US20230040021A1
2023-02-09
17/784,089
2020-12-11
Provided is an immunostimulatory composition, comprising a saponin and a CpG oligodeoxynucleotide, or consisting of an adjuvant comprising a saponin and a CpG oligodeoxynucleotide, wherein the sequence of the CpG oligodeoxynucleotide has two or more copies of 5′-TTCGTT-3′ motif or 5′-TCGTCGTCG-3′ motif. Also provided is use of the immunostimulatory composition in the preparation of a medication for treating diseases.
Get notified when new applications in this technology area are published.
A61K2039/55561 » CPC further
Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant; Organic adjuvants CpG containing adjuvants; Oligonucleotide containing adjuvants
A61K39/39 » CPC main
Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
A61K39/245 » CPC further
Medicinal preparations containing antigens or antibodies; Viral antigens Herpetoviridae, e.g. herpes simplex virus
A61K39/29 » CPC further
Medicinal preparations containing antigens or antibodies; Viral antigens Hepatitis virus
A61P31/12 » CPC further
Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics Antivirals
A61P31/04 » CPC further
Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics Antibacterial agents
The present invention belongs to the field of biopharmaceutics. In particular, the present invention relates to an immunostimulatory composition comprising a saponin and a CpG oligodeoxynucleotide, or consisting of an adjuvant comprising a saponin and a CpG oligodeoxynucleotide, wherein the sequence of the CpG oligodeoxynucleotide has two or more copies of 5′-TTCGTT-3′ motif or 5′-TCGTCGTCG-3′ motif. The present invention also relates to use of the immunostimulatory composition in the manufacture of a medicament.
CpG oligodeoxynucleotides are a new class of immunostimulatory agents discovered in recent years, and their chemical nature is an oligodeoxynucleotide containing cytosine-guanine dinucleotide, which have a similar immune response to the natural pattern recognition receptors for CpG, and can bind to Toll-like receptors on cell membrane, effectively triggering a mammalian immune response through TLR9 signaling pathway. The immunoreaction triggered by CpG is mainly of Th1-type, which can induce an immune response conversion from Th2-type to Th1-type, thus stimulating cellular immunity. Activating immunoreactive cells, such as T cells, B cells, and NK cells, etc. can generate a large amount of multiple cytokines, thereby enhancing the specific and non-specific immune effects in the body, which is an important link between natural immunity and acquired immunity.
Saponins are a class of glycosides, the aglycons of which are triterpene or spirostane compounds, and belong to plant-derived adjuvants. Among them, quillaja saponin (QS) is the saponins extracted from quillaja, and QS-21 is the most widely reported adjuvant in QS series. However, QS-21 may induce cell hemolysis and has some systemic and local toxic/side effects. Alving et al. study (ALVING CR, MATYAS G, BECK Z, et al. Revue Roumaine de Chimie, 2016, 61(8): 631-635) found that ALF liposomes in combination with MPLA and QS-21 as an adjuvant against HIVgp140 protein could effectively increase the antibody titer in serum. Ng et al. (NG H, FERNANDO G J P, DEPELSENAIRE A C I, et al. Scientific Reports, 2016, 6(1): 228-230) used a subcutaneous delivery technique, a nano-patch, to form an adjuvant complex with QS-21. The results showed, compared with traditional intramuscular injection, the nano-patch could significantly reduce the dosages of antigen and QS-21, and induce a higher IgG titer (Ziyi Han, Zhongliang Zeng, Modern Agricultural Science and Technology, 2019 (14): 220-221).
Immunostimulatory compositions comprising a saponin and a CpG oligodeoxynucleotide have been reported in the prior art (WO2001051083A3), wherein the CpG oligodeoxynucleotide involves CpG1826 and CpG7909. However, the effects of CpG adjuvants having different sequences differentiate greatly due to the structural diversity of CpG oligodeoxynucleotides.
Therefore, there is a current need for adjuvants and drugs with a stronger immune effect.
In view of the deficiencies in the prior art, the inventors have unexpectedly discovered, after extensive research, an immunostimulatory composition with a stronger immune effect. In the composition, the saponin and the CpG oligodeoxynucleotide show a synergistic effect with high efficiency, which can mediate a more potent immune response. The immunostimulatory composition has significant advantages when applied to different antigens or antigen compositions.
Therefore, it is an object of the present invention to provide an immunostimulatory composition, which can be used to prepare various drugs to obtain immunostimulating immunogenicity with high efficiency.
It is another object of the present invention to provide a vaccine adjuvant which can strongly elicit an immune response in a mammal.
The objects of the invention are achieved by the following technical solutions.
In one aspect, the present invention provides an immunostimulatory composition comprising a saponin and a CpG oligodeoxynucleotide, or consisting of an adjuvant comprising a saponin and a CpG oligodeoxynucleotide, wherein the sequence of the CpG oligodeoxynucleotide has two or more copies of 5′-TTCGTT-3′ motif or 5′-TCGTCGTCG-3′ motif.
In the immunostimulatory composition according to the present invention, the sequence of the CpG oligodeoxynucleotide is any one selected from: CpG T1: TCG TTC GTT COT TCG TTC GTT (SEQ ID NO: 6); CpG T2: TCG TTC GTT CGT TCG TTC GTT CGT T (SEQ ID NO: 7); and CpG T3: TCG TCG TCG TCG TCG TCG TCG (SEQ ID NO: 8).
Preferably, the sequence of the CpG oligodeoxynucleotide is CpG T1: TCG TTC GTT CGT TCG TTC GTT (SEQ ID NO: 6).
In the immunostimulatory composition according to the present invention, the saponin is one or more selected from the group consisting of quillaja saponin, ginsenoside, platycodin, astragaloside, notoginsenoside, glycyrrhizin, cortex albiziae saponin, ophiopogonin, saikosaponin or panax japonicus saponin. Preferably, the saponin is quillaja saponin, ginsenoside, platycodin or astragalin A. More preferably, the quillaja saponin is QS-7, QS-17, QS-18 or QS-21. More preferably, the quillaja saponin is QS-21. The ginsenoside may be ginsenoside Rg1, ginsenoside Rg3, ginsenoside Rb1 or ginsenoside Re. The platycodin is platycodin D, platycodin D2 or a mixture thereof. The astragaloside may be astragalin A (astragaloside IV), astragaloside I, astragaloside II, or a mixture of two or more of these saponin monomers. The notoginsenoside may be notoginsenoside R1. The ophiopogonin may be ophiopogonin D. The saikosaponin may be saikosaponin a, saikosaponin d, or a mixture thereof. The cortex albiziae saponin may be cortex albiziae total saponins. The glycyrrhizin may be total glycyrrhizins. The panax japonicus saponin may be panax japonicus total saponins.
In the immunostimulatory composition according to the invention, the adjuvant comprising a saponin is an immunostimulating complex adjuvant (Iscom adjuvant).
In the immunostimulatory composition according to the present invention, the CpG oligodeoxynucleotide comprises a phosphorothioate linkage. Particularly, the CpG oligodeoxynucleotide is a thio-oligodeoxynucleotide, preferably a perthio-oligodeoxynucleotide.
In the immunostimulatory composition according to the present invention, the weight ratio of the CpG oligodeoxynucleotide to the saponin is 1˜40:0.1˜2, preferably 2˜40:0.1˜2, and more preferably 2:1.
In another aspect, the present invention also provides a pharmaceutical composition comprising the immunostimulatory composition, and an antigen or an antigen composition.
In the pharmaceutical composition according to the present invention, the antigen or antigen composition is any one selected from the group consisting of human immunodeficiency virus, human herpes virus, varicella-zoster virus, human cytomegalovirus, hepatitis A, B, C or E virus, respiratory syncytial virus, human papilloma virus, influenza virus, Mycobacterium tuberculosis, salmonella, neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, borrelia such as borrelia recurrentis or borrelia duttonii, chlamydia such as Chlamydia trachomatis, bordetella such as Bordetella pertussis, plasmodium such as Plasmodium falciparum, plasmodium malariae, plasmodium ovale, Plasmodium vivax or Plasmodium knowlesi, or toxoplasma such as Toxoplasma gondii.
In the pharmaceutical composition according to the present invention, the human herpes virus is HSV1 or HSV2.
In the pharmaceutical composition according to the present invention, the antigen is a tumor antigen.
In yet another aspect, the present invention provides a vaccine comprising the immunostimulatory composition.
The vaccine according to the present invention is a vaccine for preventing a viral, bacterial and/or parasitic infection, or a vaccine for treating a viral, bacterial and/or parasitic infection with immunotherapy.
In yet another aspect, the present invention provides use of the immunostimulatory composition in the preparation of a medicament for eliciting a cytolytic T cell response.
In some specific embodiments, the present invention provides use of the immunostimulatory composition in the preparation of a medicament for inducing an interferon γ response in a mammal.
In some specific embodiments, the present invention provides use of the immunostimulatory composition in the preparation of a vaccine for preventing a viral, bacterial and/or parasitic infection.
In some specific embodiments, the present invention provides use of the immunostimulatory composition in the preparation of a vaccine for treating a viral, bacterial and/or parasitic infection with immunotherapy.
In some specific embodiments, the present invention provides use of the immunostimulatory composition in the preparation of a vaccine for treating a tumor with immunotherapy.
The present invention also provides a method for eliciting a cytolytic T cell response comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition comprising the immunostimulatory composition of the present invention.
The present invention also provides a method for inducing an interferon γ response in a mammal comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition comprising the immunostimulatory composition of the present invention.
The present invention also provides a method for preventing a viral, bacterial and/or parasitic infection comprising administering to a subject in need thereof a prophylactically effective amount of a vaccine comprising the immunostimulatory composition of the present invention.
The present invention also provides a method for treating a viral, bacterial and/or parasitic infection with immunotherapy comprising administering to a subject in need thereof an effective amount of a vaccine comprising the immunostimulatory composition of the present invention.
The present invention also provides a method for treating a tumor comprising administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising the immunostimulatory composition of the present invention.
The immunostimulatory composition provided by the present invention achieves an unexpected technical effect of mediating a stronger immune response. The immunostimulation effect of CpG T1˜T3 alone is weaker than that of CpG1018, CpG7909 or CpG1826, etc. However, when they are combined with QS-21, the immunostimulatory compositions exhibit unexpected synergistic effects, and the immune effects are significantly enhanced.
The study of the present invention found that the hepatitis B therapeutic vaccine containing the immunostimulatory composition could break through the immune tolerance in the transgenic mice and produce high titers of anti-HBsAg antibodies, anti-HBcAg antibodies and neutralizing antibodies. The various test results showed that this vaccine could significantly eliminate hepatitis B virus in the transgenic mice through multiple immunizations. At the end of the immunization process, the HBsAb level was close to saturation, which could maintain a long-term stable immune effect, and the average decrease rate of HBsAg was maintained at about 92%. Meanwhile, the Hepatitis B vaccine containing the immunostimulatory composition could induce production of stronger levels of HBsAg- and HBcAg-specific IFN-γ, and the immune effects were significantly better than those of either adjuvant alone or the combinations of the existing CPG adjuvants and QS-21.
The herpes zoster vaccine containing the immunostimulatory composition also demonstrates that the immunostimulatory composition has a superior immunostimulatory effect. The cellular immunity experiment demonstrated that this vaccine could induce a stronger level of herpes gE protein-specific IFN-γ, and the protein immune effect was significantly superior to that of a single adjuvant. The humoral immunity experiment also demonstrated that the vaccine could generate a higher level of herpes gE protein-specific IgG/IgG1/IgG2a antibody, and its effects were superior to those of a single adjuvant and significantly superior to those of the combinations of the existing CPG adjuvants and QS-21.
In conclusion, the immunostimulatory composition provided by the present invention has a superior immunostimulatory effect. Compared with a single adjuvant and combinations of the existing CPG adjuvants and QS21, CpG T1-T3 and QS-21 in the immunostimulatory composition of the present invention exhibit synergistic effects with high efficiency and can mediate stronger immune responses. They have significant advantages when applied to different antigens or antigen compositions. Therefore, as a new type of adjuvant, the immunostimulatory composition of the present invention has high clinical application value and broad market prospect.
The embodiments of the present invention will be described below in detail in conjunction with the accompanying drawings, in which:
FIG. 1 shows the effects of different CPG oligodeoxynucleotides on the secretion level of HBsAg antigen-specific IFN-γ.
FIG. 2 shows the effects of different CPG oligodeoxynucleotides on the secretion level of HBcAg antigen-specific IFN-γ.
FIG. 3 shows the effects of different immunostimulatory compositions according to the present invention on the secretion level of HBsAg antigen-specific IFN-γ.
FIG. 4 shows the effects of different immunostimulatory compositions according to the present invention on the secretion level of HBcAg antigen-specific IFN-γ.
FIG. 5 shows the effects of varying dosages of the immunostimulatory composition according to the present invention on the secretion level of HBsAg antigen-specific IFN-γ.
FIG. 6 shows the effects of varying dosages of the immunostimulatory composition according to the present invention on the secretion level of HBcAg antigen-specific IFN-γ.
FIG. 7 shows the effects of the hepatitis B vaccines containing the immunostimulatory composition of the present invention on the level of HBsAg in serum.
FIG. 8 shows the effects of the hepatitis B vaccines containing the immunostimulatory composition of the present invention on the level of HBsAb in serum.
FIG. 9 shows the effects of the hepatitis B vaccines containing the immunostimulatory composition of the present invention on the secretion level of HBsAg antigen-specific IFN-γ.
FIG. 10 shows the effects of the hepatitis B vaccines containing the immunostimulatory composition of the present invention on the secretion level of HBcAg antigen-specific IFN-γ.
FIG. 11 shows the effects of the hepatitis B vaccines containing the immunostimulatory composition of the present invention on the levels of HBsAg antigen-specific IgG antibody and subtypes thereof in the mouse serum; wherein, Panel A: HBsAb IgG levels in the mouse serum for all the groups; Panel B: HBsAb IgG1 levels in the mouse serum for all the groups; Panel C: HBsAb IgG2a levels in the mouse serum for all the groups; Panel D: the ratios of HBsAb IgG2a to IgG1 in the mouse serum for all the groups.
FIG. 12 shows the effects of the hepatitis B vaccines containing the immunostimulatory composition of the present invention on the levels of HBcAg antigen-specific IgG antibody and subtypes thereof in the serum of mice; wherein, Panel A: HBcAb IgG levels in the mouse serum for all the groups; Panel B: HBcAb IgG1 levels in the mouse serum for all the groups; Panel C: HBcAb IgG2a levels in the mouse serum for all the groups; Panel D: the ratios of HBcAb IgG2a to IgG1 in the mouse serum for all the groups.
FIG. 13 shows the effects of the herpes zoster vaccines containing the immunostimulatory composition of the present invention on the secretion level of herpes gE antigen-specific IFN-γ.
FIG. 14 shows the effects of the herpes zoster vaccines containing the immunostimulatory composition of the present invention on the levels of antigen-specific IgG antibody and subtypes thereof in the mouse serum; wherein, Panel A: IgG levels in the mouse serum for all the groups; Panel B: IgG1 levels in the mouse serum for all the groups; Panel C: IgG2a levels in the mouse serum for all the groups; Panel D: the ratios of IgG2a and IgG1 in the mouse serum for all the groups.
FIG. 15 shows the effects of the immunostimulatory compositions comprising different saponins according to the present invention on the secretion level of herpes gE antigen-specific IFN-γ.
Unless defined otherwise, all the scientific and technical terms used herein have the same meaning as understood by one of ordinary skill in the art. With regard to the definitions and terms in the art, one of skill can refer specifically to Current Protocols in Molecular Biology (Ausubel). The abbreviations for amino acid residues are standard 3-letter and/or 1-letter codes used in the art to refer to one of 20 common L-amino acids.
Although the present invention shows the numerical ranges and approximations of parameters in broad scopes, the numerical values shown in the specific examples are reported as precisely as possible. All the numerical values, however, inherently contain a certain error necessarily resulting from the standard deviations found in their respective measurements. Additionally, all the ranges disclosed herein are to be understood to encompass any and all the subranges subsumed therein. For example, a stated range of “2 to 40” should be considered to include any and all the subranges between (and inclusive of) the minimum value of 2 and the maximum value of 40, that is, all the subranges beginning with a minimum value of 2 or more, e.g. 2 to 6.1, and ending with a maximum value of 40 or less, e.g. 5.5 to 40. Further, any reference referred to as “incorporated herein” is understood to be incorporated in its entirety.
It is further noted that, as used in this specification, the singular forms include the plural forms of the referents to which they refer, unless expressly and unequivocally limited to one referent. The term “or” may be used interchangeably with the term “and/or”, unless the context clearly dictates otherwise.
As used herein, the terms “pharmaceutical composition”, “combination drug”, and “drug combination” may be used interchangeably and refer to a combination of at least one drug, and optionally a pharmaceutically acceptable excipient or auxiliary material, which are combined together to achieve a certain particular purpose. In certain embodiments, the pharmaceutical composition comprises temporally and/or spatially separated components, so long as they are capable of cooperating to achieve the objects of the present invention. For example, the ingredients (e.g. gE protein, QS-21, and CpG oligodeoxynucleotide) contained in the pharmaceutical composition may be administered to a subject as a whole or separately. When the ingredients contained in the pharmaceutical composition are administered separately to a subject, the ingredients may be administered to the subject simultaneously or sequentially.
As used herein, the term “CpG oligodeoxynucleotide” or “CpG-ODN” refers to a short single-chain synthetic DNA molecule containing one or more “CpG” unit(s), wherein C represents cytosine, G represents guanine, and p represents a phosphodiester bond. In particular, the CpG oligodeoxynucleotide is non-methylated. In some embodiments, the CpG-ODN comprises a phosphorothioate linkage or a phosphorothioate backbone. That is to say, in some embodiments, the CpG-ODN is a phosphorothioate oligodeoxynucleotide (i.e. a thio-oligodeoxynucleotide). Preferably, all the internucleotide linkages in the CpG-ODN are phosphorothioate linkages, that is, the CpG-ODN is a perthio-oligodeoxynucleotide. In other embodiments, the CpG-ODN comprises two or more copies of 5′-TTCGTT-3′ motif or 5′-TCGTCGTCG-3′ motif. In particular, the CpG-ODN has a sequence selected from: TCG TTC GTT CGT TCG TTC GTT (SEQ ID NO: 6), TCG TTC GTT CGT TCG TTC GTT CUT T (SEQ ID NO: 7), or TCG TCG TCG TCG TCG TCG TCG (SEQ ID NO: 8), preferably TCG TTC GTT CGT TCG TTC GTT (SEQ ID NO: 6).
As used herein, “ginsenoside, platycodin, astragaloside, notoginsenoside, glycyrrhizin, cortex albiziae saponin, ophiopogonin, saikosaponin or panax japonicus saponin” refer to an active ingredient presented in the corresponding plant. For example, ginsenoside is a kind of sterol compounds, which mainly exist in the medicinal materials of genus Panax and are active ingredients in ginseng. In some embodiments, the ginsenoside is preferably a monomer such as ginsenoside Rg1, ginsenoside Rg3, ginsenoside Rb1, ginsenoside Re, or a mixture of two or more of these saponin monomers. The platycodin is preferably platycodin D, platycodin D2 or a mixture thereof. The astragaloside is preferably a monomer such as astragalin A (astragaloside IV), astragaloside I, astragaloside II, and the like, or a mixture of two or more of these saponin monomers. The notoginsenoside is preferably notoginsenoside R1, or the like. The ophiopogonin is preferably ophiopogonin D, or the like. The saikosaponin is preferably saikosaponin a, saikosaponin d, or a mixture thereof. The cortex albiziae saponin is preferably cortex albiziae total saponins or the like. The glycyrrhizin is preferably total glycyrrhizins or the like. The panax japonicus saponin is preferably panax japonicus total saponins or the like.
As used herein, “Iscom adjuvant” is an immunostimulatory complex adjuvant, specifically ISCOM MATRIX that does not comprise an antigen, which is an adjuvan composed of a phospholipid, a saponin, and cholesterol with a cage-like structure.
As used herein, “a therapeutically and/or prophylactically effective amount” or “an effective amount” refers to a dosage sufficient to show its benefit to the subject to which it is administered. The actual amount administered, as well as the rate and time course of administration, would depend on the own conditions and severity of the subject being treated. A prescription of treatment (e.g. determination of dosage, etc.) is ultimately the responsibility of, and determined by, general practitioners and other physicians, often taking into account the disease to be treated, the conditions of the individual patient, the site of delivery, the method of administration, and other factors known to physicians.
As used herein, the term “mammal” refers to a human, and may also be other animals, such as wild animals (e.g. herons, storks, cranes, etc.), domestic animals (e.g. ducks, geese, etc.) or laboratory animals (e.g. chimpanzees, monkeys, rats, mice, rabbits, guinea pigs, woodchucks, ground squirrels, etc.).
In other embodiments, the composition of the present invention may further comprise an additional additive, such as a pharmaceutically acceptable carrier or additive, particularly when presented as a pharmaceutical formulation form.
The preferred pharmaceutical carrier is especially water, buffered aqueous solutions, preferably isotonic saline solutions such as PBS (phosphate buffer), glucose, mannitol, dextrose, lactose, starch, magnesium stearate, cellulose, magnesium carbonate, 0.3% glycerol, hyaluronic acid, ethanol or polyalkylene glycols such as polypropylene glycol, triglycerides, etc. The types of the pharmaceutical carrier used depend inter alia on whether the composition according to the present invention is formulated for oral, nasal, intradermal, subcutaneous, intramuscular or intravenous administration. The composition according to the present invention may comprise a wetting agent, an emulsifying agent, or buffer substance as an additive.
The pharmaceutical composition, vaccine or pharmaceutical formulation according to the present invention may be administered by any suitable route, for example, oral, nasal, intradermal, subcutaneous, intramuscular or intravenous administration.
The present invention is further illustrated by the following description of specific embodiments in conjunction with the accompanying drawings, which are not to be construed as limitation of the present invention, and various modifications or improvements can be made by those skilled in the art in light of the basic concepts of the present invention, which are all within the scope of the present invention, as long as they do not deviate from the basic concepts of the present invention.
The present invention is illustrated below with reference to the specific examples. Those skilled in the art will appreciate that these examples are merely illustrative of the present invention and not intended to limit the scope of the present invention in any way.
The experimental methods in the following examples are conventional, unless otherwise specified. The raw materials, reagent materials and the like used in the following examples are commercially available products, unless otherwise specified.
1. HBsAg stock solution: the amino acid sequence of the HBsAg protein is shown by SEQ ID NO: 1.
The HBsAg protein was prepared from recombinant yeast cells of the HBsAg gene, and the types of yeast cells include Hansenula, Saccharomyces cerevisiae and Pichia, preferably Hansenula. For the specific preparation steps, reference was made to Chinese patent application CN108330145A. The recombinant Hansenula cells of the HBsAg gene were cultured by fermentation and the mycelia were harvested. The mycelia were subjected to disruption treatment and purified by the steps of silica gel adsorption, column chromatography and TFF, etc.
2. HBcAg stock solution: the amino acid sequence of the HBcAg protein is shown by SEQ ID NO: 2.
The HBcAg protein was prepared from recombinant yeast cells of the HBcAg gene, and the types of yeast cells include Hansenula, Saccharomyces cerevisiae and Pichia, preferably Hansenula. For the specific preparation steps, reference was made to Chinese patent application CN108047316A. The recombinant Hansenula cells of the HBcAg gene were cultured by fermentation and the mycelia were harvested. The mycelia were subjected to disruption treatment and purified by the steps of ammonium sulfate treatment, column chromatography and TFF, etc to prepare the HBcAg stock solution.
3. QS-21 was purchased from BRENNTAG, CAS. NO. A010-023.
4. Preparation method of CPG oligodeoxynucleotide raw materials:
Oligodeoxynucleotides are synthetically prepared fragments of oligodeoxynucleotide sequence containing one or more CpG motifs. The oligodeoxynucleotide sequences used in this example are shown in Table 1:
| TABLE 1 |
| Specific sequences of CPG oligodeoxynucleotide |
| Typing of CPG | CPG | |
| Oligodeoxynucleotide | Oligodeoxynucleotide | Sequence |
| Type B | CpG 1018 | TGACTGTGAACGTTCGAGATGA (SEQ ID NO: 3) |
| CpG 7909 | TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 4) | |
| CpG 1826 | TCCATGACGTTCCTGACGTT (SEQ ID NO: 5) | |
| CpG T1 | TCGTTCGTTCGTTCGTTCGTT (SEQ ID NO: 6) | |
| CpG T2 | TCG TTC GTT CGT TCG TTC GTT CGT T (SEQ ID | |
| NO: 7) | ||
| CpG T3 | TCG TCG TCG TCG TCG TCG TCG (SEQ ID NO: 8) | |
| CpG 684 | TCGACGTTCGTCGTTCGTCGTTC (SEQ ID NO: 9) | |
| CpG 1668 | TCC ATG ACG TTC CTG ATGCT (SEQ ID NO: 10) | |
| CpG D2 | TGTCGTCGTCGTTTGTCGTTTGTCGTT (SEQ ID | |
| NO: 11) | ||
| Type A | CpG 2216 | GGGGGACGATCGTCGGGGGG (SEQ ID NO: 12) |
| ODN 2336 | GGGGACGACGTCGTGGGGGGG (SEQ ID NO: 13) | |
| Type C | ODN 2395 | TCGTCGTTTCGCGCGCGCCG (SEQ ID NO: 14) |
| ODN M362 | TCGTCGTTCGTTCGTCGAACGACGTTTGAT | |
| (SEQ ID NO: 15) | ||
Specific preparation method: a conventional solid phase phosphoramidite-phosphotriester chemical synthesis method was used for the preparation, starting from the 3′ end, i.e., 1) Deprotection: first removing the protecting group DMT (dimethoxytrityl) of the nucleotide connected to CpG with trichloroacetic acid to obtain free 5′ hydroxyl for the next step of condensation reaction; 2) Activation: mixing a phosphoramidite-protected nucleotide monomer and a tetrazole activator into a synthesis column to form a phosphoramidite tetrazole active intermediate, which undergoes a condensation reaction with a deprotected nucleotide on CpG; 3) Connection: when the phosphoramidite tetrazole reactive intermediate encounters a deprotected nucleotide on CpG, it will undergo an affinity reaction with its 5′ hydroxyl, condense and remove the tetrazole, upon which the oligonucleotide chain is extended forward by one base; 4) Oxidation: during the condensation reaction, the nucleotide monomer is connected to the oligonucleotide connected to CpG via a phosphite bond, while the phosphite bond is unstable and prone to be hydrolyzed by an acid or a base, upon which the phosphoramidite is oxidized into a phosphotriester with a sulphur-phosphorus double bond using a thio-substitution reagent, thereby obtaining a stable oligonucleotide; and 5) Blocking: in order to prevent the unreacted 5′ hydroxyl connected to CpG from being extended in the subsequent circular reaction after the condensation reaction, this terminal hydroxyl is often blocked by acetylation. After the above five steps, one deoxynucleotide is connected to the nucleotide of CpG. The above deprotection, activation, connection, oxidation and blocking processes are repeated to obtain a crude DNA fragment. Finally, it is subjected to post-synthesis treatments, such as cleavage, deprotection, purification and quantification, etc.
5. The HbsAg stock solution and the HbcAg stock solution were diluted to 200 μg/ml and 100 μg/ml respectively, using a PBS solution (purchased from Hyclone). All the CPG raw materials were separately dissolved and diluted to 100 μg/ml using the PBS solution for the next step.
1. Experimental animals: C57BL/6(N) mice, male, 4 weeks old, 135 mice, Shanghai Lingchang Laboratory Animal Technology Co. Ltd.
2. Experimental grouping: see Table 2. The dosage for each injection was 100 μL/mice, and Group A was the negative control (the PBS solution, 100 μL/mouse).
| TABLE 2 |
| Grouping of experimental animals |
| Component (μg/mouse) |
| Number | HBs | HBc | CpG | CpG | CpG | CpG | CpG | CpG | CpG | CpG | CPG | CpG | ODN | ODN | ODN | |
| Group | (animals) | Ag | Ag | T1 | T2 | T3 | 1618 | 7909 | 1826 | 684 | 1668 | D2 | 2216 | 2336 | 2395 | M362 |
| Control | 9 | |||||||||||||||
| Antigen | 9 | 20 | 10 | |||||||||||||
| T1 | 9 | 20 | 10 | 10 | ||||||||||||
| T2 | 9 | 20 | 10 | 10 | ||||||||||||
| T3 | 9 | 20 | 10 | 10 | ||||||||||||
| 1018 | 9 | 20 | 10 | 10 | ||||||||||||
| 7909 | 9 | 20 | 10 | 10 | ||||||||||||
| 1826 | 9 | 20 | 10 | 10 | ||||||||||||
| 684 | 9 | 20 | 10 | 10 | ||||||||||||
| 1668 | 9 | 20 | 10 | 10 | ||||||||||||
| D2 | 9 | 20 | 10 | 10 | ||||||||||||
| 2216 | 9 | 20 | 10 | 10 | ||||||||||||
| 2336 | 9 | 20 | 10 | 10 | ||||||||||||
| 2395 | 9 | 20 | 10 | 10 | ||||||||||||
| M362 | 9 | 20 | 10 | 10 | ||||||||||||
3. Experimental steps: on Day 7 after the immunization of mice, the spleen lymphocytes were prepared according to a conventional method, and the details were as follows: the spleens were taken aseptically by being cut with sterile forceps and scissors, and placed in a 70 μm cell strainer, which was placed in a plate containing 2 ml of pre-chilled 2% FBS (purchased from GIBCO)-PBS; the spleens were ground using a grinding rod, and the spleen cells entered the plate through the meshes to obtain a cell suspension, and then the suspension was filtered by a 40 μm cell strainer (purchased from BD) and put into a 50 ml sterile centrifuge tube by using a Pasteur pipet; it was centrifuged at 500×g at 4° C. for 5 min; the supernatant was discarded, and then 2 ml of 1×erythrocyte disruption agent (purchased from BD) was added to re-suspend the cells, and the resultant was allowed to stand for 5 min at 4° C., protected from light to disrupt the red blood cells; 10 ml of 2% FBS-PBS was added to terminate the erythrocyte disruption reaction; the resultant was centrifuged at 500×g at 4° C. for 5 min, the supernatant was discarded, and then 5 ml of 2% FBS-PBS was added to re-suspend the cells for later use. The spleen cells were stimulated with the stimulators, HBsAg-specific peptide library PS4 and HBcAg-specific peptide library PCP, respectively. An ELISPOT kit (BD) was used to detect the secretion levels of HBsAg and HBcAg antigen-specific IFN-γ according to the kit instructions. The spot number measured by the ELISPOT kit was read using ImmunoSPOT Series 3 Elispot analyzer (refer to Example 7 of Chinese patent CN104043120B for the specific operation steps).
The sequences of HBsAg-specific peptide library refer to Example 7 of Chinese patent CN104043120B, and the sequences of HBcAg-specific peptide library are shown by SEQ ID NO: 16˜30.
4. Experimental results: the results of ELISPOT spot are shown in FIG. 1 and FIG. 2. The results show that the CpG adjuvants of type B with different sequences had different immune effects. Among them, CpG T1˜T3, CpG 1018, CpG 7909, CpG 1826 and CpG 684 as a whole were superior to the CpG adjuvants of type A and the CpG adjuvants of type C, while CpG 1618 and CPG D2 had poorer immune effects, and the induced production levels of HBsAg- and HBcAg-specific IFN-γ were all lower than those induced by the CpG adjuvants of type A and the CpG adjuvants of type C.
1. Experimental animals: C57BL/6(N) mice, male, 4 weeks old, 81 mice, Shanghai Lingchang Laboratory Animal Technology Co. Ltd.
2. Experimental grouping: see Table 3. The dosage for each injection was 100 μL/mice, and Group A was the negative control (the PBS solution, 100 μL/mouse).
| TABLE 3 |
| Grouping of experimental animals |
| Component (μg/mouse) |
| Number | CpG | CpG | CpG | CpG | CpG | CpG | CpG | ||||
| Group | (animals) | HBsAg | HBcAg | T1 | T2 | T3 | 1018 | 7909 | 1826 | 684 | QS21 |
| Control | 9 | ||||||||||
| Antigen | 9 | 20 | 10 | ||||||||
| T1 | 9 | 20 | 10 | 10 | 5 | ||||||
| T2 | 9 | 20 | 10 | 10 | 5 | ||||||
| T3 | 9 | 20 | 10 | 10 | 5 | ||||||
| 1018 | 9 | 20 | 10 | 10 | 5 | ||||||
| 7909 | 9 | 20 | 10 | 10 | 5 | ||||||
| 1826 | 9 | 20 | 10 | 10 | 5 | ||||||
| 684 | 9 | 20 | 10 | 10 | 5 | ||||||
3. Experimental steps: following Example 2.
4. Experimental results: the results of ELISPOT spot are shown in FIG. 3 and FIG. 4. The results show that use of CpG T1˜T3 in combination with QS21 resulted in high-efficiency synergistic effects, and the induced production levels of HBsAg- and IBcAg-specific IFN-γ were significantly higher than those induced by other CpG adjuvants, such as CpG 1018, CpG 7909, etc., with unexpected immune effects.
1. Experimental animals: C57BL/6(N) mice, male, 4 weeks old, 60 mice, Shanghai Lingchang Laboratory Animal Technology Co. Ltd.
2, Reagents and materials:
1) The HBsAg protein, HBcAg protein and CpG T1 were obtained from Example 1.
2) QS-21 (CAS. NO. A010023, purchased from BRENNTAG).
3) The HBsAg stock solution and IBcAg stock solution were diluted to 200 μg/ml and 100 μg/ml respectively, using a PBS solution (purchased from Hyclone); QS21 was diluted to 5 μg/ml, 50 μg/ml and 100 μg/ml respectively, using the PBS solution; CpG T1 was dissolved and diluted to 50 μg/ml, 100 μg/ml and 2 mg/ml respectively, using the PBS solution; and CPG 7909 was dissolved and diluted to 100 μg/mi using the PBS solution, for the next step.
3. Experimental grouping: see Table 4. The dosage for each injection was 100 μL/mouse, and Group A was the negative control (the PBS solution, 100 μL/mouse).
4. Experimental steps: following Example 2.
5. Experimental results: the results of ELISPOT spot are shown in FIG. 5 and FIG. 6. The results show that the dosage changes of CpG T1 and QS21 had significant effects on the vaccine compositions, and the immunostimulatory compositions having a dosage higher than Dosage 5 induced the production levels of HBsAg- and HBcAg-specific IFN-γ, which were significantly higher than that of CPG 7909 group. However, due to the species difference, a further increase of adjuvant dosage did not induce a significant increase of the effect, presumably because the mice could not accurately reflect the immune intensity of adjuvant.
Dosages 1, 2 and 4 are equivalent to CPG 7909 group in terms of immunostimulatory effect, but the adjuvant dosages used were lower than that of the equivalent CPG 7909 group, thus they also had a certain advantage.
| TABLE 4 |
| Grouping of experimental animals |
| Number | Component (μg/mouse) |
| Group | (animals) | HBsAg | HBcAg | CpG T1 | QS21 | CPG7909 |
| Control | 5 | |||||
| Antigen | 5 | 20 | 10 | |||
| Dosage 1 | 5 | 20 | 10 | 5 | 0.5 | |
| Dosage 2 | 5 | 20 | 10 | 5 | 5 | |
| Dosage 3 | 5 | 20 | 10 | 5 | 10 | |
| Dosage 4 | 5 | 20 | 10 | 10 | 0.5 | |
| Dosage 5 | 5 | 20 | 10 | 10 | 5 | |
| Dosage 6 | 5 | 20 | 10 | 10 | 10 | |
| Dosage 7 | 5 | 20 | 10 | 200 | 0.5 | |
| Dosage 8 | 5 | 20 | 10 | 200 | 5 | |
| Dosage 9 | 5 | 20 | 10 | 200 | 10 | |
| CPG7909 | 5 | 20 | 10 | 5 | 10 | |
1. Experimental animals and model establishment: C57BL/6(N) mice, male, 4 weeks old, 81 mice, Shanghai Lingchang Laboratory Technology Co. Ltd.; rAAV 8-HBV adenovirus, purchased from Beijing FivePlus Molecular Medicine Institute Co. Ltd. A C57BL/6(N) mouse model infected persistently with rAAV 8-HBV was established by intravenously injecting rAAV 8-HBV adenovirus into the upper tail vein of C57BL/6(N) mice.
2. Reagents and materials:
1) HBsAg protein: obtained from Example 1.
2) HBcAg protein: obtained from Example 1.
3) The HBsAg stock solution, HBcAg stock solution and QS-21 were diluted to 200 μg/ml, 100 μg/ml and 50 μg/ml respectively, using a PBS solution (purchased from Hyclone), and CpG was dissolved and diluted to 100 μg/ml using the PBS solution, for the next step.
3. Experimental grouping: see Table 5. The dosage for each injection was 100 μL/mouse, and Group A was the negative control which was injected with the PBS solution 100 μL/mouse.
| TABLE 5 |
| Grouping of experimental animals and injection dosage for each group |
| Number | Component (μg/mouse) |
| Group | (animals) | HBsAg | HBcAg | CpG T1 | CpG 7909 | QS-21 |
| A | 9 | |||||
| B | 9 | 10 | ||||
| C | 9 | 5 | ||||
| D | 9 | 10 | 5 | |||
| E | 9 | 20 | 10 | |||
| F | 9 | 20 | 10 | 10 | ||
| G | 9 | 20 | 10 | 5 | ||
| H | 9 | 20 | 10 | 10 | 5 | |
| I | 9 | 20 | 10 | 10 | 5 | |
4. Animal immunization: all the groups were administrated by intramuscular injection once every 2 weeks and the inoculation site was at the right rear thigh, with a total of 6 administrations at the 4th, 6th, 8th, 10th, 12th and 14th week respectively after the tail vein intravenous injection of rAAV 8-HBV virus. The blood was collected once every 2 weeks after the start of administration, i.e., at the 4th, 6th, 8th, 10th, 12th, 14th, 16th, 18th, 20th and 22th week, respectively. All the mice were sacrificed at the 22th week.
1. Detection steps for serum HBsAg: Nanjing Drum Tower Hospital was entrusted for detection.
Using a two-step immunoassay, the binding between the sample to be detected and the paramagnetic particles coated with the hepatitis B surface antibody was firstly detected; after washing, an acridinium ester-labeled hepatitis B surface antibody conjugate was added; after washing again, a pre-excitation solution and an excitation solution were added to the reaction mixture, and the relative luminescence unit (RLU) of the sample to be detected was determined; there was a positive correlation between the content of HBsAg in the sample and RLU, and the concentration of HBsAg in the mouse serum sample was determined via a generated ARCHTITECT HBsAg standard curve; finally, the concentration of HBsAg in the mouse serum sample was 50 to 200 times of the determined value.
2. Analysis of results (FIG. 7): Group H vaccine containing the immunostimulator according to the present invention showed a significant downtrend in the corresponding HBsAg level, and maintained a stable long-lasting immune effect after the end of the immunization process (from Week 14), with a significant advantage compared to the CpG group alone (Group F) and the QS-21 group alone (Group G). The HBsAg level in Group H decreased from >6350 IU/ml at the onset to about 50 IU/ml. In this group, the HBsAg level decreased by more than 30% after the second immunization (Week 6) and decreased by more than 70% after the third immunization (Week 8), and the average decrease rate was maintained at about 92% after the end of immunization at Week 14. A superior immune effect was found. Compared with the dual adjuvant control (Group I), Group H still maintained a stable immune effect after the end of immunization at Week 14, and the immune level was significantly better than that of Group I.
1. Detection steps for serum HBsAb: Nanjing Drum Tower Hospital was entrusted for detection.
Using a two-step immunoassay, the sample to be detected was first mixed with the paramagnetic particles coated with recombinant HBsAg (rHBsAg); after washing, an acridinium ester-labeled rHBsAg conjugate was added; after washing again, a pre-excitation solution and an excitation solution were added to the reaction mixture, and the relative luminescence unit (RLU) of the sample to be detected was determined; there was a positive correlation between the content of HBsAb in the sample and RLU, and the concentration of HBsAg in the mouse serum sample was determined via a generated ARCHTITECT HBsAb standard curve; finally, the concentration of HBsAb in the mouse serum sample was 50 to 200 times of the determined value.
2. Analysis of results (FIG. 8): Group H vaccine containing the immunostimulator began to generate HBsAb (>10 mIU/ml) after the second immunization (Week 6), and the level of HBsAb showed a trend of continuous increase as the number of immunizations increased, and the trend of increase was significantly superior to that of the CpG group alone (Group F) and the QS-21 group alone (Group G). Two weeks after the end of immunization (Week 16), the HBsAb level was close to saturation, reaching an HBsAb level of 4.0 logs, i.e. about 10000 mIU/ml. The antibody level generated was also significantly superior to that of the dual adjuvant control (Group I).
1. Detection steps: following Example 2.
2. Evaluation indicators: if the spot number of control well ≤5 SFC and the spot number of sample well ≥10 SFC, it will be determined as positive; if 5 SFC<the spot number of control well ≤10 SFC, and the spot number of sample well/the spot number of control well ≥2, it will be determined as positive; and if the spot number of control well >10 SFC, and the spot number of sample well/the spot number of control well ≥3, it will be determined as positive.
3. Experimental results:
| TABLE 6 |
| Positive conversion rates of HBsAg- and |
| HBcAg-specific IFN-γ secreted by spleen cells |
| Number | Positive conversion rate (%) |
| Group | (animals) | HBsAg | HBcAg | |
| A | 9 | 11.1 | 11.1 | |
| B | 9 | 0 | 11.1 | |
| C | 8 | 0 | 0 | |
| D | 8 | 12.5 | 12.5 | |
| E | 9 | 37.5 | 12.5 | |
| F | 9 | 100 | 100 | |
| G | 8 | 100 | 100 | |
| H | 8 | 100 | 100 | |
| I | 8 | 100 | 100 | |
Detection results of cellular immune level: the results of ELISPOT spot are shown in FIGS. 9 and 10, and the analysis results show that the positive conversion rates of HBsAg-specific IFN-γ were 100% and the positive conversion rates of HBcAg-specific IFN-γ were 100% for Groups F-I. Group H vaccine containing the immunostimulator could induce higher production levels of HBsAg- and HBcAg-specific IFN-γ, greater than 2350 SFC/106 spleen cells and greater than 1250 SFC/106 spleen cells, respectively, with significant differences compared to the CpG alone group (Group F) and the QS-21 group alone (Group G). The production levels of HBsAg- and HBcAg-specific IFN-v induced by the dual adjuvant control (Group I) were about 1630 SFC/106 spleen cells and 750 SFC/106 spleen cells, which were significantly lower than those induced by Group H.
1. Detection steps: a 96-well ELISA plate was coated with the purified HBsAg and HBcAg to form solid phase antigens. After blocking treatment, the serum to be detected was diluted serially at a certain initial dilution, and multiple dilutions were set. The serially diluted serum samples were added to the 96-well ELISA plate, and then bond to HRP-labeled anti-IgG/IgG 1/IgG 2a antibody to form antigen-antibody (serum)-enzyme labeled antibody complexes. Finally, the substrate TMB was added for color development, and the absorbance (OD value) at 450 nm was measured with a microplate reader. The shade of developed color was positively correlated with the levels of HBsAg- and HBcAg-specific antibodies IgG/IgG 1/IgG 2a in the samples to be detected. The determination of antibody titers was performed by fitting the relationship curve of “absorbance OD value-dilution factor of serum sample (Log)”.
2. Analysis of results:
1) Detection results of HBsAb IgG antibody and subtypes thereof in serum.
An ELISA method was used to detect the levels of HBsAb IgG antibody and subtype thereof in the mouse serum of each group at different time. As shown in FIG. 11, Group H vaccine containing the immunostimulator generated a higher titer of anti-HBsAg-specific IgG/IgG 1/IgG 2a antibody, and with the increase of immunization number, the antibody levels continued to increase, and at the sixth immunization (Week 14), the antibody levels approached saturation, and the specific antibody titers could reach more than 5.4 log. No specific antibodies were detected in Groups A-D. Although Groups E-G generated a certain level of HBsAg-specific IgG/IgG 1/IgG 2a antibody, the level of antibody was significantly lower than that in Group H. The levels of anti-HBsAg-specific IgG antibody and IgG 2a antibody generated in the dual adjuvant control (Group I) were significantly lower than those in Group H.
2) Detection results of HBcAb IgG antibody and subtypes thereof in serum.
An ELISA method was used to detect the levels of HBcAb IgG antibody and subtype thereof in the mouse serum of each group at different time. As shown in FIG. 12, Group H vaccine containing the immunostimulator generated a higher titer of anti-HBcAg-specific IgG/IgG 1/IgG 2a antibody, and with the increase of immunization number, the antibody level continued to increase, and at the sixth immunization (Week 14), the antibody level approached saturation, and the specific antibody titer could reach more than 4.8 log. No specific antibodies were detected in Groups A-D. Although Groups E-G generated a certain level of HBcAg-specific IgG/IgG 1/IgG 2a antibody, the level of antibody was significantly lower than that in Group H. And Group H is more inclined to Th1 pathway, and the specific antibody IgG 2a appeared a significant upward trend as shown in Figure D, reflecting that the vaccine of Group H could promote the subtype conversion of anti-IBcAg antibody, and the conversion efficiency was significantly higher than that of the dual adjuvant control (Group I).
1. Experimental animals and model establishment:
C57BL/6(N) mice, female, 5 weeks old, 48 mice, purchased from Shanghai SLRC Laboratory Animal Co., Ltd.
2. Reagents and materials:
1) Herpes gE protein: the amino acid sequence is shown by SEQ ID NO: 31.
For the preparation steps, reference was made to the report of a reference, Thomsson E., Persson L. et al. “Journal of Virological Methods”, 2011, Vol. 175, No. 1, pp. 53-59, and the specific steps were as follows: according to the target protein sequence, the nucleic acid sequence was optimized so that its codons accorded with a mammalian expression system, and the target gene was synthesized. The synthesized target gene was ligated with pcDNA3.1(+) plasmid by a way of enzyme digestion and ligation, and transformed into Top 10 competence. The positive monoclones were picked up and verified by sequencing. The monoclonal bacteria were amplified massively, and a large number of plasmids suitable for cell transfection were extracted using an endotoxin-free plasmid extraction kit. Suspending CHO cells were transfected with the plasmids by a way of transient transfection. When the viability of CHO cells was less than 70% or the fermentation time was more than 7 days, the supernatant of fermentation broth was collected by centrifugation at 5000 rpm at 4° C. for 30 min. The fermentation broth was dialyzed into a solution containing 50 mM Tris-HCl, 500 mM NaCl and 20 mM imidazole with a dialysis ratio of 1:100 in a chromatography cabinet at 4° C., once every 4 h, for a total of 3 times. The collected samples were purified through a nickel column, and an SDS-PAGE detection was performed on the collected samples corresponding to the target protein peak. The purified solutions having a higher purity were combined and dialyzed with a solution containing 20 mM phosphate and 150 mM NaCl in a chromatography cabinet at 4° C. for 24 h with a dialysis ratio of 1:100, and the dialysis solution was changed every 8 h. The samples were filtered through a 0.22 μm sterile filter membrane and stored in a refrigerator at 4° C. for later use.
It was required that the prepared herpes gE protein stock solution had a purity of greater than 95%, a protein content of not less than 200 μg/ml, and an endotoxin level of not higher than 0.1 Eu/μg.
2) The herpes gE stock solution was diluted to 50 μg/ml and 10 μg/ml using a PBS solution (purchased from Hyclone), respectively; QS-21 was diluted to 50 μg/ml and 10 μg/ml using the PBS solution, respectively; CpG was diluted to 100 μg/ml and 20 μg/ml using the PBS solution, respectively; and CpG7909 was diluted to 100 μg/ml and 20 μg/ml using the PBS solution, respectively.
3. Experimental grouping: see Table 7. The dosage for each injection was 100 μL/mouse, and Group A was the negative control which was injected with the PBS solution at 100 μL/mice.
| TABLE 7 |
| Grouping of experimental animals and injection amount for each group |
| Component μg/mouse |
| Number | Herpes gE | ||||
| Group | (animals) | protein | CpG T1 | CpG7909 | QS-21 |
| A | 6 | ||||
| B | 6 | 5 | |||
| C | 6 | 5 | 10 | ||
| D | 6 | 5 | 5 | ||
| E | 6 | 5 | 10 | 5 | |
| F | 6 | 5 | 10 | 5 | |
| G | 6 | 1 | 2 | 1 | |
| H | 6 | 1 | 2 | 1 | |
4. Animal immunity: all the groups were administrated by intramuscular injection once every 2 weeks and the inoculation site was at the right rear thigh. They were administered twice continuously, that is, by injection at Weeks 0 and 2, respectively. All the mice were sacrificed at Week 4.
1. The detection steps and evaluation indicators were the same as those in Example 2, and the sequences of gE-specific peptide library are shown by SEQ ID NO. 32-46.
2. Experimental results: the levels of spot number of T-lymphocyte secreting gE-specific IFN-γ in the spleen cells of mice in each group are shown in FIG. 13, and the positive conversion rate results of gE-specific IFN-γ are shown in Table 8. The results show that the levels of spot number of T-lymphocyte secreting gE-specific IFN-γ in the spleen cells corresponding to Groups E and F with a higher immune dosage (>4000 SFC/106 spleen cells) were significantly higher than those of Groups G and H with a lower immune dosage. Among them, the levels of spot number of T-lymphocyte secreting gE-specific IFN-γ in the spleen cells corresponding to Groups E and G (CpG T1+QS-21) were higher than those of Groups F and H (CpG 7909+QS-21) with the same dosage. The positive conversion rates of IFN-γ for Groups E-H were 100%.
| TABLE 8 |
| Positive conversion rates of SgE-specific IFN-γ secreted by spleen cells |
| Group | A | B | C | D | E | F | G | H |
| Number | 1/6 | 0/6 | 4/6 | 5/6 | 6/6 | 6/6 | 6/6 | 6/6 |
| of positive | ||||||||
| conversion/ | ||||||||
| mice | ||||||||
| Positive | 16.7 | 0 | 66.7 | 83.3 | 100 | 100 | 100 | 100 |
| conversion | ||||||||
| rate/% | ||||||||
1. Detection steps: on Day 28 after the immunization, the blood was collected and the serum was separated (the whole blood was placed in an incubator with a constant temperature of 37° C. for 40 min and centrifuged at 12000 rpm at 4° C. for 10 min; the supernatant was sucked and cryopreserved at −20° C. for later use). An ELISA kit (Shanghai Kehua) was used to detect the positive conversion rates of herpes gE protein-specific antibodies according to the kit instructions. For the detection, a blank control, a negative control and the samples to be detected were set, so that each of them had two parallel wells, wherein the negative control was negative mouse serum; except for the blank control, the negative control or the sample to be detected was added to each well followed by an enzyme conjugate. After mixing and sealing the plates, the plates were incubated at 37° C. for 30 min. Each well was washed with a washing solution and added with developer solution A and developer solution B. After mixing and sealing the plates, the plates were incubated at 37° C. for 15 min. A termination solution was added into each well and mixed evenly. The OD value of each well at a wavelength of 450 nm was read using a microplate reader.
2. Experimental results: the levels of antigen-specific IgG antibody and subtypes thereof in the mouse serum detected by ELISA are shown in FIG. 14. The results show that the immune effect of Group B containing the immunostimulator of the present invention was significantly superior to that of the group CpG alone (group C), the group QS-21 alone (Group D) and the dual adjuvant control (Group F). Moreover, the corresponding levels of IgG and IgG 2a antibodies were significantly different from those of the two groups. That is, addition of CpG to QS-21 could increase the corresponding humoral immune level.
1. Experimental animals and model establishment:
C57BL/6(N) mice, female, 5 weeks old, 48 mice, purchased from Shanghai SLRC Laboratory Animal Co. Ltd.
2. Reagents and materials:
1) The herpes gE protein was obtained from Example 10, and CpG T1 and CpG 7909 were prepared from Example 1.
2) QS-21 (CAS: NO. A010-023, purchased from BRENNTAG); ginsenoside Rg1 (CAS: 22427-39-0, purchased from Nanjing Spring & Autumn Biological Engineering Co. Ltd.); astragalin A (CAS: 84687-43-4, purchased from Nanjing Spring & Autumn Biological Engineering Co. Ltd.); platycodin D (CAS: 58479-68-8, purchased from Hubei Yunmei Technology Co. Ltd.); Iscom adjuvant (purchased from Shanghai Xiyuan Biotechnology Co. Ltd.).
3) The herpes gE stock solution was diluted to 50 μg/mL using a PBS solution (purchased from Hyclone). All the saponins were separately diluted to 50 μg/mL using the PBS solution. CpG T1 and CpG 7909 were dissolved and diluted to 100 μg/mL respectively, using the PBS solution, for the next step.
3. Experimental grouping:
See Table 9. The dosage for each injection was 100 μL/mice, and the control group was injected with the PBS solution at 100 μL/mouse.
4. Experimental steps: following Example 2.
5. Experimental results:
The results of ELISPOT spot are shown in FIG. 15. The results show that use of CpG T1 in combination with various saponins resulted in a high-efficiency synergistic effect, and the induced production levels of gE-specific IFN-γ were significantly higher than those by the compositions of other CpGs and saponins, wherein QS21 had the best effect.
| TABLE 9 |
| Grouping of experimental animals |
| Component (μg/mouse) |
| Number | CpG | Ginsenoside | Platycodin | Astragaloside | Iscom | CpG | |||
| Group | (animals) | gE | T1 | QS-21 | Rg1 | D | IV | adjuvant | 7909 |
| Control | 6 | ||||||||
| Antigen | 6 | 5 | |||||||
| QS-21 | 6 | 5 | 10 | 5 | |||||
| Ginsenoside | 6 | 5 | 10 | 5 | |||||
| Rg1 | |||||||||
| Platycodin D | 6 | 5 | 10 | 5 | |||||
| Astragalin A | 6 | 5 | 10 | 5 | |||||
| Iscom | 6 | 5 | 10 | 5 | |||||
| 7909 | 6 | 5 | 5 | 10 | |||||
In conclusion, the immune composition provided by the present invention has a superior immunostimulatory effect. Compared with a single adjuvant and the combinations of other CPG adjuvants and QS21, CpG T1˜T3 and QS-21 show a high-efficiency synergistic effect and can mediate a stronger immune response. They have significant advantages when applied to different antigens or antigen compositions. Therefore, as a new type of adjuvant, this immune composition has a high clinical application value and broad market prospect.
Although the present invention has been described in detail above, those skilled in the art will appreciate that various modifications and variations can be made to the present invention without departing from the spirit and scope of the present invention. The right scope of the present invention is not to be limited by the foregoing detailed description, and the modifications and variations are intended to fall within the scope of the claims. While only examples of specific embodiments of the present invention have been described above, it will be appreciated by those skilled in the art that the foregoing is illustrative only and that the protection scope of the present invention is to be defined by the appended claims. Various variations and modifications can be made by those skilled in the art in the embodiments without departing from the principle and essence of the present invention, but such variations or modifications should all fall within the protection scope of the present invention.
1. An immunostimulatory composition comprising a saponin and a CpG oligodeoxynucleotide, or consisting of a adjuvant comprising a saponin and a CpG oligodeoxynucleotide, wherein the sequence of the CpG oligodeoxynucleotide has two or more copies of 5′-TTCGTT-3′ motif or 5′-TCGTCGTCG-3′ motif.
2. The immunostimulatory composition according to claim 1, wherein the sequence of the CpG oligodeoxynucleotide is any one selected from: CpG T1: TCG TTC GTT COT TCG TTC GTT (SEQ ID NO: 6); CpG T2: TCG TTC GTT CGT TCG TTC GTT CGT T (SEQ ID NO: 7); and CpG T3: TCG TCG TCG TCG TCG TCG TCG (SEQ ID NO: 8);
preferably, the sequence of the CpG oligodeoxynucleotide is CpG T1: TCG TTC GTT CGT TCG TTC GTT (SEQ ID NO: 6).
3. The immunostimulatory composition according to claim 1 or 2, wherein the saponin is one or more selected from the group consisting of quillaja saponin, ginsenoside, platycodin, astragaloside, notoginsenoside, glycyrrhizin, cortex albiziae saponin, ophiopogonin, saikosaponin or panax japonicus saponin.
4. The immunostimulatory composition according to claim 3, wherein the quillaja saponin is QS-7, QS-17, QS-18 or QS-21, preferably QS-21; the ginsenoside is ginsenoside Rg1, ginsenoside Rg3, ginsenoside Rb1 or ginsenoside Re; the platycodin is platycodin D, platycodin D2 or a mixture thereof; the astragaloside is astragalin A, astragaloside I, astragaloside II, or a mixture of two or more of these saponin monomers; the notoginsenoside is notoginsenoside R1; the ophiopogonin is ophiopogonin D; the saikosaponin is saikosaponin a, saikosaponin d or a mixture thereof; the cortex albiziae saponin is cortex albiziae total saponins; the glycyrrhizin is total glycyrrhizins; and the panax japonicus saponin is panax japonicus total saponins.
5. The immunostimulatory composition according to any one of claims 1 to 4, wherein the adjuvant comprising a saponin is Iscom adjuvant.
6. The immunostimulatory composition according to any one of claims 1 to 5, wherein the CpG oligodeoxynucleotide comprises a phosphorothioate linkage.
7. The immunostimulatory composition according to claim 5, wherein the CpG oligodeoxynucleotide is a perthio-oligodeoxynucleotide.
8. The immunostimulatory composition according to any one of claims 1 to 7, wherein the weight ratio of the CpG oligodeoxynucleotide to the saponin is 1˜40:0.1˜2, preferably 2˜40:0.1˜2, more preferably 2:1.
9. A pharmaceutical composition comprising the immunostimulatory composition of any one of claims 1 to 8, and an antigen or antigen composition.
10. The pharmaceutical composition according to claim 9, wherein the antigen or antigen composition is any one selected from the group consisting of human immunodeficiency virus, human herpes virus, varicella-zoster virus, human cytomegalovirus, hepatitis A, B, C or E virus, respiratory syncytial virus, human papilloma virus, influenza virus, Mycobacterium tuberculosis, salmonella, neisseria such as Neisseria meningitidis or Neisseria gonorrhoeae, borrelia such as borrelia recurrentis or borrelia duttonii, chlamydia such as Chlamydia trachomatis, bordetella such as Bordetella pertussis, plasmodium such as Plasmodium falciparum, plasmodium malariae, plasmodium ovale, Plasmodium vivax or Plasmodium knowlesi, or toxoplasma such as Toxoplasma gondii.
11. The pharmaceutical composition of claim 10, wherein the human herpes virus is HSV1 or HSV2.
12. The pharmaceutical composition of claim 9, wherein the antigen is a tumor antigen.
13. A vaccine comprising the immunostimulatory composition of any one of claims 1 to 8;
preferably, the vaccine is a vaccine for preventing a viral, bacterial and/or parasitic infection, or the vaccine is a vaccine for treating a viral, bacterial and/or parasitic infection with immunotherapy.
14. Use of the immunostimulatory composition of any one of claims 1 to 8 in the preparation of a medicament for eliciting a cytolytic T cell response.
15. Use of the immunostimulatory composition of any one of claims 1 to 8 in the preparation of a medicament for inducing an interferon γ response in a mammal.
16. Use of the immunostimulatory composition of any one of claims 1 to 8 in the preparation of a vaccine for preventing a viral, bacterial and/or parasitic infection.
17. Use of the immunostimulatory composition of any one of claims 1 to 8 in the preparation of a vaccine for treating a viral, bacterial and/or parasitic infection with immunotherapy.
18. Use of the immunostimulatory composition of any one of claims 1 to 8 in the preparation of a vaccine for the treating a tumor with immunotherapy.
19. A method for eliciting a cytolytic T cell response comprising administering to a subject in need thereof an effective amount of the pharmaceutical composition of any one of claims 9 to 12.
20. A method for inducing an interferon γ response in a mammal comprising administering to a subject in need thereof an effective amount of the pharmaceutical composition of any one of claims 9 to 12.
21. A method for preventing a viral, bacterial and/or parasitic infection comprising administering to a subject in need thereof a prophylactically effective amount of the vaccine of claim 13.
22. A method for treating a viral, bacterial and/or parasitic infection with immunotherapy comprising administering to a subject in need thereof a therapeutically effective amount of the vaccine of claim 13.
23. A method for treating a tumor comprising administering to a subject in need thereof a therapeutically effective amount of the pharmaceutical composition of any one of claims 9 to 12.