Patent application title:

A METHOD FOR PROVIDING A VLP DERIVED FROM JOHN CUNNINGHAM VIRUS

Publication number:

US20230157972A1

Publication date:
Application number:

17/311,480

Filed date:

2019-10-14

Abstract:

The invention relates to a method for providing a virus-like particle (VLP) derived from John Cunningham virus (JCV), relates to a VLP associated with a cargo, in particular a protein, and a drug delivery system (DDS) obtainable by said method, in particular for crossing the blood brain barrier (BBB), and a VLP containing composition. The method comprises steps of disassembly of VLP into pentamers, inducing the pentamers to aggregate and reassembly into VLP.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N2710/22022 »  CPC further

dsDNA viruses; Details; Polyomaviridae, e.g. polyoma, SV40, JC New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

A61K9/5184 »  CPC main

Medicinal preparations characterised by special physical form; Preparations in capsules, e.g. of gelatin, of chocolate; Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals; Nanocapsules; Excipients; Inactive ingredients; Compounds of unknown constitution, e.g. material from plants or animals Virus capsids or envelopes enclosing drugs

C12N2710/22023 »  CPC further

dsDNA viruses; Details; Polyomaviridae, e.g. polyoma, SV40, JC Virus like particles [VLP]

C12N2710/22051 »  CPC further

dsDNA viruses; Details; Polyomaviridae, e.g. polyoma, SV40, JC Methods of production or purification of viral material

C12N2710/22032 »  CPC further

dsDNA viruses; Details; Polyomaviridae, e.g. polyoma, SV40, JC Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent

A61K9/51 IPC

Medicinal preparations characterised by special physical form; Preparations in capsules, e.g. of gelatin, of chocolate; Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals Nanocapsules

C07K14/005 »  CPC further

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses

Description

FIELD OF THE INVENTION

The invention relates to a method for providing a virus-like particle (VLP) derived from John Cunningham virus (JCV), relates to a VLP associated with a cargo, in particular a protein, and a drug delivery system (DDS) obtainable by said method, in particular for crossing the blood brain barrier (BBB), and a VLP containing composition. The inventive method is particularly suitable for providing a VLP associated with a cargo, in particular a protein.

BACKGROUND OF THE INVENTION

The blood brain barrier (BBB) is a highly selective and permeable membrane between blood and the brain. The barrier functions to separate the circulating blood from the brain extracellular fluid (BECF) in the central nervous system (CNS). The BBB is highly selective in nature and allows, by passive diffusion, only the passage of lipid soluble molecules, water and certain gases. The barrier also selectively transports molecules, such as glucose and amino acids, which are essential for neural functions. In addition, the BBB hinders the entry of lipophilic potential neurotoxins into the brain.

Under physiological conditions the BBB functions effectively to substantially prevent unwanted material from entering the CNS. Large nano-therapeutics and the vast majority of small molecules (estimated are 98% of the small molecules) are restricted to enter into the brain because of the BBB. Under physiological (healthy) conditions, the function of the BBB is therefore invaluable. In the event of a CNS disease or any other disorder which requires the treatment of the CNS with a pharmaceutical product, however, the BBB constitutes a major hurdle to an effective treatment.

In addition to the problem of successfully transferring the pharmaceutical product (drug, cargo) across the BBB, heed has to be paid to those problems, which can be encountered during CNS delivery. Even if the pharmaceutical product crosses the BBB, it may not be present in a therapeutically relevant concentration. Moreover, certain enzymes in the brain tissue can inactivate the pharmaceutical product, rendering it ineffective or less effective. Thus, the pharmaceutical product may be able to cross the BBB, but can be deconstructed once it is inside the brain.

Several strategies are known for affecting a transport of a pharmaceutical product across the BBB. The extent to which a pharmaceutical product indeed is able to penetrate into the brain varies from one strategy to the other. One strategy is to increase the permeability of the BBB. Therewith not only the amount of the pharmaceutical product that crosses the BBB may be increased, but both the free and bound forms of the pharmaceutical product can be made to cross the barrier.

Means for increasing the permeability of the BBB include an osmotic opening or chemical opening. Osmotic opening might be possible with hypertonics, which have the capability of disrupting BBB when applied directly onto its surface. Chemical opening is a more selective and controllable approach of increasing the permeability of BBB. Normal capillaries appear to be unaffected when vasoactive leukotriene treatments are used to increase their permeability. Brain tumor capillaries are more sensitive to these treatments. Studies have revealed that bradykinin opens the brain tumor capillaries without affecting the capillaries in the normal brain.

Cerebral vasodilatation or focused ultrasound radiation represent other approaches for increasing the permeability of the BBB. Cerebral vasodilatation refers to the process of widening of blood vessels to increase cerebral blood flow. Focused ultrasound radiation, namely low frequency (e.g. 260 kHz), MRI-guided ultrasound can induce localized and reversible disruption of the barrier.

Another approach of transporting a pharmaceutical product into the CNS is the use of a drug delivery system on the basis of virus-like particles (VLP) derived from John Cunningham virus (JCV). The VLP are loaded with a drug (“cargo”). Such a drug delivery system is disclosed in WO 2013/131644 A1. It is described that, after intravenous administration, the VLP can cross the BBB without a prior manipulation thereof, therewith transporting the drug together with the VLP over a physiologically intact BBB. A method for the production of a drug delivery system comprising VLP from JCV is subject matter of WO 2013/017272 A1.

The disclosure of the WO 2013/131644 A1 provided the first experimental evidence of the crossing of a VLP from JCV over the physiological intact BBB in vivo. Hence VLP from JCV loaded with a pharmaceutical product are promising drug delivery systems for entering the CNS. However, there is still a need to further improve the efficacy of this system.

Among the drugs the VLP are loaded (associated) with, it is particularly challenging to load the VLP with a protein because VLP being composed of proteins may structurally interfere with the protein to be loaded, especially when the isoelectric point of the proteins forming the VLP is similar to the isoelectric point of the protein to be loaded. It is in particular challenging if the protein shall be incorporated into the VLP, in particular if the protein is large, such as an antibody fragment or an antibody.

Hence, there is further a need for providing VLP associated with a protein, in particular a large protein such as an antibody.

SUMMARY OF THE INVENTION

It is thus an objective of the present invention to provide a VLP derived from John Cunningham virus (JCV), in particular for the delivery of a pharmaceutical product into the CNS, which has an improved efficacy. An improved efficacy in particular means that more cargo reaches the CNS. The improved efficacy can have manifold reasons, which might interact. The higher efficacy can for example be due to a more efficacious crossing of the BBB by the VLP, so that a higher amount of VLP and/or cargo enters the CNS. It can equally be due an improved release of the cargo from the VLP after reaching the CNS. Furthermore, a reason for the higher efficacy can be the fact that each individual VLP can be loaded with a higher amount of cargo or the overall amount of loaded VLP can be increased.

It was surprisingly found by the inventors that a VLP derived from JCV with an improved efficacy can be provided, when the method for the production of said VLP comprises twice the steps of disassembling the VLP into pentamers and reassembling the pentamers into a VLP and comprising a step of aggregating the pentamers before the second step of reassembling. The method comprises the following steps

    • a) providing a composition comprising VP1 proteins of JCV,
    • b) exposing the VP1 proteins of the composition of a) to conditions inducing the VP1 to assemble into VLP,
    • c) exposing the VLP of the composition of b) to conditions disassembling the VLP into pentamers,
    • d) exposing the pentamers of the composition of c) to conditions inducing the pentamers to reassemble into VLP,
    • e) exposing the VLP of the composition of d) to conditions disassembling the VLP into pentamers,
    • f) exposing the pentamers of the composition of e) to conditions inducing the aggregation of the pentamers, and
    • g) exposing the aggregated pentamers of the composition of f) to a cargo, in particular a protein, under conditions inducing the aggregated pentamers to assemble into a VLP associated with the cargo, in particular the protein.

It has surprisingly been found that the inventive method allows loading a VLP with a cargo, in particular a protein such as an antibody, so that the cargo, in particular the protein such as an antibody, is associated with the VLP. The VLP associated with the cargo, in particular the protein such as an antibody, are homogeneous in size and have essentially the same size range as “empty” VLP (i.e. not associated with a cargo). The cargo, in particular the protein, such as an antibody, can be efficiently delivered into cells. Moreover, permeation of cargo, in particular protein, such as an antibody, across the BBB was surprisingly high when the cargo, in particular the protein, such as an antibody, was associated with a VLP.

It is particularly preferred that the aggregated pentamers in step g) are induced to assemble into a VLP incorporating the cargo, in particular the protein.

A drug delivery system obtainable by the method according to the invention is also provided. Hence, a drug delivery system comprising VLP derived from JCV can also be provided by the method steps a) to g) as of above.

In yet another aspect of the invention, the invention relates to a method for providing a VLP derived from JCV, in particular to a drug delivery system comprising a VLP derived from JCV, as described above (steps a) to g)) but without aggregation step f). Such method for providing a drug delivery system comprising a VLP derived from JCV comprises the following steps:

    • a) providing a composition comprising VP1 proteins,
    • b) exposing the VP1 proteins of the composition of a) to conditions inducing the VP1 to assemble into VLP,
    • c) exposing the VLP of the composition of b) to conditions disassembling the VLP into pentamers,
    • d) exposing the pentamers of the composition of c) to conditions inducing the pentamers to reassemble into VLP
    • e) exposing the VLP of the composition of d) to conditions disassembling the VLP into pentamers,
    • f) exposing the pentamers of the composition of e) to a cargo and conditions inducing the pentamers to assemble into a VLP associated with the cargo.

The improved efficacy of the drug delivery system obtainable by the method according to the invention is demonstrated by the increased expression of luciferase, when the cargo of the drug delivery system is the luciferase expression plasmid NanoLuc® (Example 1 below, FIG. 1, Example 1 is without aggregation step f)). Therewith, additionally, the suitability of the drug delivery system of the invention for the delivery of nucleic acids as cargo is shown.

Example 1 furthermore gives evidence that the VLP obtained in step f) efficiently cross the BBB (Example 1 below, FIGS. 2 and 3). Therewith, evidence is provided, that the VLP can be used as a drug delivery system for the transport of a drug into the CNS.

Moreover, it has been found, that the VLP obtained in step d), are particularly suitable for storage. They withhold storage conditions of −80° C. for a period of more than 24 h. After storage the VLP can be further processed for providing the drug delivery system or the VLP. Hence they represent a suitable storable intermediate product during the manufacture of a drug delivery system comprising VLP associated with a cargo or during the manufacture of a VLP associated with a cargo, in particular a protein.

In one particular aspect, thus, the invention relates to a method for providing VLP with an increased suitability for storage. Such VLP, for practical reasons, substantially facilitate the production of the drug delivery system. It allows for the large-scale manufacture of VLP and, then, their intermediate storage without cargo. After storage, on demand of the individual costumer, the stored VLP can be further processed and loaded with the desired cargo. Therefore, the intermediate storage of the VLP provided in step d) enables more flexibility in the manufacturing process of a drug delivery system on the basis of VLP.

Furthermore, it has been found that the VLP disclosed herein provided with two disassembly and reassembly steps are stable. Their stability can be equally compared with the VLP which are the result from VP1 production and a direct subsequent assembly, i.e. without a disassembly/reassembly step (FIG. 6). Therefrom it follows, that the two disassembly and reassembly steps according to the invention, surprisingly, do not have a negative impact on the stability of the VLP.

In yet another aspect, the invention relates to a drug delivery system or a composition comprising VLP.

It was further surprisingly found, that the homogeneity of the composition comprising VLP can be improved by reassembling the pentamers of step d) in two steps, whereas the first step comprises inducing the aggregation of the pentamers of step c) and the second step comprises separating the pentamers from the conditions inducing the aggregation of the pentamers (Example 3 below, FIGS. 7 and 8).

A homogeneous size distribution of the composition comprising VLP is advantageous because it allows producing a defined population of VLP for use as the drug delivery system which is important to fulfill a defined quality standard.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 Luciferase activity measured in glioblastoma cells transfected either with VLP prepared according to the invention without aggregation step f) (two rounds of disassembly and reassembly) or with VLP having been disassembled and reassembled only once (prior art)

FIGS. 2A and 2B Setup (A) of a BBB model as a monoculture and permeability (B) of VLP prepared according to the invention without aggregation step f)

FIGS. 3A and 3B Setup (A) of a BBB model as a coculture and permeability (B) of VLP prepared according to the invention without aggregation step f)

FIG. 4 TEM images of VLP according to the invention without aggregation step f) (after two rounds of disassembly/reassembly) versus VLP of the prior art (after one round of disassembly and reassembly), and with intermediate storage

FIGS. 5A-5C FFF-MALS analyses of VLP according to the invention without aggregation step f) (after two rounds of disassembly and reassembly) with intermediate storage of the VLP (A), VLP with one round of disassembly and reassembly with intermediate storage of the pentamers (B) and freshly prepared VLP (C).

FIG. 6 nDSF analyses of freshly prepared VLP and VLP according to the invention without aggregation step f) (two rounds of disassembly and reassembly) with intermediate storage

FIG. 7 DLS analyses showing the PDI of VLP according to step d) of the invention with or without inducing aggregation of pentamers before storage

FIG. 8 DLS analyses showing the average diameter of VLP according to step d) of the invention with or without inducing aggregation of pentamers before storage and after storage

FIGS. 9A and 9B nDSF analyses (A) and Luciferase activity (B) of VLP stored with different cryoadditives (VLP prepared without aggregation step f)

FIG. 10 TEM images of VLP according to the invention (with aggregation step f), associated with IgG (A) or IgM (B) antibodies

FIG. 11 DLS analyses showing the average diameter of pentamers (VLP (dissociated)) and “empty” VLP (VLP (original sample))

FIGS. 12A and 12B DLS analyses showing the average diameter of VLP according to the invention (with aggregation step f), associated with IgG (A) or IgM (B) antibodies

FIG. 13 Flow cytometry of glioblastoma cells incubated with VLP according to the invention (with aggregation step f), associated with IgG or IgM antibodies

FIGS. 14A and 14B Confocal microscopy of glioblastoma cells incubated with VLP according to the invention (with aggregation step f). A: Control with free antibody; B: Incubation with VLP associated with IgM antibody

FIG. 15 Confocal microscopy of glioblastoma cells incubated with VLP according to the invention (with aggregation step f) associated with IgM antibody shown in the x-, y- and z-axis (Z-stack)

FIG. 16 Confocal microscopy of glioblastoma cells incubated with VLP according to the invention (with aggregation step f) associated with anti-tubulin IgG antibody shown in the x-, y- and z-axis (Z-stack)

FIG. 17 Permeability of VLP according to the invention (with aggregation step f) associated with IgG or IgM antibodies across the BBB (BBB model)

DETAILED DESCRIPTION OF THE INVENTION

In a first aspect of the invention, the invention relates to a method for providing a virus-like particle (VLP) derived from John Cunningham virus (JCV) comprising the following steps:

    • a) providing a composition comprising VP1 proteins,
    • b) exposing the VP1 proteins of the composition of a) to conditions inducing the VP1 to assemble into VLP,
    • c) exposing the VLP of the composition of b) to conditions disassembling the VLP into pentamers,
    • d) exposing the pentamers of the composition of c) to conditions inducing the pentamers to reassemble into VLP
    • e) exposing the VLP of the composition of d) to conditions disassembling the VLP into pentamers,
    • f) exposing the pentamers of the composition of e) to conditions inducing the aggregation of the pentamers, and
    • g) exposing the aggregated pentamers of the composition of f) to a cargo, in particular a protein, under conditions inducing the aggregated pentamers to assemble into a VLP associated with the cargo, in particular the protein.

In yet another aspect of the invention, the invention relates to a method for providing a VLP derived from JCV, in particular to a drug delivery system comprising a VLP derived from JCV, as described above (steps a) to g)) but without aggregation step f). Such method for providing a drug delivery system comprising a VLP derived from JCV comprises the following steps:

    • a) providing a composition comprising VP1 proteins,
    • b) exposing the VP1 proteins of the composition of a) to conditions inducing the VP1 to assemble into VLP,
    • c) exposing the VLP of the composition of b) to conditions disassembling the VLP into pentamers,
    • d) exposing the pentamers of the composition of c) to conditions inducing the pentamers to reassemble into VLP
    • e) exposing the VLP of the composition of d) to conditions disassembling the VLP into pentamers,
    • f) exposing the pentamers of the composition of e) to a cargo and conditions inducing the pentamers to assemble into a VLP associated with the cargo.

In the context of the present invention, and for the ease of explanation, the VLP resulting from step b) may also be termed “pVLP” (primary VLP). The VLP resulting from step d) may also be termed “rVLP” (reassembled VLP). The VLP as the result of step g) may also be termed “cVLP” (cargoVLP).

In a second aspect of the invention, the invention relates to a composition comprising virus-like particles (VLP) derived from John Cunningham virus (JCV) characterized by one or more of the following parameters:

    • a. a polydispersity index (PDI) of less than 0.3, preferably less than 0.2, preferably less than 0.1, more preferably in a range between 0.01 and 0.09,
    • b. at least 70% of VLP with an average diameter from 20 nm to 70 nm, preferably of 30 nm to 70 nm, more preferably of 35 nm to 65 nm, more preferably of 40 to 60 nm,
    • c. a VLP content within the composition of at least 80% (v/v), preferably at least 85% (v/v), preferably at least 90% (v/v), preferably at least 95% (v/v).

In a third aspect, the invention relates to a drug delivery system obtainable by the method according to the invention. The drug delivery system can be used in a method of therapy and/or diagnosis, preferably for the treatment of neurological disorders. Hence the invention also relates to a method of treatment a disorder, in particular a CNS disease, with the drug delivery system according to the invention. The method of treatment preferably comprises the step of administering the drug delivery system to a subject in need thereof.

The drug delivery system preferably has an improved efficacy. The VLP can cross the BBB without a prior increase of the permeability of the BBB. Hence, the drug delivery system of the invention can be used in a method of treatment of a CNS disease, wherein the method does not comprise a step of increasing the permeability of the BBB of the subject to be treated. The drug delivery system of the invention, preferably, is administered to a patient who has not received any chemical or physical treatment for impairing or disrupting the BBB.

In a fourth aspect of the invention, the invention relates to a virus-like particles (VLP) derived from John Cunningham virus (JCV) obtainable by a method comprising steps a) to e) of the method of the invention and a further step of exposing the pentamers of the composition of e) to conditions inducing the pentamers to assemble into VLP. These VLP are cargo-free. They are particularly useful as a vaccine.

In a fifth aspect of the invention, a composition is provided which comprises virus-like particles (VLP) derived from John Cunningham virus (JCV) comprising a salt and a buffer and having a pH between 7.0 and 8.0, preferably around 7.5. The composition preferably comprises:

    • a. 120 mM to 170 mM NaCl, preferably 150 mM NaCl,
    • b. 1 to 5 mM CaCl2, preferably 2 mM CaCl2, and
    • c. 5 to 30 mM Tris-HCl, preferably 10 to 25 mM Tris-HCl, more preferably 10 mM Tris-HCl.

This composition allows handling the VLP under physiological conditions. Under these conditions the VLP essentially remain intact, preferably they essentially maintain their capsid structure. If loaded with cargo, they essentially remain associated with the cargo. The composition is preferably suitable as a pharmaceutical composition, wherein the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier, and/or excipient. It is especially suitable as a pharmaceutical composition for the intravenous administration of the VLP to a subject, in particular to a human.

In yet a further aspect of the invention a composition comprising VLP is provided, which has least one, preferably all, of the following characteristics (“target parameters”):

TABLE 1
Preferred characteristics of the VLP and the VLP-containing composition.
Methods for evaluation Measurement Target Parameters
Transmission Electron VLP per grid mesh >50 particles
Microscopy (TEM) Shape of particles round and enclosing
Diameter of particles 40-50 nm
Aggregates Not visible
SDS PAGE and Western VP1 band 40 kDa band is observed
Blot (WB) VP1 degradation Minor or no degradation
Dynamic Light PDI <0.2
Scattering (DLS) Single peak (volume Yes
based distribution)
Z-average diameter 40-50 nm
Other peaks (volume Not detectable
based distribution)
Bioanalyzer VP1 purity (40 kDa) >90%
Thermal Shift Assay Major melting peak (in >57° C.
(TSA) Tris-HCl-Buffer)
Minor melting peaks Not detectable
Nano Differential Major inflection peak >69° C.
Scanning Fluorometry Minor inflection peaks Not detectable
(nDSF)
Size Exclusion HPLC Aggregates <5% of total AUC
(SE-HPLC) Other impurities <5% of total AUC
Field Flow Fractionation Concentration of particles >1.0 × 1011 VLP/mL
(FFF-MALS) Size of particles 40-50 nm
Aggregates <5% of total AUC
Other impurities <5% of total AUC
AUC = area under the curve

In the context of the invention, the term “drug delivery system” refers to a composition for administering a pharmaceutical product to a subject in the need thereof, in particular to a human or animal. A drug delivery system, advantageously, enables the delivery of the pharmaceutical product contained therein or attached thereto to a site of interest, preferably in a human or animal. Preferably the delivery is selective for the target, i.e. more of the pharmaceutical product is delivered to the target than to other sites of the body or organ.

“A drug delivery system for the CNS” means that the drug delivery system selectively targets the CNS. CNS refers to the spinal cord and the brain, in particular to the brain. The term “brain” includes anatomical parts thereof, such as frontal lobe, parietal lobe, temporal lobe, occipital lobe, and cerebellum.

The VLP or the drug delivery system of the invention can be administered via various routes, including oral, dermal, nasal or pulmonary routes or injection, such as parenteral injection (i.v., s.c., i.m.). Particularly preferred are dosage forms which allow a systemic effect of the pharmaceutical product. In a specific embodiment the VLP or the drug delivery system of the invention is administered orally or parenterally, in particular intravenously.

The drug delivery system or the VLP of the present invention comprises a virus-like particle (VLP) derived from John Cunningham virus (JCV). The “JC virus” or John Cunningham virus (JCV; NCBI Taxonomy 10632) is a human polyomavirus. JCV is of an icosahedral symmetry, has a diameter of about 45 nm and consists of 72 VP1 pentamers. Small numbers of the structural proteins VP2 and VP3 are also present.

A “virus-like particle” (VLP) in the context of the present invention is defined as a replication-deficient particle with a hull (also termed capsid) composed of viral structural proteins or modified viral structural proteins or proteins derived from viral structural proteins. The VLP according to the invention is derived from JCV, i.e. its hull is composed of viral structural proteins or modified viral structural proteins or proteins derived from viral structural proteins VP1, VP2 and VP3 from JCV, in particular from VP1. In a preferred embodiment, the VLP according to the invention is composed of VP1 proteins of JC virus.

In a particularly preferred embodiment of the invention the only viral structural protein in the hull is a VP1 protein. In the most preferred embodiment the hull of the VLP consists of VP1 proteins, i.e. the hull does not contain any other protein. Optionally, the VLP comprises a VP2 and/or VP3 protein in addition to VP1 proteins.

VLP as such, i.e. not associated with a cargo, do not comprise any genetic material because they are only built up of proteins and are otherwise “empty”. In a preferred embodiment, the VLP according to the present invention do not comprise viral genetic material encoding a viral protein, in particular JC viral genetic material encoding a JC viral protein. In this embodiment, the VLP may comprise a viral regulatory element, in particular JC viral regulatory element or a viral regulatory element derived from JCV, as viral genetic material.

Viral genetic material comprises viral genetic material encoding a viral protein and viral regulatory elements as viral genetic material. Viral genetic material is derived from the nucleic acid of a virus, i.e. at least 70% identical to a viral RNA or DNA. Preferably, the VLP according to the invention do not comprise any viral genetic material.

Thus, preferably, in case the VLP according to the invention comprise RNA or DNA, the RNA or DNA is not derived from a virus, i.e. the RNA or DNA is not viral genetic material, in particular the RNA or DNA does not encode a viral protein. It is particularly preferred that the RNA or DNA does not encode a viral protein and does not comprise a viral regulatory element.

The viral structural proteins, in particular the VP1, assemble into pentameric structures (pentamers). According to the invention, the VLP hull preferably is composed of several VP1 proteins, in particular several VP1 pentamers, especially 72 VP1 pentamers.

A “pentamer” in the context of the invention is a structure which is formed when five polypeptides, for example VP1 proteins, assemble. The assembly into a pentamer may be due to the formation of covalent or non-covalent bonds between the polypeptides. The polypeptides typically form a ring-shaped structure, having pentagonal symmetry. In a pentamer, each polypeptide subunit preferably interacts with two adjacent subunits.

A “peptide” according to the present invention may be composed of any number of amino acids of any type, preferably naturally occurring amino acids, which preferably are linked by peptide bonds. In particular, a peptide comprises at least 3 amino acids, preferably at least 5, at least 7, at least 9, at least 12 or at least 15 amino acids. There is no upper limit for the length of a peptide. However, preferably a peptide according to the invention does not exceed a length of 500 amino acids, preferably 400, 300, 250, 200, 150 or 120 amino acids. A peptide exceeding about 10 amino acids may also be termed a “polypeptide”.

The structural proteins of the VLP, in particular the VP1, are identical to or derived from the native structural proteins of JCV. “Modified or derived” encompasses the insertion, deletion or substitution of one or more amino acids while retaining the function of VP1 to assemble into a capsid.

In one embodiment, the native (JCV) structural protein can be modified in order to optimize the VLP with regard to its production, its cellular targeting profile and specificity or its intracellular targeting profile or specificity. Modification or derivation can comprise a codon optimization of the nucleotide sequence encoding the structural protein, in particular the VP1, to enhance protein translation.

The terms “VP1” or “virus protein 1” according to the present invention refer to a protein which is identical to or is derived from the natural (native) VP1 of the JCV and which is capable of assembling into a capsid.

The term “VP1” according to the invention encompasses a protein which has an amino acid sequence identity with the amino acid sequence according to SEQ ID NO: 1 of at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 98% or at least 99% over this sequence. In a most preferred embodiment of the invention the VP1 has the amino acid sequence according to SEQ ID NO: 1.

The term “VP1” according to the invention also encompasses fractions of the native VP1. Preferably, said fractions of VP1 comprise at least acids 32 to 316 of the amino acid sequence according to SEQ ID NO: 1 or a derivative thereof having an identity with the amino acid sequence from amino acid position 32 to 316 of SEQ ID NO: 1 of at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 97%, more preferably at least 98% or at least 99% over this sequence.

In a preferred embodiment of the invention the VP1 has an amino acid sequence which is at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 99% identical to the amino acid sequence according to SEQ ID NO: 1 over its entire length. In a most preferred embodiment of the invention, the VP1 has an amino acid sequence which is identical to the amino acid sequence according to SEQ ID NO: 1.

In another embodiment of the invention the VP1 has an amino acid sequence which is at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 99% identical to the amino acid sequence according to SEQ ID NO: 3 over its entire length. In one embodiment, the amino acid sequence of VP1 is identical to the amino acid sequence of SEQ ID NO: 3.

In one embodiment, the nucleotide sequence of the VP1 protein is at least 70%, more preferably at least 80%, more preferably at least 90% identical to the nucleotide sequence of SEQ ID NO: 2 over its entire length, preferably is the nucleotide sequence of SEQ ID NO: 2.

In another embodiment of the invention the nucleotide sequence of the VP1 protein is at least 70%, more preferably at least 80%, more preferably at least 90% identical to the nucleotide sequence of SEQ ID NO: 4 over its entire length. In one embodiment, the nucleotide sequence of the VP1 protein is identical to the nucleotide sequence of SEQ ID NO: 4.

The sequences are depicted in Table 2.

TABLE 2
Amino acid and nucleotide sequences
of the VP1 protein.
SEQ
Protein/ ID
DNA Sequence Source NO:
Protein MAPTKRKGEPKDPVQVPKLLI derived 1
RGGVEVLEVKTGVDS1TEVEC from
FLTPEMGDPDEHLRGFSKSIS JCV
ISDTFESDSPNRDMLPCYSVA
RIPLPNLNEDLTCGNILMWEA
VTLKTEVIGVTSLMNVHSNGQ
ATHDNGAGKPVQGTSFHFFS
VGGEALELQGWFNYRTKYP
DGTIFPKNATVQSQVMNTEH
KAYLDKNKAYPVECWVPDPT
RNENTRYFGTLTGGENVPPV
LHITNTATTVLLDEFGVGPLC
KGDNLYLSAVDVCGMFTNRSG
SQQWRGLSRYFKVQLRKRRV
KNPYPISFLLTDLINRRTPR
VDGQPMYGMDAQVEEVRVFE
GTEELPGDPDMMRYVDKYG
QLQTKML
DNA ATGGCTCCCACCAAGCGCA derived 2
AGGGCGAGCCCAAGGACCC from
CGTGCAAGTGCCCAAGCTG JCV
CTGATCCGTGGTGGTGTCG
AGGTGCTGGAAGTCAAGAC
CGGCGTGGACTCCATTACC
GAGGTGGAGTGCTTCCTCA
CCCCCGAGATGGGTGACCC
TGACGAGCACCTGAGGGGC
TTCTCCAAGTCCATCTCCAT
CTCCGACACCTTCGAGTCC
GACTCCCCCAACCGTGACAT
GCTGCCCTGCTACTCCGTG
GCTCGTATCCCCCTGCCCAA
CCTGAACGAGGACCTGACTT
GCGGCAACATCCTGATGTG
GGAGGCTGTGACCCTCAAG
ACCGAGGTCATCGGCGTGA
CTTCCCTGATGAACGTGCAC
TCCAACGGCCAGGCTACCC
ACGACAACGGTGCTGGCAA
GCCCGTGCAGGGAACCTCC
TTCCACTTCTTCTCCGTGGG
TGGCGAGGCTCTGGAACTC
CAGGGCGTGGTGTTCAACT
ACCGTACCAAGTACCCCGA
CGGCACCATCTTCCCCAAGA
ACGCTACTGTGCAGTCCCAA
GTGATGAACACCGAGCACA
AGGCTTACCTGGACAAGAAC
AAGGCCTACCCCGTGGAGT
GCTGGGTGCCCGACCCCAC
CCGTAACGAGAACACCCGTT
ACTTCGGCACCCTGACCGG
TGGAGAGAACGTGCCCCCC
GTGCTGCACATCACCAACAC
CGCTACCACCGTGCTGCTG
GACGAGTTCGGTGTCGGTC
CCCTGTGCAAGGGCGACAA
CCTGTACCTGTCCGCTGTG
GACGTGTGCGGCATGTTCA
CCAACCGTTCCGGTTCCCA
GCAGTGGCGTGGCCTGTCC
CGCTACTTCAAGGTGCAGCT
GCGCAAGCGTCGTGTGAAG
AACCCCTACCCTATCTCCTT
CCTGCTGACCGACCTGATCA
ACCGTCGTACCCCTCGTGT
GGACGGCCAGCCCATGTAC
GGCATGGACGCTCAGGTGG
AAGAGGTCCGCGTGTTCGA
GGGCACCGAGGAATTGCCC
GGCGACCCCGACATGATGC
GTTACGTGGACAAGTACGG
CCAGCTCCAGACCAAGATG
CTGTAA
Protein MAPTKRKGERKDPVQVPKLLI wildtype 3
RGGVEVLEVKTGVDSITEVEC JCV
FLTPEMGDPDEHLRGFSKSIS (AFH57194.1)
ISDTFESDSPSKDMLPCYSVA
RIPLPNLNEDLTCGNILMWEA
VTLKTEVIGVTSLMNVHSNGQ
AAHDNGAGKPVQGTSFHFFS
VGGEALELQGWFNYRTKYP
DGTIFPKNATVQSQVMNTEH
KAYLDKNKAYPVECWVPDPT
RNENTRYFGTLTGGENVPPV
LHITNTATTVLLDEFGVGPL
CKGDNLYLSAVDVCGMFTNR
SGSQQWRGLSRYFKVQLRKR
RVKNPYPISFLLTDLINRRT
PRVDGQPMYGMDAQVEEVRV
FEGTEELPGDPDMMRYVDRY
GQLQTKML
DNA ATGGCCCCAACAAAAAGAAA wildtype JCV 4
AGGAGAAAGGAAGGACCCC (J02226)
GTGCAAGTTCCAAAACTTCT
TATAAGAGGAGGAGTAGAA
GTTCTAGAAGTTAAAACTGG
GGTTGACTCAATTACAGAGG
TAGAATGCTTTTTAACTCCA
GAAATGGGTGACCCAGATG
AGCATCTTAGGGGTTTTAGT
AAGTCAATATCTATATCAGAT
ACATTTGAAAGTGACTCCCC
AAATAGGGACATGCTTCCTT
GTTACAGTGTGGCCAGAATT
CCACTACCCAATCTAAATGA
GGATCTAACCTGTGGAAATA
TACTCATGTGGGAGGCTGT
GACCTTAAAAACTGAGGTTA
TAGGGGTGACAAGTTTGATG
AATGTGCACTCTAATGGGCA
AGCAACTCATGACAATGGTG
CAGGGAAGCCAGTGCAGGG
CACCAGCTTTCATTTTTTTTC
TGTTGGGGGGGAGGCTTTA
GAATTACAGGGGGTGCTTTT
TAATTACAGAACAAAGTACC
CAGATGGAACAAITTTTCCA
AAGAATGCCACAGTGCAATC
TCAAGTCATGAACACAGAGC
ACAAGGCGTACCTAGATAAG
AACAAAGCATATCCTGTTGA
ATGTTGGGTTCCTGATCCCA
CCAGAAATGAAAACACAAGA
TATTTTGGGACACTAACAGG
AGGAGAAAATGTTCCTCCAG
TTCTTCATATAACAAACACTG
CCACAACAGTGTTGCTTGAT
GAATTTGGTGTTGGGCCACT
TTGCAAAGGTGACAACTTAT
ACTTGTCAGCTGTTGATGTC
TGTGGCATGTTTACAAACAG
GTCTGGTTCCCAGCAGTGG
AGAGGACTCTCCAGATATTT
TAAGGTGCAGCTAAGGAAAA
GGAGGGTTAAAAACCCCTAC
CCAATTTCTTTCCTTCTTACT
GATTTAATTAACAGAAGGAC
TCCTAGAGTTGATGGGCAG
CCTATGTATGGCATGGATGC
TCAAGTAGAGGAGGTTAGA
GITTTTGAGGGAACAGAGGA
GCTTCCAGGGGACCCAGAC
ATGATGAGATACGTTGACAA
ATATGGACAGTTGCAGACAA
AAATGCTGTAA

In a preferred embodiment of the invention, the VP1 has an amino acid sequence which is at least 90% identical to the amino acid sequence according to SEQ ID NO: 1 over its entire length.

In a preferred embodiment of the invention, the nucleotide sequence of the VP1 protein is at least 80% identical to the nucleotide sequence of SEQ ID NO: 2 over its entire length.

The structural proteins of JCV, preferably VP1, can be expressed in, for example, E. coli or in insect cells. According to a preferred embodiment of the invention, the structural proteins, preferably VP1, are expressed in insect cells. This is advantageous because the expression in insect cells leads to fewer modifications, such as post-translational modifications, compared with the wildtype protein from JCV than the expression in E. coli.

The VLP according to the invention can furthermore comprise in the capsid one or several additional heterologous proteins, i.e. proteins which are not identical to or derived from a JCV protein. For example, a heterologous protein can be anchored in the capsid, i.e. at least part of this protein being preferably accessible from the outside. In principle any protein is suitable as such a heterologous protein as long as the heterologous protein can be incorporated into the capsid and does not interfere substantially with the assembly of the VLP.

The VLP according to invention is associated with a cargo, in particular with a protein. This means that the cargo, in particular the protein, is reversibly bound to the VLP. This can e.g. either be due to a physicochemical interaction with or attachment to any part of the capsid or by incorporation of the cargo, in particular the protein, into the capsid.

In a preferred embodiment, the VLP incorporates the cargo, in particular the protein. The incorporation can be complete or incomplete. In a particular preferred embodiment of the invention the major part of the total amount of the cargo is fully incorporated into the capsid. Most preferred is that the cargo is fully encapsulated in the capsid of the VLP.

In yet another aspect, the VLP used in the drug delivery system according to the invention is associated with a cargo. This means that the cargo is reversibly bound to the VLP. This can e.g. either be due to a physicochemical interaction with or attachment to any part of the capsid or by incorporation of the cargo into the capsid. In a preferred embodiment, the VLP incorporates the cargo. The incorporation can be complete or incomplete. In a particular preferred embodiment of the invention the major part of the total amount of the cargo is fully incorporated into the capsid. Most preferred is that the cargo is fully encapsulated in the capsid of the VLP.

In the context of the invention, the expression that the “VLP comprises the cargo” is used synonymously with the expression that the VLP is “associated with the cargo”. The association of the VLP and the cargo can be the result of “loading” or “packing” the VLP with the cargo.

“Loading” means any process which leads to the association of VLP and cargo, e.g. by osmotic shock or by assembly of VP1 or VP1 pentamers into VLP together with the cargo. “Loaded VLP” are the VLP resulting from this process. The term “packing” relates to the process of loading the VLP via assembly of VP1 or VP1 pentamers into VLP together with the cargo. The VLP resulting therefrom are termed “packed” VLP.

The term “cargo” is used, in the context of the present invention, for any pharmaceutical product which is associated with the VLP. The term pharmaceutical product is used in the context of the present invention interchangeably with the term “drug”.

The pharmaceutical product is a therapeutic or diagnostic substance. In can be of any chemical nature as long as it associates with the VLP. Preferably the pharmaceutical product is an active pharmaceutical ingredient (API), in particular a “small molecule” (preferably an organic compound of ≤1000 Daltons), a biological or a cytostatics. In a preferred embodiment the biological is selected from the group consisting of a protein, a peptide or a nucleic acid, in particular selected from the group consisting of nucleic acids encoding a desired protein such as mRNA, cDNA, a plasmid or vector, inhibitory nucleic acids such as siRNA or miRNA and nucleic acids having catalytic activity such as a ribozyme. Preferably, the cargo is a protein. In a particularly preferred embodiment, the protein is an antibody, antibody fragment, preferably a nanobody, derivative of the antibody or the antibody fragment, or an antibody-drug conjugate (ADC).

In a preferred embodiment, the antibody is an IgG antibody, an IgM antibody, an IgA antibody, an IgD antibody or an IgE antibody. Particularly preferred is an IgG antibody or an IgM antibody. In one embodiment, the antibody is a llama (camelid) immunoglobulin.

The antibody fragment may be naturally occurring or artificially produced. The antibody fragment is preferably selected from the group comprising a heavy-chain antibody, an antigen-binding fragment (Fab), a single chain variable fragment (scFv), and a nanobody. A nanobody is preferred.

A nanobody or single-domain antibody (sdAb) preferably is an antibody fragment consisting of a single monomeric variable antibody domain. Like a whole antibody, it is able to selectively bind to a specific antigen. Nanobodies have a molecular weight of about 10 to 40 kDa, preferably about 10 to 20 kDa. The nanobody may also be an intrabody which preferably means that the nanobody is expressed within a cell, for example within a target cell or within a prokaryote or other non-target cell.

Preferably, the cargo, in particular the protein, has a molecular weight of about 10 kDa to about 4000 kDa. If the cargo an antibody, antibody fragment, derivative of the antibody or the antibody fragment, or an antibody-drug conjugate (ADC), the cargo preferably has a molecular weight of about 10 kDa to about 1500 kDa.

In one embodiment, the cargo, in particular the protein, is a protein complex. A protein complex may be made up of more than one of the same or of different proteins.

In a further embodiment, the VLP according to the invention is loaded with a cargo which is selected from the group consisting of monoclonal antibodies, antipsychotic drugs, analgesic drugs, thrombolytics, antidepressants, immunemodulators, immunosuppressants, acetylcholinesterase inhibitors, glutamate receptor antagonists or modulators, such as NMDA receptor antagonists, psychostimulants, anti-dementia drugs, anxiolytic drugs, nootropic drugs, metabolic enhancers, metabolic modulators, neuroprotective drugs, anticonsulvants, cytostatics, and cytokines.

In a particularly preferred embodiment the cargo is a nucleic acid, in particular a nucleic acid which is suitable for RNA interference (RNAi) or gene therapy, an antibody, a cytostatic or a cytokine, more preferably the cargo is a nucleic acid such as a plasmid or an antibody. In a most preferred embodiment the cargo is a nucleic acid such as a plasmid.

Preferably, the cargo is a plasmid or an antibody or a plasmid encoding an antibody or a combination thereof.

In one embodiment, the nucleic acid, preferably the plasmid, comprises a gene. In case the cargo comprises a gene, its expression in the CNS target cell preferably is transient. Hence, according to a most preferred embodiment of the invention the drug delivery system comprising a VLP associated with a plasmid comprising a gene, whereas the treatment of the CNS disease is effected by the transient expression of said gene in the target cell of the subject to be treated.

The cargo, in particular the protein, in particular the antibody is not limited with respect to its specificity. For example, the cargo, in particular the protein, in particular the antibody, is not limited with respect to places and modes of action. In one embodiment, the VLP according to the invention target the CNS and the associated cargo, in particular the protein, in particular the antibody, has its place of action in the CNS.

According to the invention the expression “exposing” something (e.g. the VP1, pentamers, the VLP) to conditions for affecting something (e.g. inducing the assembly) refers to bringing the material under consideration (e.g. the VP1, the pentamers, the VLP) to conditions which can cause this certain effect (e.g. inducing the assembly). Such exposure may be performed by changing the conditions for the material, e.g. by bringing the material into contact with a different buffer, salt or pH etc. This is possible either by adding something to the composition comprising the material or vice versa or by separating the material from the composition and then adding the material to a different composition.

A change of conditions can also be achieved by varying temperature, radiation etc. Naturally, such means for a change of conditions can be combined and/or repeated. Other suitable conditions that induce the desired effect, such as the assembly of the VP1 or pentamers to VLP and/or inducing aggregation of the VLP, are also well known to the skilled person. The same applies to a suitable duration of the exposure to the respective conditions; this can be found out by ordinary means of the skilled person.

The expression “exposing something to conditions for affecting something” does not require the effect to be completed, i.e. not all of the material has to accomplish the effect under consideration. For example, “conditions inducing the pentamers to aggregate” essentially means that the conditions are suitable to induce aggregation. It does not require that indeed all pentamers aggregate.

As used herein, the term “assembly” or “assemble into VLP” means that the structures under consideration (either the VP1 proteins or the pentamers) associate and establish the capsid of the VLP. If the VP1 are used as the starting material the assembly into VLP may include the prior formation of pentamers, meaning that the VP1 proteins may first form pentamers and then form VLP or they may directly assemble into a VLP. The assembly to VLP is reversible.

The term “disassembly”, in turn, refers to a process, when the capsid of the VLP at least partially disintegrates into pentameric structures and/or the structural proteins. The disassembly may be induced by increasing the temperature, by adding proteases and/or by decreasing intermolecular interactions used to form the VLP such as intermolecular disulfide bridges (e.g. by adding reducing agents or adding chelating agents). Such conditions may also include stepwise exposure to a condition. For instance, the composition may be contacted with a reducing agent before the temperature is increased.

The reducing agent is preferably selected from the group consisting of 2-mercaptoethanol, Tris-2-carboxyethylphosphine hydrochloride (TCEP), hydrogen peroxide (H2O2), Dithiothreitol (DTT), thiosulfate and formic acid, more preferably selected from the group consisting of 2-mercaptoethanol, TCEP and DTT. Most preferably, the reducing agent is DTT.

Thus, in a preferred embodiment, in step c) and/or in step e) of the inventive method the VLP are exposed to a reducing agent, preferably selected from the group consisting of 2-mercaptoethanol, TCEP, H2O2, DTT, thiosulfate and formic acid, more preferably selected from the group consisting of 2-mercaptoethanol, TCEP and DTT, most preferably DTT.

Methods of inducing the VP1 and/or pentamers to assemble into VLP are generally known to the skilled person (Goldmann et al. (J. Virol. 1999; 73(5): 4465-69); DE 195 43 553 A1). The same applies to the disassembly of VLP into pentamers. The skilled person, hence, is aware of methods for the control of the assembly and disassembly of VLP.

In one embodiment of the invention the concentration of Ca2+ ions in the composition containing the VP1 or pentamers is used for the control of the assembly/disassembly of the VLP. For example, in order to induce the assembly, the concentration of free Ca2+ ions can be increased. If the disassembly is desired, the concentration of free Ca2+ ions can be lowered by adding a chelating agent to the composition.

A further option for inducing the assembly is to increase the concentration of VP1 pentamers in order to facilitate the assembly into VLP, for example by reducing the solvent in the composition comprising the pentamers. This might require an adaption of the concentration of alkaline earth metals, such as Ca2+ or Mg2+.

Accordingly to a preferred embodiment of the invention, disassembly can be induced be exposing the VLP to conditions under which intermolecular disulfide bridges are reduced, for example by exposing the VLP to reducing conditions. In a preferred embodiment this step is accomplished in the additional presence of a chelating agent. More preferred, the disassembly is induced by exposing the VLP to reducing conditions in the presence of a chelating agent and optionally at an increased temperature.

In a particular embodiment of the invention, the VLP are exposed to a composition comprising DTT and EDTA and/or EGTA, preferably at a temperature of 15° C. to 30° C., preferably 20° C. to 25° C., most preferably at a temperature of about 23° C.

According to the invention in step f) (aggregation step), the pentamers of the composition of e) are exposed to conditions inducing the aggregation of the pentamers.

According to a preferred embodiment of the invention, the pentamers of the composition of c) are also exposed to conditions inducing the aggregation thereof. This step is most suitable if performed before step d).

In a preferred embodiment, at least 20% of the material (e.g. the pentamers of the composition of e) and preferably the also the pentamers of the composition of c)) aggregates, preferably at least 30%, more preferably at least 40%.

It has surprisingly been found that the method according to the invention enables the formation of VLP associated with a protein, such as an antibody. Specifically, an antibody such as an IgG antibody or even an IgM antibody can be associated with a VLP and the resulting VLP are intact (FIG. 10). The VLP also surprisingly show a homogeneous size distribution (FIGS. 12A and 12B). Antibody associated with the VLP are efficiently delivered to and/or into cells (FIGS. 13 to 16). Moreover, the permeation of the antibody associated with a VLP according to the invention across the BBB was higher when the VLP were associated with an antibody compared with free antibody (without VLP) (FIG. 17).

It has surprisingly been found that the step of exposing the pentamers of the composition of c) to conditions inducing the aggregation thereof can lead to a more homogeneous size distribution of the VLP (FIG. 7 and FIG. 8).

A homogeneous size distribution allows for a better quality management and standardization, which is of utmost importance if the VLP are used in a drug delivery system. Accordingly, this additional procedure preferably is part of the quality control requirements of a drug delivery system.

Permeation across the BBB allows using the VLP associated with a drug, for example an antibody, to be used as an efficient drug delivery system for the transport of a drug, for example an antibody, into the CNS.

The term “aggregate” means any particulate structure. “Aggregation” means a process leading to aggregates. This process is reversible.

The aggregation of the pentamers or VLP can be determined by an increased average particle size of the VLP in the composition compared to the control. The larger particle size may be determined by standard methods, such as dynamic light scattering (DLS).

According to a particular embodiment of the invention, the aggregation of the pentamers or VP1 can be induced by one or more agents which are known in the art to facilitate precipitation of proteins (precipitation agent). Most preferred, according to the invention, thus is the use of a precipitation agent.

A “precipitation agent” refers to an agent that promotes aggregation of VP1 or pentamers. The concept of precipitation agents generally is known to the person skilled on the art. Precipitation agents are typically used to facilitate the concentration and purification of proteins. Precipitation can be the result of altering the solvation potential of the solvent, more specifically, by lowering the solubility of the protein. The solubility may also be decreased by adjusting the pH of the composition to the isoelectric point of a protein. Furthermore, lowering the temperature of the composition can also decrease the solubility of a protein.

Possible precipitation agents are e.g. polyethylene glycol (PEG), or alcohol, for example ethanol, and salts. The later are known to the skilled person as “agents for salting out”.

Preferably, according to the invention, the precipitation agent is a salt. Most preferred are salts comprising ions known as the “Hofmeister series”. The Hofmeister series describes the ordering of ions with respect to their hydrophobic effect on a specific protein in terms of their ability to affect the solubility of said protein in solution. Ions exerting a hydrophobic effect on a protein are especially preferred. Herein, such ions are referred to as kosmotropic ions.

A precipitation agent comprising at least one kosmotropic anion or cation is preferred. Preferred anions are selected from the group consisting of citrate (C6H5O73), phosphate (PO43−), sulfate (SO42−), hydrogen phosphate (HPO42), dihydrogen phosphate (H2PO4—), iodate (IO3), hydroxide (OH), fluoride (F), bromate (BrO3) or acetate (CH3COO) or combinations thereof, the more preferred anions are citrate, phosphate or sulfate, the most preferred anion is sulfate.

Preferred cations are ammonium or quaternary ammonium compounds (NR4+ with R being an alkyl or an aryl group), such as tetramethylammonium ((CH3)4N+) or dimethylammonium ((CH3)2N2+). Further preferred cations are selected from the list comprising potassium (K+), caesium (Cs+), rubidium (Rb+) or lithium (Li+) or combinations thereof, particularly preferred are quaternary ammonium compound or ammonium, most preferred is ammonium.

Therefore, the salt preferably comprises an anion and a cation selected from the group consisting of citrate (C6H5O73−), phosphate (PO43−), sulfate (SO42−), hydrogen phosphate (HPO42−), dihydrogen phosphate (H2PO4−), iodate (IO3), hydroxide (OH), fluoride (F), bromate (BrO3) or acetate (CH3COO), quaternary ammonium compounds (NR4+) with R being an alkyl or an aryl group, preferably tetramethylammonium ((CH3)4N+) or dimethylammonium ((CH3)2N2+), ammonium (NH4+), potassium (K+), caesium (Cs+), rubidium (Rb+) or lithium (Li+), preferably comprising SO42− and/or NH4+ or combinations thereof.

According to a preferred embodiment the salt is selected from the group consisting of (NH4)2SO4, K2SO4, Na2SO4, (NH4)2HPO4, K2HPO4 and Na2HPO4. The most preferred salt is ammonium sulfate ((NH4)2SO4).

According to the invention, the aggregation of the pentamers can be induced by any means for bringing the pentamers into contact with the precipitation agent, for example by adding the precipitation agent to the composition comprising the pentamers or vice versa, namely adding the composition comprising the pentamers to a precipitation agent. Also other means, such as a dialysis so that the precipitation agent reaches the pentamers by diffusion or cross-flow filtration, are possible. It is also possible to filter or centrifuge the composition comprising the pentamers and resuspend the filtered or pelleted pentamers in a composition comprising the precipitation agent. Dialysis or cross-flow filtration are preferred.

According to one preferred embodiment of the present invention, the aggregation of the pentamers is induced by a dialysis against a composition comprising the precipitation agent, for example a composition comprising ammonium sulfate.

By bringing the pentamers into contact with the precipitation agent in step f) and optionally before step d), aggregation is preferably induced. At the same time, the concentration of reducing agent (if such reducing agent has been used in step c) and/or e), can be reduced. In a preferred embodiment, the concentration of reducing agent, in particular DTT, is reduced, preferably the reducing agent, in particular DTT, is completely removed. It is particularly preferred that the reducing agent, in particular DTT, is completely removed before step g).

According to a particularly preferred embodiment of the invention, the composition containing the pentamers for aggregation, has an ammonium sulfate concentration between 0.3 to 5 M, preferably up to 4 M, even more preferred is a concentration between 1.8 and 2.2 M. Most preferred is around 2 M.

The step of inducing aggregation of the pentamers preferably has a duration of at least 1 hour, more preferred of at least 5 hours, even more preferred of at least 12 hours, most preferred of at least 16 hours. It is preferred that the step has a duration is less than 24 hours. In a preferred embodiment the duration of this step is between 14 and 19 hours. In a most preferred embodiment the duration of this step is between 16 and 18 hours. During this time the pentamers are exposed to conditions for inducing aggregation, in particular they are in contact with ammonium sulfate. Particularly preferred is that the pentamers are exposed to conditions inducing aggregation, preferably by dialysis, for 4 to 24 hours.

After the step of inducing the aggregation of the pentamers, it is advantageous to include into the process of the invention a step of separating the pentamers from the conditions which had been uses for inducing the aggregation. The methods applicable for such a step are not particularly limited; any method known to the skilled person, which allows for the separation of the pentamers from the aggregation inducing conditions is applicable.

In a preferred embodiment of the invention the pentamers are separated from the conditions inducing their aggregation by dialysis. Dialysis can be used if the aggregation of the pentamers is induced by using a precipitation agent. The principle of dialysis can also favorably be applied in order to bring the pentamers into contact with a precipitation agent. Most preferred is, if the method according to the invention includes at least four steps of dialysis: a first dialysis of the composition of step c) and of the composition of step e) against a composition comprising a precipitation agent, and a second dialysis after the induction of aggregation against a composition which is essentially free of the precipitation agent.

The dialysis for separating the pentamers from the precipitation agent preferably is against a composition which is at least similar to physiological conditions. Such a composition preferably comprises a salt and has a pH of 6 to 8.5, preferably of 6.5 to 8.5, more preferably of 7 to 8, most preferably of 7.2 to 7.5, in particular 7.5. The osmolarity of the composition is preferably between 280 and 310 mosmol/l, most preferably 308 mosmol/l. The composition may for example have a saline (sodium chloride) concentration of 0.8 to 0.92% (w/v), preferably of 0.9% (w/v). Separating the pentamers from the conditions which had been used for inducing the aggregation is preferably performed for at least 1 hour, more preferred for at least 5 hours, 12 hours, more preferably for at least 18 hours, more preferably for about 24 hours or longer. Longer time periods are also possible inter alia depending on the concentration of the pentamers which had been induced to aggregate, the composition comprising the pentamers and the nature and concentration of the precipitation agent. In a preferred embodiment, the composition comprising the aggregated pentamers is dialyzed against a composition similar to physiological conditions for about 24 hours.

The compositions according to the invention preferably further contain a buffer. Suitable buffering systems are known to the skilled person. In a preferred embodiment of the invention the composition includes a TRIS buffer, HEPES buffer, a phosphate buffer or a bicarbonate buffer system. Most preferred is a TRIS buffer.

In a most preferred embodiment the composition comprises 10 mM Tris-HCl and 150 mM NaCl and has a pH of 7.5.

In order to facilitate assembly of the pentamers into VLP, the composition may further comprise divalent ions, such as Ca2+, Mg2+, Ba2+, Cu2+, Fe2+, Zn2+ or combinations thereof. Most preferred is Ca2+, for example CaCl2. In a preferred embodiment, the composition comprises 1 to 3 mM CaCl2, preferably 2 mM CaCl2.

In a very preferred embodiment of the invention, the composition which is at least similar to physiological conditions comprises 10 mM Tris-HCl, 150 mM NaCl and 2 mM CaCl2) and has a pH of 7.5.

In step g) the mass ratio of VLP to cargo, in particular protein, in particular antibody, is preferably 20 to 1. For further cargo, in particular proteins, with different structure and size (preferably up to 4000 kDa) the mass ratio can vary and depend from the structure and folding of the cargo, in particular the protein or protein complex. In general, cargo with a diameter of about 36 nm can be packed into the VLP lumen. Association of cargo may allow for larger amounts if needed because the cargo does not need to be fully incorporated into the VLP lumen.

In yet another aspect of the invention it has surprisingly been found that the storage of VLP (rVLP) is advantageous compared with the storage of pentamers (FIG. 4 and FIG. 5). If pentamers are stored and subsequently thawed and reassembled, predominantly “tiny” particles form as well as aggregates. These VLP are not suitable for the production of a drug delivery system. VLP, however, that have been dissociated and reassembled after storage form a particularly homogeneous population of adequately sized VLP. Thus, in one embodiment of the invention a composition is provided with particles having an average diameter from 20 nm to 70 nm, preferably of 30 nm to 70 nm, more preferably of 35 nm to 65 nm, more preferably of 40 to 60 nm. A homogeneous size distribution is important in order to fulfil quality control requirements.

In a preferred embodiment, the method according to the invention comprises a step of storing the VLP from the composition of step d). Storing the VLP at a temperature of about −80° C. to about 4° C. is possible for a duration of at least 10 h, 15 h, 20 h, preferably for at least 24 h. A storage of even more than 3 days is possible.

In a preferred embodiment the VLP are stored at a temperature below 0° C. (freezing). Freezing may be performed using different cooling rates. For example “slow” freezing may occur by applying a cooling rate of about −1° C. per minute, while fast freezing may be performed by contacting the sample, i.e. the container which comprises the composition, with liquid nitrogen or by placing the sample in a freezer at −80° C.

In a preferred embodiment, storing takes place in a composition comprising a cryoadditive, preferably selected from the group comprising polyols, sugars, inorganic salts, organic salts, amino acids, polymers, extremolytes or derivatives or combinations thereof.

In a preferred embodiment, the inorganic salt comprises a sulfate anion. Preferred salts comprising a sulfate anion are potassium sulfate, sodium sulfate, sodium thiosulfate, magnesium sulfate and ammonium sulfate. Preferably, the inorganic salt is ammonium sulfate.

The amino acid preferably is glycine, glutamine, proline or alanine. A preferred amino acid derivative is betain. Further possible cryoadditives are glycerol, sucrose, DMSO, ectoin or hydroxyectoin.

It has been found that the addition of cryoadditives, in particular the addition of an inorganic salt (such as a salt comprising a sulfate anion, in particular ammonium sulfate) and/or an amino acid derivative (such as betain), is advantageous with respect to the stability and the functionality or efficacy of the VLP (FIG. 9). As stated supra, an enhanced stability and/or functionality or efficacy is particularly desired when using VLP as a drug delivery system. It was surprising that the addition of cryoadditives to the composition of step d) has an impact on the packed VLP of step f) in terms of stability and functionality or efficacy.

A cryoadditives serves the purpose of protecting biological tissue from freezing damage (i.e. due to ice formation). The cryoadditives usually operate by increasing the solute concentration in cells. However, in order to be suitable for biological use they must easily penetrate and must not be toxic to cells. Such additives are thus suitable to provide milder storing conditions for the pentamers and/or VLP. Cryoadditives can be supplemented to a composition comprising pentamers and/or VLP to be frozen for storage.

According to a particular preferred embodiment of the present invention, the cryoadditive is added to the composition comprising VLP for subsequent freezing after the VLP, preferably rVLP, were assembled using two dialysis steps (two-step reassembly).

Suitable molar concentrations of cryoadditives except for the polyol-based cryoadditives may be 0.5 M, 0.6 M, 0.7 M, 0.8 M, 0.9 M, 1 M, 1.1 M, 1.2, 1.3 M, 1.4 M, 1.5 M, 2 M, 3 M, 4 M, 5 M. Preferentially, these cryoadditives are used at a molar concentration of about 1 M, preferably at a molar concentration of 1 M.

The polyol-based cryoadditive may be used at molar concentrations of at least 0.3 M, at least 0.4 M, at least 0.5 M, at least 0.6 M, at least 0.7 M, at least 0.8 M, at least 0.9 M, at least 1 M, at least 2 M or at least 3 M. Preferably, the polyol-based cryoadditives, preferably glycerol 5%, may be used at a concentration of about 0.6 M to 0.7 M, more preferably at a concentration of 0.68 M.

Alternatively, the polyol-based cryoadditive may be added based on volume percent of the composition comprising pentamers and/or VLP. Suitable volume percent include 3% (v/v), 4% (v/v), 5% (v/v), 6% (v/v), 7% (v/v), 8% (v/v), 9% (v/v) or 10% (v/v). Preferentially, the polyol-based cryoadditive is added at 5% (v/v).

In a preferred embodiment of the invention, the VLP of step b), the pentamers of step c), the VLP of step d) and/or the VLP of step g) are subject to purification. The term “purification” in the context of the present invention refers to isolating or separating the VP1, pentamers or VLP from a complex composition. In particular, this step can be used to separate the VLP in step g) from non-associated cargo, in particular non-associated protein, preferably non-associated antibody. Possible methods include precipitation, preferably centrifugation, filtration, such as ultrafiltration and/or cross flow filtration, preferably cross flow filtration, chromatography, for example a preparative chromatography, preferably size exclusion chromatography or affinity chromatography, and/or dynamic light scattering (DLS). In particular, the VLP can be selected with DLS. Vivaspin® is an exemplary filtration unit which can be used.

Preferably, the VLP in step g) are separated from non-associated cargo, in particular non-associated protein, preferably non-associated antibody, by filtration.

The term “chromatography” refers to a method which permits the separation of a mixture of substances by distributing the individual components thereof between a stationary phase and a mobile phase. In particular, chromatography refers to a method of purifying a substance by first binding and enriching the substance of interest to the stationary phase before eluting it in a second step (bind-and-elute mode of chromatography) or by binding impurities to the stationary phase and increasing the purity of the molecule of interest in the flow-through (flow-through mode).

Chromatography can be grouped according to the basis of the interaction of the analyte comprised in the mobile phase with the stationary phase. Preferred types of chromatography according to the invention encompass “reversed phase” chromatography, “ion-exchange” chromatography, “affinity” chromatography, or size exclusion chromatography (SEC). Among ion-exchange chromatography, the purification method can be further separated based on the charge present in the stationary phase into cation-exchange chromatography (CEX), in which the stationary phase has a negative charge, thus retaining positively charged molecules, and anion exchange chromatography (AEX), in which the stationary phase has a positive charge, thus retaining negatively charged molecules.

In particular, chromatography may be used to purify rVLP obtained by the method according to the present invention as an intermediate product. In particular AEX may be used to purify rVLP.

The stationary phase used in AEX can be further described based on the strength of the ionic interaction provided by the exchanging material present in the stationary phase into “strong anion exchangers” and “weak anion exchangers”. The expressions “anion exchanger” or “anion exchange matrix” are synonymous and both refer to natural or artificial substances which can bind anions and can exchange these for anions from a surrounding medium. An anion exchanger carries positive ions and exchanges negatively charged counterions.

The VLP of the invention may be further treated with a nuclease and/or be subjected to sterile filtration. A nuclease treatment is preferably done if a nucleic acid is used as cargo. Different nucleases are known to the skilled person and include for example benzonase. Methods for sterile filtration include, inter alia diafiltration or ultracentrifugation using filters suitable for the removal of impurities.

In yet another aspect of the invention, a VLP associated with a cargo, in particular a protein, obtainable by the method according to the invention is provided. Preferably, the VLP incorporates the cargo, in particular the protein. In a preferred embodiment, the protein is an antibody, antibody fragment, preferably a nanobody, derivative of the antibody or the antibody fragment, or an antibody-drug conjugate (ADC).

In a preferred embodiment, the antibody is an IgG antibody, an IgM antibody, an IgA antibody, an IgD antibody or an IgE antibody. Particularly preferred is an IgG antibody or an IgM antibody. In one embodiment, the antibody is a llama (camelid) immunoglobulin.

The antibody fragment may be naturally occurring or artificially produced. The antibody fragment is preferably selected from the group comprising a heavy-chain antibody, an antigen-binding fragment (Fab), a single chain variable fragment (scFv), and a nanobody. A nanobody is preferred.

It was particularly surprising that a VLP incorporating an antibody can be obtained by the method according to the invention because a VLP is also composed of proteins so that structural interferences between the VLP and the protein, in particular the antibody, to be incorporated or associated with occur, especially when the isoelectric point of the different proteins is similar.

The VLP obtainable according to the invention are particularly advantageous because they are homogeneous, i.e. more uniform in size, highly pure and show increased cargo delivery capability through a BBB model. The VLP are also more stable after freezing. The cargo, in particular the protein, such as an antibody, can be efficiently delivered into cells. Furthermore, the VLP associated with an antibody show a higher permeation across the CNS compared with free antibody.

Hence, the VLP according to the invention can in particular be used to deliver the associated cargo, in particular the associated protein, to a target, in particular into the CNS, preferably into a target cell in the CNS. This is particularly advantageous when the protein is an antibody, antibody fragment, preferably a nanobody, derivative of the antibody or the antibody fragment, or an antibody-drug conjugate (ADC).

In yet another aspect of the invention, a composition comprising virus-like particles (VLP) derived from John Cunningham virus (JCV) is provided, which is characterized by one or more of the following parameters:

    • a. a polydispersity index (PDI) of less than 0.3, preferably less than 0.2, preferably less than 0.1, more preferably in a range between 0.01 and 0.09,
    • b. at least 70% of VLP with an average diameter from 20 nm to 70 nm, preferably of 30 nm to 70 nm, more preferably of 35 nm to 65 nm, more preferably of 40 to 60 nm,
    • c. a VLP content within the composition of at least 80% (v/v), preferably at least 85% (v/v), preferably at least 90% (v/v), preferably at least 95% (v/v).

The particle size distribution can be assessed as the “Poly Dispersity Index” (PDI). The PDI indicates the distribution of particle sizes in a composition, and thus describes the uniformity of particles. PDI values can be obtained using different methods, including gel permeation chromatography/size exclusion chromatography, rheology, solution viscosity, membrane osmosis or light scattering.

The PDI preferably is determined by dynamic light scattering (DLS). In DLS, the native distribution is the intensity distribution which indicates how much light is scattered from the various “slices”. DLS allows determination of the mean size and the standard deviation from this mean size from the statistics of the distribution. Relative polydispersity can be determined by dividing the standard deviation by the mean. From the relative polydispersity of a distribution the polydispersity index (PDI) can be derived as its square. PDI values obtained by DLS can be grouped into monodispersed (PDI <0.1) compositions and polydispersed (PDI >0.1) compositions, whereby also within the polydispersed group smaller values indicate a more uniform distribution within the composition.

According to the invention, PDI values of 0.1 to 0.4 are preferred. More preferably, the PDI value is 0.1 to 0.3 and even more preferably 0.1 to 0.2.

The average diameter of a composition comprising VLP may be measured by visual methods, such as microscopy, preferably equipped with software to determine the average diameter, but also by analytic light scattering methods, such as DLS or nanotracking method, such as NTA.

The VLP content within the composition can be measured by, for example, FFF-MALS and/or DLS. Both methods can distinguish between the right-sized VLP and aggregates, “tinies” (small particles) and other impurities, such as salts, debris or pentamers.

Such a composition in particular fulfills requirements usually imposed on a drug delivery system. Obviously, such a composition is homogeneous and has a high purity.

In another aspect, the invention relates to a drug delivery system obtainable by the method according to the invention. Such a drug delivery system has the advantages as stated supra. In particular, such a drug delivery system can be used in a method of therapy and/or diagnosis, preferably for the treatment of neurological disorders, i.e. CNS diseases.

Hence the invention also relates to a method of treating a disorder, in particular a CNS disease, with the drug delivery system according to the invention. The method of treating preferably comprises the step of administering the drug delivery to a subject in need thereof.

The invention also relates to the use of the drug delivery system for the manufacture of a medicament for the treatment of neurological disorders, i.e. CNS diseases. The method of treatment preferably does not comprise a step of increasing the permeability of the BBB of the subject to be treated. The drug delivery system of the invention, preferably, is administered to a patient who has not received any chemical or physical treatment for impairing or disrupting the BBB.

The term “CNS diseases” (or “neurological disorders”) refers to any disorder of an individual's nervous system, preferably of the central nervous system. It encompasses neurodegenerative, psychotic or neurovascular disorders.

In one embodiment of the invention, the neurological disorder is selected from the group consisting of stroke, alcohol addiction, Alzheimer Disease, anxiety, arthritis, asthenia, attention deficit hyperactivity disorder, bipolar disorder, cancer pain, cerebral ischemia, cerebral neuroprotectant, cervical dystonia, Chorea associated with Huntington's disease, chronic pain, chronic severe pain, cognitive disorder, cortical myoclonus, degenerative Nerve Diseases, depression, diabetic neuropathic pain, diabetic neuropathy, emotional lability, epilepsy, excessive sleepiness associated with narcolepsy, fibromyalgia, Fragile X syndrome, Friedreich's ataxia, insomnia, Lennox Gastaut syndrome, major depressive and anxiety disorders, manic episodes associated with bipolar disorder, memory impairment, migraine, mild cognitive impairment, moderate to severe pain, motor neuron disease, multiple sclerosis, musculoskeletal pain, narcolepsy, neuralgia, neuropathic pain, nicotine dependence, obsessive compulsive disorder, opioid-induced adverse effect, opioid-induced constipation, osteoarthritis pain, overactive bladder, pain, Parkinson's disease, pediatric drooling, peripheral diabetic neuropathy, post-operative pain, postherpetic neuralgia, premenstrual dysphoric disorder, psychosis, refractory complex partial seizures, restless leg syndrome (RLS), schizophrenia, seizure, severe chronic pain, sleep disorder, smoking cessation, spasticity, spinal cord injury, stroke, transthyretin familial amyloid polyneuropathy, traumatic brain injury, vertigo, cachexia, amyotrophic lateral sclerosis, spinocerebellar ataxia type I, extrapyramidal and movement disorders, transient ischemic attack (TIA), Progressive multifocal leukoencephalopathy (PML), HIV-infection, dementia, such as Alzheimer's disease, vascular dementia, frontotemporal dementia, semantic dementia and dementia with Lewy bodies, and preferably selected from the group comprising or consisting of Alzheimer's disease, Parkinson's disease and multiple sclerosis.

In a further aspect of the invention, the invention relates to a virus-like particles (VLP) derived from John Cunningham virus (JCV) obtainable by a method comprising steps a) to e) of the inventive method and a further step of exposing the pentamers of the composition of e) to conditions inducing the pentamers to assemble into VLP. No cargo is added in the final assembly step. Such a VLP may be particularly useful as a vaccine.

In one embodiment, the VLP according to the invention cross the blood brain barrier (BBB). Therefore, in one embodiment of the invention, the VLP and/or the drug delivery system may be used to deliver a drug across the BBB. According to the invention, a drug delivery system and/or a VLP and/or the drug the VLP is packed with may cross the BBB.

Importantly, the crossing of the BBB by the drug delivery system enables the VLP and/or the drug delivery system to exhibit is function of targeting specific cell populations within the brain, i.e. deliver a cargo to targeted cells. In the context of the invention said drug delivery system comprises a delivery to and/or into the targeted cells. Hence, the cargo may be delivered to and/or into the targeted cells.

In a preferred embodiment, the VLP of the invention and/or its cargo, after administration to the subject to be treated, in particular a human, can be detected in the CNS in less than 10 days, preferably in less than 5 days, more preferably in less than 3 days after administration. The VLP and/or the drug delivery system preferably is administered to the subject intravenously. This is particularly advantageous when using the VLP as a reliable drug delivery system.

Preferably, the method does not require a loss of integrity or increased permeability of the BBB.

The integrity of the BBB in vitro may be measured by known methods, for example by relative transendothelial electrical resistance measurement (TEER) (Rempe et al., Biochem Bioph Res Comm 2011, 406 (1): 64-69). Many in vitro models of BBB are established, including primary bovine or human brain endothelial cells in different co-cultures, for example the human brain endothelial cell line HBEC-5i. In vivo, imaging methods, such as CT scans or MRI, can be used together with contrast agents to visualize BBB permeability. Functional imaging, such as PET or SPECT, may also be used.

According to the invention, it is not required to impair the permeability of the BBB prior or while administering the VLP and/or the drug delivery system. Thus, the BBB is preferably physiologically intact which means that the integrity is not decreased and/or the permeability not increased compared with the healthy, native state. The VLP of the invention preferably cross the physiologically intact BBB.

The composition comprising the VLP and/or the drug delivery system preferably does not require an additive that may disrupt the integrity of the BBB. Hence, in a most preferred embodiment of the invention the VLP and/or the drug delivery system is free of any additive that can impact the permeability of the BBB.

Materials and Methods

VLP Manufacturing

Virus-like particles (VLP) were manufactured by protein expression using a Sf9 insect cell line derived from the fall armyworm (Spodoptera frugiperda) (Thermo Fischer scientific). VLP were produced by infecting the cells with recombinant Baculovirus containing a John Cunningham virus VP1-protein expression cassette. The recombinant Baculovirus was prepared by using the Bac-to-Bac® Baculovirus expression system (Thermo Fischer Scientific). VLP were produced at pH 6.3 after 7 to 10 days in a 3.4 L bioreactor (INFORS HT Minifors). Air flow and temperature (26° C.) were controlled over the time. To remove cells and cell debris suspension was centrifuged at 4° C., 5.000 g and the supernatant containing VLP was harvested.

After that VLP were concentrated using two different concentration methods: precipitation with 7.5% polyethylenglycol (PEG) or cross flow with an ÄKTAcross Flow™ system (GE Healthcare). For PEG precipitation the clarified supernatant was mixed with PEG to achieve 7.5% (v/v) and incubated for 2 h at 4° C., after that the precipitate was separated by centrifugation at 4° C., 10.000 g and suspended in 50 mM NaCl, 10 mM Tris-HCl, pH 7.5. Cross flow was performed with an ÄKTAcross Flow™ system equipped with a 300 kDa cut-off membrane (Hydrosart® 300 kDa ECO, Sartorius). The flow ultrafiltration was carried out with a constant pressure of 1.5 bar and a factor of 8 (1 L supernatant against 8 L buffer).

VLP were further dissociated to pentamers by using 5 mM DTT and 10 mM EDTA for 70 min at room temperature and the pentamers purified by anion exchange chromatography (AEX) using HiScale CaptoQ column (GE Healthcare) with a NaCl step gradient from 150 mM to 1M NaCl. Pentamers were eluted with a 250 mM NaCl step. After elution the pentamers were processed as follows:

    • a) Mixed with cargo and reassembled (see “Packaging of fresh or stored pentamers with cargo”);
    • b) Frozen at −80° C. with 5% glycerol for storage of pentamers (which can subsequently be mixed with cargo and reassembled, see “Packaging of fresh or stored pentamers with cargo”) or
    • c) Immediately placed into dialysis cassettes with 20 kDa cut-off (Slide-A-Lyzer™ G2 Dialysis Device, Thermo Scientific) and reassembled by two-step-reassembly by dialysis (two-step dialysis). First, pentamers were dialyzed against 2 M ammonium sulfate buffer (“AS”, 10 mM Tris-HCl, 150 mM NaCl, 2 M (NH4)2SO4, pH 7.5) for 24 h and then transferred for the next 24 h into 10 mM Tris-HCl, 150 mM NaCl, 2 mM CaCl2, pH 7.5 (standard reassociation buffer, “ST”) (AS>ST). Alternatively, the two-step dialysis was performed with ST buffer in both steps (ST>ST). In both cases, to separate not reassembled material and aggregates from the VLP, the composition comprising the VLP was purified by size exclusion chromatography (SEC) using HiPrep™ Sephacryl® S-500 HR column (GE Healthcare) under control of polydispersity index (PDI) of fractions in dynamic light scattering (DLS) using Zetasizer ZS Nano (Malvern Inc.). VLP fraction with targeted size were selected and pooled, and then concentrated in Vivaspin® concentrators (Sartorius) with 5 kDa cut-off membrane, if applicable followed by storage at −80° C.

Packaging of Reassembled VLP with Cargo

For VLP packaging of reassembled VLP without aggregation step f), stored VLP of step c) above were taken from −80° C. and thawed using a thermal shaker (23° C., 350 rpm). Subsequently, dissociation of thawed VLP samples was performed by incubating the samples for 15 min at 23° C. and 450 rpm in the presence of dissociation buffer (20 mM Tris-HCl, 150 mM NaCl, 5 mM DTT, and 10 mM EDTA). Dissociated VLP were reassembled in the presence of cargo (e.g., nucleic acid). In short, the dissociated VLP were mixed thoroughly with the cargo in appropriate concentrations followed by dialyzing the mixture against standard reassociation buffer (10 mM Tris-HCl, 150 mM NaCl, 2 mM CaCl2, pH7.5) using a 20 kDa MWCO dialysis chamber (Slide-A-Lyzer™ MINI Dialysis Device, Thermo Scientific). After 4 to 6 h, dialysis buffer was replaced by fresh dialysis buffer and samples were incubated for additional 16 to 18 h. In case of using nucleic acids as cargo, unpacked nucleic acids were digested by incubation with 40 u Benzonase® Nuclease (Merck) per 25 μg VLP and 2.5 mM MgCl2 at 37° C. for 1 h. Samples were filtrated (Corning® Costar® Spin-X® centrifuge tube filters; pore size 0.22 μm) before analysis. VLP were directly analyzed afterwards and/or stored at −80° C.

Packaging of Antibodies into VLP

For packaging antibodies (AB) into VLP, stored VLP of step c) above were taken from −80° C. and thawed using a thermal shaker (23° C., 350 rpm). Subsequently, dissociation of thawed VLP samples was performed by incubating the samples for 15 min at 23° C. and 450 rpm in the presence of dissociation buffer (20 mM Tris-HCl, 150 mM NaCl, 5 mM DTT, and 10 mM EDTA). In the first step of the two-step packaging process, dissociated VLP were dialyzed for 4 h to 24 h against ammonium-sulfate-buffer (10 mM Tris-HCl, 150 mM NaCl, 2 M AmSu, pH7.5) using a 20 kDa MWCO dialysis chamber (Slide-A-Lyzer™ MINI Dialysis Device, Thermo Scientific). Following first dialysis, AB were added to the VLP with a mass ratio of 20 to 1 and the mixture was dialyzed (20 kDa MWCO, Slide-A-Lyzer™ MINI Dialysis Device, Thermo Scientific) in a second step against standard reassociation buffer (10 mM Tris-HCl, 150 mM NaCl, 2 mM CaCl2), pH7.5) for 16 h to 18 h. Afterwards, samples were filtered (Corning® Costar® Spin-XR centrifuge tube filters; pore size 0.22 μm). Free (residual) AB was removed by washing the sample at least five-times with three-times excess of standard reassociation buffer using a VivaSpin® concentrator (100 kDa MWCO, Sartorius) until no fluorescence was observed in the permeate. VLP were directly analyzed afterwards and/or stored at −80° C.

Packaging of Fresh or Stored Pentamers with Cargo

For pentamer packaging, fresh or at −80° C. stored pentamers were directly mixed and reassembled with cargo or thawed using a thermal shaker (23° C., 350 rpm), and then reassembled in the presence of cargo (e.g., nucleic acid). In short, the pentamers were mixed thoroughly with the cargo in appropriate concentrations followed by dialyzing the mixture against standard reassociation buffer (10 mM Tris-HCl, 150 mM NaCl, 2 mM CaCl2, pH7.5) using a 20 kDa MWCO dialysis chamber (Slide-A-Lyzer™ MINI Dialysis Device, Thermo Scientific). In case of using nucleic acids as cargo, unpacked nucleic acids were digested by incubation with 40 u Benzonase® Nuclease (Merck) per 25 μg reassembled VLP and 2.5 mM MgCl2 at 37° C. for 1 h. Reassembled pentamers were directly analyzed afterwards.

Functionality Testing of VLP/Luciferase Assay

In case of VLP loaded with nucleic acids (manufactured from fresh or stored pentamers; or from reassembled and purified VLP) luciferase NanoLuc® plasmid has been used as cargo. Glioblastoma cells were seeded 24 h in advance with a density of 3*104 in 900 μl DMEM medium, high glucose, GutaMAX™ (Thermo Fisher) supplemented with 10% FCS (Thermo Fisher) and 1% Pen-Strep (PAN-Biotech). Prior to adding the sample the corresponding amount of media was removed for keeping a constant amount of medium in each well. Samples were added to the cells and incubated for 48 h at 37° C. and 5% CO2. After that cell medium was eliminated and cells were washed with PBS. Luciferase activity was determined according to the manufacturer's instructions (NanoGlo® Luciferase Assay (Promega)). Luminescence was measured in white 96-well plates (Greiner bio-one) in Glomax® Multi detection system (Promega).

VLP Characterization

For verifying sample dissociation, reassembly and stability, dynamic light scattering (DLS) and polydispersity indices (PDI) of the samples were measured using a Zetasizer Nano ZS (Malvern.). The VLP sizes and PDI were documented with Zetasizer Software (version 7.11, Malvern). Additionally, inflection temperatures for each sample were assessed by nDSF using a Tycho NT.6 (Nanotemper).

To analyze sample composition, asymmetric flow field flow fractionation (AF4, Wyatt Inc.) was performed. Samples were analyzed by using multiangle light scattering (MALS), dynamic light scattering (DLS) and UV detector.

Transmission electron microscopy (TEM) analyses were carried out for directly visualizing the sample at different experimental steps with help of a Zeiss EM900 electron microscope, operating at a voltage at 80 kV. For this approach, samples were stained on carbon-coated copper grids (Plano GmbH) using 2% uranyl acetate (Sigma Aldrich) beforehand.

Artificial Blood-Brain-Barrier (BBB) Model for Verifying BBB Permeation

BBB permeation of VLP was assessed by either using monoculture (direct quantification of permeated fluorescently labeled-material) or co-culture (protein expression caused by permeated material in target cells) in a two-compartment artificial BBB model.

In both cases, 24-well permeable supports (insert, 0.4 μm, Corning Costar) were coated for 90 min at 37° C. with a mixture of 1:20 Fibronectin (BioReagent) and 1:75 Collagen Type I (Merck Millipore) in phosphate buffered-saline (PBS) in advance. After carefully removing the excess coating, coated inserts were transferred to a fresh 24-well plate (Greiner Bio-One) filled with 900 μl medium (EndoGRO, SCME004, Merck Millipore). 7.5*104 BBB cells (HBEC-5i, cerebral microvascular endothelium) were seeded into the inserts with 200 μl medium. Cells were incubated for 96 h to 120 h with exchanging the media in the wells every second day.

Monoculture Experiments (Permeation of Fluorescently Labeled Cargo)

The prepared inserts were carefully transferred to a fresh 24-well plate filled with 900 μl of phenol-free medium (DMEM/F-12, HEPES, no phenol red, Thermo Fisher Scientific) per well. Prior to adding the sample to the insert, the corresponding amount of media was removed, for keeping a constant amount of 200 μl medium in each insert. After 120 min of incubation at 37° C. in an incubator, 3×100 μl of each well were transferred to a black 96-well plate and the fluorescence of the sample was determined using a plate reader (Tecan Infinite M200, Tecan).

To confirm BBB formation, the BBB was disrupted by the addition of EDTA to the insert. The inserts were transferred to a 24-well plate containing fresh phenol-free media. EDTA (CEnd=5 mM, approx. 5 μl) was added to the inserts and incubated for 90 min at 37° C. Afterwards, fluorescence was determined as described above.

Permeation was calculated by normalizing the fluorescence signal of the inserts harboring BBB cells to the appropriate inserts without BBB cells. In the same manner, the integrity of the BBB was verified after the addition of EDTA.

Co-Culture Experiments (Activity of Permeated Material)

Inserts were transferred to a fresh 24-well plate, containing target cells (glioblastoma cells), that were seeded 24 h in advance with a density of 3*104 in 900 μl DMEM, high glucose, GutaMAX™ (Thermo Fisher) supplemented with 10% FCS (Thermo Fisher) and 1% Pen-Strep (PAN-Biotech). Prior to adding the sample (VLP packed with NanoLuc® plasmid) to the insert, the corresponding amount of media was removed for keeping a constant amount of 200 μl medium in each insert. After 24 h, the insert was removed from the 24-well plate and washed using PBS. Accordingly, the membrane (harboring the BBB cells) was cut out using a scalpel and transferred to a 1.5 ml reaction vial. Luciferase activity was determined according to the manufacturer's instructions (NanoGlo® Luciferase Assay (Promega)).

The wells (containing the target cells) were incubated for another 24 h before the luciferase assay was performed according to the manufacturer's instructions (NanoGlo® Luciferase Assay (Promega)).

Storage with Cryoprotection

Each cryoadditive glycerol (Carl Roth), sucrose (Carl Roth), ammonium sulfate (Carl Roth), DMSO (Carl Roth) and betaine (Merck) was added to VLP resulting in a final additive concentration of 1 M, except for glycerol with 5% (v/v) corresponding to 0.68 M. Additionally, one aliquot did not contain an additive substance (w/o). The samples were splitted and frozen by applying two freezing speeds: One half of each sample was frozen with a cooling rate of approx. −1° C./min (slow freezing), while the second half was frozen fast by dipping the containers into liquid nitrogen (fast freezing). All samples were stored at −80° C. with a storage period of 1 to 10 days. After thawing at 23° C. and shaking at 350 rpm, the samples were dialyzed against 10 mM Tris-HCl, 150 mM NaCl, 2 mM CaCl2, pH 7.5 at room temperature for 2 h to reduce additive concentration and their impact on analysis results. Particle diameter and PDI were determined by a Zetasizer Nanoseries (Malvern). Inflection temperatures were measured using a Tycho NT.6 (Nanotemper). VLP functionality after storage was proved with help of NanoLuc® plasmid packaging and subsequent NanoGlo® Luciferase assay (Promega).

Flow Cytometry for Analyzing Attachment of VLP-Associated Antibodies to Cells

Glioblastoma cells were seeded 24 h in advance with a density of 3*104 in 900 μl DMEM high glucose medium (GutaMAX™, Thermo Fisher) supplemented with 10% FCS (Thermo Fisher) and 1% Pen-Strep (PAN-Biotech). Prior to adding the sample, the corresponding amount of media was removed for keeping a constant amount of medium in each well. Antibodies (labeled with AF488) associated with VLP manufactured according to the invention (with aggregation step f) with a mass ratio of 20 to 1 were added to the wells and incubated at 37° C. and 5% CO2. After 16 h to 18 h, medium was carefully discarded and cells were washed two times with PBS. Harvesting of cells was performed using 150 μl Trypsin/EDTA per well. After detachment of cells, cells were carefully resuspended using 0.05% FCS in 500 μl PBS. For flow cytometric investigations, cells of two wells were pooled and centrifuged at 500×g for 5 min. The supernatant was discarded and cells were resuspended in approx. 200 μl PBS. Cells were directly used for flow cytometry.

Confocal Microscopy for Analyzing VLP-Associated Antibodies Uptake into Cells

Glioblastoma cells were seeded 24 h in advance with a density of 3*104 in 900 μl DMEM high glucose medium (GutaMAX™, Thermo Fisher) supplemented with 10% FCS (Thermo Fisher) and 1% Pen-Strep (PAN-Biotech) on the cover slips. Prior to adding the sample, the corresponding amount of media was removed for keeping a constant amount of medium in each well. Antibodies (non-specific IgM, primary anti-tubulin IgG labeled with AF488) associated with VLP manufactured according to the invention (with aggregation step f) with a mass ratio of 20 to 1 were added to the wells and incubated at 37° C. and 5% CO2. After 24 h to 48 h, medium was carefully discarded and cells were washed two times with PBS. After that cells were fixed with ice-cold methanol for 15 min. For confocal investigations, cell membrane was stained with wheat germ agglutinin (WGA) antibody (WGA AF633) and cell nucleus was stained with DAPI. Confocal microscopy was prepared with Nikon Eclipse Ti confocal microscope.

EXAMPLES

Example 1: Functional Analyses

The cargo delivering efficacy of VLP, which were prepared using different methods, was compared (FIG. 1). To this end, VLP were generated that underwent two rounds of disassembly and subsequent reassembly or one round of disassembly and subsequent reassembly (in both methods, last reassembly in the presence of a luciferase plasmid). Remarkably, Luciferase activity of VLP that underwent two rounds of disassembly and subsequent reassembly was significantly increased compared to VLP that underwent one round of disassembly and subsequent reassembly and compared with the “plasmid only” and “cells only” controls.

Next, the ability of VLP prepared according to the present invention to penetrate the blood-brain-barrier (BBB) was analyzed (FIGS. 2A and 2B). FIG. 2A shows the setup of an artificial blood-brain-barrier (BBB) model for testing BBB permeation by VLP or plasmid (circles) in a monoculture setup. Human brain endothelial cells (BBB cells, HBEC-5i) were plated on the permeable support. FIG. 2B shows the permeability of the VLP that underwent two rounds of disassembly and subsequent reassembly (second reassembly in the presence of a fluorescently labeled plasmid) compared with a “plasmid only” control. The black columns represent experiments with the intact BBB.

The white columns represent experiments with an artificially disrupted BBB (by the addition of EDTA). Strikingly, VLP prepared according to the present invention were capable to cross the BBB in significantly larger ratios than naked plasmid. Disruption of the integrity of the BBB layer destroyed this difference, showing the selective, efficient penetration capacity of VLP prepared according to the present invention.

To assess the delivering efficacy of VLP generated according to the present invention into target cells a co-culture BBB model was used (FIGS. 3A and 3B). FIG. 3A shows the setup of an artificial BBB model for testing BBB permeation by VLP or plasmid (circles) and subsequent protein expression caused by permeated material in target cells in a co-culture setup. FIG. 3B shows the Luciferase activity that was measured in the BBB cells present in the insert (in HBEC-5i cells) and Luciferase activity in the target cells after permeation. An artificial BBB (“Coating+BBB cells”) and a coating without BBB cells (“Coating only”) were tested. Luciferase activity of the cells of the inserts was only measured when there were cells present (thus, the “Coating only” samples did not show any luciferase activity as expected) and when the luciferase plasmid was packed into VLP that were prepared according to the present invention (compared with plasmid only). Luciferase activity of the target cells was also only measured in the samples with the VLP prepared according to the method of the present invention (compared with plasmid only) irrespective if the BBB cell layer was present or only the coating.

Thus, VLP prepared according to the present invention are capable of efficiently passing through the BBB while retaining a high infectivity and cargo delivering capacity. Sample (packed) means VLP that underwent two rounds of disassembly and subsequent reassembly (second reassembly in the presence of a luciferase plasmid).

Example 2: Storing Pentamers Vs. Storing VLP

To investigate the homogeneity and uniformity of compositions comprising loaded VLP that had undergone different storing procedures, transmission electron microscopy (TEM) was performed. VLP that were generated with one round of disassembly and subsequent reassembly (pentamers frozen, left) were compared with VLP that were generated with two rounds of disassembly and subsequent reassembly (VLP frozen, right) (FIG. 4). The VLP generated in the latter case showed a significantly more uniform distribution as they lacked any visible defective viral particle structures when compared to the VLP wherein the pentamers were frozen during manufacturing.

To further investigate the homogeneity of loaded VLP generated as in FIG. 4, FFF-MALS analyses were performed (FIGS. 5A-5C). Both samples were compared with freshly prepared VLP (without cargo, thus without disassembly/reassembly), serving as reference. Strikingly, compared with the reference (FIG. 5 C), VLP generated after two rounds of disassembly and subsequent reassembly with intermediate freezing of VLP (FIG. 5 A) significantly reduced the amount of VLP aggregates present in the composition. In addition, the distribution of VLP was even more uniform. The size of the VLP and the presence of “Tinies” and “Salts, debris, pentamers” was comparable.

Remarkably, when VLP were generated after one round of disassembly and subsequent reassembly (pentamers frozen) very few structurally intact VLP could be identified (FIG. 5 B). Therefore, the inventive method allows the intermediate storage of VLP as reassembled VLP and the generation of a highly uniform population of loaded VLP with almost no aggregates. Percentages are given excluding the aggregates.

To further characterize the stability of VLP that were generated after two rounds of disassembly and subsequent reassembly with intermediate freezing of VLP (“Sample (packed)”, solid line) compared with freshly prepared VLP (without cargo, thus without disassembly/reassembly, “Sample (wt)”, dotted line) nDSF analyses were carried out in order to reveal melting temperatures (inflection temperatures) (FIG. 6). Remarkably, the melting curves of both VLP samples were hardly distinguishable showing that VLP prepared according to the inventive method are equally stable as freshly prepared VLP.

Example 3: Inducing Aggregation Before Reassembly

Next, the effect of inducing aggregation during reassembly of pentamers into VLP was measured. Homogeneity was analyzed by DLS (FIGS. 7 and 8). FIG. 7 shows the PDI of VLP obtained after dialysis with induction of aggregation (white column) and without induction of aggregation (black column). VLP reassembled by first inducing aggregation showed a strongly reduced PDI compared with the VLP reassembled without induction of aggregation. Therefore, the induction of aggregation during reassembly led to a much more homogenous size distribution. Both samples were taken before freezing (thus, they underwent one round of disassembly and reassembly).

FIG. 8 shows the average size distribution determined by DLS of the samples prepared as in FIG. 7 (FIG. 8, left) and samples that had undergone the same reassembly conditions but a subsequent freezing step (FIG. 8, right). Both samples that had been reassembled with induction of aggregation (solid lines) show a very uniform size distribution, while the samples that did not undergo the aggregation step (dotted lines) show at least two VLP populations. Even more, the freezing step was obviously harmful for the latter sample as the composition comprising the VLP that had been reassembled without induction of aggregation had become considerably more heterogeneous after freezing. However, the VLP that had been reassembled with induction of aggregation could be frozen without any impact on the homogeneity of the sample.

Example 4: Effect of Cryoadditives

To further scrutinize the effect of sample storage on VLP, different cryoadditives were added to compositions comprising VLP that were frozen after one round of disassembly and subsequent reassembly and two dialysis steps including AS buffer (for induction of aggregation during reassembly) (FIGS. 9A and 9B). FIG. 9A shows the stability of loaded VLP that had been stored as depicted as analyzed by nDSF. Remarkably, VLP that had been stored in a buffer comprising ammonium sulfate were considerably more stable (i.e. show a higher inflection temperature) compared with the other cryoadditives. Interestingly, this effect was independent of whether the VLP had been frozen fast (black columns) or slowly (dotted columns).

In a next step, these samples were used in a luciferase assay (FIG. 9B). Unexpectedly, the luciferase activity was strongly increased by VLP which were stored in a composition comprising ammonium sulfate. Betaine was also advantageous compared with the sample without cryoadditive and the other tested cryoadditives. Therefore, the use of cryoadditives, especially ammonium sulfate, considerably increased the stability of VLP and increased the infectivity and cargo-delivering efficacy of the loaded VLP. Again, this effect was independent of whether the VLP had been frozen fast (black columns) or slowly (white columns).

Example 5: Formation of VLP Associated with an Antibody

TEM analyses were performed of VLP associated with an IgG or an IgM antibody according to the invention (with aggregation step f). In FIG. 10 it is shown that VLP are indeed formed (left: VLP with packed IgG; right: VLP with packed IgM). The VLP are visualized as round-shaped particles.

Thus, it has been shown that VLP can be associated with an antibody and form intact VLP.

Example 6: Homogeneity of VLP Associated with an Antibody

DLS analyses with VLP associated with an IgG or IgM antibody manufactured according to the invention (with aggregation step f) revealed the same size distribution as “empty” VLP (FIGS. 11 and 12). FIG. 11 shows a comparison of pentamers (VLP (dissociated)) and “empty” VLP (VLP (original sample)). Both samples are relatively uniform in size but the “empty” VLP are larger in size. FIG. 12 shows the size distribution of VLP associated with an IgG (A) or IgM (B) antibody compared with “empty” VLP. As can be seen, the VLP associated with antibody are very homogeneous and similar to identical to the original sample in homogeneity and size.

Example 7: Efficient Delivery of Antibodies to and/or into Cells by VLP

FIG. 13 shows flow cytometric analyses of cells that had been incubated with VLP associated with IgG and IgM (manufactured according to the invention (with aggregation step f)) compared with controls (cells without addition of VLP: cell control; cells with addition of IgM without VLP: IgM control; cells with addition of IgG without VLP: IgG control). The bar depicts the positive cells. Nearly all cells that had been incubated with VLP associated with IgG and IgM are positive. Remarkably, the fluorescence is much higher compared with the incubation with only IgG or IgM antibody (IgG control/IgM control).

It has thereby been shown that antibodies can be efficiently delivered to cells by VLP that had been associated with these antibodies.

This finding has been further confirmed by confocal microscopy (FIGS. 14 to 16). Confocal microscopy was prepared with Nikon confocal microscope by XY or XYZ imaging. Cell nucleus was detected with DAPI (in blue), cell membrane was detected with WGA antibody to define the cell structure (in red). Antibody was detected in green channel. For all samples exact the same fluorescent parameter (exposure time and laser capacity) was used. Not packed antibody control (free antibody, FIG. 14A) showed no signal in green channel for AB while cell membrane and cell nucleus (red and blue signals) could be detected, which means that free antibody uptake is under the detection limit (which is verified with help of FACS, FIG. 13).

VLP packed with non-specific IgM antibody (FIG. 14B) were efficiently delivered to the cells and showed very strong signals for the antibody (green signals) both co-localized with the cell membrane and unspecifically scattered in the cells; cell membrane and cell nucleus were marked in red and blue, respectively.

FIG. 15 shows a single cell after delivery of unspecific IgM associated with VLP into the targeted cell. With help of the Z-stack the whole cell could be scanned and the cargo (IgM AF488) could be detected inside the cell (green signals detected in the cell body). WGA signals from the membrane helped to define the cell structure and to determine cell shape. For each channel and for the red and green overlay, the cell is shown in large-scale on the left, and to the bottom and right of the cell, the zoom into the z-axis from the x- and from the y-axis, respectively, is shown. Thereby, it can be verified that the antibody is detected inside the cell.

FIG. 16 shows the uptake of IgG antibody directed against tubulin into the targeted cells. With help of the Z-stack the whole cells could be scanned and the cargo (anti-tubulin IgG AF488) could be detected inside the cells (green signals detected in the cell body). WGA signals from the membrane helped to define the cell structure and to determine the cell shape.

Efficient delivery of antibody into cells has thereby been shown.

Example 8: Higher Permeation of Antibodies Associated with VLP

An in vitro BBB model has been chosen to analyze permeability of VLP packed with IgG or IgM (manufactured according to the invention (with aggregation step f)) and compared with “free antibody” (IgG/IgM without VLP) and FITC- or TRITC-conjugated dextran (4 kDa FITC/70 kDa TRITC). Surprisingly, the association of VLP with antibody increased the transport of antibody across the BBB compared with free antibody (FIG. 17). Integrity of BBB was verified by using 4 kDa FITC dextran and 70 kDa TRITC dextran. The values are the percentage of permeation compared to a permeation without BBB cells.

SPECIFIC EMBODIMENTS

For the Aspect of the Invention without Aggregation Step f)

  • 1. Method for providing a drug delivery system comprising a virus-like particle (VLP) derived from John Cunningham virus (JCV) comprising the following steps:
    • a) providing a composition comprising VP1 proteins,
    • b) exposing the VP1 proteins of the composition of a) to conditions inducing the VP1 to assemble into VLP,
    • c) exposing the VLP of the composition of b) to conditions disassembling the VLP into pentamers,
    • d) exposing the pentamers of the composition of c) to conditions inducing the pentamers to reassemble into VLP
    • e) exposing the VLP of the composition of d) to conditions disassembling the VLP into pentamers,
    • f) exposing the pentamers of the composition of e) to a cargo and conditions inducing the pentamers to assemble into a VLP associated with the cargo.
  • 2. The method according to embodiment 1, whereas before step d) the pentamers of the composition of c) are exposed to conditions inducing the aggregation of the pentamers.
  • 3. The method according to embodiment 2, whereas the aggregation is induced by a precipitation agent, preferably selected form the group consisting of polyethylene glycol (PEG), alcohol, a salt or a combination thereof, most preferably by a salt.
  • 4. The method according to embodiment 3, whereas the salt comprises an anion and a cation selected from the group consisting of citrate (C6H5O73−), phosphate (PO43−), sulfate (SO42−), hydrogen phosphate (HPO42−), dihydrogen phosphate (H2PO4−), iodate (IO3), hydroxide (OH), fluoride (F), bromate (BrO3) or acetate (CH3COO), quaternary ammonium compounds (NR4+) with R being an alkyl or an aryl group, preferably tetramethylammonium ((CH3)4N+) or dimethylammonium ((CH3)2N2+), ammonium (NH4+), potassium (K+), caesium (Cs+), rubidium (Rb+) or lithium (Li+), preferably comprising SO42− and/or NH4+.
  • 5. The method according to embodiment 3 or 4, whereas the salt is selected from the group consisting of (NH4)2SO4, K2SO4, Na2SO4, (NH4)2HPO4, K2HPO4 and Na2HPO4, preferably (NH4)2SO4.
  • 6. The method according to any of embodiments 2 to 5, whereas step d) includes separating the pentamers of composition d) from the conditions inducing the aggregation of the pentamers.
  • 7. The method according to embodiment 6, whereas the separation is achieved by a dialysis against a composition comprising a salt and a buffer and a pH of 6 to 8.5, preferably of 6.5 to 8.5, more preferably of 7 to 8, most preferably of 7.2 to 7.5, in particular of 7.5.
  • 8. The method according to any of the preceding embodiments, whereas the composition of step d) is characterized by
    • a) a polydispersity index (PDI) of less than 0.3, preferably less than 0.2, preferably less than 0.1, more preferably is in a range between 0.01 and 0.09 and/or
    • b) at least 70% of the VLP having an average diameter of 20 nm to 70 nm, preferably of 30 nm to 70 nm, more preferably of 35 nm to 65 nm, more preferably of 40 to 60 nm.
  • 9. The method according to any of the preceding embodiments, comprising a step of storing the VLP from the composition of step d) for at least 10 h, 15 h, 20 h, preferably for at least 24 h at a temperature of about −80° C. to about 4° C., more preferably at a temperature of about −80° C. for at least 24 h.
  • 10. The method according to embodiment 9, whereas storing takes place in a composition comprising a cryoadditive, preferably selected from the group comprising polyols, sugars, inorganic salts, organic salts, amino acids, polymers, extremolytes or derivatives or combinations thereof.
  • 11. The method according to embodiment 10, whereas the inorganic salt comprises a sulfate anion and preferably is ammonium sulfate and/or the amino acid is glycine, glutamine, proline, alanine and/or the amino acid derivative is betain.
  • 12. The method according to any of the preceding embodiments, whereas the VLP of step b), the pentamers of step c) and/or the VLP of step d) are subject to purification.
  • 13. The method according to any of the preceding embodiments, whereas the VP1 comprises an amino acid sequence which is at least 80%, more preferably at least 90% identical to the amino acid sequence according to SEQ ID NO: 1 over its entire length, preferably has the amino acid sequence of SEQ ID NO: 1.
  • 14. The method according to any of the preceding embodiments, whereas a nucleotide sequence of the VP1 protein is at least 70%, more preferably at least 80%, more preferably at least 90% identical to the nucleotide sequence of SEQ ID NO: 2 over its entire length, preferably is the nucleotide sequence of SEQ ID NO: 2.
  • 15. Composition comprising virus-like particles (VLP) derived from John Cunningham virus (JCV) characterized by one or more of the following parameters:
    • a) a polydispersity index (PDI) of less than 0.3, preferably less than 0.2, preferably less than 0.1, more preferably in a range between 0.01 and 0.09,
    • b) at least 70% of VLP with an average diameter from 20 nm to 70 nm, preferably of 30 nm to 70 nm, more preferably of 35 nm to 65 nm, more preferably of 40 to 60 nm,
    • c) a VLP content within the composition of at least 80% (v/v), preferably at least 85% (v/v), preferably at least 90% (v/v), preferably at least 95% (v/v).
  • 16. Drug Delivery System obtainable by the method according to any of the preceding embodiments.
  • 17. The Drug Delivery System according to embodiment 16 for use in a method of therapy and/or diagnosis, preferably for the treatment of neurological disorders, in particular of CNS diseases, in a subject in the need thereof.
  • 18. Virus-like particles (VLP) derived from John Cunningham virus (JCV) obtainable by a method comprising steps a) to e) of embodiment 1 and a further step of exposing the pentamers of the composition of e) to conditions inducing the pentamers to assemble into VLP.
  • 19. The Drug Delivery System according to embodiments 16 or 17 or the VLP according to embodiment 18, whereas the VLP cross the blood brain barrier (BBB).
  • 20. The Drug Delivery System or the VLP according to embodiment 19, whereas VLP are detectable in the CNS within 10 days or less after administration of the drug delivery system, preferably after i.v. administration.
  • 21. The Drug Delivery System or the VLP according to embodiment 19 or 20, whereas the VLP cross the physiologically intact BBB.
  • 22. The Drug Delivery System or the VLP according to embodiment 20, whereas the crossing does not require a loss of integrity or increased permeability of the BBB.
  • 23. The Drug Delivery System according to embodiment 17, whereas the subject has not received a treatment of increasing the permeability of his BBB or inducing disruption thereof.
  • 24. Composition comprising virus-like particles (VLP) derived from John Cunningham virus (JCV) comprising a salt and a buffer and a pH of 7.0 to 8.0, preferably of 7.5, preferably comprising:
    • a) 120 mM to 170 mM NaCl, preferably 150 mM NaCl,
    • b) 1 to 5 mM CaCl2, preferably 2 mM CaCl2, and
    • c) 5 to 30 mM Tris-HCl, preferably 10 to 25 mM Tris-HCl, more preferably 10 mM Tris-HCl.

Claims

1. Method for providing a virus-like particle (VLP) derived from John Cunningham virus (JCV) comprising the following steps:

a) providing a composition comprising VP1 proteins,

b) exposing the VP1 proteins of the composition of a) to conditions inducing the VP1 to assemble into VLP,

c) exposing the VLP of the composition of b) to conditions disassembling the VLP into pentamers,

d) exposing the pentamers of the composition of c) to conditions inducing the pentamers to reassemble into VLP

c) exposing the VLP of the composition of d) to conditions disassembling the VLP into pentamers,

f) exposing the pentamers of the composition of e) to conditions inducing the aggregation of the pentamers,

g) exposing the aggregated pentamers of the composition of f) to a cargo, in particular a protein, under conditions inducing the aggregated pentamers to assemble into a VLP associated with the cargo, in particular the protein.

2. The method according to claim 1, whereas the aggregated pentamers in step g) are induced to assemble into a VLP incorporating the cargo, in particular the protein.

3. The method according to claim 1, whereas before step d) the pentamers of the composition of c) are exposed to conditions inducing the aggregation of the pentamers.

4. The method according to claim 1, whereas the aggregation is induced by a precipitation agent, preferably selected from the group consisting of polyethylene glycol (PEG), alcohol, a salt or a combination thereof, most preferably by a salt.

5. The method according to claim 4, whereas the salt comprises an anion and a cation selected from the group consisting of citrate (C6H5O73−), phosphate (PO43−), sulfate (SO42−), hydrogen phosphate (HPO42−), dihydrogen phosphate (H2PO4−), iodate (IO3), hydroxide (OH), fluoride (F), bromate (BrO3) or acetate (CH3COO), quaternary ammonium compounds (NR4+) with R being an alkyl or an aryl group, preferably tetramethylammonium ((CH3)4N+) or dimethylammonium ((CH3)2N2+), ammonium (NH4+), potassium (K+), caesium (Cs+), rubidium (Rb+) or lithium (Li+), preferably comprising SO42− and/or NH4+.

6. The method according to claim 4, whereas the salt is selected from the group consisting of (NH4)2SO4, K2SO4, Na2SO4, (NH4)2HPO4, K2HPO4 and Na2HPO4, preferably (NH4)2SO4.

7. The method according to claim 4, whereas the pentamers are brought into contact with the precipitation agent, preferably by dialysis or cross-flow filtration.

8. The method according to claim 1, whereas after inducing the aggregation, the pentamers of composition f) and/or d) are separated from the conditions inducing the aggregation of the pentamers.

9. The method according to claim 8, whereas the separation is achieved by a dialysis against a composition comprising a salt and a buffer and a pH of 6 to 8.5, preferably of 6.5 to 8.5, more preferably of 7 to 8, most preferably of 7.2 to 7.5, in particular of 7.5.

10. The method according to claim 1, whereas in step c) and/or in step e) the VLP are exposed to a reducing agent, preferably selected from the group consisting of 2-mercaptoethanol, Tris-2-carboxyethylphosphine hydrochloride (TCEP), hydrogen peroxide (H2O2), Dithiothreitol (DTT), thiosulfate and formic acid, more preferably selected from the group consisting of 2-mercaptoethanol, TCEP and DTT, most preferably DTT.

11. The method according to claim 1, whereas the cargo, in particular the protein, has a molecular weight of about 10 kDa to about 4000 kDa.

12. The method according to claim 1, whereas the protein is an antibody, antibody fragment, preferably a nanobody, derivative of the antibody or the antibody fragment, or an antibody-drug-conjugate (ADC).

13. The method according to claim 12, whereas the antibody is an IgG antibody, an IgM antibody, an IgA antibody, an IgD antibody or an IgE antibody, preferably an IgG antibody or an IgM antibody.

14. The method according to claim 1, whereas the composition of step d) is characterized by

a) a polydispersity index (PDI) of less than 0.3, preferably less than 0.2, preferably less than 0.1, more preferably is in a range between 0.01 and 0.09 and/or

b) at least 70% of the VLP having an average diameter of 20 nm to 70 nm, preferably of 30 nm to 70 nm, more preferably of 35 nm to 65 nm, more preferably of 40 to 60 nm.

15. The method according to claim 1, comprising a step of storing the VLP from the composition of step d) for at least 10 h, 15 h, 20 h, preferably for at least 24 h at a temperature of about −80° C. to about 4° C., more preferably at a temperature of about −80° C. for at least 24 h.

16. The method according to claim 15, whereas storing takes place in a composition comprising a cryoadditive, preferably selected from the group comprising polyols, sugars, inorganic salts, organic salts, amino acids, polymers, extremolytes or derivatives or combinations thereof.

17. The method according to claim 16, whereas the inorganic salt comprises a sulfate anion and preferably is ammonium sulfate and/or the amino acid is glycine, glutamine, proline, alanine and/or the amino acid derivative is betain.

18. The method according to claim 1, whereas the VLP of step b), the pentamers of step c), the VLP of step d) and/or the VLP of step g) are subject to purification.

19. The method according to claim 1, whereas the VP1 comprises an amino acid sequence which is at least 80%, more preferably at least 90% identical to the amino acid sequence according to SEQ ID NO: 1 over its entire length, preferably has the amino acid sequence of SEQ ID NO: 1.

20. The method according to claim 1, whereas a nucleotide sequence of the VP1 protein is at least 70%, more preferably at least 80%, more preferably at least 90% identical to the nucleotide sequence of SEQ ID NO: 2 over its entire length, preferably is the nucleotide sequence of SEQ ID NO: 2.

21. A VLP associated with a cargo, in particular a protein, obtainable by the method according to claim 1.

22. The VLP according to claim 21, whereas the VLP incorporates the cargo, in particular the protein.

23. Composition comprising virus-like particles (VLP) derived from John Cunningham virus (JCV) characterized by one or more of the following parameters:

a) a polydispersity index (PDI) of less than 0.3, preferably less than 0.2, preferably less than 0.1, more preferably in a range between 0.01 and 0.09,

b) at least 70% of VLP with an average diameter from 20 nm to 70 nm, preferably of 30 nm to 70 nm, more preferably of 35 nm to 65 nm, more preferably of 40 to 60 nm,

c) a VLP content within the composition of at least 80% (v/v), preferably at least 85% (v/v), preferably at least 90% (v/v), preferably at least 95% (v/v).

24. Drug Delivery System obtainable by the method according to claim 1.

25. The Drug Delivery System according to claim 24 for use in a method of therapy and/or diagnosis, preferably for the treatment of neurological disorders, in particular of CNS diseases, in a subject in the need thereof.

26. The Drug Delivery System according to claim 24, whereas the VLP cross the blood brain barrier (BBB).

27. The Drug Delivery System according to claim 26, whereas VLP are detectable in the CNS within 10 days or less after administration of the drug delivery system, preferably after i.v. administration.

28. The Drug Delivery System according to claim 26, whereas the VLP cross the physiologically intact BBB.

29. The Drug Delivery System according to claim 26, whereas the crossing does not require a loss of integrity or increased permeability of the BBB.

30. The Drug Delivery System according to claim 26, whereas the subject has not received a treatment of increasing the permeability of his BBB or inducing disruption thereof.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: