Patent application title:

COMPOUNDS AND METHODS FOR REDUCING FUS EXPRESSION

Publication number:

US20220243203A1

Publication date:
Application number:

17/613,183

Filed date:

2020-05-28

Abstract:

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of FUS RNA in a cell or subject, and in certain instances reducing the amount of FUS protein in a cell or subject. These compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodegenerative condition. Such symptoms and hallmarks include muscle weakness and fatigue, protein aggregates in the central nervous system, and speech difficulties and behavioral abnormalities. Non-limiting examples of neurodegenerative conditions that benefit from these compounds, methods, and pharmaceutical compositions are amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD).

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N2310/11 »  CPC further

Structure or type of the nucleic acid; Type of nucleic acid Antisense

C12N2310/341 »  CPC further

Structure or type of the nucleic acid; Chemical structure; Spatial arrangement of the modifications Gapmers, i.e. of the type ===---===

C12N2310/3341 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the base; Modified C 5-Methylcytosine

C12N2310/315 »  CPC further

Structure or type of the nucleic acid; Chemical structure of the backbone Phosphorothioates

C12N15/113 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides

Description

SEQUENCE LISTING

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0360WOSEQ_ST25.txt, created on May 27, 2020, which is 136 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

FIELD

Mutations in the Fused in Sarcoma gene (FUS) are associated with several neurodegenerative conditions, such as amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). Provided are compounds, methods, and pharmaceutical compositions for reducing an amount of FUS RNA in a cell or subject. In certain instances, compounds, methods, and pharmaceutical compositions reduce an amount of a FUS protein in a cell or a subject. Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodegenerative condition.

BACKGROUND

ALS, also known as Lou Gehrig's disease, is a neurodegenerative disease that causes motor neuron death. ALS patients suffer from muscle stiffness, muscle twitching, muscle weakness, and decreased muscle mass. ALS progresses until patients are unable to walk, speak, swallow or breathe. There are several types of ALS and they are generally classified as familial ALS or sporadic ALS. A significant percentage of familial ALS cases are associated with a mutation in the FUS gene, a gene encoding RNA-binding protein FUS/TLS (Fused in Sarcoma/Translocated in Sarcoma). In healthy patients, the majority of FUS protein localizes to the nucleus of neurons where they function to process RNA. However, in ALS patients, a mutation in FUS causes a FUS protein to aggregate in the cytoplasm, leading to protein misfolding and aggregation. Although the age of onset for ALS is typically greater than 40, there are some instances in which patients develop ALS symptoms before the age of 25. ALS that develops in patients under the age of 25 is referred to as “juvenile ALS.” The most common mutations in juvenile ALS include mutations in FUS.

FTLD, also known as Pick's disease, is a term used to describe several disorders including frontotemporal dementia as behavioral variant, primary nonfluent aphasia, semantic dementia as language variants, amyotrophic lateral sclerosis with frontotemporal dementia (ALS+FTLD), corticobasal syndrome and progressive supranuclear palsy. FTLD is characterized by frontal lobe and temporal lobe atrophy. In some instances, accumulation of tau proteins (Pick-bodies) and TAR DNA binding protein 43 are observed in the brain of FTLD patients. These cases are classified as FTLD-tau or FTLD-TDP. In other instances, FUS positive cytoplasmic inclusions, intranuclear inclusions and neuritic threads are observed in the cortex, medulla, hippocampus and motor cells of the spinal cord are observed in FTLD patients, referred to as FTLD-FUS.

SUMMARY OF THE INVENTION

Currently there remains a need for therapies to treat ALS and FTLDs. It is therefore an object herein to provide compounds, methods, and pharmaceutical compositions for the treatment of such diseases.

Provided herein are compounds, methods and pharmaceutical compositions for reducing an amount of FUS RNA, and in certain embodiments reducing the amount or activity of FUS protein in a cell or a subject. In certain embodiments, the subject has a neurodegenerative condition. In certain embodiments, the subject has a neurodegenerative condition. In certain embodiments, the subject has ALS. In certain embodiments, the subject has an FTLD. In certain embodiments, the subject has a mutation in FUS. In certain embodiments, compounds useful for reducing the amount of FUS RNA and/or FUS protein are oligomeric compounds. In certain embodiments, oligomeric compounds comprise modified oligonucleotides.

Also provided herein are methods useful for ameliorating a symptom or hallmark of a neurodegenerative condition. Exemplary symptoms and hallmarks of ALS include, but are not limited to, muscle weakness and fatigue, slurred speech, twitching, cramping, and protein aggregates in the CNS. Exemplary symptoms and hallmarks of FTLD include, but are not limited to, speech difficulties and behavioral abnormalities.

DETAILED DESCRIPTION OF THE INVENTION

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.

Unless otherwise indicated, the following terms have the following meanings:

Definitions

As used herein, “2′-deoxynucleoside” means a nucleoside comprising a 2′-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2′-deoxynucleoside is a 2′-β-D-deoxynucleoside and comprises a 2′-β-D-deoxyribosyl sugar moiety, which has the β-D configuration as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2′-deoxynucleoside or nucleoside comprising an unmodified 2′-deoxyribosyl sugar moiety may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

As used herein, “2′-MOE” or “2′-MOE sugar moiety” means a 2′-OCH2CH2OCH3 group in place of the 2′—OH group of a ribosyl sugar moiety. “MOE” means methoxyethyl.

As used herein, “2′-MOE nucleoside” means a nucleoside comprising a 2′-MOE sugar moiety.

As used herein, “2′-OMe” or “2′-O-methyl sugar moiety” means a 2′-OCH3 group in place of the 2′—OH group of a ribosyl sugar moiety.

As used herein, “2′-OMe nucleoside” means a nucleoside comprising a 2′-OMe sugar moiety.

As used herein, “2′-substituted nucleoside” means a nucleoside comprising a 2′-substituted sugar moiety. As used herein, “2′-substituted” in reference to a sugar moiety means a sugar moiety comprising at least one 2′-substituent group other than H or OH.

As used herein, “5-methyl cytosine” means a cytosine modified with a methyl group attached to the 5 position. A 5-methyl cytosine is a modified nucleobase.

As used herein, “administering” means providing a pharmaceutical agent to a subject.

As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

As used herein, “antisense compound” means an oligomeric compound capable of achieving at least one antisense activity.

As used herein, “ameliorate” in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom.

As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety.

As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

As used herein, “cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell or a subject.

As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. As used herein, “complementary nucleobases” means nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) with thymine (T), adenine (A) with uracil (U), cytosine (C) with guanine (G), and 5-methyl cytosine (mC) with guanine (G). Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to an oligonucleotide, or portion thereof, means that oligonucleotide, or portion thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the oligonucleotide.

As used herein, “conjugate group” means a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

As used herein, “conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

As used herein, “constrained ethyl” or “cEt” or “cEt modified sugar” means a β-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4′-carbon and the 2′-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4′-CH(CH3)—O-2′, and wherein the methyl group of the bridge is in the S configuration.

As used herein, “cEt nucleoside” means a nucleoside comprising cEt modified sugar moiety.

As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.

As used herein, “gapmer” means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.” Unless otherwise indicated, “gapmer” refers to a sugar motif Unless otherwise indicated, the sugar moiety of each nucleoside of the gap is a 2′-β-D-deoxyribosyl sugar moiety. Thus, the term “MOE gapmer” indicates a gapmer having a gap comprising 2′-β-D-deoxynucleosides and wings comprising 2′-MOE nucleosides. Unless otherwise indicated, a MOE gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.

As used herein, “hotspot region” is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.

As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

As used herein, “internucleoside linkage” means the covalent linkage between contiguous nucleosides in an oligonucleotide. As used herein “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

As used herein, “mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.

As used herein, “motif” means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or internucleoside linkages, in an oligonucleotide.

As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methyl cytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modification.

As used herein, “nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. “Linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).

As used herein, “oligomeric compound” means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound. The term “oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”

As used herein, “oligonucleotide” means a strand of linked nucleosides connected via internucleoside linkages, wherein each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside is a modified oligonucleoside or at least one internucleoside linkage is a modified internucleoside linkage. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications.

As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.

As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

As used herein “pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in a free uptake assay in certain cell lines.

As used herein “prodrug” means a therapeutic agent in a form outside the body that is converted to a different form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.

As used herein, “reducing or inhibiting the amount or activity” refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.

As used herein, “RNA” means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.

As used herein, “RNAi compound” means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNase H.

As used herein, “self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

As used herein, “standard cell assay” means the assay described in Example 1 and reasonable variations thereof.

As used herein, “stereorandom” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

As used herein, “subject” means a human or non-human animal. In certain embodiments, the subject is a human. In certain embodiments, the subject has been diagnosed with ALS. In certain embodiments, the subject has been diagnosed with FTLD. In certain embodiments, the subject is at risk for ALS or FTLD. In certain embodiments, the subject at risk for ALS or FTL has a mutation in FUS. In certain embodiments, the mutation in FUS is associated with ALS or FTLD. In certain embodiments, the mutation in FUS is causative of ALS or FTLD.

As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2′-OH(H) ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) deoxyribosyl moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, and two hydrogens at the 5′ position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.

As used herein, “sugar surrogate” means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.

As used herein, “symptom or hallmark” means any physical feature or test result that indicates the existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject. In certain embodiments, a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.

As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.

As used herein, “target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves a symptom or hallmark of a disease.

Certain Embodiments

The present disclosure provides the following non-limiting numbered embodiments:

Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of a FUS nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.
Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOS: 12-480.
Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases identical to SEQ ID NO: 12 or SEQ ID NO: 13.
Embodiment 4. An oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence of SEQ ID NO: 12.
Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence of SEQ ID NO: 13.
Embodiment 6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 1,786 to 1,841 of SEQ ID NO: 1.
Embodiment 7. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of any one of SEQ ID NOS: 34, 35, 111, 112, 188, 265, 342, and 418.
Embodiment 8. The oligomeric compound of any one of embodiments 1-7, wherein the modified oligonucleotide comprises a modified sugar moiety.
Embodiment 9. The oligomeric compound of any one of embodiments 1-7, wherein the modified oligonucleotide comprises a bicyclic sugar moiety.
Embodiment 10. The oligomeric compound of embodiment 9, wherein the bicyclic sugar moiety comprises a 2′-4′ bridge selected from —O—CH2—; and —O—CH(CH3)—.
Embodiment 11. The oligomeric compound of any one of embodiments 1-10, wherein the modified oligonucleotide comprises a non-bicyclic modified sugar moiety.
Embodiment 12. The oligomeric compound of embodiment 11, wherein the non-bicyclic modified sugar moiety comprises a 2′-MOE sugar moiety or 2′-OMe sugar moiety.
Embodiment 13. The oligomeric compound of any one of embodiments 1-12, wherein the modified oligonucleotide comprises a sugar surrogate.
Embodiment 14. The oligomeric compound of embodiment 13, wherein the sugar surrogate is selected from morpholino and PNA.
Embodiment 15. The oligomeric compound of any of embodiments 1-14, wherein the modified oligonucleotide has a sugar motif comprising: (a) a 5′-region consisting of 1-5 linked 5′-region nucleosides; (b) a central region consisting of 6-10 linked central region nucleosides; and (c) a 3′-region consisting of 1-5 linked 3′-region nucleosides, wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises an unmodified 2′-deoxyribosyl sugar moiety.
Embodiment 16. The oligomeric compound of any one of embodiments 1-15, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
Embodiment 17. The oligomeric compound of embodiment 16, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
Embodiment 18. The oligomeric compound of embodiment 16 or 17, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.
Embodiment 19. The oligomeric compound of any one of embodiments 16-18, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.
Embodiment 20. The oligomeric compound of embodiment 18 or 19, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.
Embodiment 21. The oligomeric compound of any one of embodiments 1-16, wherein the modified oligonucleotide consists essentially of 20 linked nucleosides and has an internucleoside linkage motif soooossssssssssooss, wherein “s” represents a phosphorothioate internucleoside linkage and “o” represents a phosphodiester internucleoside linkage.
Embodiment 22. The oligomeric compound of any one of embodiments 1-21, wherein the modified oligonucleotide comprises at least one modified nucleobase.
Embodiment 23. The oligomeric compound of embodiment 22, wherein the modified nucleobase is a 5-methyl cytosine.
Embodiment 24. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide is a gapmer consisting of a 5′ wing segment, a central gap segment, and a 3′ wing segment, wherein: the 5′ wing segment consists of five 2′-O-methoxyethyl nucleosides, the central gap segment consists of ten β-D-deoxyribonucleosides, and the 3′ wing segment consists of five 2′-O-methoxyethyl nucleosides, wherein the modified oligonucleotide has the nucleobase sequence 5′-GTTTATCTGAATTCGCCATA-3′ (SEQ ID NO. 12), wherein each cytosine is a 5-methylcytosine, wherein the internucleoside linkages of the modified oligonucleotide are soooossssssssssooss from 5′ to 3′, and wherein each s is a phosphorothioate linkage and each o is a phosphodiester linkage.
Embodiment 25. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide is a gapmer consisting of a 5′ wing segment, a central gap segment, and a 3′ wing segment, wherein: the 5′ wing segment consists of five 2′-O-methoxyethyl nucleosides, the central gap segment consists of ten β-D-deoxyribonucleosides, and the 3′ wing segment consists of five 2′-O-methoxyethyl nucleosides, wherein the modified oligonucleotide has the nucleobase sequence 5′-GCAATGTCACCTTTCATACC-3′ (SEQ ID NO. 13), wherein each cytosine is a 5-methylcytosine, wherein the internucleoside linkages of the modified oligonucleotide are soooossssssssssooss from 5′ to 3′, and wherein each s is a phosphorothioate linkage and each o is a phosphodiester linkage.
Embodiment 26. The oligomeric compound of any of embodiments 1-25, consisting essentially of the modified oligonucleotide.
Embodiment 27. The oligomeric compound of any of embodiments 1-25, consisting of the modified oligonucleotide.
Embodiment 28. The oligomeric compound of any of embodiments 1-25, comprising a conjugate group, wherein the conjugate group consists essentially of a conjugate moiety and a conjugate linker.
Embodiment 29. The oligomeric compound of embodiment 28, wherein the conjugate linker consists of a single bond.
Embodiment 30. The oligomeric compound of embodiment 28 or 29, wherein the conjugate linker is cleavable.
Embodiment 31. The oligomeric compound of any one of embodiments 28-30, wherein the conjugate linker comprises 1-3 linker-nucleosides.
Embodiment 32. The oligomeric compound of any one of embodiments 28-30, wherein the conjugate group does not comprise a nucleoside.
Embodiment 33. The oligomeric compound of any one of embodiments 28-32, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide.
Embodiment 34. The oligomeric compound of any one of embodiments 28-32, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.
Embodiment 35. The oligomeric compound of any of embodiments 1-34 comprising a terminal group.
Embodiment 36. The oligomeric compound of any of embodiments 1-35, wherein the modified oligonucleotide is a singled-stranded modified oligonucleotide.
Embodiment 37. An oligomeric duplex comprising an oligomeric compound of any of embodiments 1-35.
Embodiment 38. An antisense compound comprising or consisting of an oligomeric compound of any of embodiments 1-36 or an oligomeric duplex of embodiment 37.
Embodiment 39. A modified oligonucleotide according to the following formula: Ges Teo Teo Teo Aeo Tds mCds Tds Gds Ads Ads Tds Tds mCds Gds mCeo mCeo Aes Tes Ae (SEQ ID NO: 12); wherein A=an adenine, mC=a 5′-methylcytosine, G=a guanine, T=a thymine, e=a 2′-O-methoxyethylribose modified sugar, d=a 2′-deoxyribose sugar, s=a phosphorothioate internucleoside linkage, and o=a phosphodiester internucleoside linkage.
Embodiment 40. A modified oligonucleotide according to the following formula: Ges Ceo Aeo Aeo Teo Gds Tds mCds Adsd mCds mCds Tds Tds Tds mCds Aeo Teo Aes mCes mCe (SEQ ID NO: 13); wherein, A=an adenine, mC=a 5′-methylcytosine, G=a guanine, T=a thymine, e=a 2′-O-methoxyethylribose modified sugar, d=a 2′-deoxyribose sugar, s=a phosphorothioate internucleoside linkage, and o=a phosphodiester internucleoside linkage.
Embodiment 41. A modified oligonucleotide according to the following chemical structure:

or a salt thereof.
Embodiment 42. The modified oligonucleotide of embodiment 41, which is the sodium salt or the potassium salt.
Embodiment 43. A modified oligonucleotide according to the following chemical structure:

or a salt thereof.
Embodiment 44. The modified oligonucleotide of embodiment 43, which is the sodium salt or the potassium salt.
Embodiment 45. A modified oligonucleotide according to the following chemical structure:

Embodiment 46. A modified oligonucleotide according to the following chemical structure:

Embodiment 47. A pharmaceutical composition comprising at least one of the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, and the modified oligonucleotide of any one of embodiments 39-46; and a pharmaceutically acceptable carrier or diluent.
Embodiment 48. The pharmaceutical composition of embodiment 47, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate buffered saline (PBS).
Embodiment 49. The pharmaceutical composition of embodiment 48, wherein the pharmaceutical composition consists essentially of the oligomeric compound, oligomeric duplex, antisense compound, or modified oligonucleotide; and artificial cerebrospinal fluid.
Embodiment 50. A method comprising administering to a subject at least one of the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, the modified oligonucleotide of any one of embodiments 39-46, and the pharmaceutical composition of any of embodiments 47-49.
Embodiment 51. A method of treating a neurodegenerative condition comprising administering to a subject having or at risk for developing the neurodegenerative condition a therapeutically effective amount of at least one of the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, the modified oligonucleotide of any one of embodiments 39-46, and the pharmaceutical composition of any of embodiments 47-49; thereby treating the neurodegenerative condition.
Embodiment 52. A method of reducing FUS RNA or FUS protein in the central nervous system of a subject having or at risk for developing a neurodegenerative condition comprising administering a therapeutically effective amount of at least one of the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, the modified oligonucleotide of any one of embodiments 39-46, and the pharmaceutical composition of any of embodiments 47-49, thereby reducing FUS RNA or FUS protein in the central nervous system.
Embodiment 53. The method of embodiment 51 or 52, wherein the neurodegenerative condition is amyotrophic lateral sclerosis (ALS).
Embodiment 54. The method of embodiment 51 or 52, wherein the neurodegenerative condition is frontotemporal lobar degeneration (FTLD).
Embodiment 55. The method of embodiment 51 or 52, wherein the neurodegenerative condition is FTLD-FUS.
Embodiment 56. The method of embodiment 51 or 52, wherein the neurodegenerative condition is ALS with FTLD.
Embodiment 57. A method of treating a neurodegenerative condition associated with a FUS mutation comprising identifying the FUS mutation in a subject and administering to the subject a therapeutically effective amount of at least one of the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, the modified oligonucleotide of any one of embodiments 39-46, and the pharmaceutical composition of any of embodiments 47-49.
Embodiment 58. The method of embodiment 57, wherein the FUS mutation is a single nucleotide polymorphism selected from rs121909667, rs121909668, rs121909669, rs121909671, rs186547381, rs267606831, rs267606832, rs267606833, rs387906627, rs387906628, rs387907274, rs752076094, rs764487847, rs886041389, rs886041390, rs886041577, rs886041776, rs1085308015, rs1161032867, rs1555509569, rs1555509609, rs1555509693, rs1596908744, rs1596912983, and rs121909668.
Embodiment 59. The method of claim 57, wherein the FUS mutation is selected from S57del, S96del, G156E, G171-174del, G174-175del, G187S, G191S, G206S, R216C, G225V, G230C, R234C, R234L, R244C, M254V, S402_P411delinsGGGG, S462F, G466VfsX14, Y484AfsX514, R495X, R495EfsX527, G497AfsX527, G507D, K510WfsX517, K510E, S513P, R514S, R514G, G515C, E516V, H517D, H517P, H517Q, R518G, R518K, Q519IfsX9, R521C, R521G, R521H, R521L, R521S, R522G, R524S, R524T, R524W, and P525L.
Embodiment 60. The method of embodiment 57, wherein identifying the FUS mutation comprises sequencing a FUS nucleic acid from the subject, or contacting the FUS nucleic acid from the subject with a nucleic acid probe that is complementary to a portion of the FUS nucleic acid comprising the mutation.
Embodiment 61. The method of any of embodiments 50-60, wherein the administering is by intrathecal administration.
Embodiment 62. The method of any of embodiments 55-61, wherein at least one symptom or hallmark of the neurodegenerative condition is ameliorated.
Embodiment 63. The method of embodiment 62, wherein the neurodegenerative condition is ALS and the at least one symptom or hallmark is selected from muscle weakness, muscle fatigue, slurred speech, twitching, cramping, protein aggregates in the central nervous system of the subject, and a combination thereof.
Embodiment 64. The method of embodiment 62, wherein the neurodegenerative condition is FTLD and the at least one symptom or hallmark is selected from speech difficulty and a behavioral abnormality.
Embodiment 65. The method of any of embodiments 50-64, wherein the method prevents or slows disease regression.
Embodiment 66. The method of any one of embodiments 50-65, wherein the subject is pre-symptomatic for the neurodegenerative condition.
Embodiment 67. The method of any one of embodiments 50-65, wherein the subject is symptomatic for the neurodegenerative condition.
Embodiment 68. The method of any one of embodiments 50-65, wherein the subject is prodromal for the neurodegenerative condition.
Embodiment 69. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 50 mg.
Embodiment 70. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 60 mg.
Embodiment 71. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 70 mg.
Embodiment 72. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 80 mg.
Embodiment 73. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 90 mg.
Embodiment 74. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 100 mg.
Embodiment 75. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 110 mg.
Embodiment 76. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 120 mg.
Embodiment 77. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 130 mg.
Embodiment 78. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 140 mg.
Embodiment 79. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 150 mg.
Embodiment 80. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 160 mg.
Embodiment 81. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 170 mg.
Embodiment 82. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 180 mg.
Embodiment 83. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 190 mg.
Embodiment 84. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is 200 mg.
Embodiment 85. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 50 mg.
Embodiment 86. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 60 mg.
Embodiment 87. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 70 mg.
Embodiment 88. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 80 mg.
Embodiment 89. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 90 mg.
Embodiment 90. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 100 mg.
Embodiment 91. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 110 mg.
Embodiment 92. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 120 mg.
Embodiment 93. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 130 mg.
Embodiment 94. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 140 mg.
Embodiment 95. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 150 mg.
Embodiment 96. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 160 mg.
Embodiment 97. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 170 mg.
Embodiment 98. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 180 mg.
Embodiment 99. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 190 mg.
Embodiment 100. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is about 200 mg.
Embodiment 101. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is any of 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, and 300 mg.
Embodiment 102. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is any of about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, about 150 mg, about 155 mg, about 160 mg, about 165 mg, about 170 mg, about 175 mg, about 180 mg, about 185 mg, about 190 mg, about 195 mg, about 200 mg, about 205 mg, about 210 mg, about 215 mg, about 220 mg, about 225 mg, about 230 mg, about 235 mg, about 240 mg, about 245 mg, about 250 mg, about 255 mg, about 260 mg, about 265 mg, about 270 mg, about 275 mg, about 280 mg, about 285 mg, about 290 mg, about 295 mg, and about 300 mg.
Embodiment 103. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is any of 115.0 mg, 115.1 mg, 115.2 mg, 115.3 mg, 115.4 mg, 115.5 mg, 115.6 mg, 115.7 mg, 115.8 mg, 115.9 mg, 116.0 mg, 116.1 mg, 116.2 mg, 116.3 mg, 116.4 mg, 116.5 mg, 116.6 mg, 116.7 mg, 116.8 mg, 116.9 mg, 117.0 mg, 117.1 mg, 117.2 mg, 117.3 mg, 117.4 mg, 117.5 mg, 117.6 mg, 117.7 mg, 117.8 mg, 117.9 mg, 118.0 mg, 118.1 mg, 118.2 mg, 118.3 mg. 118.4 mg, 118.5 mg, 118.6 mg, 118.7 mg, 118.8 mg, 118.9 mg, 119.0 mg, 119.1 mg, 119.2 mg, 119.3 mg, 119.4 mg, 119.5 mg, 119.6 mg, 119.7 mg, 119.8 mg, 119.9 mg, 120.0 mg, 120.1 mg, 120.2 mg, 120.3 mg. 120.4 mg, 120.5 mg, 120.6 mg, 120.7 mg, 120.8 mg, 120.9 mg, 121.0 mg, 121.1 mg, 121.2 mg, 121.3 mg, 121.4 mg, 121.5 mg, 121.6 mg, 121.7 mg, 121.8 mg, 121.9 mg, 122.0 mg, 122.1 mg, 122.2 mg, 122.3 mg. 122.4 mg, 122.5 mg, 122.6 mg, 122.7 mg, 122.8 mg, 122.9 mg, 123.0 mg, 123.1 mg, 123.2 mg, 123.3 mg, 123.4 mg, 123.5 mg, 123.6 mg, 123.7 mg, 123.8 mg, 123.9 mg, 124.0 mg, 124.1 mg, 124.2 mg, 124.3 mg. 124.4 mg, 124.5 mg, 124.6 mg, 124.7 mg, 124.8 mg, 124.9 mg, and 125.0 mg.
Embodiment 104. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is any of about 115.0 mg, about 115.1 mg, about 115.2 mg, about 115.3 mg, about 115.4 mg, about 115.5 mg, about 115.6 mg, about 115.7 mg, about 115.8 mg, about 115.9 mg, about 116.0 mg, about 116.1 mg, about 116.2 mg, about 116.3 mg, about 116.4 mg, about 116.5 mg, about 116.6 mg, about 116.7 mg, about 116.8 mg, about 116.9 mg, about 117.0 mg, about 117.1 mg, about 117.2 mg, about 117.3 mg, about 117.4 mg, about 117.5 mg, about 117.6 mg, about 117.7 mg, about 117.8 mg, about 117.9 mg, about 118.0 mg, about 118.1 mg, about 118.2 mg, about 118.3 mg. 118.4 mg, about 118.5 mg, about 118.6 mg, about 118.7 mg, about 118.8 mg, about 118.9 mg, about 119.0 mg, about 119.1 mg, about 119.2 mg, about 119.3 mg, about 119.4 mg, about 119.5 mg, about 119.6 mg, about 119.7 mg, about 119.8 mg, about 119.9 mg, about 120.0 mg, about 120.1 mg, about 120.2 mg, about 120.3 mg. 120.4 mg, about 120.5 mg, about 120.6 mg, about 120.7 mg, about 120.8 mg, about 120.9 mg, about 121.0 mg, about 121.1 mg, about 121.2 mg, about 121.3 mg, about 121.4 mg, about 121.5 mg, about 121.6 mg, about 121.7 mg, about 121.8 mg, about 121.9 mg, about 122.0 mg, about 122.1 mg, about 122.2 mg, about 122.3 mg. 122.4 mg, about 122.5 mg, about 122.6 mg, about 122.7 mg, about 122.8 mg, about 122.9 mg, about 123.0 mg, about 123.1 mg, about 123.2 mg, about 123.3 mg, about 123.4 mg, about 123.5 mg, about 123.6 mg, about 123.7 mg, about 123.8 mg, about 123.9 mg, about 124.0 mg, about 124.1 mg, about 124.2 mg, about 124.3 mg. 124.4 mg, about 124.5 mg, about 124.6 mg, about 124.7 mg, about 124.8 mg, about 124.9 mg, and about 125.0 mg.
Embodiment 105. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is any of 95.0 mg, 95.1 mg, 95.2 mg, 95.3 mg, 95.4 mg, 95.5 mg, 95.6 mg, 95.7 mg, 95.8 mg, 95.9 mg, 96.0 mg, 96.1 mg, 96.2 mg, 96.3 mg, 96.4 mg, 96.5 mg, 96.6 mg, 96.7 mg, 96.8 mg, 96.9 mg, 97.0 mg, 97.1 mg, 97.2 mg, 97.3 mg, 97.4 mg, 97.5 mg, 97.6 mg, 97.7 mg, 97.8 mg, 97.9 mg, 98.0 mg, 98.1 mg, 98.2 mg, 98.3 mg. 98.4 mg, 98.5 mg, 98.6 mg, 98.7 mg, 98.8 mg, 98.9 mg, 99.0 mg, 99.1 mg, 99.2 mg, 99.3 mg, 99.4 mg, 99.5 mg, 99.6 mg, 99.7 mg, 99.8 mg, 99.9 mg, 100.0 mg, 100.1 mg, 100.2 mg, 100.3 mg. 100.4 mg, 100.5 mg, 100.6 mg, 100.7 mg, 100.8 mg, 100.9 mg, 101.0 mg, 101.1 mg, 101.2 mg, 101.3 mg, 101.4 mg, 101.5 mg, 101.6 mg, 101.7 mg, 101.8 mg, 101.9 mg, 102.0 mg, 102.1 mg, 102.2 mg, 102.3 mg. 102.4 mg, 102.5 mg, 102.6 mg, 102.7 mg, 102.8 mg, 102.9 mg, 103.0 mg, 103.1 mg, 103.2 mg, 103.3 mg, 103.4 mg, 103.5 mg, 103.6 mg, 103.7 mg, 103.8 mg, 103.9 mg, 104.0 mg, 104.1 mg, 104.2 mg, 104.3 mg. 104.4 mg, 104.5 mg, 104.6 mg, 104.7 mg, 104.8 mg, 104.9 mg, and 105.0 mg.
Embodiment 106. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is any of about 95.0 mg, about 95.1 mg, about 95.2 mg, about 95.3 mg, about 95.4 mg, about 95.5 mg, about 95.6 mg, about 95.7 mg, about 95.8 mg, about 95.9 mg, about 96.0 mg, about 96.1 mg, about 96.2 mg, about 96.3 mg, about 96.4 mg, about 96.5 mg, about 96.6 mg, about 96.7 mg, about 96.8 mg, about 96.9 mg, about 97.0 mg, about 97.1 mg, about 97.2 mg, about 97.3 mg, about 97.4 mg, about 97.5 mg, about 97.6 mg, about 97.7 mg, about 97.8 mg, about 97.9 mg, about 98.0 mg, about 98.1 mg, about 98.2 mg, about 98.3 mg. 98.4 mg, about 98.5 mg, about 98.6 mg, about 98.7 mg, about 98.8 mg, about 98.9 mg, about 99.0 mg, about 99.1 mg, about 99.2 mg, about 99.3 mg, about 99.4 mg, about 99.5 mg, about 99.6 mg, about 99.7 mg, about 99.8 mg, about 99.9 mg, about 100.0 mg, about 100.1 mg, about 100.2 mg, about 100.3 mg. 100.4 mg, about 100.5 mg, about 100.6 mg, about 100.7 mg, about 100.8 mg, about 100.9 mg, about 101.0 mg, about 101.1 mg, about 101.2 mg, about 101.3 mg, about 101.4 mg, about 101.5 mg, about 101.6 mg, about 101.7 mg, about 101.8 mg, about 101.9 mg, about 102.0 mg, about 102.1 mg, about 102.2 mg, about 102.3 mg. 102.4 mg, about 102.5 mg, about 102.6 mg, about 102.7 mg, about 102.8 mg, about 102.9 mg, about 103.0 mg, about 103.1 mg, about 103.2 mg, about 103.3 mg, about 103.4 mg, about 103.5 mg, about 103.6 mg, about 103.7 mg, about 103.8 mg, about 103.9 mg, about 104.0 mg, about 104.1 mg, about 104.2 mg, about 104.3 mg. 104.4 mg, about 104.5 mg, about 104.6 mg, about 104.7 mg, about 104.8 mg, about 104.9 mg, and about 105.0 mg.
Embodiment 107. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is within the range of any of 40 mg to 200 mg, 40 mg to 190 mg, 40 mg to 180 mg, 40 mg to 170 mg, from 40 mg to 160 mg, 40 mg to 150 mg, 40 mg to 140 mg, 40 mg to 120 mg, 40 mg to 110 mg, 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 200 mg, 50 mg to 190 mg, 50 mg to 180 mg, 50 mg to 170 mg, 50 mg to 160 mg, 50 mg to 150 mg, 50 mg to 140 mg, 50 mg to 120 mg, 50 mg to 110 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 200 mg, 60 mg to 190 mg, 60 mg to 180 mg, 60 mg to 170 mg, 60 mg to 160 mg, 60 mg to 150 mg, 60 mg to 140 mg, 60 mg to 120 mg, 60 mg to 110 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 200 mg, 70 mg to 190 mg, 70 mg to 180 mg, 70 mg to 170 mg, 70 mg to 160 mg, 70 mg to 150 mg, 70 mg to 140 mg, 70 mg to 120 mg, 70 mg to 110 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 200 mg, 80 mg to 190 mg, 80 mg to 180 mg, 80 mg to 170 mg, 80 mg to 160 mg, 80 mg to 150 mg, 80 mg to 140 mg, 80 mg to 120 mg, 80 mg to 110 mg, 80 mg to 100 mg, 80 mg to 90 mg, 90 mg to 200 mg, 90 mg to 190 mg, 90 mg to 180 mg, 90 mg to 170 mg, 90 mg to 160 mg, 90 mg to 150 mg, 90 mg to 140 mg, 90 mg to 120 mg, 90 mg to 110 mg, 90 mg to 100 mg, 100 mg to 200 mg, 100 mg to 190 mg, 100 mg to 180 mg, 100 mg to 170 mg, 100 mg to 160 mg, 100 mg to 150 mg, 100 mg to 140 mg, 100 mg to 120 mg, 100 mg to 110 mg, 110 mg to 200 mg, 110 mg to 190 mg, 110 mg to 180 mg, 110 mg to 170 mg, 110 mg to 160 mg, 110 mg to 150 mg, 110 mg to 140 mg, 110 mg to 130 mg, 110 mg to 120 mg, 120 mg to 200 mg, 120 mg to 190 mg, 120 mg to 180 mg, 120 mg to 170 mg, 120 mg to 160 mg, 120 mg to 150 mg, 120 mg to 140 mg, 120 mg to 130 mg, 130 mg to 200 mg, 130 mg to 190 mg, 130 mg to 180 mg, 130 mg to 170 mg, 130 mg to 160 mg, 130 mg to 150 mg, 130 mg to 140 mg, 140 mg to 200 mg, 140 mg to 190 mg, 140 mg to 180 mg, 140 mg to 170 mg, 140 mg to 160 mg, 140 mg to 150 mg, 150 mg to 200 mg, 150 mg to 190 mg, 150 mg to 180 mg, 150 mg to 170 mg, 150 mg to 160 mg, 160 mg to 200 mg, 160 mg to 190 mg, 160 mg to 180 mg, 160 mg to 170 mg, 180 mg to 200 mg, 180 mg to 190 mg, 190 mg to 200 mg, 105 mg to 135 mg, 105 mg to 130 mg, 105 mg to 125 mg 105 mg to 120 mg, 110 mg to 135 mg, 110 mg to 130 mg, 110 mg to 125 mg, 110 mg to 120 mg, 115 mg to 135 mg, 115 mg to 130 mg, 115 mg to 125 mg, 115 mg to 120 mg, 115 mg to 125 mg, 115 mg to 120 mg, 120 mg to 135 mg, 120 mg to 125 mg, 125 mg to 140 mg, 125 mg to 130 mg, 130 mg to 135 mg, 135 mg to 140 mg, 120 mg to 129 mg, 120 mg to 128 mg, 120 mg to 127 mg, 120 mg to 86 mg, 120 mg to 124 mg, 120 mg to 123 mg, 120 mg to 122 mg, 120 mg to 121 mg, 121 mg to 130 mg, 122 mg to 129 mg, 122 mg to 128 mg, 122 mg to 127 mg, 122 mg to 126 mg, 122 mg to 125 mg, 122 mg to 124 mg, 122 mg to 123 mg, 123 mg to 130 mg, 123 mg to 129 mg, 123 mg to 128 mg, 123 mg to 127 mg, 123 mg to 126 mg, 123 mg to 125 mg, 123 mg to 124 mg, 124 mg to 130 mg, 124 mg to 129 mg, 124 mg to 128 mg, 124 mg to 127 mg, 124 mg to 126 mg, 124 mg to 125 mg, 125 mg to 129 mg, 125 mg to 128 mg, 125 mg to 127 mg, 125 mg to 126 mg, 126 mg to 130 mg, 126 mg to 129 mg, 126 mg to 128 mg, 126 mg to 127 mg, 127 mg to 130 mg, 127 mg to 129 mg, 127 mg to 128 mg, 128 mg to 130 mg, 128 mg to 129 mg, and 129 mg to 130 mg.
Embodiment 108. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is any of less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg, less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.
Embodiment 109. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is any of less than about 300 mg, less than about 295 mg, less than about 290 mg, less than about 285 mg, less than about 280 mg, less than about 275 mg, less than about 270 mg, less than about 265 mg, less than about 260 mg, less than about 255 mg, less than about 250 mg, less than about 245 mg, less than about 240 mg, less than about 235 mg, less than about 230 mg, less than about 225 mg, less than about 220 mg, less than about 215 mg, less than about 210 mg, less than about 205 mg, less than about 200 mg, less than about 195 mg, less than about 190 mg, less than about 185 mg, less than about 180 mg, less than about 175 mg, less than about 170 mg, less than about 165 mg, less than about 160 mg, less than about 150 mg, less than about 145 mg, less than about 140 mg, less than about 135 mg, less than about 130 mg, less than about 125 mg, less than about 120 mg, less than about 115 mg, less than about 110 mg, less than about 105 mg, less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, less than about 50 mg, less than about 45 mg, less than about 40 mg, less than about 35 mg, less than about 30 mg, less than about 25 mg, less than about 20 mg, less than about 15 mg, less than about 10 mg, and less than about 5 mg.
Embodiment 110. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is any of at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least about 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, at least 150 mg, at least 155 mg, at least 160 mg, at least 165 mg, at least 170 mg, at least 175 mg, at least 180 mg, at least 185, at least 190 mg, at least 195 mg, and at least 200 mg.
Embodiment 111. The method of any one of embodiments 51-68, wherein the therapeutically effective amount is any of at least about 5 mg, at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, or at least about 150 mg, at least about 155 mg, at least about 160 mg, at least about 165 mg, at least about 170 mg, at least about 175 mg, at least about 180 mg, at least about 185, at least about 190 mg, at least about 195 mg, and at least about 200 mg.
Embodiment 112. The method of any one of embodiments 51-111, comprising administering the modified oligonucleotide once every 4 weeks.
Embodiment 113. The method of any one of embodiments 51-111, comprising administering the modified oligonucleotide once every 8 weeks.
Embodiment 114. The method of any one of embodiments 51-111, comprising administering the modified oligonucleotide once every 12 weeks.
Embodiment 115. The method of any one of embodiments 51-111, comprising administering the modified oligonucleotide once every 16 weeks.
Embodiment 116. The method of any one of embodiments 51-111, comprising administering the modified oligonucleotide about once every 4 weeks.
Embodiment 117. The method of any one of embodiments 51-111, comprising administering the modified oligonucleotide about once every 8 weeks.
Embodiment 118. The method of any one of embodiments 51-111, comprising administering the modified oligonucleotide about once every 12 weeks.
Embodiment 119. The method of any one of embodiments 51-111, comprising administering the modified oligonucleotide about once every 16 weeks.
Embodiment 120. The method of any one of embodiments 51-111, comprising administering the modified oligonucleotide any of once every 1 week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, once every 16 weeks, once every 17 weeks, once every 18 weeks, once every 19 weeks, and once every 20 weeks.
Embodiment 121. The method of any one of embodiments 51-111, comprising administering the modified oligonucleotide any of once about every 1 week, once about every 2 weeks, once about every 3 weeks, once about every 4 weeks, once about every 5 weeks, once about every 6 weeks, once about every 7 weeks, once about every 8 weeks, once about every 9 weeks, once about every 10 weeks, once about every 11 weeks, once about every 12 weeks, once about every 13 weeks, once about every 14 weeks, once about every 15 weeks, once about every 16 weeks, once about every 17 weeks, once about every 18 weeks, once about every 19 weeks, and once about every 20 weeks.
Embodiment 122. A method of reducing FUS RNA in a cell comprising contacting the cell with at least one of the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, and the modified oligonucleotide of any one of embodiments 39-46, thereby reducing FUS RNA in the cell.
Embodiment 123. A method of reducing FUS protein in a cell comprising contacting the cell with at least one of the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, and the modified oligonucleotide of any one of embodiments 39-46, thereby reducing FUS protein in the cell.

I. Certain Oligonucleotides

In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage.

A. Certain Modified Nucleosides

Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase.

1. Certain Sugar Moieties

In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2′, 4′, and/or 5′ positions. In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched. Examples of 2′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2′-F, 2′-OCH3 (“OMe” or “O-methyl”), and 2′-O(CH2)2OCH3 (“MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O—C1-C10 alkoxy, O—C1-C10 substituted alkoxy, O—C1-C10 alkyl, O—C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(═O)—N(Rm)(Rn), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, and the 2′-substituent groups described in Cook et al., U.S. Pat. No. 6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al., U.S. Pat. No. 6,005,087. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015/106128. Examples of 5′-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5-methyl (R or S), 5′-vinyl, and 5′-methoxy. In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008/101157 and Rajeev et al., US2013/0203836.).

In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH═CH2, OCH2CH═CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(═O)—N(Rm)(Rn)), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl.

In certain embodiments, a 2′-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(═O)—N(H)CH3 (“NMA”).

In certain embodiments, a 2′-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2′-substituent group selected from: F, OCH3, and OCH2CH2OCH3.

Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′, 4′-CH2—O-2′ (“LNA”), 4′-CH2—S-2′, 4′-(CH2)2—O-2′ (“ENA”), 4′-CH(CH3)—O-2′ (referred to as “constrained ethyl” or “cEt”), 4′-CH2—O—CH2-2′, 4′-CH2—N(R)-2′, 4′-CH(CH2OCH3)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No. 8,022,193), 4′-C(CH3)(CH3)—O-2′ and analogs thereof (see, e.g., Seth et al., U.S. Pat. No. 8,278,283), 4′-CH2—N(OCH3)-2′ and analogs thereof (see, e.g., Prakash et al., U.S. Pat. No. 8,278,425), 4′-CH2—O—N(CH3)-2′ (see, e.g., Allerson et al., U.S. Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745), 4′-CH2—C(H)(CH3)-2′ (see, e.g., Zhou, et al., J Org. Chem., 2009, 74, 118-134), 4′-CH2—C(═CH2)-2′ and analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426), 4′-C(RaRb)—N(R)—O-2′, 4′-C(RaRb)—O—N(R)-2′, 4′-CH2—O—N(R)-2′, and 4′-CH2—N(R)—O-2′, wherein each R, Ra, and Rb is, independently, H, a protecting group, or C1-C12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No. 7,427,672).

In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(Ra)(Rb)]n—, —[C(Ra)(Rb)]n—O—, —C(Ra)═C(Rb)—, —C(Ra)═N—, —C(═NRa)—, —C(═O)—, —C(═S)—, —O—, —Si(Ra)2—, —S(═O)r—, and —N(Ra)—;

wherein:

x is 0, 1, or 2;

n is 1, 2, 3, or 4;

each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O)2-J1), or sulfoxyl (S(═O)-J1); and

each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al., J Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379; Wengel et al., U.S. Pat. No. 7,053,207; Imanishi et al., U.S. Pat. No. 6,268,490; Imanishi et al. U.S. Pat. No. 6,770,748; Imanishi et al., U.S. RE44,779; Wengel et al., U.S. Pat. No. 6,794,499; Wengel et al., U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133; Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat. No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No. 6,525,191; Torsten et al., WO 2004/106356; Wengel et al., WO 1999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat. No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al., U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No. 8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S. Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et al., U.S. Pat. No. 8,501,805; and U.S. Patent Publication Nos. Allerson et al., US2008/0039618 and Migawa et al., US2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration.

α-L-methyleneoxy (4′-CH2—O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D configuration, unless otherwise specified.

In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars).

In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2-position (see, e.g., Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No. 7,939,677) and/or the 5′ position.

In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“INA”) (see, e.g., Leumann, C J. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:

(“F-HNA”, see e.g. Swayze et al., U.S. Pat. No. 8,088,904; Swayze et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S. Pat. No. 8,796,437; and Swayze et al., U.S. Pat. No. 9,005,906; F-HNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula:

wherein, independently, for each of said modified THP nucleoside:

Bx is a nucleobase moiety;

T3 and T4 are each, independently, an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′ or 3′-terminal group; q1, q2, q3, q4, q5, q6 and q7 are each, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and

each of R1 and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(═X)J1, OC(═X)NJ1J2, NJ3C(═X)NJ1J2, and CN, wherein X is O, S or NJ1, and each J1, J2, and J3 is, independently, H or C1-C6 alkyl.

In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6 and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat. No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat. No. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modifed morpholinos.”

In certain embodiments, sugar surrogates comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.

Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

2. Certain Modified Nucleobases

In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.

In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C═C—CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403; Manoharan et al., US2003/0175906; Dinh et al., U.S. Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302; Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S. Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No. 5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al., U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908; Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S. Pat. No. 5,525,711; Haralambidis et al., U.S. Pat. No. 5,552,540; Cook et al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No. 5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al., U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985; Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No. 5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S. Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No. 5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al., U.S. Pat. No. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. Pat. No. 6,005,096.

3. Certain Modified Internucleoside Linkages

In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P═S”), and phosphorodithioates (“HS—P═S”). Representative non-phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH2—N(CH3)—O—CH2—), thiodiester, thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH2—O—); and N,N′-dimethylhydrazine (—CH2—N(CH3)—N(CH3)—). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.

Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:

Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.

Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH2—N(CH3)—O-5′), amide-3 (3′-CH2—C(═O)—N(H)-5′), amide-4 (3′-CH2—N(H)—C(═O)-5′), formacetal (3′-O—CH2—O-5′), methoxypropyl, and thioformacetal (3′-S—CH2—O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.

B. Certain Motifs

In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).

1. Certain Sugar Motifs

In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5-wing differs from the sugar motif of the 3-wing (asymmetric gapmer).

In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least one nucleoside of each wing of a gapmer is a modified nucleoside. In certain embodiments, at least two nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least three nucleosides of each wing of a gapmer are modified nucleosides. In certain embodiments, at least four nucleosides of each wing of a gapmer are modified nucleosides.

In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer is an unmodified 2′-deoxynucleoside. In certain embodiments, at least one nucleoside of the gap of a gapmer is a modified nucleoside.

In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified 2′-deoxynucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides. In certain embodiments, each nucleoside of the gap is an unmodified 2′-deoxynucleoside. In certain embodiments, each nucleoside of each wing of a gapmer is a modified nucleoside.

In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2′-modification.

Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5′-wing]-[# of nucleosides in the gap]-[# of nucleosides in the 3′-wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise unmodified deoxynucleosides sugars. Thus, a 5-10-5 MOE gapmer consists of 5 linked MOE modified nucleosides in the 5′-wing, 10 linked deoxynucleosides in the gap, and 5 linked MOE nucleosides in the 3′-wing.

In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers.

2. Certain Nucleobase Motifs

In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines. In certain embodiments, all of the cytosine nucleobases are 5-methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3′-end of the oligonucleotide. In certain embodiments, the block is at the 5′-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5′-end of the oligonucleotide.

In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2′-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.

3. Certain Internucleoside Linkage Motifs

In certain embodiments, oligonucleotides comprise modified and/or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P═O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P═S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the internucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs.

C. Certain Modified Oligonucleotides

In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.

D. Certain Populations of Modified Oligonucleotides

Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for R-D ribosyl sugar moieties, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one, particular phosphorothioate internucleoside linkage in a particular stereochemical configuration.

E. Nucleobase Sequence

In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.

II. Certain Oligomeric Compounds

In certain embodiments, provided herein are oligomeric compounds, which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2′-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3′ and/or 5′-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3′-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5′-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5′-end of oligonucleotides.

Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

A. Certain Conjugate Groups

In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

1. Conjugate Moieties

Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

2. Conjugate Linkers

Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.

In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxynucleoside that is attached to either the 3′ or 5′-terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2′-deoxyadenosine.

B. Certain Terminal Groups

In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5′-phophate. Stabilized 5′-phosphates include, but are not limited to 5′-phosphanates, including, but not limited to 5′-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2′-linked nucleosides. In certain such embodiments, the 2′-linked nucleoside is an abasic nucleoside.

III. Oligomeric Duplexes

In certain embodiments, oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid. In certain embodiments, an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex. Such oligomeric duplexes comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group. The oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.

IV. Antisense Activity

In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in the standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.

In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA).

In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.

Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.

V. Certain Target Nucleic Acids

In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target nucleic acid is the RNA transcriptional product of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.

A. Complementarity/Mismatches to the Target Nucleic Acid

It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and a 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.

In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.

In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5′-end of the gap region. In certain embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3′-end of the gap region. In certain embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5′-end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3′-end of the wing region.

B. FUS

In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a FUS nucleic acid. In certain embodiments, the FUS nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No: NM_004960.3). In certain embodiments, the FUS nucleic acid has the sequence set forth in SEQ ID NO: 2 (GENBANK Accession No: NC_000016.10 truncated from nucleotides 31176001 to 31198000).

In certain embodiments an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing a FUS RNA in a cell. In certain embodiments an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing a FUS protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of ameliorating one or more symptom or hallmark of a neurodegenerative condition when it is introduced to a cell in a subject. Exemplary symptoms and hallmarks of ALS include, but are not limited to, muscle weakness and fatigue, slurred speech, twitching, cramping, and protein aggregates in the CNS. Exemplary symptoms and hallmarks of FTLD include, but are not limited to, speech difficulties and behavioral abnormalities.

In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing a detectable amount of FUS RNA in the CSF of a subject when the oligomeric compound is administered to the CSF of the subject. The detectable amount of the FUS RNA may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing a detectable amount of a FUS protein in the CSF of the subject when the oligomeric compound is administered to the CSF of the subject. The detectable amount of the FUS protein may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

VI. Certain Compounds

Compound No. 1043680

In certain embodiments, Compound No. 1043680 is characterized as a 5-10-5 MOE gapmer, having a sequence of (from 5′ to 3′) GTTTATCTGAATTCGCCATA (incorporated herein as SEQ ID NO: 12), wherein each of nucleosides 1-5 and 16-20 are 2′-O-methoxyethyl nucleosides, and each of nucleosides 6-15 are β-D-deoxyribonucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, and 15 to 16 are phosphorothioate linkages, and wherein each cytosine is a 5′-methylcytosine.

In certain embodiments, Compound No. 1043680 is described by the following chemical notation: Ges Teo Teo Teo Aeo Tds mCds Tds Gds Ads Ads Tds Tds mCds Gds mCeo mCeo Aes Tes Ae (SEQ ID NO: 12); wherein, A=an adenine, mC=a 5′-methylcytosine, G=a guanine, T=a thymine, e=a 2′-O-methoxyethylribose modified sugar, d=a 2′-deoxyribose sugar, s=a phosphorothioate internucleoside linkage, and o=a phosphodiester internucleoside linkage.

In certain embodiments, Compound No. 1043680 is described by the following chemical structure, or a salt thereof:

In certain embodiments, the sodium salt of Compound No. 1043680 is described by the following chemical structure:

Compound No. 1044030

In certain embodiments, Compound No. 1044030 is characterized as a 5-10-5 MOE gapmer, having a sequence of (from 5′ to 3′) GCAATGTCACCTTTCATACC (incorporated herein as SEQ ID NO: 13), wherein each of nucleosides 1-5 and 16-20 are 2′-O-methoxyethyl nucleosides, and each of nucleosides 6-15 are β-D-deoxyribonucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, and 15 to 16 are phosphorothioate linkages, and wherein each cytosine is a 5′-methylcyto sine.

In certain embodiments, Compound No. 1044030 is described by the following chemical notation: Ges Ceo Aeo Aeo Teo Gds Tds mCds Adsd mCds mCds Tds Tds Tds mCds Aeo Teo Aes mCes mCe (SEQ ID NO: 13); wherein, A=an adenine, mC=a 5′-methylcytosine, G=a guanine, T=a thymine, e=a 2′-O-methoxyethylribose modified sugar, d=a 2′-deoxyribose sugar, s=a phosphorothioate internucleoside linkage, and o=a phosphodiester internucleoside linkage.

In certain embodiments, Compound No. 1044030 is described by the following chemical structure, or a salt thereof:

In certain embodiments, the sodium salt of Compound No. 1044030 is described by the following chemical structure:

VII. Certain Hotspot Regions

In certain embodiments, nucleobases 1,786-1,841 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to a portion of nucleobases 1,786-1,841 of SEQ ID NO: 1. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, the gapmers are MOE gapmers. In certain embodiments, the internucleoside linkages of the modified oligonucleotides are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

The nucleobase sequences of SEQ ID NOs: 34, 35, 111, 112, 188, 265, 342, and 418 are complementary to nucleobases 1,786-1,841 of SEQ ID NO: 1.

The nucleobase sequences of Compound Nos: 1043394, 1043395, 1043396, 1043397, 1043398, 1043399, 1043400, and 1043401 are complementary to nucleobases 1,786-1,841 of SEQ ID NO: 1.

In certain embodiments, modified oligonucleotides complementary to nucleobases 1,786-1,841 of SEQ ID NO: 1 achieve an average of 83% reduction of FUS mRNA in vitro in the standard cell assay. In certain embodiments, modified oligonucleotides complementary to nucleobases 1,786-1,841 of SEQ ID NO: 1 achieve a minimum of 62% reduction of FUS mRNA in vitro in the standard cell assay.

VIII. Certain Pharmaceutical Compositions

In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.

Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.

In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.

In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.

In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

Under certain conditions, the compounds described herein act as an acids. For example, although Compound No. 1044030 may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of Compound No. 1044030 exist in equilibrium among such forms. For example, a phosphate linkage of Compound No. 1044030 in aqueous solution exists in equilibrium among free acid, anion, and salt forms. Unless otherwise indicated, the term, “Compound No. 1044030,” is intended to include all such forms. Moreover, Compound No. 1044030 has several such linkages, each of which is in equilibrium. Thus, Compound No. 1044030 exists in solution in an ensemble of forms at multiple positions all at equilibrium. The term “Compound No. 1044030” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of Compound No. 1044030 followed by the term “or a salt thereof” expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.

In certain embodiments, compounds are in aqueous solution with sodium. In certain embodiments, compounds are in aqueous solution with potassium. In certain embodiments, compounds are in PBS. In certain embodiments, compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HCl to achieve a desired pH.

Herein, certain specific doses are described. For clarity and by way of example, a dose of Compound No. 1044030 in milligrams indicates the mass of the free acid form of Compound No. 1044030. As described above, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that Compound No. 1044030 exists as a solvent-free, sodium-acetate free, anhydrous, free acid. For example, where Compound No. 1044030 is in solution comprising sodium (e.g., saline), Compound No. 1044030 may be partially or fully de-protonated and in association with Na+ ions. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the Na+ ions are not counted toward the weight of the dose. Thus, for example, a dose of 100 mg of Compound No. 1044030 equals the number of fully protonated molecules that weighs 100 mg. This would be equivalent to 106 mg of solvent-free, sodium-acetate free, anhydrous sodiated Compound No. 1044030.

IX. Certain Dosage Amounts

In certain embodiments, described herein are methods of administering to a subject a therapeutically effective amount of a compound disclosed herein. In certain embodiments, the therapeutically effective amount is 50 mg. In certain embodiments, the therapeutically effective amount is about 50 mg. In certain embodiments, the therapeutically effective amount is 60 mg. In certain embodiments, the therapeutically effective amount is about 60 mg. In certain embodiments, the therapeutically effective amount is 70 mg. In certain embodiments, the therapeutically effective amount is about 70 mg. In certain embodiments, the therapeutically effective amount is 80 mg. In certain embodiments, the therapeutically effective amount is about 80 mg. In certain embodiments, the therapeutically effective amount is 90 mg. In certain embodiments, the therapeutically effective amount is about 90 mg. In certain embodiments, the therapeutically effective amount is 100 mg. In certain embodiments, the therapeutically effective amount is about 100 mg. In certain embodiments, the therapeutically effective amount is 110 mg. In certain embodiments, the therapeutically effective amount is about 110 mg. In certain embodiments, the therapeutically effective amount is 120 mg. In certain embodiments, the therapeutically effective amount is about 120 mg. In certain embodiments, the therapeutically effective amount is 130 mg. In certain embodiments, the therapeutically effective amount is about 130 mg. In certain embodiments, the therapeutically effective amount is 140 mg. In certain embodiments, the therapeutically effective amount is about 140 mg. In certain embodiments, the therapeutically effective amount is 150 mg. In certain embodiments, the therapeutically effective amount is about 150 mg. In certain embodiments, the therapeutically effective amount is 160 mg. In certain embodiments, the therapeutically effective amount is about 160 mg. In certain embodiments, the therapeutically effective amount is 170 mg. In certain embodiments, the therapeutically effective amount is about 170 mg. In certain embodiments, the therapeutically effective amount is 180 mg. In certain embodiments, the therapeutically effective amount is about 180 mg. In certain embodiments, the therapeutically effective amount is 190 mg. In certain embodiments, the therapeutically effective amount is about 190 mg. In certain embodiments, the therapeutically effective amount is 200 mg. In certain embodiments, the therapeutically effective amount is about 200 mg.

In certain embodiments, the therapeutically effective amount is any of 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, 220 mg, 225 mg, 230 mg, 235 mg, 240 mg, 245 mg, 250 mg, 255 mg, 260 mg, 265 mg, 270 mg, 275 mg, 280 mg, 285 mg, 290 mg, 295 mg, and 300 mg.

In certain embodiments, the therapeutically effective amount is any of about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, about 150 mg, about 155 mg, about 160 mg, about 165 mg, about 170 mg, about 175 mg, about 180 mg, about 185 mg, about 190 mg, about 195 mg, about 200 mg, about 205 mg, about 210 mg, about 215 mg, about 220 mg, about 225 mg, about 230 mg, about 235 mg, about 240 mg, about 245 mg, about 250 mg, about 255 mg, about 260 mg, about 265 mg, about 270 mg, about 275 mg, about 280 mg, about 285 mg, about 290 mg, about 295 mg, and about 300 mg.

In certain embodiments, the therapeutically effective amount is any of 95.0 mg, 95.1 mg, 95.2 mg, 95.3 mg, 95.4 mg, 95.5 mg, 95.6 mg, 95.7 mg, 95.8 mg, 95.9 mg, 96.0 mg, 96.1 mg, 96.2 mg, 96.3 mg, 96.4 mg, 96.5 mg, 96.6 mg, 96.7 mg, 96.8 mg, 96.9 mg, 97.0 mg, 97.1 mg, 97.2 mg, 97.3 mg, 97.4 mg, 97.5 mg, 97.6 mg, 97.7 mg, 97.8 mg, 97.9 mg, 98.0 mg, 98.1 mg, 98.2 mg, 98.3 mg. 98.4 mg, 98.5 mg, 98.6 mg, 98.7 mg, 98.8 mg, 98.9 mg, 99.0 mg, 99.1 mg, 99.2 mg, 99.3 mg, 99.4 mg, 99.5 mg, 99.6 mg, 99.7 mg, 99.8 mg, 99.9 mg, 100.0 mg, 100.1 mg, 100.2 mg, 100.3 mg. 100.4 mg, 100.5 mg, 100.6 mg, 100.7 mg, 100.8 mg, 100.9 mg, 101.0 mg, 101.1 mg, 101.2 mg, 101.3 mg, 101.4 mg, 101.5 mg, 101.6 mg, 101.7 mg, 101.8 mg, 101.9 mg, 102.0 mg, 102.1 mg, 102.2 mg, 102.3 mg. 102.4 mg, 102.5 mg, 102.6 mg, 102.7 mg, 102.8 mg, 102.9 mg, 103.0 mg, 103.1 mg, 103.2 mg, 103.3 mg, 103.4 mg, 103.5 mg, 103.6 mg, 103.7 mg, 103.8 mg, 103.9 mg, 104.0 mg, 104.1 mg, 104.2 mg, 104.3 mg. 104.4 mg, 104.5 mg, 104.6 mg, 104.7 mg, 104.8 mg, 104.9 mg, and 105.0 mg.

In certain embodiments, the therapeutically effective amount is any of about 95.0 mg, about 95.1 mg, about 95.2 mg, about 95.3 mg, about 95.4 mg, about 95.5 mg, about 95.6 mg, about 95.7 mg, about 95.8 mg, about 95.9 mg, about 96.0 mg, about 96.1 mg, about 96.2 mg, about 96.3 mg, about 96.4 mg, about 96.5 mg, about 96.6 mg, about 96.7 mg, about 96.8 mg, about 96.9 mg, about 97.0 mg, about 97.1 mg, about 97.2 mg, about 97.3 mg, about 97.4 mg, about 97.5 mg, about 97.6 mg, about 97.7 mg, about 97.8 mg, about 97.9 mg, about 98.0 mg, about 98.1 mg, about 98.2 mg, about 98.3 mg. 98.4 mg, about 98.5 mg, about 98.6 mg, about 98.7 mg, about 98.8 mg, about 98.9 mg, about 99.0 mg, about 99.1 mg, about 99.2 mg, about 99.3 mg, about 99.4 mg, about 99.5 mg, about 99.6 mg, about 99.7 mg, about 99.8 mg, about 99.9 mg, about 100.0 mg, about 100.1 mg, about 100.2 mg, about 100.3 mg. 100.4 mg, about 100.5 mg, about 100.6 mg, about 100.7 mg, about 100.8 mg, about 100.9 mg, about 101.0 mg, about 101.1 mg, about 101.2 mg, about 101.3 mg, about 101.4 mg, about 101.5 mg, about 101.6 mg, about 101.7 mg, about 101.8 mg, about 101.9 mg, about 102.0 mg, about 102.1 mg, about 102.2 mg, about 102.3 mg. 102.4 mg, about 102.5 mg, about 102.6 mg, about 102.7 mg, about 102.8 mg, about 102.9 mg, about 103.0 mg, about 103.1 mg, about 103.2 mg, about 103.3 mg, about 103.4 mg, about 103.5 mg, about 103.6 mg, about 103.7 mg, about 103.8 mg, about 103.9 mg, about 104.0 mg, about 104.1 mg, about 104.2 mg, about 104.3 mg. 104.4 mg, about 104.5 mg, about 104.6 mg, about 104.7 mg, about 104.8 mg, about 104.9 mg, and about 105.0 mg.

In certain embodiments, the therapeutically effective amount is any of 115.0 mg, 115.1 mg, 115.2 mg, 115.3 mg, 115.4 mg, 115.5 mg, 115.6 mg, 115.7 mg, 115.8 mg, 115.9 mg, 116.0 mg, 116.1 mg, 116.2 mg, 116.3 mg, 116.4 mg, 116.5 mg, 116.6 mg, 116.7 mg, 116.8 mg, 116.9 mg, 117.0 mg, 117.1 mg, 117.2 mg, 117.3 mg, 117.4 mg, 117.5 mg, 117.6 mg, 117.7 mg, 117.8 mg, 117.9 mg, 118.0 mg, 118.1 mg, 118.2 mg, 118.3 mg. 118.4 mg, 118.5 mg, 118.6 mg, 118.7 mg, 118.8 mg, 118.9 mg, 119.0 mg, 119.1 mg, 119.2 mg, 119.3 mg, 119.4 mg, 119.5 mg, 119.6 mg, 119.7 mg, 119.8 mg, 119.9 mg, 120.0 mg, 120.1 mg, 120.2 mg, 120.3 mg. 120.4 mg, 120.5 mg, 120.6 mg, 120.7 mg, 120.8 mg, 120.9 mg, 121.0 mg, 121.1 mg, 121.2 mg, 121.3 mg, 121.4 mg, 121.5 mg, 121.6 mg, 121.7 mg, 121.8 mg, 121.9 mg, 122.0 mg, 122.1 mg, 122.2 mg, 122.3 mg. 122.4 mg, 122.5 mg, 122.6 mg, 122.7 mg, 122.8 mg, 122.9 mg, 123.0 mg, 123.1 mg, 123.2 mg, 123.3 mg, 123.4 mg, 123.5 mg, 123.6 mg, 123.7 mg, 123.8 mg, 123.9 mg, 124.0 mg, 124.1 mg, 124.2 mg, 124.3 mg. 124.4 mg, 124.5 mg, 124.6 mg, 124.7 mg, 124.8 mg, 124.9 mg, and 125.0 mg.

In certain embodiments, the therapeutically effective amount is any of about 115.0 mg, about 115.1 mg, about 115.2 mg, about 115.3 mg, about 115.4 mg, about 115.5 mg, about 115.6 mg, about 115.7 mg, about 115.8 mg, about 115.9 mg, about 116.0 mg, about 116.1 mg, about 116.2 mg, about 116.3 mg, about 116.4 mg, about 116.5 mg, about 116.6 mg, about 116.7 mg, about 116.8 mg, about 116.9 mg, about 117.0 mg, about 117.1 mg, about 117.2 mg, about 117.3 mg, about 117.4 mg, about 117.5 mg, about 117.6 mg, about 117.7 mg, about 117.8 mg, about 117.9 mg, about 118.0 mg, about 118.1 mg, about 118.2 mg, about 118.3 mg. 118.4 mg, about 118.5 mg, about 118.6 mg, about 118.7 mg, about 118.8 mg, about 118.9 mg, about 119.0 mg, about 119.1 mg, about 119.2 mg, about 119.3 mg, about 119.4 mg, about 119.5 mg, about 119.6 mg, about 119.7 mg, about 119.8 mg, about 119.9 mg, about 120.0 mg, about 120.1 mg, about 120.2 mg, about 120.3 mg. 120.4 mg, about 120.5 mg, about 120.6 mg, about 120.7 mg, about 120.8 mg, about 120.9 mg, about 121.0 mg, about 121.1 mg, about 121.2 mg, about 121.3 mg, about 121.4 mg, about 121.5 mg, about 121.6 mg, about 121.7 mg, about 121.8 mg, about 121.9 mg, about 122.0 mg, about 122.1 mg, about 122.2 mg, about 122.3 mg. 122.4 mg, about 122.5 mg, about 122.6 mg, about 122.7 mg, about 122.8 mg, about 122.9 mg, about 123.0 mg, about 123.1 mg, about 123.2 mg, about 123.3 mg, about 123.4 mg, about 123.5 mg, about 123.6 mg, about 123.7 mg, about 123.8 mg, about 123.9 mg, about 124.0 mg, about 124.1 mg, about 124.2 mg, about 124.3 mg. 124.4 mg, about 124.5 mg, about 124.6 mg, about 124.7 mg, about 124.8 mg, about 124.9 mg, and about 125.0 mg.

In certain embodiments, the therapeutically effective amount is any of 40 mg to 200 mg, 40 mg to 190 mg, 40 mg to 180 mg, 40 mg to 170 mg, from 40 mg to 160 mg, 40 mg to 150 mg, 40 mg to 140 mg, 40 mg to 120 mg, 40 mg to 110 mg, 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 200 mg, 50 mg to 190 mg, 50 mg to 180 mg, 50 mg to 170 mg, 50 mg to 160 mg, 50 mg to 150 mg, 50 mg to 140 mg, 50 mg to 120 mg, 50 mg to 110 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 200 mg, 60 mg to 190 mg, 60 mg to 180 mg, 60 mg to 170 mg, 60 mg to 160 mg, 60 mg to 150 mg, 60 mg to 140 mg, 60 mg to 120 mg, 60 mg to 110 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 200 mg, 70 mg to 190 mg, 70 mg to 180 mg, 70 mg to 170 mg, 70 mg to 160 mg, 70 mg to 150 mg, 70 mg to 140 mg, 70 mg to 120 mg, 70 mg to 110 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 200 mg, 80 mg to 190 mg, 80 mg to 180 mg, 80 mg to 170 mg, 80 mg to 160 mg, 80 mg to 150 mg, 80 mg to 140 mg, 80 mg to 120 mg, 80 mg to 110 mg, 80 mg to 100 mg, 80 mg to 90 mg, 90 mg to 200 mg, 90 mg to 190 mg, 90 mg to 180 mg, 90 mg to 170 mg, 90 mg to 160 mg, 90 mg to 150 mg, 90 mg to 140 mg, 90 mg to 120 mg, 90 mg to 110 mg, 90 mg to 100 mg, 100 mg to 200 mg, 100 mg to 190 mg, 100 mg to 180 mg, 100 mg to 170 mg, 100 mg to 160 mg, 100 mg to 150 mg, 100 mg to 140 mg, 100 mg to 120 mg, 100 mg to 110 mg, 110 mg to 200 mg, 110 mg to 190 mg, 110 mg to 180 mg, 110 mg to 170 mg, 110 mg to 160 mg, 110 mg to 150 mg, 110 mg to 140 mg, 110 mg to 130 mg, 110 mg to 120 mg, 120 mg to 200 mg, 120 mg to 190 mg, 120 mg to 180 mg, 120 mg to 170 mg, 120 mg to 160 mg, 120 mg to 150 mg, 120 mg to 140 mg, 120 mg to 130 mg, 130 mg to 200 mg, 130 mg to 190 mg, 130 mg to 180 mg, 130 mg to 170 mg, 130 mg to 160 mg, 130 mg to 150 mg, 130 mg to 140 mg, 140 mg to 200 mg, 140 mg to 190 mg, 140 mg to 180 mg, 140 mg to 170 mg, 140 mg to 160 mg, 140 mg to 150 mg, 150 mg to 200 mg, 150 mg to 190 mg, 150 mg to 180 mg, 150 mg to 170 mg, 150 mg to 160 mg, 160 mg to 200 mg, 160 mg to 190 mg, 160 mg to 180 mg, 160 mg to 170 mg, 180 mg to 200 mg, 180 mg to 190 mg, 190 mg to 200 mg, 105 mg to 135 mg, 105 mg to 130 mg, 105 mg to 125 mg 105 mg to 120 mg, 110 mg to 135 mg, 110 mg to 130 mg, 110 mg to 125 mg, 110 mg to 120 mg, 115 mg to 135 mg, 115 mg to 130 mg, 115 mg to 125 mg, 115 mg to 120 mg, 115 mg to 125 mg, 115 mg to 120 mg, 120 mg to 135 mg, 120 mg to 125 mg, 125 mg to 140 mg, 125 mg to 130 mg, 130 mg to 135 mg, 135 mg to 140 mg, 120 mg to 129 mg, 120 mg to 128 mg, 120 mg to 127 mg, 120 mg to 86 mg, 120 mg to 124 mg, 120 mg to 123 mg, 120 mg to 122 mg, 120 mg to 121 mg, 121 mg to 130 mg, 122 mg to 129 mg, 122 mg to 128 mg, 122 mg to 127 mg, 122 mg to 126 mg, 122 mg to 125 mg, 122 mg to 124 mg, 122 mg to 123 mg, 123 mg to 130 mg, 123 mg to 129 mg, 123 mg to 128 mg, 123 mg to 127 mg, 123 mg to 126 mg, 123 mg to 125 mg, 123 mg to 124 mg, 124 mg to 130 mg, 124 mg to 129 mg, 124 mg to 128 mg, 124 mg to 127 mg, 124 mg to 126 mg, 124 mg to 125 mg, 125 mg to 129 mg, 125 mg to 128 mg, 125 mg to 127 mg, 125 mg to 126 mg, 126 mg to 130 mg, 126 mg to 129 mg, 126 mg to 128 mg, 126 mg to 127 mg, 127 mg to 130 mg, 127 mg to 129 mg, 127 mg to 128 mg, 128 mg to 130 mg, 128 mg to 129 mg, and 129 mg to 130 mg.

In certain embodiments, the therapeutically effective amount is any of less than 300 mg, less than 295 mg, less than 290 mg, less than 285 mg, less than 280 mg, less than 275 mg, less than 270 mg, less than 265 mg, less than 260 mg, less than 255 mg, less than 250 mg, less than 245 mg, less than 240 mg, less than 235 mg, less than 230 mg, less than 225 mg, less than 220 mg, less than 215 mg, less than 210 mg, less than 205 mg, less than 200 mg, less than 195 mg, less than 190 mg, less than 185 mg, less than 180 mg, less than 175 mg, less than 170 mg, less than 165 mg, less than 160 mg, less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.

In certain embodiments, the therapeutically effective amount is any of less than about 300 mg, less than about 295 mg, less than about 290 mg, less than about 285 mg, less than about 280 mg, less than about 275 mg, less than about 270 mg, less than about 265 mg, less than about 260 mg, less than about 255 mg, less than about 250 mg, less than about 245 mg, less than about 240 mg, less than about 235 mg, less than about 230 mg, less than about 225 mg, less than about 220 mg, less than about 215 mg, less than about 210 mg, less than about 205 mg, less than about 200 mg, less than about 195 mg, less than about 190 mg, less than about 185 mg, less than about 180 mg, less than about 175 mg, less than about 170 mg, less than about 165 mg, less than about 160 mg, less than about 150 mg, less than about 145 mg, less than about 140 mg, less than about 135 mg, less than about 130 mg, less than about 125 mg, less than about 120 mg, less than about 115 mg, less than about 110 mg, less than about 105 mg, less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, less than about 50 mg, less than about 45 mg, less than about 40 mg, less than about 35 mg, less than about 30 mg, less than about 25 mg, less than about 20 mg, less than about 15 mg, less than about 10 mg, and less than about 5 mg.

In certain embodiments, the therapeutically effective amount is any of at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, at least 150 mg, at least 155 mg, at least 160 mg, at least 165 mg, at least 170 mg, at least 175 mg, at least 180 mg, at least 185, at least 190 mg, at least 195 mg, and at least 200 mg.

In certain embodiments, the therapeutically effective amount is any of at least about 5 mg, at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, or at least about 150 mg, at least about 155 mg, at least about 160 mg, at least about 165 mg, at least about 170 mg, at least about 175 mg, at least about 180 mg, at least about 185, at least about 190 mg, at least about 195 mg, and at least about 200 mg.

X. Certain Dosing Regimens

In certain embodiments, described herein are methods of administering to a subject a therapeutically effective amount of a compound disclosed herein one or more times. In certain embodiments, methods comprise administering the therapeutically effective amount at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times. In certain embodiments, methods comprise administering the therapeutically effective amount once every 4 weeks. In certain embodiments, methods comprise administering the therapeutically effective amount once every 8 weeks. In certain embodiments, methods comprise administering the therapeutically effective amount once every 12 weeks. In certain embodiments, methods comprise administering the therapeutically effective amount once every 16 weeks.

In certain embodiments, methods comprise administering the therapeutically effective amount about every 1 week, about every 2 weeks, about every 3 weeks, about every 4 weeks, about every 5 weeks, about every 6 weeks, about every 7 weeks, about every 8 weeks, about every 9 weeks, about every 10 weeks, about every 11 weeks, about every 12 weeks, about every 13 weeks, about every 14 weeks, about every 15 weeks, about every 16 weeks, about every 17 weeks, about every 18 weeks, about every 19 weeks, or about every 20 weeks.

In certain embodiments, methods comprise administering the therapeutically effective amount for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months.

Loading and Maintenance Doses

In certain embodiment, the therapeutically effective amount is administered as a loading dose and/or a maintenance dose. In certain embodiments, methods comprise administering a loading dose or doses and subsequently administering a maintenance dose or doses. In certain embodiments, methods comprise administering a loading dose once about every 4 weeks, and subsequently administering a maintenance dose once about every 8 weeks. In certain embodiments, methods comprise administering a loading dose once about every 4 weeks, and subsequently administering a maintenance dose once about every 16 weeks.

In certain embodiments, methods comprise administering at least 2 loading doses, at least 3 loading doses, at least 4 loading doses, at least 5 loading doses, or at least 6 loading doses. In certain embodiments, methods comprise administering 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 loading doses. In certain embodiments, methods comprise administering a loading dose or doses about every 1 week, about every 2 weeks, about every 3 weeks, about every 4 weeks, about every 5 weeks, about every 6 weeks, about every 7 weeks, about every 8 weeks, about every 9 weeks, about every 10 weeks, about every 11 weeks, or about every 12 weeks. In certain embodiments, methods comprise administering an initial loading dose and administering a second loading dose about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, or about 12 weeks after administering the initial loading dose.

In certain embodiments, methods comprise administering at least 2 maintenance doses, at least 3 maintenance doses, at least 4 maintenance doses, at least 5 maintenance doses, or at least 6 maintenance doses. In certain embodiments, methods comprise administering 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 maintenance doses. In some instances, methods comprise administering a maintenance dose or doses about every 4 weeks, about every 5 weeks, about every 6 weeks, about every 7 weeks, about every 8 weeks, about every 9 weeks, about every 10 weeks, about every 11 weeks, about every 12 weeks, about every 13 weeks, about every 14 weeks, about every 15 weeks, about every 16 weeks, about every 17 weeks, about every 18 weeks, about every 19 weeks, or about every 20 weeks. In certain embodiments, methods comprise administering a first maintenance dose and administering a second maintenance dose about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, or about 20 weeks after administering the first maintenance dose.

In certain embodiments, methods comprise administering a first maintenance dose or doses about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, or about 20 weeks after administering the last loading dose.

XI. Potency and Efficacy

In certain embodiments, described herein are methods of reducing FUS RNA and/or FUS protein in a cell or biological fluid of a human subject, wherein the methods comprise administering a therapeutically effective amount of Compound No. 1044030 to the subject. In certain embodiments, methods reduce FUS RNA and/or FUS protein in the cerebrospinal fluid of the human subject. One may determine whether or not methods reduce FUS RNA and/or FUS protein, e.g., by detecting/quantifying a first amount of FUS RNA or FUS protein in a first biological sample obtained before administering and detecting/quantifying a second amount of FUS RNA or FUS protein in a second biological sample obtained after administering, and detecting or quantifying a reduction in FUS RNA or FUS protein by comparing the first amount to the second amount.

In certain embodiments, methods comprise reducing FUS RNA and/or FUS protein by 1-100%, or a range defined by any two of these values. In certain embodiments, methods comprise reducing FUS RNA and/or FUS protein by 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

In certain embodiments, methods comprise reducing FUS RNA or FUS protein by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%.

In certain embodiments, methods comprise reducing FUS RNA or FUS protein by about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, or about 95% to 100%.

In certain embodiments, methods comprise administering Compound No. 1044030 to a subject and detecting or quantifying an amount of FUS RNA or FUS protein in a cell or a biological fluid of the subject. In certain embodiments, methods comprise detecting/quantifying a first amount of FUS RNA or FUS protein in a first biological sample obtained before administering and detecting/quantifying a second amount of FUS RNA or FUS protein in a second biological sample obtained after administering, and detecting or quantifying a reduction in FUS RNA or FUS protein by comparing the first amount to the second amount. In certain embodiments, the second biological sample is obtained less than about 24 hours after administering. In certain embodiments, the second biological sample is obtained less than about 1 week after administering. In certain embodiments, the second biological sample is obtained about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, or about 18 weeks after administering. In certain embodiments, methods comprise increasing or decreasing the dose after comparing the first amount to the second amount. In certain embodiments, methods comprise administering more frequently or less frequently after comparing the first amount to the second amount.

XII. Certain Indications

In certain embodiments, provided herein are methods of administering to a subject in need thereof an oligomeric compound targeting a FUS nucleic acid. Such oligomeric compounds are described herein.

In certain embodiments, the subject has a neurodegenerative condition. In certain embodiments, the neurodegenerative condition is a polyglutamine (polyQ) repeat disorder. In certain embodiments, the neurodegenerative condition is a neuronal intranuclear inclusion body disease (NIIBD). In certain embodiments, the neurodegenerative condition is ALS. In certain embodiments, the neurodegenerative condition is FTLD. In certain embodiments, the subject has juvenile ALS, wherein the subject develops at least one symptom or hallmark of ALS before the age of 25.

In certain embodiments, the subject has a FUS mutation (a mutation in a gene encoding FUS). In certain embodiments, the subject has a neurodegenerative condition associated with a FUS mutation. In certain embodiments, the subject has a FUS mutation associated with ALS. In certain embodiments, the FUS mutation associated with ALS results in overexpression of FUS relative to expression of FUS in a control subject that does not have a FUS mutation. In certain embodiments, the FUS mutation associated with ALS results in a gain of function of FUS protein relative to the activity of FUS protein in a control subject that does not have a FUS mutation. In certain embodiments the FUS mutation causes a FUS protein to aggregate in the cytoplasm, misfold, aggregate, or any combination thereof. In certain embodiments, the FUS mutation is a missense mutation. In certain embodiments, the FUS mutation is a truncation mutation.

In certain embodiments, the FUS mutation associated with ALS is a single nucleotide polymorphism (SNP). In certain embodiments, the SNP is selected from rs121909667 (C>G), rs121909668 (C>A/C>G/C>T), rs121909669 (G>A), rs121909671 (G>A/G>T), rs186547381 (C>T), rs267606831 (G>A), rs267606832 (C>G/C>T), rs267606833 (A>T), rs387906627 (C>T), rs387906628 (G>A), rs387907274 (C>T), rs752076094 (A>G), rs764487847 (C>G/C>T), rs886041389 (G>C), rs886041390 (C>T), rs886041577 (delGA), rs886041776 (dupGGTGG), rs1085308015 (A>C/A>G), rs1161032867 (delG/dupGGG), rs1555509569 (delA), rs1555509609 (A>C/A>G/A>T), rs1555509693 (A>G), rs1596908744 (delTT), rs1596912983 (dupAG), and rs121909668 (C>A/C>G/C>T), located at positions 31191408, 31191418, 31191410, 31191419, 31190398, 31191089, 31185061, 31191427, 31191052, 31185031, 31189158, 31185175, 31183884, 31191429, 31191431, 31191073-31191074, 31191079-31191083, 31191407, 31191070-31191073, 31190961, 31191109, 31191421, 31189748-31189751, 31191076-31191079, and 31191418 of chromosome 16, respectively, according to Genome Reference Consortium Human Build 38 patch release 12 (GRCh38.p12).

In certain embodiments, the FUS mutation associated with ALS results in a modification of a FUS protein amino acid sequence relative to a wildtype FUS protein (e.g., see NCBI reference number NP_004951.1 (SEQ ID NO: 3)). In certain embodiments, the modification of the FUS protein amino acid sequence is selected from S57del, S96del, G156E, G171-174del, G174-175del, G187S, G191S, G206S, R216C, G225V, G230C, R234C, R234L, R244C, M254V, S402_P411delinsGGGG, S462F, G466VfsX14, Y484AfsX514, R495X, R495EfsX527, G497AfsX527, G507D, K510WfsX517, K510E, S513P, R514S, R514G, G515C, E516V, H517D, H517P, H517Q, R518G, R518K, Q519IfsX9, R521C, R521G, R521H, R521L, R521S, R522G, R524S, R524T, R524W, and P525L. In certain embodiments, the FUS mutation results in a modification of at least one of the 60 amino acids at the C-terminal of the FUS protein amino acid sequence relative to a wildtype FUS protein. In certain embodiments, the FUS mutation results in a modification of at least one of the 17 amino acids at the C-terminal of the FUS protein amino acid sequence relative to a wildtype FUS protein. In certain embodiments, the FUS mutation results in the substitution of the proline at amino acid position 525 of SEQ ID NO: 3 with an amino acid other than proline. In certain embodiments, the FUS mutation is P525L.

In certain embodiments, methods comprise identifying a FUS mutation in a subject. In certain embodiments, methods comprise identifying a FUS mutation in a subject and subsequently administering an oligomeric compound disclosed herein to the subject. In certain embodiments, identifying the FUS mutation may comprise obtaining information about a sequence of a FUS nucleic acid in a sample from the subject. In certain embodiments, obtaining information about the sequence of the FUS nucleic acid comprises obtaining a sequence of a FUS nucleic acid in a sample from the subject. In certain embodiments, the sequence of the FUS nucleic acid is obtained from a sequencing reaction, e.g., Sanger sequencing or high throughput sequencing. In certain embodiments, identifying a FUS mutation comprises contacting the FUS nucleic acid with a primer or a probe. In certain embodiments, the primer or probe hybridizes to the nucleic acid if the mutation is present. In certain embodiments, the primer or probe does not hybridize to the nucleic acid if the mutation is present.

XIII. Certain Comparator Compounds

Comparator Compound No. 441522 was selected as a comparator compound in the experiment described in Example 8 of the instant specification. Comparator Compound No. 441522 is identical to a FUS-targeting modified oligonucleotide described by Lagier-Tourenne et al., Nat Neurosci. 15(11):1488-1497 (2012), incorporated herein by reference. Compound No. 441522 is a gapmer having a sugar motif of (from 5′ to 3′) eeeeeddddddddddeeeee, wherein each “e” represents a 2′-MOE sugar moiety and each “d” represents a 2′-β-D-deoxyribosyl sugar moiety; having a sequence of (from 5′ to 3′) CCTGGTTATTTCCCATGAGC (SEQ ID NO: 481) wherein each “C” of the gap is a 5-methyl cytosine; and wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

In certain embodiments, compounds described herein are more tolerable relative to Comparator Compound No. 441522.

For example, as described herein (see Example 5), Comparator Compound No. 441522 had a 3-hour FOB of 6.00 in mice, whereas Compound No. 1044030 had a 3-hour FOB of 0.00 in mice. An FOB of 6 indicates the mouse is immobile and unresponsive to stimuli. An FOB of 0 indicates a bright, alert, and responsive mouse. Therefore, certain compounds described herein are more tolerable than Comparator Compound No. 441522.

Nonlimiting Disclosure and Incorporation by Reference

Each of the literature and patent publications listed herein is incorporated by reference in its entirety.

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.

Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH in place of one 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of a uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “ATmCGAUCG,” wherein mC indicates a cytosine base comprising a methyl group at the 5-position.

Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or R such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.

Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.

The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2H or 3H in place of 1H, 13C or 14C in place of 12C, 5N in place of 14N, 17O or 18O in place of 16O, and 33S, 34S, 35S or 36S in place of 32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.

EXAMPLES

The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.

Example 1: Effects of Modified Oligonucleotides on Human FUS RNA In Vitro, Single Dose

Modified oligonucleotides complementary to human FUS were designed and tested for their single dose effects on FUS mRNA in vitro.

The modified oligonucleotides are 5-10-5 MOE gapmers, wherein a central gap segment consists of ten 2′-β-D-deoxynucleosides, the 5′ wing segment consists of five 2′-MOE nucleosides, and the 3′ wing segment consists of five 2′-MOE nucleosides. The sugar motif of the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. The gapmers have an internucleoside linkage motif of (from 5′ to 3′): soooossssssssssooss; wherein “s” represents a phosphorothioate internucleoside linkage and “o” represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines.

The sequences of the modified oligonucleotides are shown in Tables 1-6 below. “Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence. Each modified oligonucleotide listed in the Tables 1-6 is 100% complementary to SEQ ID NO: 2 (GENBANK Accession No. NC_000016.10 truncated from nucleotides 31176001 to 31198000). ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular gene sequence. The values marked with an asterisk (*) indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set.

Cultured A-431 cells at a density of 10,000 cells per well, were treated with modified oligonucleotide at a concentration of 4,000 nM using free uptake for a treatment period of 48 hours. At the end of the treatment period, total RNA was isolated from the cells and FUS RNA levels were measured by quantitative real-time PCR. FUS RNA levels were measured by Human FUS primer probe set RTS38562 (forward sequence TGCTTGCTTGCCTGTGC, designated herein as SEQ ID NO: 6; reverse sequence ACTGTAACTCTGCTGTCCGT, designated herein as SEQ ID NO: 7; probe sequence TTGAGGCCATGTCCGCGC, designated herein as SEQ ID NO: 8). FUS RNA levels were normalized to total RNA content, as measured by RIBOGREEN®.

TABLE 1
Reduction of FUS RNA by 5-10-5 MOE gapmers with mixed PO/PS linkages
complementary to human FUS
SEQ SEQ SEQ SEQ
ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 FUS SEQ
Compound Start Stop Start Stop (% ID
Number Site Site Site Site Sequence (5′ to 3′) UTC) NO
1043279   51   70  4160  4179 AGTTCCAACACCGCTGAGTA  40 14
1043285   91  110  4200  4219 GCCATGTCCGCGCACGCGCG   7* 15
1043291  218  237  6587  6606 GGACTGGCTATAACCACTGT  74* 16
1043297  266  285  6635  6654 CTGGCCATAAGAAGAATAGC 111 17
1043303  330  349  7892  7911 CATAGCCGCCAGTCGAGCCA  98 18
1043309  362  381  7924  7943 CCCGTAAGACGATTGGGAGC 105 19
1043315  439  458  8207  8226 TGAGAACTGCTACCGTAACT  43 20
1043321  505  524  8273  8292 TGCTGTCCACCATAGCTAGG  74 21
1043327  648  667  8958  8977 CACCACTACTCATGGAGGAT  36 22
1043333  719  738  9029  9048 CTGCTGTCCATAGCCACCGC  53 23
1043339  788  807  9098  9117 GCGGTTGTAACCACCACCGC  87 24
1043345 1198 1217 14066 14085 CGAGTAGCAAATGAGACCTT  67 25
1043351 1225 1244 14093 14112 CCACCACCCCGATTAAAGTC  55 26
1043357 1320 1339 14321 14340 TGGGAAATCCTCCTCGGCCA  96 27
1043363 1505 1524 14969 14988 ACGACGATCATCCCCGTAGT  55 28
1043369 1534 1553 14998 15017 CCGCCTCGATCATAGCCTCC  52 29
1043375 1544 1563 15008 15027 GCCCCGGTAGCCGCCTCGAT  68 30
1043381 1667 1686 15419 15438 TTAATACGGCCTCTCCCTGC  87 31
1043387 1676 1695 15428 15447 CCAGGCTAATTAATACGGCC 105 32
1043393 1781 1800 15533 15552 TAGTCCGACACAAAAAAACC  66 33
1043397 1792 1811 15544 15563 TTACAATTACATAGTCCGAC   6 34
1043400 1808 1827 15560 15579 GGAACCAGAGGTATAGTTAC  35 35
1043406 1883 1902 15635 15654 TCGGGACATCGATCTTCCAG 103 36
1043412 1922 1941 15674 15693 GCAGGGTAATCTGAACAGGA  91 37
1043418 1964 1983 15716 15735 ATTTGGCCTTCTCCCCGAAC 104 38
1043424 2061 2080 15813 15832 TAGGCCAACACTCATGACAT  76 39
1043430 2334 2353 16086 16105 GAGTCACTCACCTCCTAGAT 107 40
1043436 2448 2467 16200 16219 GTCAATGACCTCAAGCCCTC  63 41
1043442 2606 2625 16358 16377 CGTGCAAGTTTACAACCACA  72 42
1043448 2718 2737 16470 16489 TCTTACAAACCAAGTTCGAA  94 43
1043454 3471 3490 17223 17242 GGAAGTAAACCTGCTATTCC  98 44
1043460 3519 3538 17271 17290 ACCACTCTCCGCCTACTGTT  79 45
1043466 3531 3550 17283 17302 TTAATACGCCAGACCACTCT 105 46
1043472 3553 3572 17305 17324 CCCACTTGACGATCCTTTGT  83 47
1043478 3681 3700 17433 17452 AGTGAACTACTCAAATATCG  71 48
1043484 3794 3813 17546 17565 GGTCCCAGTAATCATATCTT  81 49
1043490 3841 3860 17593 17612 GGCCAATCACATATGCCATT  96 50
1043496 3895 3914 17647 17666 ACTGGACCTACCCACTAAAC  99 51
1043502 4232 4251 17984 18003 TGGGACACCTAATGCTTCAA  78 52
1043508 4404 4423 18156 18175 GCAGCCCTACATCCAAGTAC  94 53
1043514 4434 4453 18186 18205 CTGGTCAATCTACCCACCAC  92 54
1043520 4450 4469 18202 18221 CCCTAGACCTTAATTCCTGG 102 55
1043526 4841 4860 18593 18612 ATTTTCATAGCCGGACACAG  77 56
1043532 N/A N/A  3749  3768 TGGCCGGGCCCCTTCGCTGG  91 57
1043538 N/A N/A  3887  3906 CGATCTATCTCCACCCCCAT 114 58
1043544 N/A N/A  3901  3920 GCAGGACTAGCCCACGATCT  84 59
1043550 N/A N/A  4104  4123 GTCGAAGCTTAAGTACGCTC 113 60
1043556 N/A N/A  4225  4244 CTCGCGCCCTTACCTACCGT  98* 61
1043562 N/A N/A  4290  4309 CCCGGTCCCACTGAAAACGA  97 62
1043568 N/A N/A  4417  4436 AGACTTCCCGCCCCGCGCGC  88 63
1043574 N/A N/A  4755  4774 GGAGCGATCCCGCCCATTCG 104 64
1043580 N/A N/A  4838  4857 CCACCGCCGCCAAACCGTTA 101 65
1043586 N/A N/A  4871  4890 GGGCCGTCCCCAAGTCCGTT 106 66
1043592 N/A N/A  5238  5257 CGGCCGTTCTTCTCCGTCCC  94 67
1043598 N/A N/A  5543  5562 GGCTTTTTAGTGCAAAGCCA  81 68
1043604 N/A N/A  5775  5794 GTGATTGCTCTAAAACATCG  72 69
1043610 N/A N/A  7636  7655 AGTTCCAATTTCACCCCGCC  38 70
1043616 N/A N/A  7989  8008 CCGTACCTTCCCGAGGTGCT 111 71
1043622 N/A N/A  7999  8018 ATCAACACCACCGTACCTTC  94 72
1043628 N/A N/A  8931  8950 GGCCATAGTTACCTGTGAGA  80 73
1043634 N/A N/A  9507  9526 ATCATCGGTTTCCCTTGCAG   5 74
1043640 N/A N/A  9721  9740 GCTTACTTCAGTCAGCTGGC  19 75
1043646 N/A N/A 10220 10239 GTCACCCCTTCTACACTGCG  15 76
1043652 N/A N/A 10443 10462 GTTGGTTTAAAAACCCTACC  80 77
1043658 N/A N/A 10999 11018 TACCTGCTCCAGGTTAGCAC  80 78
1043664 N/A N/A 11075 11094 TCCAAGGCCTACTAGACCCC  71 79
1043670 N/A N/A 11315 11334 TCATTGACACCATTCCGTAC  25 80
1043676 N/A N/A 11467 11486 GGTCCACGAATTCAGTTTGT  47 81
1043682 N/A N/A 11812 11831 GTTGTTTCCCCGAAACCACA  85 82
1043688 N/A N/A 11932 11951 TGGGCTCGCCACCAGCCATG  75 83
1043694 N/A N/A 12159 12178 CCAAACCCTTTCCTGGGTCG  96 84
1043700 N/A N/A 12564 12583 GGGTCCTCTCAGACCTAAAT  99 85
1043706 N/A N/A 13418 13437 GGTACTCTGATAAGTTATAC  51 86
1043712 N/A N/A 13842 13861 GGCTTGTTTCCTAAGGCTTG 101 87
1043718 N/A N/A 14454 14473 CGCACATACCTCAGTACCAA  53 88
1043724 N/A N/A 14899 14918 GTTCCCCGAGCCTCCCCGCT 102 89
1043730 N/A N/A 15154 15173 ACCCTGTTATCCTATGGCCT  83 90
1043736 N/A N/A 15301 15320 CCCTCCTACCTAACCCAGCG  90 91

TABLE 2
Reduction of FUS RNA by 5-10-5 MOE gapmers with mixed PO/PS linkages
complementary to human FUS RNA
SEQ SEQ SEQ SEQ
ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 FUS SEQ
Compound Start Stop Start Stop (% ID
Number Site Site Site Site Sequence (5′ to 3′) UTC) NO
1043280   54   73  4163  4182 CGAAGTTCCAACACCGCTGA  45  92
1043286   98  117  4207  4226 GTTTGAGGCCATGTCCGCGC  15*  93
1043292  233  252  6602  6621 GCCTGAAGTGTCCGTGGACT  86  94
1043298  321  340  7883  7902 CAGTCGAGCCATATCCCTGG  74  95
1043304  333  352  7895  7914 TGCCATAGCCGCCAGTCGAG  82  96
1043310  363  382  7925  7944 GCCCGTAAGACGATTGGGAG  94  97
1043316  494  513  8262  8281 ATAGCTAGGCTGCTGGCTGT  89  98
1043322  506  525  8274  8293 CTGCTGTCCACCATAGCTAG  88  99
1043328  678  697  8988  9007 CTTGATTGCCATAACCGCCA  37 100
1043334  720  739  9030  9049 CCTGCTGTCCATAGCCACCG  36 101
1043340  789  808  9099  9118 TGCGGTTGTAACCACCACCG  48 102
1043346 1199 1218 14067 14086 GCGAGTAGCAAATGAGACCT  52 103
1043352 1226 1245 14094 14113 GCCACCACCCCGATTAAAGT  36 104
1043358 1322 1341 14323 14342 ACTGGGAAATCCTCCTCGGC  94 105
1043364 1506 1525 14970 14989 CACGACGATCATCCCCGTAG  56 106
1043370 1535 1554 14999 15018 GCCGCCTCGATCATAGCCTC  91 107
1043376 1567 1586 15031 15050 AAGCCTCCACGGTCCCCGCC  83 108
1043382 1668 1687 15420 15439 ATTAATACGGCCTCTCCCTG  92 109
1043388 1677 1696 15429 15448 GCCAGGCTAATTAATACGGC  89 110
1043394 1786 1805 15538 15557 TTACATAGTCCGACACAAAA  38 111
1043397 1792 1811 15544 15563 TTACAATTACATAGTCCGAC   6  34
1043401 1822 1841 15574 15593 GGTCACTTTTAATGGGAACC   9 112
1043407 1885 1904 15637 15656 GATCGGGACATCGATCTTCC 121 113
1043413 1958 1977 15710 15729 CCTTCTCCCCGAACACTGTA  78 114
1043419 1965 1984 15717 15736 CATTTGGCCTTCTCCCCGAA  94 115
1043425 2062 2081 15814 15833 TTAGGCCAACACTCATGACA  84 116
1043431 2335 2354 16087 16106 GGAGTCACTCACCTCCTAGA 103 117
1043437 2487 2506 16239 16258 CCTCCAATCAAAAAGGGATC  94 118
1043443 2661 2680 16413 16432 GTTACGCTCTGTGTAACTAA  84 119
1043449 2719 2738 16471 16490 GTCTTACAAACCAAGTTCGA  82 120
1043455 3494 3513 17246 17265 GAGAGCACCCCAATGCTGGC 110 121
1043461 3520 3539 17272 17291 GACCACTCTCCGCCTACTGT  90 122
1043467 3533 3552 17285 17304 TTTTAATACGCCAGACCACT  85 123
1043473 3554 3573 17306 17325 GCCCACTTGACGATCCTTTG 103 124
1043479 3689 3708 17441 17460 GCACCAACAGTGAACTACTC 101 125
1043485 3796 3815 17548 17567 ATGGTCCCAGTAATCATATC 104 126
1043491 3846 3865 17598 17617 GTCAAGGCCAATCACATATG  86 127
1043497 3896 3915 17648 17667 AACTGGACCTACCCACTAAA  98 128
1043503 4233 4252 17985 18004 ATGGGACACCTAATGCTTCA  73 129
1043509 4405 4424 18157 18176 TGCAGCCCTACATCCAAGTA  98 130
1043515 4444 4463 18196 18215 ACCTTAATTCCTGGTCAATC  91 131
1043521 4452 4471 18204 18223 GACCCTAGACCTTAATTCCT 118 132
1043527 N/A N/A  3462  3481 CCCGGATCCTCATGGCTTTG 105 133
1043533 N/A N/A  3750  3769 GTGGCCGGGCCCCTTCGCTG 102 134
1043539 N/A N/A  3892  3911 GCCCACGATCTATCTCCACC 107 135
1043545 N/A N/A  4029  4048 GGAACGCACTCCGCCCCCTT  75 136
1043551 N/A N/A  4220  4239 GCCCTTACCTACCGTTTGAG  99* 137
1043557 N/A N/A  4226  4245 CCTCGCGCCCTTACCTACCG  89* 138
1043563 N/A N/A  4304  4323 CACGGGATCGCCGCCCCGGT  90 139
1043569 N/A N/A  4672  4691 CTCGCGACAGAAAGCTGAAC 106 140
1043575 N/A N/A  4756  4775 CGGAGCGATCCCGCCCATTC  71 141
1043581 N/A N/A  4839  4858 ACCACCGCCGCCAAACCGTT  82 142
1043587 N/A N/A  4873  4892 TCGGGCCGTCCCCAAGTCCG 108 143
1043593 N/A N/A  5239  5258 GCGGCCGTTCTTCTCCGTCC 113 144
1043599 N/A N/A  5572  5591 ACTCTTTGACCAATCCCGGA  76 145
1043605 N/A N/A  5815  5834 GGTGGACATCCACAATTTTC  93 146
1043611 N/A N/A  7637  7656 CAGTTCCAATTTCACCCCGC  42 147
1043617 N/A N/A  7990  8009 ACCGTACCTTCCCGAGGTGC  94 148
1043623 N/A N/A  8004  8023 CCGACATCAACACCACCGTA 103 149
1043629 N/A N/A  8933  8952 TTGGCCATAGTTACCTGTGA  89 150
1043635 N/A N/A  9587  9606 TCAGGTTAACCATTACCAAC  41 151
1043641 N/A N/A  9926  9945 GTAGGGTCCTTCAAATCTTA   7 152
1043647 N/A N/A 10221 10240 GGTCACCCCTTCTACACTGC  17 153
1043653 N/A N/A 10459 10478 GGTTGACAACCAAGTAGTTG   9 154
1043659 N/A N/A 11014 11033 ATTGAGTCTTACCCCTACCT  49 155
1043665 N/A N/A 11076 11095 GTCCAAGGCCTACTAGACCC  52 156
1043671 N/A N/A 11316 11335 TTCATTGACACCATTCCGTA  25 157
1043677 N/A N/A 11621 11640 CACCTAAGTCATGAACCCAC  52 158
1043683 N/A N/A 11816 11835 CCGTGTTGTTTCCCCGAAAC   9 159
1043689 N/A N/A 11935 11954 AGATGGGCTCGCCACCAGCC  86 160
1043695 N/A N/A 12309 12328 GGGCCTTTAGTGACATGGAA 117 161
1043701 N/A N/A 12794 12813 GGTCCCCGAATTAAATAAGA  89 162
1043707 N/A N/A 13608 13627 GCTACAGTACTCCCTTTCCA  91 163
1043713 N/A N/A 13985 14004 GCAAGACACATTAATCCGAA 106 164
1043719 N/A N/A 14455 14474 ACGCACATACCTCAGTACCA  31 165
1043725 N/A N/A 14911 14930 CCATTCCCCTATGTTCCCCG 107 166
1043731 N/A N/A 15155 15174 AACCCTGTTATCCTATGGCC  81 167
1043737 N/A N/A 15318 15337 CTAGATATCCTATCTGCCCC  84 168

TABLE 3
Reduction of FUS RNA by 5-10-5 MOE gapmers with mixed PO/PS linkages
complementary to human FUS RNA
SEQ SEQ SEQ SEQ
ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 FUS SEQ
Compound Start Stop Start Stop (% ID
Number Site Site Site Site Sequence (5′ to 3′) UTC) NO
1043281   55   74 4164  4183 ACGAAGTTCCAACACCGCTG  18 169
1043287  167  186  6536  6555 CTGGGAATAGCCCTGCCCGG  48* 170
1043293  236  255  6605  6624 ATAGCCTGAAGTGTCCGTGG  54 171
1043299  322  341  7884  7903 CCAGTCGAGCCATATCCCTG  59 172
1043305  335  354  7897  7916 ACTGCCATAGCCGCCAGTCG 104 173
1043311  364  383  7926  7945 TGCCCGTAAGACGATTGGGA  97 174
1043317  496  515  8264  8283 CCATAGCTAGGCTGCTGGCT  63 175
1043323  507  526  8275  8294 GCTGCTGTCCACCATAGCTA  44 176
1043329  679  698  8989  9008 TCTTGATTGCCATAACCGCC  64 177
1043335  724  743  9034  9053 CGGTCCTGCTGTCCATAGCC  62 178
1043341  991 1010 13176 13195 GCCACAGACTCAATTGTAAC  36 179
1043347 1215 1234 14083 14102 GATTAAAGTCTGCCCGGCGA 102 180
1043353 1227 1246 14095 14114 TGCCACCACCCCGATTAAAG  53 181
1043359 1323 1342 14324 14343 CACTGGGAAATCCTCCTCGG 100 182
1043365 1507 1526 14971 14990 CCACGACGATCATCCCCGTA  78 183
1043371 1536 1555 15000 15019 AGCCGCCTCGATCATAGCCT  62 184
1043377 1572 1591 15036 15055 CTCGGAAGCCTCCACGGTCC  93 185
1043383 1670 1689 15422 15441 TAATTAATACGGCCTCTCCC  88 186
1043389 1678 1697 15430 15449 AGCCAGGCTAATTAATACGG 121 187
1043395 1788 1807 15540 15559 AATTACATAGTCCGACACAA   8 188
1043397 1792 1811 15544 15563 TTACAATTACATAGTCCGAC   6  34
1043402 1876 1895 15628 15647 ATCGATCTTCCAGGAAAGTG 106 189
1043408 1896 1915 15648 15667 TCTACCTTCCTGATCGGGAC  76 190
1043414 1959 1978 15711 15730 GCCTTCTCCCCGAACACTGT 105 191
1043420 1966 1985 15718 15737 TCATTTGGCCTTCTCCCCGA  78 192
1043426 2186 2205 15938 15957 GCCTCACCATTAAAAGGGCC  94 193
1043432 2336 2355 16088 16107 GGGAGTCACTCACCTCCTAG 100 194
1043438 2503 2522 16255 16274 TAGGAGGGCCTTCCACCCTC 122 195
1043444 2666 2685 16418 16437 TTAATGTTACGCTCTGTGTA  88 196
1043450 2720 2739 16472 16491 TGTCTTACAAACCAAGTTCG 104 197
1043456 3514 3533 17266 17285 TCTCCGCCTACTGTTGCTTA 104 198
1043462 3525 3544 17277 17296 CGCCAGACCACTCTCCGCCT  28 199
1043468 3534 3553 17286 17305 TTTTTAATACGCCAGACCAC 112 200
1043474 3557 3576 17309 17328 AAGGCCCACTTGACGATCCT  92 201
1043480 3711 3730 17463 17482 GATTAGAATCCTGCTAGGCA  89 202
1043486 3807 3826 17559 17578 ACTTGACACTAATGGTCCCA  91 203
1043492 3891 3910 17643 17662 GACCTACCCACTAAACAGTC  97 204
1043498 3898 3917 17650 17669 CAAACTGGACCTACCCACTA 102 205
1043504 4263 4282 18015 18034 CTTAGCCTGTCCCAATTCCA 106 206
1043510 4406 4425 18158 18177 CTGCAGCCCTACATCCAAGT 109 207
1043516 4445 4464 18197 18216 GACCTTAATTCCTGGTCAAT 129 208
1043522 4453 4472 18205 18224 GGACCCTAGACCTTAATTCC 104 209
1043528 N/A N/A  3463  3482 ACCCGGATCCTCATGGCTTT 100 210
1043534 N/A N/A  3762  3781 ACCGAGATTCCTGTGGCCGG  96 211
1043540 N/A N/A  3893  3912 AGCCCACGATCTATCTCCAC  75 212
1043546 N/A N/A  4087  4106 CTCCGCCGCCTACGCACCGC  97 213
1043552 N/A N/A  4221  4240 CGCCCTTACCTACCGTTTGA  94* 214
1043558 N/A N/A  4227  4246 GCCTCGCGCCCTTACCTACC  90* 215
1043564 N/A N/A  4340  4359 CGCGGCTTCCCGCCACAGGG  95 216
1043570 N/A N/A  4710  4729 CACACCGGACGCGCGCCGCC 103 217
1043576 N/A N/A  4760  4779 GGAACGGAGCGATCCCGCCC 133 218
1043582 N/A N/A  4848  4867 CGAACCCTGACCACCGCCGC 100 219
1043588 N/A N/A  4877  4896 ACTCTCGGGCCGTCCCCAAG 115 220
1043594 N/A N/A  5349  5368 AGCCCCACTTAAGATACACG 115 221
1043600 N/A N/A  5664  5683 CAGGTTTGAATTCGAACAGT  48 222
1043606 N/A N/A  5914  5933 CGTTATCAGCCAAGTGTTCT  85 223
1043612 N/A N/A  7654  7673 CTACCAACTCTTTAGTACAG  58 224
1043618 N/A N/A  7991  8010 CACCGTACCTTCCCGAGGTG  85 225
1043624 N/A N/A  8005  8024 CCCGACATCAACACCACCGT  97 226
1043630 N/A N/A  9178  9197 GGCTCATGAGACACCTACCC  75 227
1043636 N/A N/A  9588  9607 GTCAGGTTAACCATTACCAA   9 228
1043642 N/A N/A 10012 10031 CTTACCATTTCCAAACTCGG  36 229
1043648 N/A N/A 10222 10241 GGGTCACCCCTTCTACACTG  95 230
1043654 N/A N/A 10956 10975 TACCCTACCCCTTTCTGGAG  76 231
1043660 N/A N/A 11060 11079 ACCCCTCTTATTAACCTGGG  56 232
1043666 N/A N/A 11087 11106 GCAACGGCCCAGTCCAAGGC  67 233
1043672 N/A N/A 11368 11387 GAGCTAGTTTCTATTTGCCC  24 234
1043678 N/A N/A 11623 11642 GACACCTAAGTCATGAACCC  35 235
1043684 N/A N/A 11829 11848 ACCATCCTTAAAACCGTGTT   7 236
1043690 N/A N/A 11961 11980 CCCGGTTCTCTCACCCGAGA  96 237
1043696 N/A N/A 12314 12333 CCCGAGGGCCTTTAGTGACA  62 238
1043702 N/A N/A 13033 13052 CCTAGTATCCATCAAGCAAC  69 239
1043708 N/A N/A 13791 13810 GCCTTCTCATACATACCATC 105 240
1043714 N/A N/A 13986 14005 TGCAAGACACATTAATCCGA 129 241
1043720 N/A N/A 14534 14553 ACATCAACCTTACCTAGGTA  82 242
1043726 N/A N/A 14957 14976 CCCGTAGTTACCCCCTAGGA  75 243
1043732 N/A N/A 15284 15303 GCGAGTATCTTATCTCAAGT  54 244
1043738 N/A N/A 15319 15338 CCTAGATATCCTATCTGCCC  87 245

TABLE 4
Reduction of FUS RNA by 5-10-5 MOE gapmers with mixed PO/PS linkages
complementary to human FUS RNA
SEQ SEQ SEQ SEQ
ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 FUS SEQ
Compound Start Stop Start Stop (% ID
Number Site Site Site Site Sequence (5′ to 3′) UTC) NO
1043282   56   75  4165  4184 AACGAAGTTCCAACACCGCT  49* 246
1043288  197  216  6566  6585 ACTCTGCTGTCCGTAGGGCT   8* 247
1043294  240  259  6609  6628 GGCCATAGCCTGAAGTGTCC  85 248
1043300  323  342  7885  7904 GCCAGTCGAGCCATATCCCT  59 249
1043306  339  358  7901  7920 GGCTACTGCCATAGCCGCCA  97 250
1043312  370  389  7932  7951 GACTGCTGCCCGTAAGACGA  48 251
1043318  497  516  8265  8284 ACCATAGCTAGGCTGCTGGC  56 252
1043324  627  646  8937  8956 GATCTTGGCCATAGTTACCT  40 253
1043330  680  699  8990  9009 GTCTTGATTGCCATAACCGC  44 254
1043336  727  746  9037  9056 CCACGGTCCTGCTGTCCATA  45 255
1043342 1045 1064 13668 13687 GGCTGTCCCGTTTTCTTGTT  55 256
1043348 1221 1240 14089 14108 CACCCCGATTAAAGTCTGCC  97 257
1043354 1243 1262 14111 14130 CGGCCTCCACGACCATTGCC  95 258
1043360 1377 1396 14378 14397 GATTAGGACACTTCCAGTCA  92 259
1043366 1508 1527 14972 14991 ACCACGACGATCATCCCCGT  71 260
1043372 1537 1556 15001 15020 TAGCCGCCTCGATCATAGCC  68 261
1043378 1573 1592 15037 15056 CCTCGGAAGCCTCCACGGTC  87 262
1043384 1671 1690 15423 15442 CTAATTAATACGGCCTCTCC 103 263
1043390 1739 1758 15491 15510 GGTTACAAAATAACGAGGGT   5 264
1043396 1789 1808 15541 15560 CAATTACATAGTCCGACACA  33 265
1043397 1792 1811 15544 15563 TTACAATTACATAGTCCGAC   6  34
1043403 1879 1898 15631 15650 GACATCGATCTTCCAGGAAA  80 266
1043409 1897 1916 15649 15668 CTCTACCTTCCTGATCGGGA 111 267
1043415 1960 1979 15712 15731 GGCCTTCTCCCCGAACACTG  62 268
1043421 1976 1995 15728 15747 CTCAAGGATATCATTTGGCC  81 269
1043427 2242 2261 15994 16013 CGCTCTCCACCATGGTCAAA  80 270
1043433 2396 2415 16148 16167 CAGACCAGTCTCCTTATAGC  62 271
1043439 2504 2523 16256 16275 TTAGGAGGGCCTTCCACCCT 112 272
1043445 2668 2687 16420 16439 GGTTAATGTTACGCTCTGTG  24 273
1043451 3153 3172 16905 16924 GCAACTCTTCAGTAGAGAAC  81 274
1043457 3516 3535 17268 17287 ACTCTCCGCCTACTGTTGCT  99 275
1043463 3526 3545 17278 17297 ACGCCAGACCACTCTCCGCC  92 276
1043469 3535 3554 17287 17306 GTTTTTAATACGCCAGACCA  71 277
1043475 3560 3579 17312 17331 GGGAAGGCCCACTTGACGAT  92 278
1043481 3712 3731 17464 17483 AGATTAGAATCCTGCTAGGC 116 279
1043487 3808 3827 17560 17579 AACTTGACACTAATGGTCCC 110 280
1043493 3892 3911 17644 17663 GGACCTACCCACTAAACAGT  96 281
1043499 3907 3926 17659 17678 AGATCCCCCCAAACTGGACC  62 282
1043505 4267 4286 18019 18038 CCTACTTAGCCTGTCCCAAT  94 283
1043511 4431 4450 18183 18202 GTCAATCTACCCACCACTGA  94 284
1043517 4446 4465 18198 18217 AGACCTTAATTCCTGGTCAA 125 285
1043523 4458 4477 18210 18229 GGGCTGGACCCTAGACCTTA 118 286
1043529 N/A N/A  3464  3483 CACCCGGATCCTCATGGCTT  80 287
1043535 N/A N/A  3763  3782 AACCGAGATTCCTGTGGCCG 134 288
1043541 N/A N/A  3894  3913 TAGCCCACGATCTATCTCCA  87 289
1043547 N/A N/A  4088  4107 GCTCCGCCGCCTACGCACCG  94 290
1043553 N/A N/A  4222  4241 GCGCCCTTACCTACCGTTTG  83* 291
1043559 N/A N/A  4229  4248 TCGCCTCGCGCCCTTACCTA  91 292
1043565 N/A N/A  4341  4360 CCGCGGCTTCCCGCCACAGG 104 293
1043571 N/A N/A  4716  4735 AAGGCTCACACCGGACGCGC  89 294
1043577 N/A N/A  4802  4821 CGATCCCGAGCCTCCGCCCC  92 295
1043583 N/A N/A  4851  4870 GGTCGAACCCTGACCACCGC  90 296
1043589 N/A N/A  5234  5253 CGTTCTTCTCCGTCCCTATC 112 297
1043595 N/A N/A  5428  5447 TGGGACTCCAGATGGTTCCG  99 298
1043601 N/A N/A  5727  5746 AGCCATTATCGCCAGGAGTC  32 299
1043607 N/A N/A  6473  6492 CGTGATCAGAAAACATGGCG  96 300
1043613 N/A N/A  7703  7722 GCAAAGATAGTTACCCTCCT  10 301
1043619 N/A N/A  7992  8011 CCACCGTACCTTCCCGAGGT  72 302
1043625 N/A N/A  8011  8030 GCCTTCCCCGACATCAACAC  79 303
1043631 N/A N/A  9282  9301 GCCCTCACAGATCCCTAGAC  68 304
1043637 N/A N/A  9589  9608 AGTCAGGTTAACCATTACCA   6 305
1043643 N/A N/A 10177 10196 GTCACCTTTCATACCTGTGG   3 306
1043649 N/A N/A 10263 10282 GTCCTAACTACTGAGCTGTT  29 307
1043655 N/A N/A 10963 10982 GGCATTCTACCCTACCCCTT   9 308
1043661 N/A N/A 11061 11080 GACCCCTCTTATTAACCTGG  19 309
1043667 N/A N/A 11089 11108 TGGCAACGGCCCAGTCCAAG  76 310
1043673 N/A N/A 11438 11457 GACCTGGTTATTTCCCATGA  22 311
1043679 N/A N/A 11628 11647 GCAATGACACCTAAGTCATG  62 312
1043685 N/A N/A 11830 11849 AACCATCCTTAAAACCGTGT   7 313
1043691 N/A N/A 11962 11981 GCCCGGTTCTCTCACCCGAG  87 314
1043697 N/A N/A 12323 12342 ATCCTTGGTCCCGAGGGCCT 100 315
1043703 N/A N/A 13036 13055 GCACCTAGTATCCATCAAGC  35 316
1043709 N/A N/A 13795 13814 GCCAGCCTTCTCATACATAC 119 317
1043715 N/A N/A 14038 14057 TTCCGGAGAATTCTTTACCT  61 318
1043721 N/A N/A 14535 14554 TACATCAACCTTACCTAGGT  83 319
1043727 N/A N/A 14958 14977 CCCCGTAGTTACCCCCTAGG  98 320
1043733 N/A N/A 15285 15304 AGCGAGTATCTTATCTCAAG  61 321
1043739 N/A N/A 15320 15339 GCCTAGATATCCTATCTGCC  95 322

TABLE 5
Reduction of FUS RNA by 5-10-5 MOE gapmers with mixed PO/PS linkages
complementary to human FUS RNA
SEQ SEQ SEQ SEQ
ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 FUS SEQ
Compound Start Stop Start Stop (% ID
Number Site Site Site Site Sequence (5′ to 3′) UTC) NO
1043283   57   76  4166  4185 CAACGAAGTTCCAACACCGC  48* 323
1043289  213  232  6582  6601 GGCTATAACCACTGTAACTC  11* 324
1043295  241  260  6610  6629 TGGCCATAGCCTGAAGTGTC 115 325
1043301  328  347  7890  7909 TAGCCGCCAGTCGAGCCATA 119 326
1043307  340  359  7902  7921 TGGCTACTGCCATAGCCGCC 113 327
1043313  371  390  7933  7952 GGACTGCTGCCCGTAAGACG  57 328
1043319  501  520  8269  8288 GTCCACCATAGCTAGGCTGC  59 329
1043325  638  657  8948  8967 CATGGAGGATTGATCTTGGC  65 330
1043331  682  701  8992  9011 TGGTCTTGATTGCCATAACC 101 331
1043337  737  756  9047  9066 GCCGCGGCCTCCACGGTCCT 101 332
1043343 1046 1065 13669 13688 GGGCTGTCCCGTTTTCTTGT  85 333
1043349 1223 1242 14091 14110 ACCACCCCGATTAAAGTCTG  69 334
1043355 1244 1263 14112 14131 TCGGCCTCCACGACCATTGC  58 335
1043361 1502 1521 14966 14985 ACGATCATCCCCGTAGTTAC  48 336
1043367 1509 1528 14973 14992 CACCACGACGATCATCCCCG  88 337
1043373 1539 1558 15003 15022 GGTAGCCGCCTCGATCATAG  57 338
1043379 1586 1605 15050 15069 ACCACCCCGGCCCCCTCGGA 111 339
1043385 1673 1692 15425 15444 GGCTAATTAATACGGCCTCT  78 340
1043391 1740 1759 15492 15511 AGGTTACAAAATAACGAGGG   6 341
1043397 1792 1811 15544 15563 TTACAATTACATAGTCCGAC   9  34
1043398 1793 1812 15545 15564 GTTACAATTACATAGTCCGA   5 342
1043404 1881 1900 15633 15652 GGGACATCGATCTTCCAGGA 110 343
1043410 1898 1917 15650 15669 TCTCTACCTTCCTGATCGGG  90 344
1043416 1962 1981 15714 15733 TTGGCCTTCTCCCCGAACAC 122 345
1043422 2058 2077 15810 15829 GCCAACACTCATGACATCCC  75 346
1043428 2243 2262 15995 16014 GCGCTCTCCACCATGGTCAA 113 347
1043434 2398 2417 16150 16169 GCCAGACCAGTCTCCTTATA  87 348
1043440 2557 2576 16309 16328 GGTTTTAACTCATTGGCTGC  56 349
1043446 2673 2692 16425 16444 TCTTGGGTTAATGTTACGCT  56 350
1043452 3305 3324 17057 17076 TCCCAGCTATCGCTTGAACC  98 351
1043458 3517 3536 17269 17288 CACTCTCCGCCTACTGTTGC 112 352
1043464 3528 3547 17280 17299 ATACGCCAGACCACTCTCCG 102 353
1043470 3536 3555 17288 17307 TGTTTTTAATACGCCAGACC 121 354
1043476 3561 3580 17313 17332 TGGGAAGGCCCACTTGACGA  92 355
1043482 3753 3772 17505 17524 CACTCCTAACAGGAGGGCAT  94 356
1043488 3809 3828 17561 17580 GAACTTGACACTAATGGTCC 101 357
1043494 3893 3912 17645 17664 TGGACCTACCCACTAAACAG 143 358
1043500 3935 3954 17687 17706 GCTAGGTGTCTCTATCCATT  85 359
1043506 4268 4287 18020 18039 TCCTACTTAGCCTGTCCCAA  97 360
1043512 4432 4451 18184 18203 GGTCAATCTACCCACCACTG 106 361
1043518 4447 4466 18199 18218 TAGACCTTAATTCCTGGTCA 105 362
1043524 4472 4491 18224 18243 GTCAAGTCTCACATGGGCTG 115 363
1043530 N/A N/A  3465  3484 TCACCCGGATCCTCATGGCT 144 364
1043536 N/A N/A  3765  3784 GGAACCGAGATTCCTGTGGC  89 365
1043542 N/A N/A  3896  3915 ACTAGCCCACGATCTATCTC 109 366
1043548 N/A N/A  4092  4111 GTACGCTCCGCCGCCTACGC 108 367
1043554 N/A N/A  4223  4242 CGCGCCCTTACCTACCGTTT 100* 368
1043560 N/A N/A  4232  4251 CCGTCGCCTCGCGCCCTTAC 123 369
1043566 N/A N/A  4342  4361 TCCGCGGCTTCCCGCCACAG 129 370
1043572 N/A N/A  4746  4765 CCGCCCATTCGCGAAGGACC 100 371
1043578 N/A N/A  4813  4832 GAGGGCGGCCCCGATCCCGA  88 372
1043584 N/A N/A  4852  4871 TGGTCGAACCCTGACCACCG 127 373
1043590 N/A N/A  5235  5254 CCGTTCTTCTCCGTCCCTAT 105 374
1043596 N/A N/A  5479  5498 AACTGCTCGCCTTAGGAGGC  96 375
1043602 N/A N/A  5773  5792 GATTGCTCTAAAACATCGCG  73 376
1043608 N/A N/A  7535  7554 CGTGCAGTATCTACAGGACA  21 377
1043614 N/A N/A  7729  7748 GCTGTTAGTGATGTTGCAAC  72 378
1043620 N/A N/A  7993  8012 ACCACCGTACCTTCCCGAGG  94 379
1043626 N/A N/A  8015  8034 TCAAGCCTTCCCCGACATCA  81 380
1043632 N/A N/A  9458  9477 GCCTAGGATATTAATGACTC  57 381
1043638 N/A N/A  9704  9723 GGCCCCATAAACCAAGTCAC  62 382
1043644 N/A N/A 10193 10212 CGGAGTATTTTGCAATGTCA   2 383
1043650 N/A N/A 10305 10324 AGGCAACTTCCCCTTAAAGC  11 384
1043656 N/A N/A 10967 10986 AGGTGGCATTCTACCCTACC 111 385
1043662 N/A N/A 11063 11082 TAGACCCCTCTTATTAACCT  36 386
1043668 N/A N/A 11184 11203 ACAACGATCAAAAGGATCCT  91 387
1043674 N/A N/A 11465 11484 TCCACGAATTCAGTTTGTGC  14 388
1043680 N/A N/A 11668 11687 GTTTATCTGAATTCGCCATA   4  12
1043686 N/A N/A 11926 11945 CGCCACCAGCCATGCGATGT  55 389
1043692 N/A N/A 11963 11982 GGCCCGGTTCTCTCACCCGA  69 390
1043698 N/A N/A 12389 12408 GTCTTGATACCACTTTAGCC  39 391
1043704 N/A N/A 13296 13315 GGCAACCATTAAAGACTTGC  46 392
1043710 N/A N/A 13827 13846 GCTTGCTGCCCTATATCCCC  89 393
1043716 N/A N/A 14193 14212 CCATGCAAGCCTTTACCATC  78 394
1043722 N/A N/A 14540 14559 CCCATTACATCAACCTTACC  85 395
1043728 N/A N/A 14960 14979 ATCCCCGTAGTTACCCCCTA  41 396
1043734 N/A N/A 15294 15313 ACCTAACCCAGCGAGTATCT 108 397
1043740 N/A N/A 15321 15340 AGCCTAGATATCCTATCTGC 111 398

TABLE 6
Reduction of FUS RNA by 5-10-5 MOE gapmers with mixed PO/PS linkages
complementary to human FUS RNA
SEQ SEQ SEQ SEQ
ID ID ID ID
NO: 1 NO: 1 NO: 2 NO: 2 FUS SEQ
Compound Start Stop Start Stop (% ID
Number Site Site Site Site Sequence (5′ to 3′) UTC) NO
1043284   78   97  4187  4206 ACGCGCGCACAGGCAAGCAA  13* 399
1043290  215  234  6584  6603 CTGGCTATAACCACTGTAAC  29* 400
1043296  242  261  6611  6630 CTGGCCATAGCCTGAAGTGT 101 401
1043302  329  348  7891  7910 ATAGCCGCCAGTCGAGCCAT 108 402
1043308  341  360  7903  7922 CTGGCTACTGCCATAGCCGC  75 403
1043314  372  391  7934  7953 AGGACTGCTGCCCGTAAGAC  73 404
1043320  504  523  8272  8291 GCTGTCCACCATAGCTAGGC  41 405
1043326  647  666  8957  8976 ACCACTACTCATGGAGGATT  65 406
1043332  717  736  9027  9046 GCTGTCCATAGCCACCGCTG  81 407
1043338  738  757  9048  9067 TGCCGCGGCCTCCACGGTCC  83 408
1043344 1107 1126 13730 13749 AAGAGACCGTTGCCTCTCCC 111 409
1043350 1224 1243 14092 14111 CACCACCCCGATTAAAGTCT  46 410
1043356 1245 1264 14113 14132 CTCGGCCTCCACGACCATTG 121 411
1043362 1503 1522 14967 14986 GACGATCATCCCCGTAGTTA  47 412
1043368 1529 1548 14993 15012 TCGATCATAGCCTCCTCTGC  69 413
1043374 1540 1559 15004 15023 CGGTAGCCGCCTCGATCATA  73 414
1043380 1664 1683 15416 15435 ATACGGCCTCTCCCTGCGAT  65 415
1043386 1675 1694 15427 15446 CAGGCTAATTAATACGGCCT 116 416
1043392 1763 1782 15515 15534 CCCTTGGGTGATCAGGAATT  67 417
1043397 1792 1811 15544 15563 TTACAATTACATAGTCCGAC   5  34
1043399 1794 1813 15546 15565 AGTTACAATTACATAGTCCG   4 418
1043405 1882 1901 15634 15653 CGGGACATCGATCTTCCAGG  94 419
1043411 1899 1918 15651 15670 CTCTCTACCTTCCTGATCGG 102 420
1043417 1963 1982 15715 15734 TTTGGCCTTCTCCCCGAACA  90 421
1043423 2059 2078 15811 15830 GGCCAACACTCATGACATCC  91 422
1043429 2329 2348 16081 16100 ACTCACCTCCTAGATCCTGA  93 423
1043435 2406 2425 16158 16177 GTAACCCAGCCAGACCAGTC 107 424
1043441 2558 2577 16310 16329 AGGTTTTAACTCATTGGCTG  83 425
1043447 2674 2693 16426 16445 CTCTTGGGTTAATGTTACGC  62 426
1043453 3306 3325 17058 17077 ATCCCAGCTATCGCTTGAAC 110 427
1043459 3518 3537 17270 17289 CCACTCTCCGCCTACTGTTG  81 428
1043465 3529 3548 17281 17300 AATACGCCAGACCACTCTCC 124 429
1043471 3551 3570 17303 17322 CACTTGACGATCCTTTGTTT  77 430
1043477 3662 3681 17414 17433 GTATCAGGCCATTTCAACTA  62 431
1043483 3773 3792 17525 17544 CAAGGAGCTTCGACCTCCTC 150 432
1043489 3810 3829 17562 17581 GGAACTTGACACTAATGGTC 106 433
1043495 3894 3913 17646 17665 CTGGACCTACCCACTAAACA 119 434
1043501 3937 3956 17689 17708 CTGCTAGGTGTCTCTATCCA  91 435
1043507 4401 4420 18153 18172 GCCCTACATCCAAGTACTGA 114 436
1043513 4433 4452 18185 18204 TGGTCAATCTACCCACCACT  80 437
1043519 4448 4467 18200 18219 CTAGACCTTAATTCCTGGTC 119 438
1043525 4474 4493 18226 18245 GAGTCAAGTCTCACATGGGC  91 439
1043531 N/A N/A  3578  3597 GTTGCCTTGCCTTTCGGCCT 125 440
1043537 N/A N/A  3858  3877 GTGGTACGGCCTGAGTGCCC 104 441
1043543 N/A N/A  3899  3918 AGGACTAGCCCACGATCTAT 120 442
1043549 N/A N/A  4098  4117 GCTTAAGTACGCTCCGCCGC  89 443
1043555 N/A N/A  4224  4243 TCGCGCCCTTACCTACCGTT 103* 444
1043561 N/A N/A  4234  4253 CGCCGTCGCCTCGCGCCCTT 104 445
1043567 N/A N/A  4415  4434 ACTTCCCGCCCCGCGCGCGA 118 446
1043573 N/A N/A  4752  4771 GCGATCCCGCCCATTCGCGA  98 447
1043579 N/A N/A  4814  4833 AGAGGGCGGCCCCGATCCCG 127 448
1043585 N/A N/A  4857  4876 TCCGTTGGTCGAACCCTGAC  90 449
1043591 N/A N/A  5236  5255 GCCGTTCTTCTCCGTCCCTA  87 450
1043597 N/A N/A  5481  5500 GCAACTGCTCGCCTTAGGAG  30 451
1043603 N/A N/A  5774  5793 TGATTGCTCTAAAACATCGC 100 452
1043609 N/A N/A  7635  7654 GTTCCAATTTCACCCCGCCA  29 453
1043615 N/A N/A  7857  7876 GACTGAGTTCCATAGCCTGC  67 454
1043621 N/A N/A  7994  8013 CACCACCGTACCTTCCCGAG  80 455
1043627 N/A N/A  8096  8115 AGGCTCCCCTACCCCAATTA 110 456
1043633 N/A N/A  9506  9525 TCATCGGTTTCCCTTGCAGA   7 457
1043639 N/A N/A  9710  9729 TCAGCTGGCCCCATAAACCA  51 458
1043645 N/A N/A 10218 10237 CACCCCTTCTACACTGCGAG  49 459
1043651 N/A N/A 10432 10451 AACCCTACCCCAATTTACCC  82 460
1043657 N/A N/A 10969 10988 ACAGGTGGCATTCTACCCTA  72 461
1043663 N/A N/A 11069 11088 GCCTACTAGACCCCTCTTAT  41 462
1043669 N/A N/A 11286 11305 GTATACCAACTTCACCATCC  10 463
1043675 N/A N/A 11466 11485 GTCCACGAATTCAGTTTGTG  21 464
1043681 N/A N/A 11669 11688 TGTTTATCTGAATTCGCCAT   7 465
1043687 N/A N/A 11928 11947 CTCGCCACCAGCCATGCGAT  95 466
1043693 N/A N/A 12115 12134 GCAGGCCCCTTAAGATCTGT 105 467
1043699 N/A N/A 12390 12409 AGTCTTGATACCACTTTAGC  49 468
1043705 N/A N/A 13327 13346 GCAACAACCACTAAGACTTG  91 469
1043711 N/A N/A 13841 13860 GCTTGTTTCCTAAGGCTTGC 103 470
1043717 N/A N/A 14391 14410 AGTTTCACTCACGGATTAGG 101 471
1043723 N/A N/A 14886 14905 CCCCGCTGAAAAATTAAGGA 136 472
1043729 N/A N/A 15153 15172 CCCTGTTATCCTATGGCCTC 103 473
1043735 N/A N/A 15298 15317 TCCTACCTAACCCAGCGAGT 101 474
1043741 N/A N/A 15324 15343 CCAAGCCTAGATATCCTATC  80 475

Example 2: Effects of Modified Oligonucleotides on Human FUS mRNA In Vitro, Multiple Doses

Modified oligonucleotides selected from the examples above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 10,000 cells per well were treated using free uptake with 185 nM, 556 nM, 1667 nM, and 5000 nM of modified oligonucleotide as specified in the Table 3 below. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and FUS RNA levels were measured by quantitative real-time PCR. Human FUS primer probe set RTS38562 was used to measure RNA levels as described above. FUS levels were adjusted according to total RNA content, as measured by RIBOGREENK® Results are presented in Tables 7-9 below as percent reduction of the amount of FUS RNA, relative to untreated control. The half maximal inhibitory concentration (IC50) was calculated using a linear regression on a log/linear plot of the data in excel.

TABLE 7
Dose-dependent percent reduction of human
FUS RNA by 5-10-5 MOE gapmers with mixed
PO/PS linkages complementary to human FUS
Compound % UTC IC50
No. 185 nM 556 nM 1667 nM 5000 nM (μM)
1043279 96 75 56 42 2.8
1043327 85 67 52 N.D. N.C.
1043334 87 81 63 47 4.6
1043352 95 76 56 46 3.2
1043397 64 26 11 5 0.3
1043400 92 72 52 45 2.7
1043401 36 22 17 12 <0.2
1043610 75 73 50 40 2.2
1043634 48 19 11 8 <0.2
1043640 80 61 37 24 1.0
1043641 61 23 11 6 0.2
1043646 96 55 31 19 1.0
1043647 77 51 30 18 0.7
1043653 52 29 13 7 <0.2
1043670 82 62 43 28 1.2
1043671 76 59 36 19 0.8
1043683 64 28 12 8 0.3
1043684 58 26 10 6 0.2
1043719 79 71 62 49 >5.0

TABLE 8
Dose-dependent percent reduction of human
FUS RNA by 5-10-5 MOE gapmers with mixed
PO/PS linkages complementary to human FUS
Compound % UTC IC50
No. 185 nM 556 nM 1667 nM 5000 nM (μM)
1043323 119 95 97 76 >5.0
1043341 70 65 45 32 1.2
1043390 55 16 7 4 <0.2
1043395 81 47 20 9 0.6
1043396 96 59 39 22 1.2
1043397 63 28 9 4 0.3
1043445 88 67 37 21 1.1
1043462 98 109 111 108 >5.0
1043613 55 33 15 7 0.2
1043636 61 40 17 11 0.3
1043637 57 24 8 3 <0.2
1043642 82 60 46 30 1.3
1043643 29 8 4 2 <0.2
1043655 71 43 16 8 0.4
1043661 61 39 30 17 0.3
1043672 62 44 28 21 0.4
1043673 67 46 34 23 0.5
1043678 83 58 36 29 1.1
1043685 82 38 13 5 0.5

TABLE 9
Dose-dependent percent reduction of human
FUS RNA by 5-10-5 MOE gapmers with mixed
PO/PS linkages complementary to human FUS
Compound % UTC IC50
No. 185 nM 556 nM 1667 nM 5000 nM (μM)
1043320 106 90 58 48 3.8
1043391 70 25 7 5 0.3
1043397 68 28 11 5 0.3
1043398 42 15 9 4 <0.2
1043399 34 13 5 3 <0.2
1043608 97 72 51 39 2.2
1043609 83 62 38 25 1.1
1043633 54 21 8 6 <0.2
1043644 67 19 4 2 0.2
1043649 84 59 40 26 1.1
1043650 73 32 18 12 0.4
1043662 89 58 47 28 1.3
1043669 65 38 22 10 0.4
1043674 59 39 22 14 0.3
1043675 89 67 46 29 1.5
1043680 46 17 6 3 <0.2
1043681 69 39 18 8 0.4
1043698 95 85 59 35 2.6
1043728 99 84 64 51 >5.0

Example 3: Design of Modified Oligonucleotides Complementary to a Human FUS Nucleic Acid

Additional modified oligonucleotides were designed as indicated in Table 10 below.

The modified oligonucleotides Table 10 below are 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment consists of ten 2′-β-D-deoxynucleosides, the 5′ wing segment consists of five 2′-MOE nucleosides, and the 3′ wing segment consists of five 2′-MOE nucleosides. The sugar motif of the gapmers is (from 5′ to 3′): eeeeeddddddddddeeeee; wherein ‘d’ represents a 2′-β-D-deoxyribosyl sugar moiety, and ‘e’ represents a 2′-MOE sugar moiety. The gapmers have an internucleoside linkage motif of (from 5′ to 3′): soooossssssssssooss; wherein “s” represents a phosphorothioate internucleoside linkage and “o” represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines.

“Start site” indicates the 5′-most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence. Each modified oligonucleotide listed in Table 10 is 100% complementary to SEQ ID NO: 2 (GENBANK Accession No. NC_000016.10 truncated from nucleotides 31176001 to 31198000). ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular gene sequence.

TABLE 10
5-10-5 MOE gapmers with a mixed PO/PS internucleoside linkages
complementary to human FUS
SEQ SEQ SEQ SEQ
ID No: ID No: ID No: ID No: SEQ
Compound 1 Start 1 Stop 2 Start 2 Stop ID
Number SEQUENCE Site Site Site Site No.
1044028 GGCACATAAAATGCAGAGCA N/A N/A 10159 10178 476
1044030 GCAATGTCACCTTTCATACC N/A N/A 10182 10201  13
1044031 GAGTATTTTGCAATGTCACC N/A N/A 10191 10210 477
1044032 GGAGTATTTTGCAATGTCAC N/A N/A 10192 10211 478
1044033 GCGGAGTATTTTGCAATGTC N/A N/A 10194 10213 479
1044075 GTGCATCCATCCAGTTTCTC N/A N/A 11908 11927 480

Example 4: Effects of Modified Oligonucleotides on Human FUS mRNA In Vitro, Multiple Doses

Modified oligonucleotides selected from the examples above were tested at various doses in A-431 cells. Cultured A-431 cells at a density of 10,000 cells per well were treated using free uptake with various concentrations of modified oligonucleotide as specified in the Table 11 below. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and FUS RNA levels were measured by quantitative real-time RTPCR. Human FUS primer probe set RTS38562 was used to measure RNA levels as described above. FUS levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the Table 11 below as percent reduction of the amount of FUS RNA, relative to untreated control. The half maximal inhibitory concentrations (IC50) were calculated using a linear regression on a log/linear plot of the data in excel.

TABLE 11
Dose-dependent percent reduction of human FUS RNA by 5-10-5 MOE
gapmers with mixed PO/PS linkages complementary to human FUS
% UTC
Compound No. 5 nM 20 nM 78 nM 313 nM 1250 nM 5000 nM IC50 (μM)
1043643 87 75 56 29 18 12 0.1
1043644 77 73 57 38 19 9 0.1
1043678 118 133 105 95 76 53 >5.0
1044028 78 76 71 56 39 35 0.6
1044030 70 73 48 31 16 9 0.1
1044031 75 82 58 42 26 17 0.2
1044032 95 92 92 56 35 18 0.5
1044033 118 105 102 83 54 40 2.8
1044075 108 95 80 59 40 29 0.7

Example 5: Tolerability of Modified Oligonucleotides in Wild-Type Mice

Modified oligonucleotides described above were tested in wild-type female C57/B16 mice to assess the tolerability of the oligonucleotides. Additionally, Comparator Compound No. 441522 was tested in wild-type female C57/B16 mice to assess the tolerability of the oligonucleotides. Wild-type female C57/B16 mice each received a single ICV dose of 700 μg or 500 μg of modified oligonucleotide in separate experiments as listed in Tables 12-15 below. Each treatment group consisted of 4 mice. A group of 4 mice received PBS as a negative control for each experiment (identified in separate tables below). At 3 hours post-injection, mice were evaluated according to seven different criteria. The criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse showed any movement without stimuli; (4) the mouse demonstrated forward movement after it was lifted; (5) the mouse demonstrated any movement after it was lifted; (6) the mouse responded to tail pinching; (7) regular breathing. For each of the 7 criteria, a mouse was given a subscore of 0 if it met the criteria and 1 if it did not (the functional observational battery score or FOB). After all 7 criteria were evaluated, the scores were summed for each mouse and averaged within each treatment group.

TABLE 12
Tolerability scores in mice at 700 μg dose
Compound Number 3 hour FOB
PBS 0.00
1043341 1.00
1043390 3.00
1043391 5.75
1043397 2.00
1043398 4.50
1043399 4.00
1043401 4.75
1043613 1.00
1043633 2.25
1043634 5.50
1043636 2.50
1043637 1.00
1043641 1.00
1043650 1.00
1043653 5.00
1043655 1.00
1043661 4.00
1043669 1.00
1043672 0.00
1043674 4.00
1043680 5.25
1043681 3.00
1043683 1.00
1043684 1.00

TABLE 13
Tolerability scores in mice at 500 μg dose
Compound Number 3 hour FOB
PBS 0.00
1043678 1.00
1044022 0.00
1044023 0.00
1044024 2.00
1044025 0.00
1044030 0.00
1044049 1.00
1044053 0.00

TABLE 14
Tolerability scores in mice at 700 μg dose
Compound Number 3 hour FOB
PBS 0.00
441522 6.00

TABLE 15
Tolerability scores in mice at 700 μg dose
Compound Number 3 hour FOB
PBS 0.00
1044030 0.00

Example 6: Activity of Modified Oligonucleotides Complementary to Human FUS in Transgenic Mice

Transgenic mice lines (mice expressing the human FUS wildtype gene hgFUSWT, or mice containing human FUS mutations R521C or R521H, hgFUSR521C and hgFUSR521H), previously described in Lopez-Erauskin., et al., ALS/FTD-Linked Mutation in FUS Suppresses Intra-axonal Protein Synthesis and Drives Disease Without Nuclear Loss-of-Function of FUS, Neuron 2018, 100:816-830, were used to test activity of modified oligonucleotides described above. The FUS transgenic mice were divided into groups of 3 mice each. Each mouse received a single ICV bolus of 500 g of modified oligonucleotide. A group of 4 mice received PBS as a negative control.

Four weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for real-time qPCR analysis of RNA expression of FUS using primer probe set RTS38562 as described above. Results are presented as percent change of RNA, relative to PBS control, normalized to mouse GAPDH. Mouse GAPDH was amplified using primer probe set RTS108 (forward sequence GGCAAATTCAACGGCACAGT, designated herein as SEQ ID NO: 9; reverse sequence GGGTCTCGCTCCTGGAAGAT, designated herein as SEQ ID NO: 10; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, designated herein as SEQ ID NO: 11). Two separate experiments were carried out under similar conditions. The results for each experiment are presented in Tables 16 and 17 below.

TABLE 16
Reduction of human FUS RNA in transgenic mice
Mouse Compound FUS RNA (% control)
Line ID SPINAL CORD CORTEX
WT PBS 100 100
1043341 55 78
1043390 62 81
1043398 57 89
1043399 64 94
1043613 44 60
1043636 60 106
R521H PBS 100 100
1043397 42 56
1043637 33 103
1043672 32 78
1043674 49 88
1043680 14 19
1043681 35 52

TABLE 17
Reduction of human FUS RNA in transgenic mice
Mouse Compound FUS RNA (% control)
Line ID SPINAL CORD CORTEX
R521H PBS 100 100
1043643 51 96
1043678 48 112
1044028 83 159
1044030 23 57
1044033 59 84
1043644 67 133
R521C PBS 100 100
1044032 48 96
WT PBS 100 100
1044031 28 66

Example 7: Tolerability of Modified Oligonucleotides in Rats, 3 mg Dose

Modified oligonucleotides described above were tested in rats to assess the tolerability of the oligonucleotides. Sprague Dawley rats each received a single intrathecal (IT) dose of 3 mg of oligonucleotide listed in Table 9 below. Each treatment group consisted of 3-4 rats. A group of 3-4 rats received PBS as a negative control. At 3 hours post-injection, movement in 7 different parts of the body were evaluated for each rat. The 7 body parts are (1) the rat's tail; (2) the rat's posterior posture; (3) the rat's hind limbs; (4) the rat's hind paws; (5) the rat's forepaws; (6) the rat's anterior posture; (7) the rat's head. For each of the 7 different body parts, each rat was given a sub-score of 0 if the body part was moving or 1 if the body part was paralyzed. After each of the 7 body parts were evaluated, the sub-scores were summed for each rat and then averaged for each group (the functional observational battery score or FOB). For example, if a rat's tail, head, and all other evaluated body parts were moving 3 hours after the 3 mg IT dose, it would get a summed score of 0. If another rat was not moving its tail 3 hours after the 3 mg IT dose but all other evaluated body parts were moving, it would receive a score of 1. Results are presented in Table 18 as the average score for each treatment group. All compounds listed in Table 18 were found to be more tolerable in rats as compared to Comparator Compound No. 441522.

TABLE 18
Tolerability scores in rats at 3 mg dose
Compound Number 3 hour FOB
PBS 0.00
1043613 1.00
1043680 2.33
1044030 0.67

Example 8. Human Clinical Trial with Compound No. 1044030

Patients displaying one or more symptoms of ALS and/or identified as having a gain of function mutation in FUS are administered Compound No. 1044030 intrathecally. Symptomatic, pre-symptomatic, and prodromal patients receive 50 mg to 200 mg of Compound No. 1044030 about every 4 weeks, about every 8 weeks, or about every 12 weeks.

Pharmacodynamics and efficacy are assessed at multiple time points. Efficacy of Compound No. 1044030 is assessed by monitoring function in daily activities, muscle strength and respiratory function. In some instance, the assessment takes the form of a questionnaire, patient-reported outcome, or ALS Functional Rating Scale. Patient safety is monitored closely during the study. Safety and tolerability evaluations may include, e.g., physical examination, vital signs, adverse events, concomitant medications, and plasma laboratory tests.

Claims

What is claimed is:

1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of a FUS nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases of any of SEQ ID NOS: 12-480.

3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases identical to any one of SEQ ID NOS: 12 and 13.

4. An oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence of SEQ ID NO: 12.

5. An oligomeric compound comprising a modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence of SEQ ID NO: 13.

6. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of nucleobases 1,786 to 1,841 of SEQ ID NO: 1.

7. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of any one of SEQ ID NOS: 34, 35, 111, 112, 188, 265, 342, and 418.

8. The oligomeric compound of any one of claims 1-7, wherein the modified oligonucleotide comprises a modified sugar moiety.

9. The oligomeric compound of any one of claims 1-7, wherein the modified oligonucleotide comprises a bicyclic sugar moiety.

10. The oligomeric compound of claim 9, wherein the bicyclic sugar moiety comprises a 2′-4′ bridge selected from —O—CH2—; and —O—CH(CH3)—.

11. The oligomeric compound of any one of claims 1-10, wherein the modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

12. The oligomeric compound of claim 11, wherein the non-bicyclic modified sugar moiety comprises a 2′-MOE sugar moiety or 2′-OMe sugar moiety.

13. The oligomeric compound of any one of claims 1-12, wherein the modified oligonucleotide comprises a sugar surrogate.

14. The oligomeric compound of claim 13, wherein the sugar surrogate is selected from morpholino and PNA.

15. The oligomeric compound of any of claims 1-14, wherein the modified oligonucleotide has a sugar motif comprising:

a) a 5′-region consisting of 1-5 linked 5′-region nucleosides;

b) a central region consisting of 6-10 linked central region nucleosides; and

c) a 3′-region consisting of 1-5 linked 3′-region nucleosides,

wherein each of the 5′-region nucleosides and each of the 3′-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises an unmodified 2′-deoxyribosyl sugar moiety.

16. The oligomeric compound of any one of claims 1-15, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

17. The oligomeric compound of claim 16, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

18. The oligomeric compound of claim 16 or 17, wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

19. The oligomeric compound of any one of claims 16-18, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

20. The oligomeric compound of claim 18 or 19, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

21. The oligomeric compound of any one of claims 1-16, wherein the modified oligonucleotide consists essentially of 20 linked nucleosides and has an internucleoside linkage motif soooossssssssssooss, wherein “s” represents a phosphorothioate internucleoside linkage and “o” represents a phosphodiester internucleoside linkage.

22. The oligomeric compound of any one of claims 1-21, wherein the modified oligonucleotide comprises at least one modified nucleobase.

23. The oligomeric compound of claim 22, wherein the modified nucleobase is a 5-methyl cytosine.

24. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide is a gapmer consisting of a 5′ wing segment, a central gap segment, and a 3′ wing segment, wherein:

the 5′ wing segment consists of five 2′-O-methoxyethyl nucleosides,

the central gap segment consists of ten β-D-deoxyribonucleosides, and

the 3′ wing segment consists of five 2′-O-methoxyethyl nucleosides,

wherein the modified oligonucleotide has the nucleobase sequence 5′-GTTTATCTGAATTCGCCATA-3′ (SEQ ID NO. 12), wherein each cytosine is a 5-methylcytosine, wherein the internucleoside linkages of the modified oligonucleotide are soooossssssssssooss from 5′ to 3′, and wherein each s is a phosphorothioate linkage and each o is a phosphodiester linkage.

25. An oligomeric compound comprising a modified oligonucleotide, wherein the modified oligonucleotide is a gapmer consisting of a 5′ wing segment, a central gap segment, and a 3′ wing segment, wherein:

the 5′ wing segment consists of five 2′-O-methoxyethyl nucleosides,

the central gap segment consists of ten β-D-deoxyribonucleosides, and

the 3′ wing segment consists of five 2′-O-methoxyethyl nucleosides,

wherein the modified oligonucleotide has the nucleobase sequence 5′-GCAATGTCACCTTTCATACC-3′ (SEQ ID NO. 13), wherein each cytosine is a 5-methylcytosine, wherein the internucleoside linkages of the modified oligonucleotide are soooossssssssssooss from 5′ to 3′, and wherein each s is a phosphorothioate linkage and each o is a phosphodiester linkage.

26. The oligomeric compound of any of claims 1-25, consisting essentially of the modified oligonucleotide.

27. The oligomeric compound of any of claims 1-25, consisting of the modified oligonucleotide.

28. The oligomeric compound of any of claims 1-25, comprising a conjugate group, wherein the conjugate group consists essentially of a conjugate moiety and a conjugate linker.

29. The oligomeric compound of claim 28, wherein the conjugate linker consists of a single bond.

30. The oligomeric compound of claim 28 or 29, wherein the conjugate linker is cleavable.

31. The oligomeric compound of any one of claims 28-30, wherein the conjugate linker comprises 1-3 linker-nucleosides.

32. The oligomeric compound of any one of claims 28-30, wherein the conjugate group does not comprise a nucleoside.

33. The oligomeric compound of any one of claims 28-32, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide.

34. The oligomeric compound of any one of claims 28-32, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.

35. The oligomeric compound of any of claims 1-34 comprising a terminal group.

36. The oligomeric compound of any of claims 1-35, wherein the modified oligonucleotide is a singled-stranded modified oligonucleotide.

37. An oligomeric duplex comprising an oligomeric compound of any of claims 1-35.

38. An antisense compound comprising or consisting of an oligomeric compound of any of claims 1-36 or an oligomeric duplex of claim 37.

39. A modified oligonucleotide according to the following formula:


Ges Teo Teo Teo Aeo Tds mCds Tds Gds Ads Ads Tds Tds mCds Gds mCeo mCeo Aes Tes Ae   (SEQ ID NO: 12); wherein,

A=an adenine,

mC=a 5′-methylcytosine

G=a guanine,

T=a thymine,

e=a 2′-O-methoxyethylribose modified sugar

d=a 2′-deoxyribose sugar,

s=a phosphorothioate internucleoside linkage, and

o=a phosphodiester internucleoside linkage.

40. A modified oligonucleotide according to the following formula:


Ges Ceo Aeo Aeo Teo Gds Tds mCds Adsd mCds mCds Tds Tds Tds mCds Aeo Teo Aes mCes mCe   (SEQ ID NO: 13); wherein,

A=an adenine,

mC=a 5′-methylcytosine

G=a guanine,

T=a thymine,

e=a 2′-O-methoxyethylribose modified sugar

d=a 2′-deoxyribose sugar,

s=a phosphorothioate internucleoside linkage, and

o=a phosphodiester internucleoside linkage.

41. A modified oligonucleotide according to the following chemical structure:

or a salt thereof.

42. The modified oligonucleotide of claim 41, which is the sodium salt or the potassium salt.

43. A modified oligonucleotide according to the following chemical structure:

or a salt thereof.

44. The modified oligonucleotide of claim 43, which is the sodium salt or the potassium salt.

45. A modified oligonucleotide according to the following chemical structure:

46. A modified oligonucleotide according to the following chemical structure:

47. A pharmaceutical composition comprising at least one of the oligomeric compound of any of claims 1-36, the oligomeric duplex of claim 37, the antisense compound of claim 38, and the modified oligonucleotide of any one of claims 39-46; and a pharmaceutically acceptable carrier or diluent.

48. The pharmaceutical composition of claim 47, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate buffered saline (PBS).

49. The pharmaceutical composition of claim 48, wherein the pharmaceutical composition consists essentially of the oligomeric compound, oligomeric duplex, antisense compound, or modified oligonucleotide; and artificial cerebrospinal fluid.

51. A method of treating a neurodegenerative condition comprising administering to a subject having or at risk for developing the neurodegenerative condition a therapeutically effective amount of at least one of the oligomeric compound of any of claims 1-36, the oligomeric duplex of claim 37, the antisense compound of claim 38, the modified oligonucleotide of any one of claims 39-46, and the pharmaceutical composition of any of claims 47-49; thereby treating the neurodegenerative condition.

52. A method of reducing FUS RNA or FUS protein in the central nervous system of a subject having or at risk for developing a neurodegenerative condition comprising administering a therapeutically effective amount of at least one of the oligomeric compound of any of claims 1-36, the oligomeric duplex of claim 37, the antisense compound of claim 38, the modified oligonucleotide of any one of claims 39-46, and the pharmaceutical composition of any of claims 47-49, thereby reducing FUS RNA or FUS protein in the central nervous system.

53. The method of claim 51 or 52, wherein the neurodegenerative condition is amyotrophic lateral sclerosis (ALS).

54. The method of claim 51 or 52, wherein the neurodegenerative condition is frontotemporal lobar degeneration (FTLD).

55. The method of claim 51 or 52, wherein the neurodegenerative condition is FTLD-FUS.

56. The method of claim 51 or 52, wherein the neurodegenerative condition is ALS with FTLD.

57. A method of treating a neurodegenerative condition associated with a FUS mutation comprising identifying the FUS mutation in a subject and administering to the subject a therapeutically effective amount of at least one of the oligomeric compound of any of claims 1-36, the oligomeric duplex of claim 37, the antisense compound of claim 38, the modified oligonucleotide of any one of claims 39-46, and the pharmaceutical composition of any of claims 47-49.

58. The method of claim 57, wherein the FUS mutation is a single nucleotide polymorphism selected from rs121909667, rs121909668, rs121909669, rs121909671, rs186547381, rs267606831, rs267606832, rs267606833, rs387906627, rs387906628, rs387907274, rs752076094, rs764487847, rs886041389, rs886041390, rs886041577, rs886041776, rs1085308015, rs1161032867, rs1555509569, rs1555509609, rs1555509693, rs1596908744, rs1596912983, and rs121909668.

59. The method of claim 57, wherein the FUS mutation is selected from S57del, S96del, G156E, G171-174del, G174-175del, G187S, G191S, G206S, R216C, G225V, G230C, R234C, R234L, R244C, M254V, S402_P411delinsGGGG, S462F, G466VfsX14, Y484AfsX514, R495X, R495EfsX527, G497AfsX527, G507D, K510WfsX517, K510E, S513P, R514S, R514G, G515C, E516V, H517D, H517P, H517Q, R518G, R518K, Q519IfsX9, R521C, R521G, R521H, R521L, R521S, R522G, R524S, R524T, R524W, and P525L.

60. The method of claim 57, wherein identifying the FUS mutation comprises sequencing a FUS nucleic acid from the subject, or contacting the FUS nucleic acid from the subject with a nucleic acid probe that is complementary to a portion of the FUS nucleic acid comprising the mutation.

61. The method of any of claims 50-60, wherein the administering is by intrathecal administration.

62. The method of any of claims 55-61, wherein at least one symptom or hallmark of the neurodegenerative condition is ameliorated.

63. The method of claim 62, wherein the neurodegenerative condition is ALS and the at least one symptom or hallmark is selected from muscle weakness, muscle fatigue, slurred speech, twitching, cramping, protein aggregates in the central nervous system of the subject, and a combination thereof.

64. The method of claim 62, wherein the neurodegenerative condition is FTLD and the at least one symptom or hallmark is selected from speech difficulty and a behavioral abnormality.

65. The method of any of claims 50-64, wherein the method prevents or slows disease regression.

66. The method of any one of claims 50-65, wherein the subject is pre-symptomatic for the neurodegenerative condition.

67. The method of any one of claims 50-65, wherein the subject is symptomatic for the neurodegenerative condition.

68. The method of any one of claims 50-65, wherein the subject is prodromal for the neurodegenerative condition.

69. A method of reducing FUS RNA in a cell comprising contacting the cell with at least one of the oligomeric compound of any of claims 1-36, the oligomeric duplex of claim 37, the antisense compound of claim 38, and the modified oligonucleotide of any one of claims 39-46, thereby reducing FUS RNA in the cell.

70. A method of reducing FUS protein in a cell comprising contacting the cell with at least one of the oligomeric compound of any of claims 1-36, the oligomeric duplex of claim 37, the antisense compound of claim 38, and the modified oligonucleotide of any one of claims 39-46, thereby reducing FUS protein in the cell.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: