts are shown on the right of FIG. 2A. FIG. 2BâSeveral strategies such as Cas9, Cpf1, or restriction endonuclease cleavage at cTAGs may be used to replace individual parts without having to reassemble the entire plasmid. cTAG sequences may comprise one or more cloning sites, including, but not limited to Cas9, Cpf1, restriction, and/or recombination sites. FIG. 2CâOnce integrated into the genome of an organism, cTAGs may continue to serve as pre-validated Cas9 or Cpf1 landing sites, enabling replacement, insertion, or removal of genomically integrated DNA with prevalidated and orthogonal gRNA sequences.
FIGS. 3A-3D illustrates an embodiment of the present cloning methods utilizing modular CRISPR constructs of the present disclosure. FIG. 3Aâdiagrams a modular CRISPR plasmid that can be easily altered with Cas9 or Cpf1 nucleases, according to present disclosure. Interchangeable parts represented by numbers are flanked by invariant cTAG sequences represented by letters. Parts may come pre-assembled, or may be assembled in vivo or in vitro based on cTAG sequence identity. Example insert parts are shown on the right of FIG. 3A. FIG. 3BâSeveral strategies such as Cas9, Cpf1, or restriction endonuclease cleavage at cTAGs may be used to replace individual parts without having to reassemble the entire plasmid. cTAG sequences may comprise one or more cloning sites, including, but not limited to Cas9, Cpf1, restriction, and/or recombination sites. FIG. 3CâIllustrates methods of the present disclosure for removing insert parts, or for adding stuffer sequences from existing modular plasmids. FIG. 3DâInsert parts of the modular plasmids of the present disclosure may serve as sequences for genomic integration of a portion or the whole of the modular CRISPR vectors into the genome of a host cell.
FIG. 4 illustrates the one-pot in vitro modular CRISPR cloning of Example 1. Specifically, the generation of plasmid 13001009086 by transfer of an insert from one plasmid to another in a one-pot reaction is shown. The details of this reaction are set forth in Example 1.
FIG. 5 illustrates an embodiment of the in vitro modular CRISPR cloning methods of Example 2. Each panel provides an illustration of the experimental design described in Example 2. A chloramphenicol resistance gene was cloned into a kanamycin resistant backbone plasmid to create a dual resistance plasmid. Dual resistance plasmids were then transformed into bacteria, which was subsequently cultured in media augmented with kanamycin and chloramphenicol antibiotics. Resistant colonies indicated successful Cpf1 cloning assemblies.
FIG. 6 illustrates the results of the in vitro modular CRISPR cloning methods of Example 2. The y-axis represents the number of recovered colonies growing in media augmented with kanamycin and chloramphenicol. Resistant colonies indicate successful Cpf1 cloning assemblies. The results showed a ligase-dependent assembly of dual resistance plasmids.
FIG. 7 Depicts the vector map for pJDI427. CRISPR landing sites used in the Cpf1assembly are labeled as cTAG M and cTAG N. Relevant sequence information can be found in SEQ ID NO: 102.
FIG. 8 Depicts the vector map for pJDI429. CRISPR landing sites used in the Cpf1assembly are labeled as cTAG N and cTAG 0. Relevant sequence information can be found in SEQ ID NO: 103.
FIG. 9 Depicts the vector map for pJDI430. CRISPR landing sites used in the Cpf1assembly are labeled as cTAG P and cTAG N. Relevant sequence information can be found in SEQ ID NO: 104.
FIG. 10 Depicts the vector map for pJDI431. CRISPR landing sites used in the Cpf1assembly are labeled as cTAG P and cTAG 0. Relevant sequence information can be found in SEQ ID NO: 105.
FIG. 11 Depicts the vector map for pJDI432. CRISPR landing sites used in the Cpf1assembly are labeled as cTAG M and cTAG N. Relevant sequence information can be found in SEQ ID NO: 106.
FIG. 12 Depicts the vector map for pJDI434. CRISPR landing sites used in the Cpf1C assembly are labeled as cTAG N and cTAG 0. Relevant sequence information can be found in SEQ ID NO: 107.
FIG. 13 Depicts the vector map for pJDI435. CRISPR landing sites used in the Cpf1assembly are labeled as cTAG P and cTAG N. Relevant sequence information can be found in SEQ ID NO: 108.
FIG. 14 Depicts the vector map for pJDI436. CRISPR landing sites used in the Cpf1assembly are labeled as cTAG P and cTAG 0. Relevant sequence information can be found in SEQ ID NO: 109.
FIG. 15 illustrates an example gene editing of a modular CRISPR construct, according to the methods of the present disclosure. Specifically, FIG. 15 illustrates a plasmid assembly by restriction enzyme digestion and ligation using the megamodular design of Example 3. FIG. 15 shows that a modular CRISPR plasmid backbone p1300283391 and a compatible GFP-containing insert DNA part are each digested with ApaI and PvuI restriction enzymes to create compatible cloning tag ends. The digested backbone and insert are ligated in vitro to create a new modular CRISPR construct
While the following terms are believed to be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate explanation of the presently disclosed subject matter.
The term âaâ or âanâ refers to one or more of that entity, i.e., can refer to a plural referent. As such, the terms âaâ or âanâ, âone or moreâ and âat least oneâ are used interchangeably herein. In addition, reference to âan elementâ by the indefinite article âaâ or âanâ does not exclude the possibility that more than one of the elements is present, unless the context clearly requires that there is one and only one of the elements.
The term âprokaryotesâ is art recognized and refers to cells which contain no nucleus. The prokaryotes are generally classified in one of two domains, the Bacteria and the Archaea. The definitive difference between organisms of the Archaea and Bacteria domains is based on fundamental differences in the nucleotide base sequence in the 16S ribosomal RNA.
A âeukaryoteâ is any organism whose cells contain a nucleus and other organelles enclosed within membranes. Eukaryotes belong to the taxon Eukarya or Eukaryota. The defining feature that sets eukaryotic cells apart from prokaryotic cells (the aforementioned Bacteria and Archaea) is that they have membrane-bound organelles, especially the nucleus, which contains the genetic material, and is enclosed by the nuclear envelope.
The term âArchaeaâ refers to a categorization of organisms of the division Mendosicutes, typically found in unusual environments and distinguished from the rest of the prokaryotes by several criteria, including the number of ribosomal proteins and the lack of muramic acid in cell walls. On the basis of ssrRNA analysis, the Archaea consist of two phylogenetically-distinct groups: Crenarchaeota and Euryarchaeota. On the basis of their physiology, the Archaea can be organized into three types: methanogens (prokaryotes that produce methane); extreme halophiles (prokaryotes that live at very high concentrations of salt (NaCl)); and extreme (hyper) thermophilus (prokaryotes that live at very high temperatures). Besides the unifying archaeal features that distinguish them from Bacteria (i.e., no murein in cell wall, ester-linked membrane lipids, etc.), these prokaryotes exhibit unique structural or biochemical attributes which adapt them to their particular habitats. The Crenarchaeota consists mainly of hyperthermophilic sulfur-dependent prokaryotes and the Euryarchaeota contains the methanogens and extreme halophiles.
âBacteriaâ or âeubacteriaâ refers to a domain of prokaryotic organisms. Bacteria include at least 11 distinct groups as follows: (1) Gram-positive (gram+) bacteria, of which there are two major subdivisions: (1) high G+C group (Actinomycetes, Mycobacteria, Micrococcus, others) (2) low G+C group (Bacillus, Clostridia, Lactobacillus, Staphylococci, Streptococci, Mycoplasmas); (2) Proteobacteria, e.g., Purple photosynthetic +non-photosynthetic Gram-negative bacteria (includes most âcommonâ Gram-negative bacteria); (3) Cyanobacteria, e.g., oxygenic phototrophs; (4) Spirochetes and related species; (5) Planctomyces; (6) Bacteroides, Flavobacteria; (7) Chlamydia; (8) Green sulfur bacteria; (9) Green non-sulfur bacteria (also anaerobic phototrophs); (10) Radioresistant micrococci and relatives; (11) Thermotoga and Thermosipho thermophiles.
The terms âgenetically modified host cell,â ârecombinant host cell,â and ârecombinant strainâ are used interchangeably herein and refer to host cells that have been genetically modified by the cloning and transformation methods of the present disclosure. Thus, the terms include a host cell (e.g., bacteria, yeast cell, fungal cell, CHO, human cell, etc.) that has been genetically altered, modified, or engineered, such that it exhibits an altered, modified, or different genotype and/or phenotype (e.g., when the genetic modification affects coding nucleic acid sequences of the microorganism), as compared to the naturally-occurring microorganism from which it was derived. It is understood that the terms refer not only to the particular recombinant microorganism in question, but also to the progeny or potential progeny of such a microorganism.
The term âgenetically engineeredâ may refer to any manipulation of a host cell's genome (e.g. by insertion or deletion of nucleic acids).
As used herein, âselectable markerâ is a nucleic acid segment that allows one to select for a molecule (e.g., a replicon) or a cell that contains it, often under particular conditions. These markers can encode an activity, such as, but not limited to, production of RNA, peptide, or protein, or can provide a binding site for RNA, peptides, proteins, inorganic and organic compounds or compositions and the like. Examples of selectable markers include but are not limited to: (1) nucleic acid segments that encode products which provide resistance against otherwise toxic compounds (e.g., antibiotics); (2) nucleic acid segments that encode products which are otherwise lacking in the recipient cell (e.g., tRNA genes, auxotrophic markers); (3) nucleic acid segments that encode products which suppress the activity of a gene product; (4) nucleic acid segments that encode products which can be readily identified (e.g., phenotypic markers such as β-galactosidase, green fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), and cell surface proteins); (5) nucleic acid segments that encode products that bind other products which are otherwise detrimental to cell survival and/or function; (6) nucleic acid segments that encode nucleic acids that otherwise inhibit the activity of any of the nucleic acid segments resulting in a visible or selectable phenotype (e.g., antisense oligonucleotides); (7) nucleic acid segments that encode products that bind other products that modify a substrate (e.g. restriction endonucleases); (8) nucleic acid segments that can be used to isolate or identify a desired molecule (e.g. specific protein binding sites); (9) nucleic acid segments that encode a specific nucleotide sequence which can be otherwise non-functional (e.g., for PCR amplification of subpopulations of molecules); and (10) nucleic acid segments, which when absent, directly or indirectly confer resistance or sensitivity to particular compounds.
As used herein, âcounterselectable markerâ or a âcounterselection markerâ is a nucleic acid segment that eliminates or inhibits growth of a host organism upon selection. In some embodiments, the counterselectable markers of the present disclosure render the cells sensitive to one or more chemicals/growth conditions/genetic backgrounds. In some embodiments, the counterselectable markers of the present disclosure are toxic genes. In some embodiments, the counterselectable markers are expressed by inducible promoters.
As used herein, the term ânucleic acidâ refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, or analogs thereof. This term refers to the primary structure of the molecule, and thus includes double- and single-stranded DNA, as well as double- and single-stranded RNA. It also includes modified nucleic acids such as methylated and/or capped nucleic acids, nucleic acids containing modified bases, backbone modifications, and the like. The terms ânucleic acidâ and ânucleotide sequenceâ are used interchangeably.
As used herein, the term âgeneâ refers to any segment of DNA associated with a biological function. Thus, genes include, but are not limited to, coding sequences and/or the regulatory sequences required for their expression. Genes can also include non-expressed DNA segments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
As used herein, the term âhomologousâ or âhomologâ or âorthologâ is known in the art and refers to related sequences that share a common ancestor or family member and are determined based on the degree of sequence identity. The terms âhomology,â âhomologous,â âsubstantially similarâ and âcorresponding substantiallyâ are used interchangeably herein. They refer to nucleic acid fragments wherein changes in one or more nucleotide bases do not affect the ability of the nucleic acid fragment to mediate gene expression or produce a certain phenotype. These terms also refer to modifications of the nucleic acid fragments of the instant disclosure such as deletion or insertion of one or more nucleotides that do not substantially alter the functional properties of the resulting nucleic acid fragment relative to the initial, unmodified fragment. It is therefore understood, as those skilled in the art will appreciate, that the disclosure encompasses more than the specific exemplary sequences. These terms describe the relationship between a gene found in one species, subspecies, variety, cultivar or strain and the corresponding or equivalent gene in another species, subspecies, variety, cultivar or strain. For purposes of this disclosure homologous sequences are compared. âHomologous sequencesâ or âhomologsâ or âorthologsâ are thought, believed, or known to be functionally related. A functional relationship may be indicated in any one of a number of ways, including, but not limited to: (a) degree of sequence identity and/or (b) the same or similar biological function. Preferably, both (a) and (b) are indicated. Homology can be determined using software programs readily available in the art, such as those discussed in Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1987) Supplement 30, section 7.718, Table 7.71. Some alignment programs are MacVector (Oxford Molecular Ltd, Oxford, U.K.), ALIGN Plus (Scientific and Educational Software, Pennsylvania) and AlignX (Vector NTI, Invitrogen, Carlsbad, CA). Another alignment program is Sequencher (Gene Codes, Ann Arbor, Michigan), using default parameters.
As used herein, the term ânucleotide changeâ refers to, e.g., nucleotide substitution, deletion, and/or insertion, as is well understood in the art. For example, mutations contain alterations that produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded protein or how the proteins are made.
As used herein, the term âprotein modificationâ refers to, e.g., amino acid substitution, amino acid modification, deletion, and/or insertion, as is well understood in the art.
As used herein, the term âat least a portionâ or âfragmentâ of a nucleic acid or polypeptide means a portion having the minimal size characteristics of such sequences, or any larger fragment of the full length molecule, up to and including the full length molecule. A fragment of a polynucleotide of the disclosure may encode a biologically active portion of a genetic regulatory element. A biologically active portion of a genetic regulatory element can be prepared by isolating a portion of one of the polynucleotides of the disclosure that comprises the genetic regulatory element and assessing activity as described herein. Similarly, a portion of a polypeptide may be 4 amino acids, 5 amino acids, 6 amino acids, 7 amino acids, and so on, going up to the full length polypeptide. The length of the portion to be used will depend on the particular application. A portion of a nucleic acid useful as a hybridization probe may be as short as 12 nucleotides; in some embodiments, it is 20 nucleotides. A portion of a polypeptide useful as an epitope may be as short as 4 amino acids. A portion of a polypeptide that performs the function of the full-length polypeptide would generally be longer than 4 amino acids.
For PCR amplifications of the polynucleotides disclosed herein, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any organism of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual (3rd ed., Cold Spring Harbor Laboratory Press, Plainview, New York). See also Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially-mismatched primers, and the like.
The term âprimerâ as used herein refers to an oligonucleotide which is capable of annealing to the amplification target allowing a DNA polymerase to attach, thereby serving as a point of initiation of DNA synthesis when placed under conditions in which synthesis of primer extension product is induced, i.e., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and pH. The (amplification) primer is preferably single stranded for maximum efficiency in amplification. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization. The exact lengths of the primers will depend on many factors, including temperature and composition (A/T vs. G/C content) of primer. A pair of bi-directional primers consists of one forward and one reverse primer as commonly used in the art of DNA amplification such as in PCR amplification.
The terms âstringencyâ or âstringent hybridization conditionsâ refer to hybridization conditions that affect the stability of hybrids, e.g., temperature, salt concentration, pH, formamide concentration and the like. These conditions are empirically optimized to maximize specific binding and minimize non-specific binding of primer or probe to its target nucleic acid sequence. The terms as used include reference to conditions under which a probe or primer will hybridize to its target sequence, to a detectably greater degree than other sequences (e.g. at least 2-fold over background). Stringent conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe or primer. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M Na+ion, typically about 0.01 to 1.0 M Na+ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes or primers (e.g. 10 to 50 nucleotides) and at least about 60° C. for long probes or primers (e.g. greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringent conditions or âconditions of reduced stringencyâ include hybridization with a buffer solution of 30% formamide, 1 M NaCl, 1% SDS at 37° C. and a wash in 2ĂSSC at 40° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1M NaCl, 1% SDS at 37° C., and a wash in 0.1ĂSSC at 60° C. Hybridization procedures are well known in the art and are described by e.g. Ausubel et al., 1998 and Sambrook et al., 2001. In some embodiments, stringent conditions are hybridization in 0.25 M Na2HPO4 buffer (pH 7.2) containing 1 mM Na2EDTA, 0.5-20% sodium dodecyl sulfate at 45° C., such as 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19% or 20%, followed by a wash in 5ĂSSC, containing 0.1% (w/v) sodium dodecyl sulfate, at 55° C. to 65° C.
As used herein, the term âsubstantially identicalâ refers to two polynucleotide sequences which vary in no more than 1, 2, 3, 4, 5, 6, or 7 nucleotides. When used in the context of cTAGs, the term substantially identical denotes two cTAGs that would be identical, except for a mutation in the PAM or protospacer region of on one of the cTAGs designed to abrogate CRISPR cleavage in at least one CRISPR landing site. When the term substantially identical is used in conjunction with the term âpartialâ sequence or cTAG, the combination refers to the comparison between two substantially identical cTAGs as described above, wherein one of the cTAGs has been digested by a CRISPR endonuclease. Thus the term would be used to indicate that the cTAG being described was identical to a second cTAG (in its undigested form), except for the mutation in the PAM or protospacer region.
As used herein, the term âpromoterâ refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. The promoter sequence may consist of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an âenhancerâ is a DNA sequence that can stimulate promoter activity, and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter.
As used herein, the term âheterologousâ refers to a nucleic acid sequence which is not naturally found in the particular organism.
As used herein, the term âendogenous,â âendogenous gene,â refers to the naturally occurring copy of a gene.
As used herein, the term ânaturally occurringâ refers to a gene or sequence derived from a naturally occurring source. In some embodiments a naturally occurring gene refers to a gene of a wild type (non-transgene) gene, whether located in its endogenous setting within the source organism, or if placed in a âheterologousâ setting, when introduced in a different organism. Thus, for the purposes of this disclosure, a ânon-naturally occurringâ sequence is a sequence that has been synthesized, mutated, or otherwise modified to have a different sequence from known natural sequences. In some embodiments, the modification may be at the protein level (e.g., amino acid substitutions). In other embodiments, the modification may be at the DNA level, without any effect on protein sequence (e.g., codon optimization). In some embodiments, the non-naturally occurring sequence may be a construct.
As used herein, the term âexogenousâ is used interchangeably with the term âheterologous,â and refers to a substance coming from some source other than its native source. For example, the terms âexogenous protein,â or âexogenous geneâ refer to a protein or gene from a non-native source or location, and that have been artificially supplied to a biological system. Artificially mutated variants of endogenous genes are considered âexogenousâ for the purposes of this disclosure.
As used herein, the phrases ârecombinant constructâ, âexpression constructâ, âchimeric constructâ, âconstructâ, and ârecombinant DNA constructâ are used interchangeably herein. A recombinant construct comprises an artificial combination of nucleic acid fragments, e.g., regulatory and coding sequences that are not found together in nature. For example, a chimeric construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. Such construct may be used by itself or may be used in conjunction with a vector. If a vector is used then the choice of vector is dependent upon the method that will be used to transform host cells as is well known to those skilled in the art. For example, a plasmid vector can be used. The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleic acid fragments of the disclosure. The skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al., (1985) EMBO J. 4:2411-2418; De Almeida et al., (1989) Mol. Gen. Genetics 218:78-86), and thus that multiple events must be screened in order to obtain lines displaying the desired expression level and pattern. Such screening may be accomplished by Southern analysis of DNA, Northern analysis of mRNA expression, immunoblotting analysis of protein expression, or phenotypic analysis, among others. Vectors can be plasmids, viruses, bacteriophages, pro-viruses, phagemids, transposons, artificial chromosomes, and the like, that replicate autonomously or can integrate into a chromosome of a host cell. A vector can also be a naked RNA polynucleotide, a naked DNA polynucleotide, a polynucleotide composed of both DNA and RNA within the same strand, a poly-lysine-conjugated DNA or RNA, a peptide-conjugated DNA or RNA, a liposome-conjugated DNA, or the like, that is not autonomously replicating. As used herein, the term âexpressionâ refers to the production of a functional end-product e.g., an mRNA or a protein (precursor or mature).
The term âoperably linkedâ means in the context the sequential arrangement of the promoter polynucleotide according to the disclosure with a further oligo- or polynucleotide, resulting in transcription of said further polynucleotide. In some embodiments, the promoter sequences of the present disclosure are inserted just prior to a gene's 5ⲠUTR, or open reading frame. In other embodiments, the operably linked promoter sequences and gene sequences of the present disclosure are separated by one or more linker nucleotides. The term âoperably linkedâ in the context of CRISPR protospacers and prospacer adjacent motifs (PAMs) refers to a proximately placed protospacer/PAM combination sequence that is capable of being cleaved at high efficiency by a CRISPR endonuclease complex.
The term âCRISPR RNAâ or âcrRNAâ refers to the RNA strand responsible for hybridizing with target DNA sequences, and recruiting CRISPR endonucleases. crRNAs may be naturally occurring, or may be synthesized according to any known method of producing RNA.
The term âguide sequenceâ or âspacerâ refers to the portion of a crRNA or guide RNA (gRNA) that is responsible for hybridizing with the target DNA.
The term âprotospacerâ refers to the DNA sequence targeted by a crRNA or guide strand. In some embodiments, the protospacer sequence hybridizes with the crRNA guide sequence of a CRISPR complex.
The term âseed regionâ refers to the ribonucleic sequence responsible for initial complexation between a DNA sequence CRISPR ribonucleoprotein complex. Mismatches between the seed region and a target DNA sequence have a stronger effect on target site recognition and cleavage than the remainder of the crRNA/sgRNA sequence. In some embodiments a single mismatch in the seed region of a crRNA/gRNA can render a CRISPR complex inactive at that binding site. In some embodiments, the seed regions for Cas9 endonucleases are located along the last Ë12 nt of the 3Ⲡportion of the guide sequence, which correspond (hybridize) to the portion of the protospacer target sequence that is adjacent to the PAM. In some embodiments, the seed regions for Cpf1 endonucleases are located along the first Ë5 nt of the 5Ⲡportion of the guide sequence, which correspond (hybridize) to the portion of the protospacer target sequence adjacent to the PAM.
The term âtracrRNAâ refers to a small trans-encoded RNA. TracrRNA is complementary to and basepairs with crRNA to form a crRNA/tracrRNA hybrid, capable of recruiting CRISPR endonucleases to target sequences.
The term âGuide RNAâ or âgRNAâ as used herein refers to an RNA sequence or combination of sequences capable of recruiting a CRISPR endonuclease to a target sequence. Thus as used herein, a guide RNA can be a natural or synthetic crRNA (e.g., for Cpf1), a natural or synthetic crRNA/tracrRNA hybrid (e.g., for Cas9), or a single-guide RNA (sgRNA).
The term âCRISPR landing siteâ as used herein, refers to a DNA sequence capable of being targeted by a CRISPR complex. Thus, in some embodiments, a CRISPR landing site comprises a proximately placed protospacer/Protopacer Adjacent Motif combination sequence that is capable of being cleaved a CRISPR endonuclease complex. The term âvalidated CRISPR landing siteâ refers to a CRISPR landing site for which there exists a guide RNA capable of inducing high efficiency cleaving of said sequence. Thus, the term validated should be interpreted as meaning that the sequence has been previously shown to be cleavable by a CRISPR complex. Each âvalidated CRISPR landing siteâ will by definition confirm the existence of a tested guide RNA associated with the validation.
The term âsticky end(s)â refers to double stranded polynucleotide molecule end that comprises a sequence overhang. In some embodiments, the sticky end can be a dsDNA molecule end with a 5Ⲡor 3Ⲡsequence overhang. In some embodiments, the sticky ends of the present disclosure are capable of hybridizing with compatible sticky ends of the same or other molecules. Thus, in one embodiment, a sticky end on the 3Ⲡof a first DNA fragment may hybridize with a compatible sticky end on a second DNA fragment. In some embodiments, these hybridized sticky ends can be sewn together by a ligase. In other embodiments, the sticky ends might require extension of the overhangs to complete the dsDNA molecule prior to ligation. The term âgenetic scar(s)â refers to any undesirable sequence introduced into a nucleic acid sequence by DNA manipulation methods. For example, in some embodiments, the present disclosure teaches genetic scars such as restriction enzyme binding sites, sequence adapters or spacers to accommodate cloning, TA-sites, scars left over from NHEJ, etc. In some embodiments, the present disclosure teaches methods of scarless cloning and gene editing.
As used herein the term âtargetedâ refers to the expectation that one item or molecule will interact with another item or molecule with a degree of specificity, so as to exclude non-targeted items or molecules. For example, a first polynucleotide that is targeted to a second polynucleotide, according to the present disclosure has been designed to hybridize with the second polynucleotide in a sequence specific manner (e.g., via Watson-Crick base pairing). In some embodiments, the selected region of hybridization is designed so as to render the hybridization unique to the one, or more targeted regions. A second polynucleotide can cease to be a target of a first targeting polynucleotide, if its targeting sequence (region of hybridization) is mutated, or is otherwise removed/separated from the second polynucleotide.
The disclosure refers to the taught and described universal modular CRISPR DNA constructs or designs as a âMegaModularâ construct or design.
In some embodiments, the present disclosure teaches methods and compositions for gene editing/cloning utilizing DNA nucleases. CRISPR complexes, transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), and Fokl restriction enzymes are some of the sequence-specific nucleases that have been used as gene editing tools. These enzymes are able to target their nuclease activities to desired target loci through interactions with guide regions engineered to recognize sequences of interest. In some embodiments, the present disclosure teaches CRISPR-based gene editing methods
The principles of in vivo CRISPR-based editing largely rely on natural cellular DNA repair systems. Double-stranded dsDNA breaks introduced by nucleases are repaired by either non-homologous end-joining (NHEJ) or homology-directed repair (HDR), or single strand annealing, (SSA), or microhomology end joining (MMEJ).
HDR relies on a template DNA containing sequences homologous to the region surrounding the targeted site of DNA cleavage. Cellular repair proteins use the homology between the exogenously supplied or endogenous DNA sequences and the site surrounding a DNA break to repair the dsDNA break, replacing the break with the sequence on the template DNA. Failure to integrate the template DNA however, can result in NHEJ, MMEJ, or SSA. NHEJ, MMEJ and SSA are error-prone processes that are often accompanied by insertion or deletion of nucleotides (indels) at the target site, resulting in genetic knockout (silencing) of the targeted region of the genome due to frameshift mutations or insertions of a premature stop codon. Cpf1-mediated editing can also function via traditional hybridization of overhangs created by the endonuclease, followed by ligation.
CRISPR endonucleases are also useful for in vitro DNA manipulations, as discussed in later sections of this disclosure.
CRISPR Systems
CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR-associated (cas) endonucleases were originally discovered as adaptive immunity systems evolved by bacteria and archaea to protect against viral and plasmid invasion. Naturally occurring CRISPR/Cas systems in bacteria are composed of one or more Cas genes and one or more CRISPR arrays consisting of short palindromic repeats of base sequences separated by genome-targeting sequences acquired from previously encountered viruses and plasmids (called spacers). (Wiedenheft, B., et. al. Nature. 2012; 482:331; Bhaya, D., et. al., Annu. Rev. Genet. 2011; 45:231; and Terms, M. P. et. al., Curr. Opin. Microbiol. 2011; 14:321). Bacteria and archaea possessing one or more CRISPR loci respond to viral or plasmid challenge by integrating short fragments of foreign sequence (protospacers) into the host chromosome at the proximal end of the CRISPR array. Transcription of CRISPR loci generates a library of CRISPR-derived RNAs (crRNAs) containing sequences complementary to previously encountered invading nucleic acids (Haurwitz, R. E., et. al., Science. 2012:329;1355; Gesner, E. M., et. al., Nat. Struct. Mol. Biol. 2001:18;688; Jinek, M., et. al., Science. 2012:337; 816-21). Target recognition by crRNAs occurs through complementary base pairing with target DNA, which directs cleavage of foreign sequences by means of Cas proteins. (Jinek et. al. 2012 âA Programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.â Science. 2012:337; 816-821).
There are at least five main CRISPR system types (Type I, II, III, IV and V) and at least 16 distinct subtypes (Makarova, K. S., et al., Nat Rev Microbiol. 2015. Nat. Rev. Microbiol. 13, 722-736). CRISPR systems are also classified based on their effector proteins. Class 1 systems possess multi-subunit crRNA-effector complexes, whereas in class 2 systems all functions of the effector complex are carried out by a single protein (e.g., Cas9 or Cpf1). In some embodiments, the present disclosure teaches using type II and/or type V single-subunit effector systems. Thus, in some embodiments, the present disclosure teaches using class 2 CRISPR systems.
CRISPR/Cas9
In some embodiments, the present disclosure teaches methods of gene editing using a Type II CRISPR system. In some embodiments, the Type II CRISPR system uses the Cas9 enzyme. Type II systems rely on a i) single endonuclease protein, ii) a transactiving crRNA (tracrRNA), and iii) a crRNA where a Ë20-nucleotide (nt) portion of the 5Ⲡend of crRNA is complementary to a target nucleic acid. The region of a CRISPR crRNA strand that is complementary to its target DNA protospacer is hereby referred to as âguide sequence.â
In some embodiments, the tracrRNA and crRNA components of a Type II system can be replaced by a single-guide RNA (sgRNA). The sgRNA can include, for example, a nucleotide sequence that comprises an at least 12-20 nucleotide sequence complementary to the target DNA sequence (guide sequence) and can include a common scaffold RNA sequence at its 3Ⲡend. As used herein, âa common scaffold RNAâ refers to any RNA sequence that mimics the tracrRNA sequence or any RNA sequences that function as a tracrRNA.
Cas9 endonucleases produce blunt end DNA breaks and are recruited to target DNA by a combination of a crRNA and a tracrRNA oligos, which tether the endonuclease via complementary hybridization of the RNA CRISPR complex. (see solid triangle arrows in FIG. 1A).
In some embodiments, DNA recognition by the crRNA/endonuclease complex requires additional complementary base-pairing with a protospacer adjacent motif (PAM) (e.g., 5â˛-NGG-3â˛) located in a 3Ⲡportion of the target DNA, downstream from the target protospacer. (Jinek, M., et. al., Science. 2012:337;816-821). In some embodiments, the PAM motif recognized by a Cas9 varies for different Cas9 proteins.
In some embodiments, one skilled in the art can appreciate that the Cas9 disclosed herein can be any variant derived or isolated from any source. For example, in some embodiments, the Cas9 peptide of the present disclosure can include one or more of SEQ ID Nos selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6. In other embodiments, the Cas9 peptide of the present disclosure can include one or more of the mutations described in the literature, including but not limited to the functional mutations described in: Fonfara et al. Nucleic Acids Res. 2014 February;42(4):2577-90; Nishimasu H. et al. Cell. 2014 Feb. 27;156(5):935-49; Jinek M. et al. Science. 2012 337:816-21; and Jinek M. et al. Science. 2014 Mar. 14;343(6176); see also U.S. patent application Ser. No. 13/842,859, filed Mar. 15, 2013, which is hereby incorporated by reference; further, see U.S. Pat. Nos. 8,697,359; 8,771,945; 8,795,965; 8,865,406; 8,871,445; 8,889,356; 8,895,308; 8,906,616; 8,932,814; 8,945,839; 8,993,233; and 8,999,641, which are all hereby incorporated by reference. Thus, in some embodiments, the systems and methods disclosed herein can be used with the wild type Cas9 protein having double-stranded nuclease activity, Cas9 mutants that act as single stranded nickases, or other mutants with modified nuclease activity.
CRISPR/Cpf1
In other embodiments, the present disclosure teaches methods of gene editing using a Type V CRISPR system. In some embodiments, the present disclosure teaches methods of using CRISPR from Prevotella and Francisella 1 (Cpf1).
The Cpf1 CRISPR systems of the present disclosure comprise i) a single endonuclease protein, and ii) a crRNA, wherein a portion of the 3Ⲡend of crRNA contains the guide sequence complementary to a target nucleic acid. In this system, the Cpf1 nuclease is directly recruited to the target DNA by the crRNA (see solid triangle arrows in FIG. 1B). In some embodiments, guide sequences for Cpf1 must be at least 12nt, 13nt, 14nt, 15nt, or 16nt in order to achieve detectable DNA cleavage, and a minimum of 14nt, 15nt, 16nt, 17nt, or 18nt to achieve efficient DNA cleavage.
The Cpf1 systems of the present disclosure differ from Cas9 in a variety of ways. First, unlike Cas9, Cpf1 does not require a separate tracrRNA for cleavage. In some embodiments, Cpf1crRNAs can be as short as about 42-44 bases longâof which 23-25 nt is guide sequence and 19 nt is the constitutive direct repeat sequence. In contrast, the combined Cas9 tracrRNA and crRNA synthetic sequences can be about 100 bases long. In some embodiments, the present disclosure will refer to a crRNA for Cpf1 as a âguide RNA.â
Second, Cpf1 prefers a âTTNâ PAM motif that is located 5Ⲡupstream of its target. This is in contrast to the âNGGâ PAM motifs located on the 3Ⲡof the target DNA for Cas9 systems. In some embodiments, the uracil base immediately preceding the guide sequence cannot be substituted (Zetsche, B. et al. 2015. âCpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas Systemâ Cell 163, 759-771, which is hereby incorporated by reference in its entirety for all purposes).
Third, the cut sites for Cpf1 are staggered by about 3-5 bases, which create âsticky endsâ (Kim et al., 2016. âGenome-wide analysis reveals specificities of Cpf1 endonucleases in human cellsâ published online June 06, 2016). These sticky ends with -3-5 nt overhangs are thought to facilitate NHEJ-mediated-ligation, and improve gene editing of DNA fragments with matching ends. The cut sites are in the 3Ⲡend of the target DNA, distal to the 5Ⲡend where the PAM is. The cut positions usually follow the 18th base on the non-hybridized strand and the corresponding 23rd base on the complementary strand hybridized to the crRNA (FIG. 1B).
Fourth, in Cpf1 complexes, the âseedâ region is located within the first 5 nt of the guide sequence. Cpf1 crRNA seed regions are highly sensitive to mutations, and even single base substitutions in this region can drastically reduce cleavage activity (see Zetsche B. et al. 2015 âCpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas Systemâ Cell 163, 759-771). Critically, unlike the Cas9 CRISPR target, the cleavage sites and the seed region of Cpf1systems do not overlap. Additional guidance on designing Cpf1 crRNA targeting oligos is available on (Zetsche B. et al. 2015. âCpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas Systemâ Cell 163, 759-771).
Persons skilled in the art will appreciate that the Cpf1 disclosed herein can be any variant derived or isolated from any source. For example, in some embodiments, the Cpf1 peptide of the present disclosure can include one or more of SEQ ID Nos selected from SEQ ID NO: 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or any variants thereof.
Ligases
In some embodiments, the present disclosure teaches methods of cleaving target DNA via targeted Cpf1 complexes, and then ligating the resulting sticky ends with DNA inserts. In some embodiments, the present disclosure teaches methods of providing a Cpf1 complex to cleave the target DNA, and a ligase to âsewâ the DNA back together. In other embodiments, the present disclosure teaches modified Cpf1 complexes that include a tethered ligase enzyme.
As used herein, the term âligaseâ can comprise any number of enzymatic or non-enzymatic reagents. For example, ligase is an enzymatic ligation reagent or catalyst that, under appropriate conditions, forms phosphodiester bonds between the 3â˛-OH and the 5â˛-phosphate of adjacent nucleotides in DNA molecules, RNA molecules, or hybrids.
In some embodiments, the present disclosure teaches the use of enzymatic ligases. Compatible temperature sensitive enzymatic ligases, include, but are not limited to, bacteriophage T4 ligase and E. coli ligase. Thermostable ligases include, but are not limited to, Afu ligase, Taq ligase, Tfl ligase, Tth ligase, Tth HB8 ligase, Thermus species AK16D ligase and Pfu ligase (see for example Published P.C.T. Application WO/2000/026381, Wu et al., Gene, 76(2):245-254, (1989), and Luo et al., Nucleic Acids Research, 24(15): 3071-3078 (1996)). The skilled artisan will appreciate that any number of thermostable ligases can be obtained from thermophilic or hyperthermophilic organisms, for example, certain species of eubacteria and archaea; and that such ligases can be employed in the disclosed methods and kits. In some embodiments, reversibly inactivated enzymes (see for example U.S. Pat. No. 5,773,258) can be employed in some embodiments of the present teachings.
In other embodiments, the present disclosure teaches the use of chemical ligation agents. Chemical ligation agents include, without limitation, activating, condensing, and reducing agents, such as carbodiimide, cyanogen bromide (BrCN), N-cyanoimidazole, imidazole, 1-methylimidazole/carbodiimide/cystamine, dithiothreitol (DTT) and ultraviolet light. Autoligation, i.e., spontaneous ligation in the absence of a ligating agent, is also within the scope of the teachings herein. Detailed protocols for chemical ligation methods and descriptions of appropriate reactive groups can be found in, among other places, Xu et al., Nucleic Acid Res., 27:875-81 (1999); Gryaznov and Letsinger, Nucleic Acid Res. 21:1403-08 (1993); Gryaznov et al., Nucleic Acid Res. 22:2366-69 (1994); Kanaya and Yanagawa, Biochemistry 25:7423-30 (1986); Luebke and Dervan, Nucleic Acids Res. 20:3005-09 (1992); Sievers and von Kiedrowski, Nature 369:221-24 (1994); Liu and Taylor, Nucleic Acids Res. 26:3300-04 (1999); Wang and Kool, Nucleic Acids Res. 22:2326-33 (1994); Purmal et al., Nucleic Acids Res. 20:3713-19 (1992); Ashley and Kushlan, Biochemistry 30:2927-33 (1991); Chu and Orgel, Nucleic Acids Res. 16:3671-91 (1988); Sokolova et al., FEBS Letters 232:153-55 (1988); Naylor and Gilham, Biochemistry 5:2722-28 (1966); and U.S. Pat. No. 5,476,930.
In some embodiments, the methods, kits and compositions of the present disclosure are also compatible with photoligation reactions. Photoligation using light of an appropriate wavelength as a ligation agent is also within the scope of the teachings. In some embodiments, photoligation comprises probes comprising nucleotide analogs, including but not limited to, 4-thiothymidine, 5-vinyluracil and its derivatives, or combinations thereof. In some embodiments, the ligation agent comprises: (a) light in the UV-A range (about 320 nm to about 400 nm), the UV-B range (about 290 nm to about 320 nm), or combinations thereof, (b) light with a wavelength between about 300 nm and about 375 nm, (c) light with a wavelength of about 360 nm to about 370 nm; (d) light with a wavelength of about 364 nm to about 368 nm, or (e) light with a wavelength of about 366 nm. In some embodiments, photoligation is reversible. Descriptions of photoligation can be found in, among other places, Fujimoto et al., Nucl. Acid Symp. Ser. 42:39-40 (1999); Fujimoto et al., Nucl. Acid Res. Suppl. 1:185-86 (2001); Fujimoto et al., Nucl. Acid Suppl., 2:155-56 (2002); Liu and Taylor, Nucl. Acid Res. 26:3300-04 (1998) and on the world wide web at: sbchem.kyoto-u.ac.jp/saito-lab.
In some embodiments, the present invention describes a strategy for the modular assembly of DNA constructs. In some embodiments the DNA assembly methods of the present disclosure are applicable to any construct, including plasmids, small linear DNA, and transformed chromosomal loci.
In aspects, the inventors refer to such a universal modular CRISPR DNA Construct as a âMegaModularâ design.
Shortcomings in Traditional DNA Editing and Assembly Techniques
Traditional multicomponent DNA cloning strategies are limited in their ability to effectively assemble and modify multi-component DNA constructs with complex sequences. For example, restriction enzyme cloning is limited by the availability of unique restriction enzyme recognition sites that are appropriately located at the cloning junctures at each of the DNA inserts, and their destination sites within a final vector. Gateway cloning technologies are similarly limited by the relatively small number of unique recombination sites available for multi-component assemblies.
Another downside to traditional DNA assembly techniques is that their ability to edit sequences is often restricted to the time of construction. For example, the products of efficient assembly strategies such as Ligase Cycling Reactions (LCR are not easily modified once the initial assembly is completed (Kok, S, et al., 2014 âRapid and Reliable DNA assembly via Ligase Cycling Reactionâ ACS Synth. Biol., 3 (2): 97-106). Similar concerns arise with traditional restriction enzyme cloning, whose common restriction recognition sites cease to function as unique cloning points once a polynucleotide containing the restriction sites is inserted into the construct being assembled, or when said construct is integrated into a chromosome full of said sites. Vectors produced through sequential restriction cloning thus provide very few options for fixing or updating sequences once the cloning process is well under way.
Even newer technologies, such as the traditional CRISPR DNA assembly techniques continue to suffer from similar complexity, the ease of iterating on a previous assembled construct/vector design, and speed limitations (Wang, J W. et al., 2015 âCRISPR/Cas9 nuclease combined with Gibson assembly for seamless cloningâ BioTechniques, Vol 58, No. 4:161-170). CRISPR cloning requires the design of a functional guide RNA targeted next to a compatible protospacer adjacent motif (PAM). Availability of suitable PAM sequences within target sites results in a significant design limitation to the number of possible DNA insertion locations within a genome or construct.
Moreover, the design and testing of guide RNA sequences imposes significant technical challenges for multi-component assemblies. Persons having skill in the art will recognize for example, that not all gRNA sequences are functional, and that effective implementation of a CRISPR DNA assembly may sometimes require the design and validation of multiple gRNA sequence variants. These limitations are particularly cumbersome in multi-component assemblies, where failure of a single gRNA sequence to successfully produce a desired modification can trigger the need to redesign subsequent assembly components that no longer fall within the original cloning plan. Applying techniques that require multiple custom guide RNAs for every junction of a multicomponent assembly can thus also be very expensive, cumbersome, and impractical.
Modular CRISPR Tag Assembly Vectors and Methods of Using Such
In some embodiments, the present disclosure teaches methods for DNA assembly that overcome many of the limitations associated with the aforementioned traditional techniques described above. In some embodiments, the present disclosure also teaches modular CRISPR assembly constructs, compositions, and kits for use with the methods of the present invention.
In some embodiments, the present disclosure teaches DNA constructs comprising one or more CRISPR multi-clonal sites (cMCS). In some embodiments, the cMCS of the present disclosure represent only a portion of the DNA constructs described (i.e., only a portion of the construct is readily editable according to the methods of the present disclosure). In other embodiments, the cMCS of the present disclosure are located on key positions within the entire construct, such that the entire DNA construct is readily editable. Thus, in some embodiments all the functional parts of the modular cTAG vectors (e.g., all origins, markers, cargo, elements required for assembly) are comprised within insert DNA parts and can be readily exchanged via the gene editing methods of the present disclosure.
In some embodiments, the cMCS of the present disclosure comprise one or more cloning tags (cTAG), each comprising at least one validated CRISPR targeting site. In some embodiments, the cMCS of the present disclosure further comprises DNA insert parts, each flanked by a pair of cTAGs, such that digestion of the cMCS with one or more CRISPR endonuclease targeting one or more cTAGs, will release said flanked insert part, allowing for insertion of a compatible donor DNA part.
FIGS. 2 and 3 of this specification illustrate an embodiment of a modular CRISPR assembly plasmid construct, according to the methods of the present disclosure. The disclosed example plasmid contains a series of DNA insertions (Parts 1-8 in FIG. 2A), each flanked by a pair of cTAGs (Tags A-H) in FIG. 2A. Digestion of cTAGs A and B of this example with the appropriate CRISPR/guide sequence complexes will release Part 2 of the plasmid, allowing for insertion of a replacement part 2 insert with the desired characteristics.
Persons having skill in the art will immediately recognize the advantages of the presently described vector system, which allows for the sequence-specific modular cloning/editing of vectors in vivo and in vitro. The sections below will outline the various aspects of the disclosed modular cloning vectors, as well as their various applications to molecular biology, gene therapy, and gene editing.
Modular CRISPR Vector Insert Parts
In some embodiments, the insert parts of the present disclosure are donor DNA sequences for homologous recombination insertion following a CRISPR digestion. Thus, in some embodiments, insert part sequences of the present disclosure comprise an insert sequence of interest, flanked by sequences with sufficient homology to the ends of the digested modular CRISPR construct, so as to trigger homologous recombination, hybridization and insertion of the sequence.
In other embodiments, the insert parts of the present disclosure are donor DNA sequences capable of hybridizing and ligation via sticky ends (e.g., following a Cpf1 digestion, restriction enzyme digestion, Gibson assembly, or other hybridization-based assembly, including LCR). Thus, in some embodiments, insert part sequences of the present disclosure comprise an insert sequence of interest, flanked by sequences with sufficient homology to the ends of the digested modular CRISPR construct, so as to allow for hybridization of sticky ends.
In yet other embodiments, the insert parts of the present disclosure are donor DNA sequences for blunt end ligation.
In some embodiments, the modular CRISPR DNA constructs of the present disclosure are compatible with any insert part sequence. Thus, the parts of the present vectors can comprise, without limitation, selectable markers, origins of replication, promoters, terminator sequences; other regulatory sequences, barcodes, recombination sites, or other sequences of interest to the user. In some embodiments, the insert parts of the present disclosure can comprise homology sequences for triggering homologous recombination and insertion into one or more genetic loci. In some embodiments, said homologous recombination insert parts will precede and follow other insert parts that will be also be inserted into the genome via the recombination event.
In some embodiments, the present disclosure teaches that each insert part comprises a single sequence (e.g., only a promoter or only a gene of interest, see FIG. 2A, part 8). In other embodiments, the present disclosure teaches that one or more insert parts may contain multiple elements, such as promoter-gene of interest (GOI) combinations, multi-subunit chimeric protein fusions, or even entire constructs (see FIG. 2A, part 5, comprising a promoter-GOI-terminator combination).
In some embodiments, the present disclosure teaches uncombined individual insert parts. That is, in some embodiments, the present disclosure teaches one or a plurality of unconnected insert parts (see FIG. 2A, right side showing a list of uncombined insert parts). In some embodiments, the present disclosure teaches methods of assembling said plurality of parts into one or more modular CRISPR constructs. In some aspects, the disclosure teaches kits for assembling a MegaModular construct.
In other embodiments, the present disclosure teaches partial- or fully- assembled modular CRISPR DNA constructs. For example, in some embodiments the present disclosure teaches modular CRISPR DNA constructs comprising 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more assembled insert parts, and any ranges therebetween. The disclosure also teaches kits comprising said insert parts.
In some embodiments, said assembled or partially assembled modular CRISPR DNA constructs are linear. In some embodiments, said assembled or partially assembled modular CRISPR DNA constructs are circular (e.g., a plasmid). In some embodiments, said assembled or partially assembled modular CRISPR DNA constructs are integrated into genomic DNA.
In some embodiments, the constructs of the present disclosure will initially contain only short spacer sequences as placeholders for further cloning (see âstufferâ sequence in FIG. 3C). In some embodiments the insert part placeholders are small, randomized sequences. In other embodiments, the vectors of the present disclosure will initially comprise one or more pre-selected insert DNA parts. For example, in some embodiments, the modular CRISPR constructs will initially comprise at least one selection marker, and/or at least one origin of replication.
Suitable selectable markers include, but are not limited to, genes that confer antibiotic resistance, genes that encode fluorescent proteins, tRNA genes, auxotrophic markers, toxic genes, phenotypic markers, antisense oligonucleotides, restriction endonucleases, restriction endonuclease cleavage sites, enzyme cleavage sites, protein binding sites, and sequences complementary to PCR primer sequences.
Suitable antibiotic resistance genes include, but are not limited to, a chloramphenicol resistance gene, an ampicillin resistance gene, a tetracycline resistance gene, a Zeocin resistance gene, a spectinomycin resistance gene and a kanamycin resistance gene.
In certain embodiments of the present invention, the counterselectable marker is a toxic gene. Suitable toxic genes include, but are not limited to, a ccdB gene, a gene encoding a tus protein which binds one or more ter sites, a kicB gene, a sacB gene, an ASKI gene, a ÎŚX174 E gene and a DpnI gene. In some embodiments, the presence of a toxic selectable marker serves as an indicator that an insertion was not conducted, or was unsuccessful. Toxic selectable markers may also serve to decrease background of unmodified parent vectors of positive cells, by causing death to cells harboring unmodified vectors with the toxic gene still in place.
In additional embodiments of the methods of the present invention, the modular CRISPR constructs may comprise both one or more toxic genes and one or more antibiotic resistance genes.
In some embodiments, the modular CRISPR constructs will initially comprise at least one regulatory sequence. In some embodiments, the present disclosure teaches vectors comprising, without limitation, Matrix Attachment Regions, expression insulator sequences, expression enhancer sequences, promoters, 5ⲠUTRs, 3ⲠUTRs, terminator sequences, stop codons, start codons, etc. In some embodiments, the modular CRISPR constructs will initially comprise sequences for facilitating chromosomal insertion of said construct (e.g., t-DNA borders, Cre/Lox, or homology ends to chromosomal sequences). In some embodiments, the sequences for chromosomal insertion are positioned so as to insert the entire modular CRISPR construct into the genome of an organism. In other embodiments, the sequences for chromosomal insertion are positioned so as to insert only a portion of the modular CRISPR construct (see FIG. 3D).
In some embodiments, the insert parts of the present disclosure can even comprise additional cTAGs. The addition of cTAGs, through insert parts, can increase the complexity of available cloning schemes, and can also expand the size of the construct by expanding the number of available insert parts that can be replaced.
In some embodiments, the insert parts of the present disclosure can comprise a traditional cloning site. For example, in some embodiments, the present disclosure teaches insert parts comprising gateway recombination sites, restriction sites, Cre/Lox sites, or other traditional cloning sites).
In some embodiments, the present disclosure teaches methods of producing insert parts from traditional DNA constructs. That is, in some embodiments, the present disclosure teaches methods of adding cTAGs to traditional DNA constructs (e.g., to oligos, PCR fragments, plasmids, or other available DNA segment). In some embodiments, the present disclosure teaches methods of adding cTAGs to a single component, such as a gene of interest (GOI), promoter. In other embodiments, the present disclosure teaches methods of adding cTAGS to multi-element constructs.
Persons having skill in the art will recognize methods for constructing insert parts. For example, in some embodiments, the cTAGs may be incorporated into a DNA molecule via PCR amplification with primers comprising said cTAGs. In other embodiments the cTAGs may be incorporated via traditional cloning techniques (e.g., restriction enzymes, Gibson, or other assembly method). In yet other embodiments, the cTAGs can be incorporated via blunt-end ligation.
In some embodiments, the insert parts of the present disclosure can have a wide species compatibility spectrum (e.g., a marker may contain both prokaryotic and eukaryotic expression sequences to make it effective in multiple organisms). In other embodiments, the insert parts of the present disclosure are designed to have limited applicability to organisms within a single species/genus/family/order/class/phylum/kingdom or domain. In some embodiments for example, an origin of replication part may be capable of maintaining a plasmid in only a single species, or a group of species. In other embodiments, a fluorescent marker may be codon optimized to function across both prokaryotic and eukaryotic domains.
In some embodiments Cas9 endonucleases cleave 3-4 nucleotides upstream from the PAM of a target sequence. cTAG digestion by a Cas9 complex can thus result in loss of cTAG functionality through the loss of the PAM sequence, or protospacer sequence of the target. In some embodiments, the present disclosure teaches methods of maintaining the functionality of said cTAG sequences by designing donor insert sequences such that they reconstitute the cTAG sequence upon insertion (e.g., through insertion of the previously lost PAM of protospacer sequence). Similar provisions are envisioned for sequences cleaved through Cpf1 endonucleases.
FIG. 2B illustrates the presently disclosed concept of cTAG repair. Cleavage of insert part 2 with a Cas9 endonuclease also results in loss of a portion of cTAGs A and B. Subsequent insertions of any one of insert parts 2a-2d via homologous recombination results in a restoration of the full cTAG sequence.
Persons having skill in the art will recognize the nearly infinite options for insert parts. The foregoing list of inserts was intended as illustrative, and should in no way be construed as limiting the applicability of the presently disclosed methods, kits, and constructs.
Modular CRISPR Cloning Tags
In some embodiments the modular CRISPR constructs of the present disclosure comprise one or more cloning tags (cTAGs). In some embodiments, the modular CRISPR constructs of the present disclosure comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more cTAGs.
In some embodiments, the present disclosure teaches that each cTAG comprises at least one validated CRISPR protospacer/PAM combination sequence (âCRISPR landing siteâ). That is, in some embodiments, cTAGs comprise at least one experimentally validated, high efficiency CRISPR landing site. In some embodiments, the cTAGs of the present disclosure may be validated by wet bench experimentation (e.g., in vitro cleavage of the cTAG sequence with a CRISPR complex targeting said CRISPR landing site). In other embodiments, the cTAG validation may be assumed from reports of cleavage in peer-reviewed journals.
In some embodiments, the cTAGs of the present disclosure comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more CRISPR landing sites. In some embodiments, the CRISPR landing sites overlap with each other. In other embodiments, the CRISPR landing sites occupy distinct non-overlapping regions within the cTAG. In some embodiments, the CRISPR landing sites can be specific for either Cas9 or Cpf1 endonuclease cleavage. In some embodiments, the CRISPR landing sites can be specific to any other current or yet to be discovered CRISPR endonuclease.
In other embodiments, the present disclosure teaches that multiple cloning sites in a single cTAG can be designed to function across different organisms. Thus in some embodiments, cTAG Cpf1 landing sites may be preferred in organisms lacking or downregulating HR machinery. In other embodiments, restriction sites of a cTAG may be preferred for initial in vitro cloning, while Cas9 or Cpf1 landing sites may be preferred for more complex editing occurring in vivo in selected eukaryotic organisms.
In some embodiments, the present disclosure teaches that cTAGs may comprise one or more non-CRISPR cloning sequences. For example, in some embodiments, the cTAGs of the present disclosure may comprise one or more elements selected from the group consisting of a restriction enzyme site, a recombination site, a topoisomerase site, a splicing site, and a Cre-Lox site.
In some embodiments, suitable restriction enzyme sites include, without limitation, sites recognized by restriction enzymes selected from the group consisting of AaII, AarI, AasI, AatII, Acc65I, AccB7I, AccI, AccIII, AciI, AclI, AcuI, AdeI, AfeI, AflII, AflIII, AgeI, AhdI, AleI, AloI, AluI, Alw21I, Alw26I, Alw44I, AlwI, AlwNI, ApaI, ApaLI, ApeKI, ApoI, AscI, AseI, AsiSI, AvaI, AvaII, AvrII, BaeI, BalI, BamHI, BanI, BanII, BbsI, BbuI, BbvCI, BbvI, BccI, BceAI, BcgI, BciVI, BclI, BcnI, BcuI, BfaI, BfiI, BfmI BfrBI, BfuAI, BfuCI, BfuI, BglI, Bg1II, BlpI, Bme1390I, Bme1580I, BmgBI, BmrI, BmtI, BoxI, BpiI, BplI, BpmI, Bpu10I, Bpu1102I, BpuEI, BsaAI, BsaBI, BsaHI, BsaI, BsaJI, BsaMI, BsaWI, BsaXI, BseDI, BseGI, BseJI, BseLI, BseMI, BseMII, BseNI, BseRI, BseSI, BseXI, BseYI, BsgI, Bsh1236I, Bsh1285I, BshNI, BshTI, BsiEI, BsiHKAI, BsiWI, BsII, BsmAI, BsmBI, BsmFI, BsmI, BsoBI, Bsp19I, Bsp120I, Bsp1286I, Bsp1407I, Bsp143I, Bsp143II, Bsp68I, BspCNI, BspDI, BspEI, BspHI, BspLI, BspMI, BspPI, BspQI, BspTI, BsrBI, BsrDI, BsrFI, BsrGI, BsrI, BsrSI, BssHII, BssKI, BssSI, Bst1107I, Bst98I, BstAPI, BstBI, BstEII, BstF5I, BstNI, BstOI, BstUI, BstXI, BstYI, BstZI, BstZ17I, Bsu15I, Bsu36I, BsuRI, BtgI, BtgZI, BtsCI, BtsI, BveI, Cac8I, CaiI, CfoI, Cfr10I, Cfr13I, Cfr42I, Cfr9I, CfrI, ClaI, CpoI, Csp45I, Csp6I, CspI, CspCI, CviaII, CviKI-1, CviQI, DdeI, DpnI, DpnII, DraI, DraIII, DrdI, EaeI, EagI, Eam1104I, Eam1105I, EarI, EciI, Ec1136II, EcIHKI, Eco105I, Eco130I, Eco147I, Eco24I, Eco31I, Eco32I, Eco47I, Eco47III, Eco52I, Eco57I, Eco57MI, Eco72I, Eco81I, Eco88I, Eco91I, EcolCRI, EcoNI, EcoO109I, EcoP15I, EcoRI, EcoRV, EbeI, Esp3I, FatI, FauI, Fnu4HI, FokI, FseI, FspI, FspAI, GsuI, HaeII, HaeIII, HgaI, HhaI, HinlI, Hin4I, Hin6I, HincII, HindIII, HinfI, HinP1I, HpaI, HpalI, HphI, Hpyl66II, Hpyl88I, Hpyl88III, Hpy8I, Hpy99I, HpyAV, HpyCH4III, HpyCH4IV, HpyCH4V, HpyF10VI, Hsp92I, Hsp921I, I-PpoI, KasI, Kpn2I, KpnI, KspAI, LweI, MbiI, MboI, MbolI, MfeI, MisI, MluI, MlyI, MmeI, MnII, Mph1103I, MscI, MseI, Ms1I, MspA1I, MspI, MssI, MunI, Mva1269I, MvaI, MwoI, NaeI, NarI, NciI, NcoI, NdeI, NdeII, NgoMIV, NheI, Nhel-HF, NlaIII, NlaIV, NmeAIII, NmuCI, NotI, NruI, NsbI, NsiI, NspI, OliI, PacI, PaeI, PaeR7I, PagI, PauI, PciI, PdiI, PdmI, Pf123II, PflFI, PflMI, PfoI, PhoI, PleI, PmeI, PmlI, PpiI, PpuMI, PshAI, PsiI, Psp1406I, Psp5II, PspGI, PspOMI, PspXI, PstI, PsuI, PsyI, PvuI, PvuII, PvuII-HF, RsaI, RsrII, SacI, SacII, SaII, SalI-HF, SapI, SatI, Sau3AI, Sau96I, SbfI, ScaI, ScaI-HF, SchI, ScrFI, SdaI, SduI, SexAI, SfaNI, SfcI, SfiI, SfoI, SgfI, SgrAI, SinI, SmaI, SmiI, SmlI, SmuI, SnaBI, SpeI, SphI, SphI-HF, SspI, StuI, StyD4I, StyI, SwaI, TaaI, TaiI, TaqÎąI, TaqI, TasI, TatI, TauI, TfiI, TliI, Tru1I, Tru91, TseI, Tsp45I, Tsp509I, TspMI, TspRI, Tth111I, TurboNaeI, TurboNarI, Van91I, VspI, XagI, XapI, XbaI, XceI, XcmI, XhoI, XhoII, XmaI, XmaJI, XmiI, XmnI, and ZraI. Aspects also include homing endonucleases such as: I-Scel, I-Ceul, and PI-PspI. The corresponding cleavage sites for these enzymes are known in the art.
In some embodiments the present disclosure teaches the use of rare restriction enzymes, recognizing sites greater than or equal to eight nucleotides in length (âĽ8 restriction enzymes). In some embodiments, the present disclosure teaches use of a single rare restriction site in each cTAG. In other embodiments, the cTAGs of the present disclosure may comprise two or more restriction sites. Table 1 below provides a list of cTAGs according to the present invention, each with their rare restriction enzyme sites bolded.
| TABLEâ1 |
| ExampleâcTAGâsequences,âCRISPRâlandingâsites,âandârareârestriction |
| enzymeâsitesâ(boldâsequenceâportionsâareârestrictionâsites) |
| TagA | ACTGGGTGGAATCCCTTCTGCAGCACCTGGATTACCCTGTTATCCCTAGT | I-SceI | SEQâID |
| NO:â65 | |||
| TagB | TAATGAGTAGTCCTCATCTCCCTCAAGCAGGCGCCGGCGGTACTGCCATC | MreI | SEQâID |
| NO:â66 | |||
| TagC | CATATAATCTCCCTCAAGCAGGCCCCGCTGGCGCGCGCGAATGTTAGGAA | MauBI | SEQâID |
| NO:â67 | |||
| TagD | GCCTATAATGTGAAGAGCTTCACTGAGTAGGGCCCGGGCTGTAAACGGTT | SrfI | SEQâID |
| NO:â68 | |||
| TagE | ATTCGCTAGCAGATGTAGTGTTTCCACAGGGGCGATCGCTGATATGGGTC | AsiSI | SEQâID |
| NO:â69 | |||
| TagF | ACTACCTAGCTGCATTTTCAGGAGGAAGCGATGGGCGGCCGCACACCTTC | NotI | SEQâID |
| NO:â70 | |||
| TagG | TGATAATGGGTGAGTGAGTGTGTGCGTGTGGGGCGCGCCAGATGGGAACA | AscI | SEQâID |
| NO:â71 | |||
| TagH | ACTCCAGTCTTTCTAGAAGATGGCAAACAGCTATTATGGGTATTATGGGT | PI- | SEQâID |
| PspI | NO:â72 | ||
| TagI | TAGTGGACGGGGCCACTAGGGACAGGATTGGCCTGCAGGATTCCCGTCAA | SbfI | SEQâID |
| NO:â73 | |||
| TagJ | TGAACTAAGGCGGCTGCACAACCAGTGGAGâGCCTAAATGATC | none | SEQâID |
| NO:â74 | |||
In some embodiments, suitable recombination sites for use in the present invention include, but are not limited to: attB sites, attP sites, attL sites, attR sites, lox sites, psi sites, tnpI sites, dif sites, cer sites, frt sites, and mutants, variants and derivatives thereof. In certain embodiments of the present invention, the topoisomerase recognition site, if present, is recognized and bound by a type I topoisomerase, which may be a type IB topoisomerase. Suitable types of type IB topoisomerase include, but are not limited to, eukaryotic nuclear type I topoisomerase and poxvirus topoisomerase. In some embodiments, suitable types of poxvirus topoisomerase include, but are not limited to, poxvirus topoisomerase produced by or isolated from a virus such as vaccinia virus, Shope fibroma virus, ORF virus, fowlpox virus, molluscum contagiosum virus and Amsacta morreientomopoxvirus.
In some embodiments, cTAG arrangement of CRISPR and non-CRISPR cloning sites can be ordered according to user preference. In some embodiments, the present disclosure teaches that CRISPR binding sites should be ordered so as to be the furthest away from insert parts. In one illustrative embodiment, a cTAG could be arranged as follows from 5â˛-3â˛: (Part I)-[R1-A1-C-A2-R2]-(Part II), where R=restriction site, A=recombinase site, and C=CRISPR landing site. In some embodiments, C may include multiple overlapping, or sequential CRISPR and/or restriction landing sites. In some embodiments, the arrangement of cloning sites on a cTAG of the present disclosure will be symmetrical (i.e., provide for a symmetrical order of types of cloning sites).
In other embodiments, arrangement of cloning sites on a cTAG of the present disclosure may be non-symmetrical. For example, in another illustrative embodiment, a cTAG could be arranged as follows from 5â˛-3â˛: (Part I)-[R1-A1-C1-C2]-(Part II), where R=restriction site, A=recombinase site, and C1-2=CRISPR landing site(s). In yet other embodiments, a cTAG could be arranged as follows from 5â˛-3â˛: i) (Part I)-[R1-C1-C2]-(Part II), ii) (Part I)-[R1-C1]-(Part II), iii) (Part I)-[C1-C2]-(Part II), or their reverse order, wherein R=restriction site, A=recombinase site, and C1-2=CRISPR landing site(s).
Persons having skill in the art will recognize the advantages and applications of various cTAG arrangements. For example, in single-tag embodiments, the modular construct would allow for insertion with the digestion of a single CRISPR endonuclease, but would not (without more, for example further digestion of additional cTAGs) allow for removal or replacement of said insertion, due to the lack of a second flanking cTAG site. In some embodiments, the present disclosure teaches that inserted parts may themselves contain additional cTAGs, to expand the number of possible insert part locations within the cMCS.
In other embodiments, the present disclosure teaches methods of removing one or more insert parts from the modular CRISPR constructs. In some embodiments, two or more of the cTAGs of a modular CRISPR construct comprise restriction enzyme binding sites capable of creating compatible ends. In some embodiments, the restriction enzyme sites are identical. In other embodiments the restriction enzyme sites are distinct, but the resulting digestion of said sites produces compatible ends for hybridization and ligation. In some embodiments, the restriction sites for deletion of portions of a modular CRISPR construct are placed on other ends of two or more cTAGS, such that the resulting ligated construct will still maintain the same ratio of insert parts to cTAGS.
In some embodiments, the present disclosure teaches that the restriction enzyme sites used for deletions within the modular CRISPR constructs of the present disclosure can be any restriction enzyme that results in compatible ends. In other embodiments, the present disclosure teaches that the restriction enzyme sites used for deletions within the modular CRISPR constructs of the present disclosure can be any rare 8âĽbase restriction enzyme that result in compatible ends. In selected embodiments, the present disclosure teaches that the restriction enzyme sites used for deletions within the modular CRISPR constructs of the present disclosure can be I-SceI and PI-PspI.
In some embodiments, the present disclosure teaches modular CRISPR constructs with two cTAGs flanking each insert part, so as to create a cTAG pair. In some embodiments, the aforementioned cTAG pairs allow for the selective cutting/replacement of insert parts. For example, as illustrated in FIG. 2B, digestion of the modular CRISPR plasmid with endonucleases targeting cTAGs A and B would result in the specific removal of insert part 2.
As discussed above, selected embodiments of the present disclosure provide for replacement insert parts which restore cTAG function following endonuclease cleavage. Thus, as illustrated in FIG. 2B, replacement insert parts 2a-2d comprise sequences that will restore cTAG A and B function upon insertion into the modular CRISPR plasmid.
In some embodiments, the present disclosure teaches that cTAGs can also control insert part directionality. Sequence homology between cTAG ends in insert parts and cleaved cTAGs in the modular CRISPR construct will determine insertion directionality for Cas9 cleaved sequences, either through homologous recombination or hybridization (e.g., in Gibson approaches). Insertion directionality in Cpf1 sequences may also be controlled via Watson crick hybridization of Cpf1sticky ends on either cTAG.
In some embodiments, the present disclosure also provides for alternative cTAG arrangements. For example, in some embodiments, the modular CRISPR constructs of the present disclosure may be designed such as to provide functionality for the use of nested cTAGs.
In some embodiments, the present disclosure teaches component-based CRISPR assemblies based on shared overlapping âtagâ regions that enable multicomponent assembly in vitro and in vivo. In some embodiments, the tags of the present disclosure comprise CRISPR landing sites to facilitate future cloning or in vitro DNA assembly from DNA constructs. If DNA constructs are integrated into the genome of a host organism, preselected Cas9 or Cpf1 landing sites may facilitate facile genetic alterations. In a single suite of experiments, the assembly strategy enables construction of DNA plasmids that can be used in multiple organisms, containing multiple numbers and types of DNA components.
In some embodiments, this assembly strategy can be used to assemble and quickly reassemble plasmids encoding any desired set of DNA components, including metabolic pathways. In other embodiments, designing cTAGs into integrating plasmids can also be used to swap DNA components directly in and out of the genome of host organisms, circumventing the need to clone future plasmids.
cTAG Sequence Design Algorithm
In some embodiments, the present disclosure teaches algorithms designed to facilitate CRISPR landing sites within cTAGs. In some embodiments, the CRISPR landing sites are sequences identified from existing sequences. Thus, in some embodiments, the present disclosure teaches use of software programs is designed to identify candidate CRISPR target sequences on both strands of an input DNA sequence based on desired guide sequence length and a CRISPR motif sequence (PAM, protospacer adjacent motif) for a specified CRISPR enzyme. For example, target sites for Cpf1 from Francisella novicida U112, with PAM sequences TTN, may be identified by searching for 5â˛-TTN- 3Ⲡboth on the input sequence and on the reverse-complement of the input. The target sites for Cpf1 from Lachnospiraceae bacterium and Acidaminococcus sp., with PAM sequences TTTN, may be identified by searching for 5â˛-TTTN-3Ⲡboth on the input sequence and on the reverse complement of the input. Likewise, target sites for Cas9 of S. thermophilus CRISPRI, with PAM sequence NNAGAAW, may be identified by searching for 5â˛-Nx-NNAGAAW-3Ⲡboth on the input sequence and on the reverse-complement of the input. The PAM sequence for Cas9 of S. pyogenes is 5â˛-NGG-3â˛.
Likewise, target sites for Cas9 of S. thermophilus CRISPR, with PAM sequence NGGNG, may be identified by searching for 5â˛-N, âNGGNG-3Ⲡboth on the input sequence and on the reverse-complement of the input.
In other embodiments, the present disclosure teaches methods of designing CRISPR landing sites from scratch. Persons having skill in the art will readily be able to design CRISPR landing sites in conjunction with the guide RNAs of the present disclosure, wherein the resulting protospacer sequence is combined with the PAM motif appropriate to the desired CRISPR endonuclease, as described above.
In some embodiments, the present disclosure teaches cTAGs comprising a sequence selected from the group consisting of: SEQ ID NO. 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 78, 79, 80, 81, and combinations thereof.
Since multiple occurrences in the genome of the DNA target site may lead to nonspecific genome editing, after identifying all potential sites, the present disclosure teaches, in some embodiments, filtering out sequences based on the number of times they appear in the relevant reference genome or modular CRISPR construct. For those CRISPR enzymes for which sequence specificity is determined by a âseedâ sequence (such as the first 5 nt of the guide sequence for Cpf1-mediated cleavage) the filtering step may also filter out different sequences with the same seed.
In some embodiments algorithmic tools can also identify potential off target sites for a particular guide sequence. For example, in some embodiments Cas-Offinder can be used to identify potential off target sites for Cpf1 (see Kim et al., 2016. âGenome-wide analysis reveals specificities of Cpf1 endonucleases in human cellsâ published online June 06, 2016). Any other publicly available CRISPR design/identification tool may also be used, including for example the Zhang lab's crispr.mit.edu tool (see Hsu, et al. 2013 âDNA targeting specificity of RNA_guided Cas9 nucleasesâ Nature Biotech 31, 827-832).
In some embodiments, the user may be allowed to choose the length of the seed sequence. The user may also be allowed to specify the number of occurrences of the seed:PAM sequence in a genome for purposes of passing the filter. The default is to screen for unique sequences. Filtration level is altered by changing both the length of the seed sequence and the number of occurrences of the sequence in the genome. The program may, in addition, or alternatively, provide the sequence of a guide sequence complementary to the reported target sequence(s) by providing the reverse complement of the identified target sequence(s).
In some embodiments, the present disclosure teaches methods for preparing new recombinant nucleic acid molecules using the modular CRISPR DNA constructs of the present disclosure. In some embodiments, the present disclosure teaches methods of DNA part assembly. Descriptions of each method are provided below.
DNA Assembly Methods
In some embodiments, the present disclosure teaches methods for the modular assembly of DNA parts. In some embodiments, the DNA assembly methods of the present disclosure are conducted in vitro. Thus, in some embodiments, the present disclosure teaches the steps of i) forming a mixture comprising at least two insert part DNAs together with at least one CRISPR complex, and ii) allowing said mixture to incubate in conditions for CRISPR digestion of the insert DNAs, iii) followed by hybridizing the compatible sticky ends from the digestion of each of the two insert part DNAs, and iv) ligating said hybridized ends to one another to create the new recombinant nucleic acid. Thus, in some embodiments, the insert part DNAs of the present disclosure are digested together. In other embodiments, the present disclosure teaches methods of digesting each insert part DNA individually, with the same or different CRISPR complexes. In some embodiments, at least one insert part is not digested by a CRISPR complex. In some embodiments, the present disclosure teaches that an exonuclease treatment is conducted prior to the hybridization of step iii) (for dual CRISPR digestions as described in later sections).
In yet other embodiments, the present disclosure teaches Gibson-like joining of insert parts, by exposing the insert part ends to an ssDNA exonuclease, and hybridizing the resulting sticky ends followed by an optional fill with polymerase, and ligation. In some embodiments one or more insert parts are exposed to a dsDNA exonuclease prior to the ssDNA exonuclease treatment. In some embodiments, the present disclosure teaches Gibson-like joining of insert parts or modular CRISPR vectors that have been digested by one or more CRISPR endonuclease (e.g., dual CRISPR digestions, as described in later sections).
The sections below provide a series of illustrative examples demonstrating the various ways in which the insert parts and modular CRISPR constructs of the present disclosure can be assembled and edited. The list of techniques described below provides an illustrative series of examples highlighting the utility of the sequences of the present disclosure, but is not intended to be limiting. Persons having skill in the art will recognize other techniques that allow for the assembly and editing of insert parts according to the present disclosure.
In some embodiments, the present disclosure describes methods involving Cpf1 and/or Cas9 CRISPR endonucleases. Reference to these specific CRISPR endonucleases is illustrative, and is not intended to be limiting, unless specified in a claim. Persons having skill in the art will immediately recognize the applicability of other existingâor heretofore undiscovered CRISPR endonucleases to the constructs and methods of the present disclosure. References to Cpf1 may be interpreted as encompassing use of any presently known or undiscovered CRISPR endonuclease capable of catalyzing staggered DNA cleavage to produce sticky DNA ends. References to Cas9 may similarly be interpreted as encompassing use of any presently known or undiscovered CRISPR endonuclease capable of catalyzing blunt end cleavage of dsDNA.
In Citro Cpf1
In some embodiments, the in vitro DNA assemblies of the present disclosure are conducted with Cpf1 CRISPR complexes as described below. First, two or more insert parts are incubated with a Cpf1 CRISPR complex targeting the cTAG that is common between the at least two insert parts. In some embodiments, the insert parts are incubated together in a single mixture. In other embodiments, the insert parts are incubated in different mixtures.
Second, in some embodiments, the digested products are purified to remove active CRISPR nuclease. In some embodiments, the purification involves separation of the active Cpf1 complex from the digested insert parts. In some embodiments, this can be accomplished through a DNA purification, such as a gel or column purification. In other embodiments, the purification can be accomplished by Cpf1 inactivation, such as through heat or chemical inactivation.
Third, the digested insert parts are incubated in conditions appropriate for hybridization of the compatible sticky ends created by the Cpf1 complex. Hybridized ends are then ligated according to any known ligation methods, including those described in earlier portions of this disclosure.
In Vitro Cas9
In other embodiments, the in vitro DNA assemblies of the present disclosure are conducted with Cas9 CRISPR complexes as described below. First, two or more insert parts are incubated with a Cas9 CRISPR complex targeting the cTAG that is common between the at least two insert parts. In some embodiments, the insert parts are incubated together in a single mixture. In other embodiments, the insert parts are incubated in different mixtures.
Second, in some embodiments, the digested products are purified to remove active CRISPR nuclease. In some embodiments, the purification involves separation of the active Cas9 complex from the digested insert parts. In some embodiments, this can be accomplished through a DNA purification, such as a gel or column purification. In other embodiments, the purification can be accomplished by Cas9 inactivation, such as through heat or chemical inactivation.
In some embodiments, the third step for Cas9 digested products is to incubate the insert parts in conditions appropriate for blunt end-ligation.
Dual CRISPR Assemblies
In other embodiments, the present disclosure also teaches Gibson-assembly type methods for assembling the pieces of CRISPR-digested insert parts with at least one shared cTAG sequence (e.g., assembly of compatible cTAGs digested at different CRISPR landing sites). Thus, in some embodiments, the present disclosure teaches dual CRISPR digestion assemblies as described below.
First, two or more insert parts are incubated with two CRISPR complexes targeting two different CRISPR landing sites flanking each part within the aforementioned cTAGs that are common between the at least two insert parts.
In some embodiments, the two different CRISPR landing sites are digested together. In other embodiments, one insert part DNA is digested with one CRISPR complex targeting one CRISPR landing site, and the other insert part DNA is digested with a different CRISPR complex targeting the second CRISPR landing target site in separate vessels. In each case, the result of these digestions will be that the shared cTAG in each of the two insert DNA cTAGs will comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bp of sequence overlap with each other.
For example, in an illustrative embodiment, the shared cTAG between two insert DNA parts would be arranged as follows from 5â˛-3â˛: (Part I)-[R1-C1-C2]-(Part II), where R=restriction site, C1=a first CRISPR landing site and C2=a second CRISPR landing site. In this illustrative embodiment, the first insert DNA part with a 3Ⲡshared cTAG would be digested with a CRISPR complex targeting C2 and the second insert DNA part with a 5Ⲡshared cTAG would be digested with a CRISPR complex targeting C1. This would result in two DNA insert parts with overlapping sequence spanning C1-C2.
Second, in some embodiments, the digested products are purified to remove active CRISPR nuclease. In some embodiments, the purification involves separation of the active CRISPR complex from the digested insert parts. In some embodiments, this can be accomplished through a DNA purification, such as a gel or column purification. In other embodiments, the purification can be accomplished by CRISPR inactivation, such as through heat or chemical inactivation.
Third, in some embodiments, the CRISPR-digested insert parts are incubated with a ssDNA exonuclease to create overlapping sticky ends between the two insert DNA parts.
Fourth, the digested insert parts are incubated in conditions appropriate for hybridization of the compatible sticky ends created by the CRISPR complex/exonuclease digestions. Hybridized ends are then ligated according to any known ligation methods, including those described in earlier portions of this disclosure. In some embodiments, the hybridized parts are incubated with a polymerase to fill in any missing sequence gaps prior to ligation.
Bridging Assemblies
In other embodiments, the present disclosure teaches Gibson-assembly of Cas9 digested parts, through the addition of a third DNA sequence comprising a bridging sequence that overlaps with the digested cTAG sequences of the insert parts.
In this illustrative example, both insert parts are digested with the same Cas9 CRISPR complex targeting the same CRISPR landing site. In this embodiment, the resulting digested cTAGs would have no sequence overlap. Thus, in some embodiments, the third step is for Cas9 digested insert parts to be further digested with an ssDNA exonuclease to create either 3Ⲡor 5Ⲡoverhang. The exonuclease digested insert parts are then incubated in conditions appropriate for hybridization of the compatible sticky ends created by the combination of the CRISPR complex and exonuclease digestions with the bridging sequence. Hybridized ends are then ligated according to any known ligation methods, including those described in earlier portions of this disclosure. In some embodiments the exonuclease digestion of the present disclosure is conducted before the second step.
In Vitro HDR
In other embodiments, the present disclosure teaches in vitro methods of assembling the ends of insert part DNAs digested by a Cas9 or Cpf1 endonuclease with an HDR complex, thereby triggering recombination of said digested insert parts.
In Vivo Homologous Recombination
In some embodiments, the in vivo DNA assemblies of the present disclosure are conducted with Cpf1 or Cas9 CRISPR complexes as described below. In one embodiment, two or more insert parts with at least one shared cTAG are introduced into a host cell. In some embodiments, the presence of DNA insert parts with homologous shared cTAG sequences will be sufficient to trigger homologous recombination assembly (e.g., yeast homologous recombination).
For example, in some embodiments, at least one shared cTAG sequence between the two insert DNA parts could be assembled to produce a linear construct. In this illustrative embodiment the two remaining outer cTAGs could also be designed to recombine with cTAGs of another vector within the cell (e.g., insertion into an existing plasmid, or a chromosome). In other embodiments, the two parts could be further assembled into a circular construct through the recombination of a second shared cTAG between the two insert DNA parts. The assembled construct can be either used in the organism that was used for the assembly, or can, in some embodiments, be purified and transformed into a second organism (e.g., assembly in yeast, and subsequent transformation into bacteria).
In other embodiments, one or more insert parts with a shared cTAG can be digested prior to introduction into the host cell. Thus, in some embodiments, the present disclosure teaches CRISPR digestions to release insert parts from larger vectors prior to in vivo assembly of the released parts. In some embodiments, the digestion is carried out with Cas9. In other embodiments the digestion is carried out with Cpf1. In other embodiments the digestion is carried out with restriction endonucleases. In some embodiments the CRISPR digestions of insert parts are conducted in vitro. In some embodiments, the digested products are purified to remove active CRISPR endonuclease prior to transformation of the insert parts into the assembly host cell.
In some embodiments, the purification step can be accomplished through a DNA purification, such as a gel or column purification. In other embodiments, the purification can be accomplished by CRISPR inactivation, such as through heat or chemical inactivation.
In Vivo Ligation
In some embodiments, the present disclosure teaches methods of protecting insert parts from re-cleavage by the CRISPR endonuclease. In some embodiments, the insert parts of the present disclosure may be protected from endonuclease cleavage via chemical modification of the DNA sequence. For example, in some embodiments, the present disclosure teaches phosphorothioate oligonucleotides.
In some embodiments, the methods of the present disclosure are especially useful for multi-part DNA assemblies.
FIG. 2A of the specification provides an illustrative example of a multi-part DNA assembly, according to the methods of the present disclosure. In this example, a series of eight DNA parts (parts 1-8), each with two cTAGs (tags A-H) are combined in vitro and are then able to self-assemble (either via homologous recombination in vivo, or via ligation, as described above).
DNA Editing Methods
In some embodiments, the present disclosure teaches methods for the editing of modular CRISPR DNA constructs. In some embodiments, the DNA editing methods of the present disclosure apply the same principles of the DNA assembly methods described above, but do so for the purposes of editing one or more pre-existing modular CRISPR DNA constructs.
In some embodiments, the DNA editing methods of the present disclosure are conducted in vitro. Thus, in some embodiments, the present disclosure teaches the steps of i) forming a mixture comprising a modular CRISPR DNA construct, and at least one insert DNA part, together with at least one CRISPR complex, and ii) allowing said mixture to incubate in conditions for CRISPR digestion of the cTAGS of the insert DNA, and its corresponding modular CRISPR DNA construct cTAGs, followed by iii) hybridizing the compatible sticky ends (if Cpf1) produced by the digestion of each of the aforementioned cTAGs, and iv) ligating said hybridized ends (or blunt ends, if Cas9 is used) to one another to create the new recombinant nucleic acid. In some embodiments, an exonuclease treatment is conducted prior to the hybridization of step iii) (for dual CRISPR digestions as described in later sections). In some embodiments, the digestions of the present disclosure are conducted separately for the insert part DNA and modular CRISPR DNA construct. In some embodiments, only the modular CRISPR DNA construct is digested with a CRISPR complex.
In Vitro Cpf1
In some embodiments, the in vitro DNA editing methods of the present disclosure are conducted with Cpf1 CRISPR complexes as described below. First, a modular CRISPR DNA construct, and at least one insert DNA part are incubated with a Cpf1 CRISPR complex targeting the cTAGs of the insert parts, and their corresponding tags within the modular CRISPR DNA construct. In some embodiments, the digestion of the modular CRISPR DNA and the insert part DNA is conducted in separate reactions.
Second, in some embodiments, the digested products are purified to remove active CRISPR nuclease. In some embodiments, the purification involves separation of the active Cpf1 complex from the digested nucleotides. In some embodiments, this can be accomplished through a DNA purification, such as a gel or column purification. In other embodiments, the purification can be accomplished by Cpf1 inactivation, such as through heat or chemical inactivation.
Third, the digested modular CRISPR DNA construct and insert parts are incubated in conditions appropriate for hybridization of the compatible sticky ends created by the Cpf1complex. Hybridized ends are then ligated according to any known ligation methods, including those described in earlier portions of this disclosure.
In Vitro Cas9
In other embodiments, the in vitro DNA editing methods of the present disclosure are conducted with Cas9 CRISPR complexes as described below. First, a modular CRISPR DNA construct, and at least one insert DNA part are incubated with a Cas9 CRISPR complex targeting the cTAGs of the insert parts, and their corresponding tags within the modular CRISPR DNA construct. In some embodiments, the digestion of the modular CRISPR DNA and the insert part DNA are conducted in separate reactions.
Second, in some embodiments, the digested products are purified to remove active CRISPR nuclease. In some embodiments, the purification involves separation of the active Cas9 complex from the digested nucleotides. In some embodiments, this can be accomplished through a DNA purification, such as a gel or column purification. In other embodiments, the purification can be accomplished by Cas9 inactivation, such as through heat or chemical inactivation.
In some embodiments, the third step for Cas9 digested products is to incubate the insert parts in conditions appropriate for blunt end-ligation.
Gibson Editing
In other embodiments, the present disclosure also teaches Gibson-assembly type methods for editing the sequences of CRISPR-digested constructs and/or undigested insert parts containing intact overlapping cTAG sequence. Thus, in some embodiments, the third step is for Cas9 digested modular CRISPR DNA construct and insert part(s) to be further digested with an ssDNA exonuclease to create either a 3Ⲡor 5Ⲡoverhang. In some embodiments, the present disclosure teaches dsDNA exonuclease digestion to shorten the non-CRISPR digested insert parts prior to the ssDNA digestion.
The exonuclease digested DNA sections are then incubated under conditions appropriate for hybridization of the compatible sticky ends created by the combination of the CRISPR complex and exonuclease digestions. Hybridized ends are then ligated according to any known ligation methods, including those described in earlier portions of this disclosure. In some embodiments the hybridized DNA is incubated with a polymerase to fill in missing DNA sections prior to ligation. In some embodiments the exonuclease digestion of the present disclosure is conducted before the CRISPR inactivation step.
In some embodiments, the ligation of digested sequences can occur in vitro.
In other embodiments, the present disclosure teaches in vitro methods of assembling the ends of a modular CRISPR DNA construct digested by a Cas9 or Cpf1 endonuclease, and at least one undigested insert with an HDR complex, thereby triggering recombination of said digested modular CRISPR DNA construct, and at least one insert DNA part.
In some embodiments of the DNA editing methods of the present disclosure, the DNA insert parts are comprised within a second modular CRISPR DNA construct. Thus, in some embodiments, the DNA editing methods of the present disclosure comprise the transfer of a DNA insert part from one modular CRISPR DNA construct to another.
In some embodiments, the present disclosure teaches methods and compositions of vectors, constructs, and nucleic acid sequences encoding CRISPR complexes. In some embodiments, the present disclosure teaches plasmids for transgenic or transient expression of the Cas9 or Cpf1proteins. In some embodiments the present disclosure teaches a plasmid encoding chimeric Cas9 or Cpf1 proteins comprising in-frame sequences for protein fusions of one or more of the other polypeptides described herein, including, but not limited to a ligase, a linker, and an NLS.
In some embodiments the plasmids and vectors of the present disclosure will encode for the Cas9/Cpf1 protein(s) and also encode the crRNA/tracrRNA/sgRNA, and/or donor insert sequences of the present disclosure. In other embodiments, the different components of the engineered complex can be encoded in one or more distinct plasmids.
In some embodiments, the plasmids of the present disclosure can be used across multiple species. In other embodiments, the plasmids of the present disclosure are tailored to the organism being transformed. In some embodiments, the sequences of the present disclosure will be codon-optimized to express in the organism whose genes are being edited. Persons having skill in the art will recognize the importance of using promoters providing adequate expression for gene editing. In some embodiments, the plasmids for different species will require different promoters.
In some embodiments, the plasmids and vectors of the present disclosure are selectively expressed in the cells of interest. Thus in some embodiments, the present application teaches the use of ectopic promoters, tissue-specific promoters, developmentally-regulated promoters, or inducible promoters. In some embodiments, the present disclosure also teaches the use of terminator sequences.
In some embodiments, the present disclosure also teaches methods of expressing and purifying Cpf1 and/or Cas9 endonuclease protein. In some embodiments, the present disclosure teaches that the proteins of the present disclosure may be produced by any of the commercially available protein production and purification kits or services. For example, in some embodiments, the present disclosure teaches methods of cloning Cas9 and/or Cpf1 into a vector with a polyhistidine (His), glutathione s-transferase (GST), or other purification tag chimeric fusion. In some embodiments the present disclosure teaches a variety of prokaryotic and eukaryotic organisms, and cell-free protein production systems. For example, in some embodiments, the present disclosure teaches expression of protein expression plasmids in E. coli BL21. In some embodiments, the protein production system will be inducible, to reduce the effects of protein toxicity. For example, in some embodiments, the present disclosure teaches methods of using the IPTG or an arabinose induction system.
In some embodiments, the present disclosure also teaches various protein purification schemes, including affinity tags (His-Nickel, GST-Glutathione, etc.). In some embodiments, the present disclosure teaches both native and denaturing conditions for protein purification.
In other embodiments, the present disclosure teaches production of Cas9 and/or Cpf1 via one or more protein production services, including, but not limited to GenScriptÂŽ, ThermoFisherÂŽ, and NovoProteinÂŽ.
In some embodiments, the present disclosure teaches the use of transformation of the plasmids and vectors disclosed herein. Persons having skill in the art will recognize that the plasmids of the present disclosure can be transformed into cells through any known system as described in other portions of this specification. For example, in some embodiments, the present disclosure teaches transformation by particle bombardment, chemical transformation, agrobacterium transformation, nano-spike transformation, electroporation and virus transformation.
In some embodiments, the vectors of the present disclosure may be introduced into the host cells using any of a variety of techniques, including transformation, transfection, transduction, viral infection, gene guns, or Ti-mediated gene transfer. Particular methods include calcium phosphate transfection, DEAE-Dextran mediated transfection, lipofection, or electroporation (Davis, L., Dibner, M., Battey, I., 1986 âBasic Methods in Molecular Biologyâ). Other methods of transformation include for example, lithium acetate transformation and electroporation See, e.g., Gietz et al., Nucleic Acids Res. 27:69-74 (1992); Ito et al., J. Bacterol. 153:163-168 (1983); and Becker and Guarente, Methods in Enzymology 194:182-187 (1991). In some embodiments, transformed host cells are referred to as recombinant host strains.
In some embodiments, the present disclosure teaches high throughput transformation of cells using the 96-well plate robotics platform and liquid handling machines of the present disclosure.
In some embodiments, the present disclosure teaches methods for getting exogenous protein (Cpf1 /Cas9 and DNA ligase), RNA (crRNA/tracRNA/GuideRNA), and DNA (insert DNA part or modular CRISPR construct) into the cell. Various methods for achieving this have been described previously including direct transfection of protein/RNA/DNA or DNA transformation followed by intracellular expression of RNA and protein (Dicarlo, J. E. et al. âGenome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems.â Nucleic Acids Res (2013). doi:10.1093/nar/gkt135; Ren, Z. J., Baumann, R. G. & Black, L. W. âCloning of linear DNAs in vivo by overexpressed T4 DNA ligase: construction of a T4 phage hoc gene display vector.â Gene 195, 303-311 (1997); Lin, S., Staahl, B. T., Alla, R. K. & Doudna, J. A. âEnhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery.â Elife 3, e04766 (2014)).
In some embodiments, the present disclosure teaches screening transformed cells with one or more selection markers as described above. In one such embodiment, cells transformed with a vector comprising a kanamycin resistance marker (KanR) are plated on media containing effective amounts of the kanamycin antibiotic. Colony forming units visible on kanamycin-laced media are presumed to have incorporated the vector cassette into their genome. Insertion of the desired sequences can be confirmed via PCR, restriction enzyme analysis, and/or sequencing of the relevant insertion site.
In other embodiments, a portion, or the entire complexes of the present disclosure can be delivered directly to cells. Thus, in some embodiments, the present disclosure teaches the expression and purification of the polypeptides and nucleic acids of the present disclosure. Persons having skill in the art will recognize the many ways to purify protein and nucleic acids. In some embodiments, the polypeptides can be expressed via inducible or constitutive protein production systems such as the bacterial system, yeast system, plant cell system, or animal cell systems. In some embodiments, the present disclosure also teaches the purification of proteins and or polypeptides via affinity tags, or custom antibody purifications. In other embodiments, the present disclosure also teaches methods of chemical synthesis for polynucleotides.
In some embodiments, persons having skill in the art will recognize that viral vectors or plasmids for gene expression can be used to deliver the complexes disclosed herein. Virus-like particles (VLP) can be used to encapsulate ribonucleoprotein complexes, and purified ribonucleoprotein complexes disclosed herein can be purified and delivered to cells via electroporation or injection.
Kits
In some embodiments, the disclosure provides kits containing any one or more of the elements disclosed in the above methods and compositions. In some embodiments, the kit comprises a modular CRISPR DNA construct and instructions for using the kit and any necessary reagents or reactants. In some embodiments, the vector system comprises (a) a modular CRISPR DNA construct (b) a CRISPR complex, including a CRISPR endonuclease protein, and necessary target guide RNA(s) (or sequences encoding said items), and optionally (c) insert DNA parts, as describe supra in this application.
Elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, or a tube, or host cell, or plasmid. In some embodiments, the kit includes instructions in one or more languages, for example in more than one language.
In some embodiments, a kit comprises one or more reagents for use in a process utilizing one or more of the elements described herein (e.g., purified Cpf1 endonuclease). Reagents may be provided in any suitable container. For example, a kit may provide one or more reaction or storage buffers. Reagents may be provided in a form that is usable in a particular assay, or in a form that requires addition of one or more other components before use (e.g. in concentrate or lyophilized form). A buffer can be any buffer, including but not limited to a sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof. In some embodiments, the buffer is alkaline. In some embodiments, the buffer has a pH from about 7 to about 10. In some embodiments, the kit comprises one or more oligonucleotides corresponding to a crRNA sequence for insertion into a vector so as to operably link the crRNA sequence and a regulatory element.
The following examples are given for the purpose of illustrating various embodiments of the disclosure and are not meant to limit the present disclosure in any fashion. Changes therein and other uses which are encompassed within the spirit of the disclosure, as defined by the scope of the claims, will occur to those skilled in the art.
This example describes the generation of plasmid 13001009086 (SEQ ID NO: 82) by transfer of an insert from one plasmid to another in a one-pot reaction. See, FIG. 4.
Both plasmids carry cloning tags flanking the region of interest (cTAG K [SEQ ID NO: 78] /cTAG L [SEQ ID NO: 79] and cTAG KⲠ[SEQ ID NO: 80]/cTAG LⲠ[SEQ ID NO: 81]). In order to drive the cloning reaction towards the edited plasmid, the Cpf1 spacers are in opposite orientations on the recipient and donor plasmids (K/KⲠand L/LⲠrespectively). This inside-out/outside-in digest removes the Cpf1 spacer in the final product, eliminating re-cutting of the desired product (see, curved arrows in FIG. 4, depicting inside-out digestion in the '485 plasmid and outside-in digestion in the '784 plasmid). The Cas9 spacers remain, enabling iterative editing at this site. Thus, the MegaModular construct allows for a rapid single-pot reaction scheme that enables iterative editing.
Cpf1 protein was synthesized by Genscript and the crRNAs by Synthego. For the one-pot cleavage/ligation reaction, the Cpf1 protein complexed with the crRNAs (crRNA 1 and crRNA 3), was added to the plasmids (13000789485âSEQ ID NO: 83 and 13000823784âSEQ ID NO: 84) and DNA ligase in buffer containing ATP. These components were cycled at temperatures optimized for cleavage and ligation.
The reaction was transformed into E. coli and positive clones were sequenced to confirm insertion of the new insert and loss of the Cpf1 spacers.
For deletions, the Cpf1 sites within cloning tags used must generate compatible overhangs to allow for plasmid closure. cTAG LⲠwas designed to contain two Cpf1 spacers, one for insertion where the overhang is incompatible with cTAG KⲠand a second one for deletion where the overhang is compatible with cTAG Kâ˛.
This example was designed to demonstrate the flexibility of CRISPR cloning. As an initial step, several resistance plasmids encoding for Kanamycin or Chloramphenicol resistance genes were created from source vectors pzHR039 (SEQ ID No: 100) and 13000223370 (SEQ ID No: 101), respectively. The Kanamycin resistance plasmids were each designed so as to include various Cpf1 landing sites flanking the GFP gene (when digested, these plasmids produce âthe kanamycin resistant plasmid backboneâ). The Chloramphenicol resistance plasmids were each designed so as to include various Cpf1 landing sites flanking the Chloramphenicol resistance gene (when digested, these plasmids produce âthe chloramphenicol resistant insertâ). Sequences, and vector maps for each plasmid used in this Example are disclosed in Table 2.
Each Kanamycin and Chloramphenicol resistant plasmid was initially linearized with type-II restriction enzymes KpnI-HF and PvuI-HF, respectively (both commercially available from NEB). The location of the KpnI and PvuI restriction sites on each plasmid are noted in the vector maps provided in FIGS. 7-14. After linearization, the resistance plasmids were no longer capable of self-replication in a bacterial host system.
Linearized resistance plasmids were then mixed with a pre-incubated mixture of 15 ug (1.58 uM final concentration) of Cpf1 enzyme and 2 uL of 5 uM of each guide RNA described below (0.167 uM final concentration) in a 60 uL reaction to form active CRISPR complexes.
The Cpf1 enzyme used in this Example was commercially obtained from IDT. The Cpf1was sourced from Acidaminococcus sp. Cpf1 (AsCpf1). The enzyme was further modified to comprise 1 N-terminal nuclear localization sequence (NLS) and 1 C-terminal NLSs, as well as 3 N-terminal FLAG tags and a C-terminal 6-His tag.
The guide RNAs used in this example were custom ordered from IDT. Each guide RNA was designed to target a different CRISPR landing site located within the linearized resistance plasmid. In this Example, the Cpf1 landing sites of the backbone plasmid were excised, but restored upon ligation of the insert. Table 2 provides the guide sequence portion of each guide RNA used. The CRISPR complexes in the mixture were thus designed to cleave out the GFP gene from each kanamycin resistant plasmid to generate kanamycin resistant plasmid backbones (see FIG. 5, second panel). The CRISPR complexes in the mixture were also designed to cleave out the chloramphenicol resistance gene from the chloramphenicol resistance plasmid to generate chloramphenicol resistant inserts (see FIG. 5, second panel). The kanamycin resistant plasmid backbone and the chloramphenicol resistant insert of each reaction were similarly designed to generate compatible overhangs that would result in hybridization of the ends to produce a âdual resistantâ kanamycin and chloramphenicol plasmid.
The linearized resistance plasmid mixtures comprising the Cpf1 and guide RNAs were allowed to incubate for 3 hours at 37 degrees Celsius in the manufacturer's recommended Cpf1buffer. Selected reactions were run on agarose gels and the resulting fragments were purified using standard DNA extraction kits (Zymo Research kit, used according to manufacturer's instructions). Purified (control) and unpurified (test).
DNA fragments comprising the kanamycin resistant plasmid backbone and the chloramphenicol resistant insert, each comprising two compatible Cpf1 sticky ends were combined in a new reactions with or without a T4 DNA ligase (commercially available form NEB) and transformed into NEB10-B cells (commercially available from NEB). Transformed cells were plated on media augmented with both Kanamycin and Chloramphenicol designed to prevent the growth of any cells that did not contain functional resistance plasmids.
Individual colonies were sent for sequencing to confirm junctions of Cpf1 cloning. Recovered colonies were also validated via PCR using primers described in Table 2. FIG. 5 illustrates the general experimental design described above, except that the plasmids were linearized prior to Cpf1 digestion, as described above.
| TABLEâ2 |
| ListâofâsequencesâusedâinâthisâExampleâ2 |
| Component | Description | SEQâIDâNO |
| GFPâCpf1âcTAGâMâfwd | 5Ⲡ| SEQâIDâNo:â86 |
| CAGCACCTGGATTACCCTGTTATCCCTAGT | ||
| TTTGGGTTAAAGATGGTTAAATGATTCG | ||
| AAAATAATAAAGGGAAAATCAâ3Ⲡ| ||
| GFPâCpf1âcTAGâNâfwd | 5Ⲡ| SEQâIDâNo:â87 |
| CAGCACCTGGATTACCCTGTTATCCCTAGT | ||
| TTTGGGATGTTAAGAGTCCCTATCTTCG | ||
| AAAATAATAAAGGGAAAATCAâ3Ⲡ| ||
| GFPâCpf1âcTAGâPâfwd | 5Ⲡ| SEQâIDâNo:â88 |
| CAGCACCTGGATTACCCTGTTATCCCTAGT | ||
| TTTGAGGAGTGTTCAGTCTCCGTGAACT | ||
| CGAAAATAATAAAGGGAAAATCAâ3Ⲡ| ||
| GFPâCpf1âcTAGâOârvs | 5Ⲡ| SEQâIDâNo:â89 |
| CGCTTCCTCCTGAAAATGCAGCTAGGTAGT | ||
| TTTGACCGCCCCCCCCATACCCCAATCG | ||
| ACATGCCGAACTCAGAAGTGAâ3Ⲡ| ||
| GFPâCpf1âcTAGâNârvs | 5Ⲡ| SEQâIDâNo:â90 |
| CGCTTCCTCCTGAAAATGCAGCTAGGTAGT | ||
| TTTGGGATGTTAAGAGTCCCTATCTTCG | ||
| ACATGCCGAACTCAGAAGTGAâ3Ⲡ| ||
| CAT01âCpf1âcTAGâMâfwd | 5Ⲡ| SEQâIDâNo:â91 |
| TTTGGGTTAAAGATGGTTAAATGATTCG | ||
| ACATACACATAAAGTAGCTTGCGâ3Ⲡ| ||
| CAT01âCpf1âcTAGâNâfwd | 5Ⲡ| SEQâIDâNo:â92 |
| TTTGGGATGTTAAGAGTCCCTATCTTCGA | ||
| CATACACATAAAGTAGCTTGCGâ3Ⲡ| ||
| CAT01âCpf1âcTAGâPâfwd | 5Ⲡ| SEQâIDâNo:â93 |
| TTTGAGGAGTGTTCAGTCTCCGTGAACT | ||
| CGACATACACATAAAGTAGCTTGCGâ3Ⲡ| ||
| CAT01âCpf1âcTAGâNârvs | 5Ⲡ| SEQâIDâNo:â94 |
| TTTGGGATGTTAAGAGTCCCTATCTTCG | ||
| ACTGGAAGGACAAGGGGGACCâ3Ⲡ| ||
| CAT01âCpf1âcTAGâOârvs | 5Ⲡ| SEQâIDâNo:â95 |
| TTTGACCGCCCCCCCCATACCCCAATCG | ||
| ACTGGAAGGACAAGGGGGACCâ3Ⲡ| ||
| Cpf1âcTAGâM | 5â˛âTTTGGGTTAAAGATGGTTAAATGATâ3Ⲡ| SEQâIDâNo:â96 |
| RNAâtargetingâcTAGâM | 5Ⲡ| SEQâIDâNO:â110 |
| UAAUUUCUACUCUUGUAGAUGGUUAAAGAU | ||
| GGUUAAAUGAUâ3Ⲡ| ||
| Cpf1âcTAGâN | 5â˛âTTTGGGATGTTAAGAGTCCCTATCTâ3Ⲡ| SEQâIDâNo:â97 |
| RNAâtargetingâcTAGâN | 5Ⲡ| SEQâIDâNO:â111 |
| UAAUUUCUACUCUUGUAGAUGGAUGUUAAG | ||
| AGUCCCUAUCUâ3Ⲡ| ||
| Cpf1âcTAGâO | 5â˛âTTTGACCGCCCCCCCCATACCCCAAâ3Ⲡ| SEQâIDâNo:â98 |
| RNAâtargetingâcTAGâO | 5Ⲡ| SEQâIDâNO:â112 |
| UAAUUUCUACUCUUGUAGAUACCGCCCCCC | ||
| CCAUACCCCAAâ3Ⲡ| ||
| Cpf1âcTAGâP | 5â˛âTTTGAGGAGTGTTCAGTCTCCGTGAACâ3Ⲡ| SEQâIDâNo:â99 |
| RNAâtargetingâcTAGâP | 5Ⲡ| |
| UAAUUUCUACUCUUGUAGAUAGGAGUGUUC | ||
| AGUCUCCGUGAACâ3Ⲡ| SEQâIDâNO:â113 | |
| pzHR039 | SourceâforâKanamycinâresistanceâandâGFP. | SEQâIDâNO:â100 |
| Seeâlistingâforâfullâsequence | ||
| 13000223370 | SourceâforâChloramphenicolâresistanceâand | SEQâIDâNO:â101 |
| GFP.âSeeâlistingâforâfullâsequence | ||
| pJDI427 | GFPâCpf1âcTAGsâMâandâNâKanRâCENARS | SEQâIDâNO:â102 |
| TRP1âseeâlistingâforâfullâsequence | FIG.â7 | |
| pJDI429 | GFPâCpf1âcTAGsâNâandâOâKanRâCENARS | SEQâIDâNO:â103 |
| TRP1âseeâlistingâforâfullâsequence | FIG.â8 | |
| pJDI430 | GFPâCpf1âcTAGsâNâandâPâKanRâCENARS | SEQâIDâNO:â104 |
| TRP1âseeâlistingâforâfullâsequence | FIG.â9 | |
| pJDI431 | GFPâCpf1âcTAGsâOâandâPâKanRâCENARS | SEQâIDâNO:â105 |
| TRP1âseeâlistingâforâfullâsequence | FIG.â10 | |
| pJDI432 | pJETâAmpRâCmRâCpf1âcTAGsâMâandâNâsee | SEQâIDâNO:â106 |
| listingâforâfullâsequence | FIG.â11 | |
| pJDI434 | pJETâAmpRâCmRâbluntâCpf1âcTAGsâNâandâO | SEQâIDâNO:â107 |
| seeâlistingâforâfullâsequence | FIG.â12 | |
| pJDI435 | pJETâAmpRâCmRâbluntâCpf1âcTAGsâNâandâP | SEQâIDâNO:â108 |
| seeâlistingâforâfullâsequence | FIG.â13 | |
| pJDI436 | pJETâAmpRâCmRâbluntâCpf1âcTAGsâOâandâP | SEQâIDâNO:â109 |
| seeâlistingâforâfullâsequence | FIG.â14 | |
| ***non-underlined portion of guide RNA for SEQ ID NOs: 110-113 is the chemically modified Alt-R RNA from IDT. The homologous region of sequence to the respective cTAGs (i.e. M-P) is underlined. |
The results of this experiment are shown in Table 3 and FIG. 6. Reaction numbers for each transformation are shown along the top row, with guide RNAs used listed along the left-hand column of Table 3. The comparison of identical Cpf1 reactions with and without ligase showed a 9.9-fold increase in transformants in the presence of ligase enzyme, indicating that colony growth was due to formation of the double kanamycin and chloramphenicol resistant plasmid after Cpf1digestion. The no-ligase reactions are matched controls designed to establish that the reactions are specific, and were not simply due to the presence of contaminating levels of undigested resistance plasmids.
Sixteen individual colonies were Sanger sequenced to verify both the upstream and downstream cloning junctions. In seven of seven upstream sequenced junctions, and eight of nine downstream junctions, the Cpf1 mediated clones from the reactions with T4 DNA ligase indicated faithful digestion and ligation.
Reactions 71 and 72 were transformed with Cpf1 digested plasmids that were not subjected to DNA gel purification steps. Cpf1 enzyme however was heat inactivated according to supplier's instructions before addition of T4 DNA ligase (reaction 72). Reactions 71 and 72 exhibited the same ligase-dependency.
| TABLE 3 |
| Resistant Transformant Colonies Comprising Cpf1-edited vectors |
| 55 | 56 | 59 | 60 | 67 | 68 | 71* | 72* | |
| Guides M + N | yes | yes | ||||||
| Guides N + O | yes | yes | ||||||
| Guides P + O | yes | yes | yes | yes | ||||
| T4 Ligase | No | Yes | No | Yes | No | Yes | No | Yes |
| # of transformants | 1 | 20 | 0 | 141 | 0 | 12 | 2 | 95 |
| (Kan Resistant Colonies) | ||||||||
| *Plates 71 and 72 were transformed with digested DNA that had not undergone DNA gel purification after Cpf1 digestion. |
The disclosure of PCT/US2017/042245 (WO 2018/013990 A1, claiming priority to U.S. Provisional App. No. 62/362,909) is incorporated herein in its entirety.
This example describes the genetic editing of a modular CRISPR vector, according to the methods of the present disclosure. FIG. 15 illustrates the genetic editing of modular CRISPR plasmid 13000444591 described in this example. The plasmid backbone was first prepared by removing a âstufferâ insert DNA part from a previously constructed plasmid. The stuffer insert DNA part was removed by digesting the stuffer part's flanking cloning tags (cTAGs) D (SEQ ID NO: 68) and E (SEQ ID NO: 69) with restriction enzymes ApaI and PvuI. The resulting fragments were separated via gel electrophoresis, and the desired 8.3 kb fragment corresponding to the plasmid backbone was excised from the gel and extracted using standard silica membrane columns.
To generate the new insert for the modular CRISPR vector, a desired insert DNA part flanked by cTAG D and cTAG E, was PCR amplified using universal cTAG oligos tagD_FWD (SEQ ID NO: 75) and tagE_REV (SEQ ID NO: 76). The resulting insert contained a GFP marker gene flanked by cTAG D and cTAG E. The resulting PCR fragment was digested with the ApaI enzyme that cuts within cTAG D and the PvuI enzyme that cuts within cTAG E sequence. The digested insert DNA part was purified using standard silica membrane columns.
The purified modular CRISPR vector backbone and insert DNA part were combined into a single reaction with a ligase to generate a circular plasmid. The sequence for the resulting edited GFP-containing plasmid 13000444591 is provided in (SEQ ID NO: 77).
Plasmid 13000283399 (SEQ ID NO: 85) was assembled by yeast homologous recombination of PCR fragments flanked by MegaModular tags. The desired constructs for assembly were amplified by PCR in such a way that they were flanked by specific MegaModular tags. These tags allowed for directional assembly of fragments in Saccharomyces cerevisiae as the tags themselves served as the overlapping homologous region for homologous recombination.
Specifically, 5 fragments were amplified via PCR flanked by MegaModular tags as follows: tag AâFragment 1âtag B; tag BâFragment 2âtag C; tag CâFragment 3âtag D; tag DâFragment 4âtag E; and tag EâFragment 5âtag F. These fragments, along with a linearized assembly vector containing a yeast origin of replication and a TRP auxotrophic selection marker as well as tag A at one end and tag F at the other, were transformed into S. cerevisiae. Circularized, assembled plasmids were selected by S. cerevisiae growth in media lacking tryptophan. These plasmids were recovered and amplified in Escherichia coli, and correct conformation was confirmed by sequencing.
All references, articles, publications, patents, patent publications, and patent applications cited herein are incorporated by reference in their entireties for all purposes. However, mention of any reference, article, publication, patent, patent publication, and patent application cited herein is not, and should not, be taken as an acknowledgment or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world.
1. A modular CRISPR DNA construct comprising a CRISPR multi-clonal site, said multi-clonal site comprising:
a) a plurality of distinct cloning tags (cTAGs), said plurality of distinct cTAGs having been artificially introduced into the CRISPR DNA construct, wherein each cTAG comprises:
i) a validated CRISPR landing site comprising a protospacer sequence operably linked to a protospacer adjacent motif (PAM); wherein the validated CRISPR landing site in at least three of the plurality of distinct cTAGs is different from any other CRISPR landing sites within the modular CRISPR DNA construct; and
b) a plurality of distinct DNA inserts;
i) wherein each DNA insert is flanked by a pair of cTAGs; and
wherein the construct further comprises at least 5 cTAGs.
2. The modular CRISPR DNA construct of claim 1, wherein said modular CRISPR DNA construct is circular.
3. The modular CRISPR DNA construct of claim 1, wherein said modular CRISPR DNA construct is linear.
4. The modular CRISPR DNA construct of claim 1, wherein said modular CRISPR DNA construct is integrated into an organism's genome.
5. The modular CRISPR DNA construct of claim 1, wherein the validated CRISPR landing site is for a Cas9 endonuclease.
6. The modular CRISPR DNA construct of claim 1, wherein the validated CRISPR landing site is for a Cpf1 endonuclease.
7. The modular CRISPR DNA construct of claim 1, wherein at least one of said distinct cTAGs comprises a restriction endonuclease site at least 8 bases in length.
8. A reaction mixture comprising:
A) a modular CRISPR DNA construct comprising a plurality of distinct cloning tags (cTAGs), said plurality of distinct cTAGS having been artificially introduced into the CRISPR DNA construct, wherein each cTAG comprises:
i) a validated CRISPR landing site(s), each comprising a protospacer sequence operably linked to a protospacer adjacent motif (PAM); and
B) a replacement DNA insert, wherein said replacement DNA insert is flanked by a first and second insert cTAG;
i) wherein the first insert cTAG comprises the validated CRISPR landing site of one of the distinct cTAGs of the CRISPR DNA construct, and the second insert cTAG comprises the validated CRISPR landing site of another distinct cTAG of the CRISPR DNA construct; and
C) a first and second CRISPR complex targeting the first and second insert cTAGs, respectively, each CRISPR complex comprising:
i) a CRISPR endonuclease, and
ii) a guide RNA capable of recruiting said CRISPR endonuclease to one of said targeted insert cTAGs.
9. The reaction mixture of claim 8, wherein said modular CRISPR DNA construct is circular.
10. The reaction mixture of claim 8, wherein said modular CRISPR DNA construct is linear.
11. The reaction mixture of claim 8, wherein said modular CRISPR DNA construct is integrated into an organism's genome.
12. The reaction mixture of claim 8, wherein the CRISPR endonuclease is Cas9.
13. The reaction mixture of claim 8, wherein the CRISPR endonuclease is Cpf1.
14. The reaction of claim 8, wherein at least one of said distinct cTAGs comprises a restriction endonuclease site at least 8 bases in length.
15. The reaction of claim 8, wherein the guide RNA comprises a tracrRNA and a crRNA.
16. A reaction mixture comprising:
A) a plurality of different DNA inserts, wherein each DNA insert is flanked by a pair of artificially introduced cloning tags (cTAGs), each cTAG comprising:
i) a validated CRISPR landing site(s), each comprising a protospacer sequence operably linked to a protospacer adjacent motif (PAM); and
ii) one or more CRISPR complexes targeting at least one of the cTAGs present in at least two of the plurality of different DNA inserts, each CRISPR complex comprising:
a) a CRISPR endonuclease, and
b) a guide RNA capable of recruiting said CRISPR endonuclease to one of said targeted cTAGs.
17. The reaction mixture of claim 16, wherein the CRISPR endonuclease is Cas9.
18. The reaction mixture of claim 16, wherein the CRISPR endonuclease is Cpf1 .
19. The reaction mixture of claim 16, wherein at least one of the cTAGs comprises a restriction endonuclease site at least 8 bases in length.
20. The reaction mixture of claim 16, wherein the guide RNA comprises a tracrRNA and a crRNA.