Patent application title:

DETERMINATION OF NFKB PATHWAY ACTIVITY USING UNIQUE COMBINATION OF TARGET GENES

Publication number:

US20230260595A1

Publication date:
Application number:

17/931,919

Filed date:

2022-09-14

Abstract:

A bioinformatics process which provides an improved means to detect NFkB cellular signaling pathway in a subject, such as a human, based on the expression levels of at least six unique target genes of the NFkB cellular signaling pathway measured in a sample. The invention includes an apparatus comprising a digital processor configured to perform such a method, a non-transitory storage medium storing instructions that are executable by a digital processing device to perform such a method, and a computer program comprising program code means for causing a digital processing device to perform such a method. Kits are also provided for measuring expression levels of unique sets of NFkB cellular signaling pathway target genes.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

G01N33/57484 »  CPC further

Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites

G01N2800/60 »  CPC further

Detection or diagnosis of diseases Complex ways of combining multiple protein biomarkers for diagnosis

C12Q2600/158 »  CPC further

Oligonucleotides characterized by their use Expression markers

G16B25/20 »  CPC main

ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression Polymerase chain reaction [PCR]; Primer or probe design; Probe optimisation

G01N33/574 IPC

Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor for cancer

A61K31/336 »  CPC further

Medicinal preparations containing organic active ingredients; Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having three-membered rings, e.g. oxirane, fumagillin

A61K31/416 »  CPC further

Medicinal preparations containing organic active ingredients; Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole 1,2-Diazoles condensed with carbocyclic ring systems, e.g. indazole

A61K38/05 »  CPC further

Medicinal preparations containing peptides; Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof Dipeptides

A61K31/4985 »  CPC further

Medicinal preparations containing organic active ingredients; Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two nitrogen atoms as the only ring heteroatoms, e.g. piperazine Pyrazines or piperazines ortho- or peri-condensed with heterocyclic ring systems

A61K31/573 »  CPC further

Medicinal preparations containing organic active ingredients; Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone

G16B25/00 »  CPC further

ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression

G16B5/00 »  CPC further

ICT specially adapted for modelling or simulations in systems biology, e.g. gene-regulatory networks, protein interaction networks or metabolic networks

C12Q1/6886 »  CPC further

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

G16B40/00 »  CPC further

ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding

G16B5/20 »  CPC further

ICT specially adapted for modelling or simulations in systems biology, e.g. gene-regulatory networks, protein interaction networks or metabolic networks Probabilistic models

Description

RELATED APPLICATIONS

This application claims the benefit of European Patent Application No. EP15181029.8, filed Aug. 14, 2015, and is a continuation of U.S. patent Ser. No. 15/235,478, filed Aug. 12, 2016 (now issued as U.S. Pat. No. 11,450,409, the entirety of the specification and claims thereof are hereby incorporated by reference for all purposes.

ELECTRONIC SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on May 4, 2023, is named AOMB-005-US1_Sequence_Listing.xml and is 185,636 bytes in size.

FIELD OF THE INVENTION

The present invention is in the field of systems biology, bioinformatics, genomic mathematical processing and proteomic mathematical processing. In particular, the invention includes a systems-based mathematical process for determining the activity of a NFkB cellular signaling pathway in a subject based on expression levels of a unique set of selected target genes in a subject. The invention further provides an apparatus that includes a digital processor configured to perform such a method, a non-transitory storage medium storing instructions that are executable by a digital processing device to perform such a method, and a computer program comprising a program code means for causing a digital processing device to perform such a method. The present invention also includes kits for the determination of expression levels of the unique combinations of target genes.

BACKGROUND OF THE INVENTION

As knowledge of tumors including cancers evolve, it becomes more clear that they are extraordinarily heterogeneous and multifactorial. Tumors and cancers have a wide range of genotypes and phenotypes, they are influenced by their individualized cell receptors (or lack thereof), micro-environment, extracellular matrix, tumor vascularization, neighboring immune cells, and accumulations of mutations, with differing capacities for proliferation, migration, stem cell properties and invasion. This scope of heterogeneity exists even among same classes of tumors. See generally: Nature Insight: Tumor Heterogeneity (entire issue of articles), 19 Sep. 2013 (Vol. 501, Issue 7467); Zellmer and Zhang, “Evolving concepts of tumor heterogeneity”, Cell and Bioscience 2014, 4:69.

Traditionally, physicians have treated tumors, including cancers, as the same within class type (including within receptor type) without taking into account the enormous fundamental individualized nature of the diseased tissue. Patients have been treated with available chemotherapeutic agents based on class and receptor type, and if they do not respond, they are treated with an alternative therapeutic, if it exists. This is an empirical approach to medicine.

There has been a growing trend toward taking into account the heterogeneity of tumors at a more fundamental level as a means to create individualized therapies, however, this trend is still in its formative stages. What is desperately needed are approaches to obtain more metadata about the tumor to inform therapeutic treatment in a manner that allows the prescription of approaches more closely tailored to the individual tumor, and perhaps more importantly, avoiding therapies destined to fail and waste valuable time, which can be life-determinative.

A number of companies and institutions are active in the area of classical, and some more advanced, genetic testing, diagnostics, and predictions for the development of human diseases, including, for example: Affymetrix, Inc.; Bio-Rad, Inc; Roche Diagnostics; Genomic Health, Inc.; Regents of the University of California; Illumina; Fluidigm Corporation; Sequenom, Inc.; High Throughput Genomics; NanoString Technologies; Thermo Fisher; Danaher; Becton, Dickinson and Company; bioMerieux; Johnson & Johnson, Myriad Genetics, and Hologic.

Several companies have developed technology or products directed to gene expression profiling and disease classification. For example, Genomic Health, Inc. is the assignee of numerous patents pertaining to gene expression profiling, for example: U.S. Pat. Nos. 7,081,340; 8,808,994; 8,034,565; 8,206,919; 7,858,304; 8,741,605; 8,765,383; 7,838,224; 8,071,286; 8,148,076; 8,008,003; 8,725,426; 7,888,019; 8,906,625; 8,703,736; 7,695,913; 7,569,345; 8,067,178; 7,056,674; 8,153,379; 8,153,380; 8,153,378; 8,026,060; 8,029,995; 8,198,024; 8,273,537; 8,632,980; 7,723,033; 8,367,345; 8,911,940; 7,939,261; 7,526,637; 8,868,352; 7,930,104; 7,816,084; 7,754,431 and 7,208,470, and their foreign counterparts.

U.S. Pat. No. 9,076,104 to the Regents of the University of California titled “Systems and Methods for Identifying Drug Targets using Biological Networks” claims a method with computer executable instructions by a processor for predicting gene expression profile changes on inhibition of proteins or genes of drug targets on treating a disease, that includes constructing a genetic network using a dynamic Bayesian network based at least in part on knowledge of drug inhibiting effects on a disease, associating a set of parameters with the constructed dynamic Bayesian network, determining the values of a joint probability distribution via an automatic procedure, deriving a mean dynamic Bayesian network with averaged parameters and calculating a quantitative prediction based at least in part on the mean dynamic Bayesian network, wherein the method searches for an optimal combination of drug targets whose perturbed gene expression profiles are most similar to healthy cells.

Affymetrix has developed a number of products related to gene expression profiling. Non-limiting examples of U.S. patents to Affymetrix include: U.S. Pat. Nos. 6,884,578; 8,029,997; 6,308,170; 6,720,149; 5,874,219; 6,171,798; and 6,391,550.

Likewise, Bio-Rad has a number of products directed to gene expression profiling. Illustrative examples of U.S. patents to Bio-Rad include: U.S. Pat. Nos. 8,021,894; 8,451,450; 8,518,639; 6,004,761; 6,146,897; 7,299,134; 7,160,734; 6,675,104; 6,844,165; 6,225,047; 7,754,861 and 6,004,761.

Koninklijke Philips N.V. (NL) has filed a number of patent applications in the general area of assessment of cellular signaling pathway activity using various mathematical models, including U.S. Ser. No. 14/233,546 (WO 2013/011479), titled “Assessment of Cellular Signaling Pathway Using Probabilistic Modeling of Target Gene Expression”; U.S. Ser. No. 14/652,805 (WO 2014/102668) titled “Assessment of Cellular Signaling Pathway Activity Using Linear Combinations of Target Gene Expressions”; WO 2014/174003 titled “Medical Prognosis and Prediction of Treatment Response Using Multiple Cellular Signaling Pathway Activities”; and WO 2015/101635 titled “Assessment of the PI3K Cellular Signaling Pathway Activity Using Mathematical Modeling of Target Gene Expression”.

Despite this progress, more work is needed to definitively characterize tumor cellular behavior. In particular, there is a critical need to determine which pathways have become pathogenic to the cell. However, it is difficult to identify and separate abnormal cellular signaling from normal cellular pathway activity.

Nuclear factor-kappa B (NFkB or NFκB) is an inducible transcription factor that regulates the expression of many genes involved in the immune response. The NFkB cellular signaling pathway is a key cellular signaling pathway involved in immune, inflammatory, and acute phase response, but is also implicated in the control of cell survival, proliferation, and apoptosis. In healthy, non-activated cells, the NFkB cellular signaling pathway associated transcription factors that are composed of dimers originating from five genes (NFKB1 or p50/p105, NFKB2 or p52/p100, RELA or p65, REL, and RELB) are predominantly cytoplasmic due to their interaction with the inhibitors of NFkB (IkBs) and therefore remain transcriptionally inactive, thus keeping the NFkB cellular signaling pathway inactive. Upon activation of the upstream signaling cascade, the IkBs become phosphorylated and undergo ubiquitin-dependent degradation by the proteasome, and NFkB dimers are translocated to the nucleus where they act as transcription factors. Besides this canonical NFkB cellular signaling pathway there is also an alternative pathway that is able to initiate NFkB regulated transcription (see FIG. 1; CP=canonical pathway; AP=alternative pathway; PS=proteasome; NC=nucleus). The term “NFkB cellular signaling pathway” herein preferably refers to any signaling process that leads to transcriptional activity of the above mentioned NFkB transcription factors.

Although activity of the NFkB cellular signaling pathway is known to be associated with different types of cancer and to support the pro-survival phenotypes of cancer cells, there is no clinical assay available to assess the activity of the NFkB cellular signaling pathway. Thus, it is desirable to be able to improve the possibilities of characterizing patients that have a cancer, e.g., a diffuse large B-cell lymphoma (DLBCL), a multiple myeloma, a cancer of another haematological origin, or a solid tumor, such as a breast, melanoma, or prostate tumor, which is at least partially driven by a deregulated NFkB cellular signaling pathway, and that are therefore likely to respond to inhibitors of the NFkB cellular signaling pathway.

It is therefore an object of the invention to provide a more accurate process to determine the tumorigenic propensity of the NFkB cellular signaling pathway in a cell, as well as associated methods of therapeutic treatment, kits, systems, etc.

SUMMARY OF THE INVENTION

The present invention includes methods and apparatuses for determining the activity level of a NFkB cellular signaling pathway in a subject, typically a human with diseased tissue such as a tumor or cancer, wherein the activity level of the NFkB cellular signaling pathway is determined by calculating a level of NFkB transcription factor element in a sample of the involved tissue isolated from the subject, wherein the level of the NFkB transcription factor element in the sample are determined by measuring the expression levels of a unique set of target genes controlled by the NFkB transcription factor element using a calibrated pathway model that compares the expression levels of the target genes in the sample with expression levels of the target genes in the calibrated pathway model.

In particular, the unique set of target genes whose expression level is analyzed in the model includes at least six target genes, at least seven target genes, at least eight target genes, at least nine target genes, at least ten or more target genes selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1. In one embodiment, the unique set of target genes whose expression level is analyzed in the model is selected from BIRC3, CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, TNF, TNFAIP2, TRAF1, and VCAM1. In one embodiment, the unique set of target genes comprises at least three target genes, at least four target genes, at least five target genes, at least six or more target genes selected from CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, MMP9, NFKB2, NFKBIA, and TNFAIP2. In one embodiment, the unique set of target genes comprises at least three target genes, at least four target genes, at least five target genes, at least six or more target genes selected from CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2.

Using this invention, health care providers will be able to more accurately assess the functional state of the NFkB cellular signaling pathway at specific points in disease progression. Without being bound by any particular theory, it is believed that the identified target genes of the present invention in combination with the analytical methods described herein reduces the noise associated with the use of large subsets of target genes as previously described in the literature. Furthermore, as described and exemplified below, the use of specific combinations of select target genes allows for the precise determination of cellular signaling activity, and allows for an increased accuracy in the determination of disease state and prognosis. Accordingly, such cellular signaling pathway status can be used to, for example but not limited to, identify the presence or absence of disease and/or particular disease state or advancement, identify the presence or absence of a disorder or disease state, identify a particular subtype within a disease or disorder based one the activity level of the NFkB cellular signaling pathway, derive a course of treatment based on the presence or absence of NFkB signaling activity for example by administering a NFkB inhibitor, and/or monitor disease progression in order to, for example, adjust therapeutic protocols based on a predicted drug efficacy in light of the determined activity of the NFkB cellular signaling pathway in the sample.

The term “NFkB transcriptional factor element” or “NFkB TF element” or “TF element” refers to a protein complex containing at least one or, preferably, a dimer of the NFkB members (NFKB1 or p50/p105, NFKB2 or p52/p100, RELA or p65, REL, and RELB), which is capable of binding to specific DNA sequences, thereby controlling transcription of target genes.

The present invention is based on the realization of the inventors that a suitable way of identifying effects occurring in the NFkB cellular signaling pathway can be based on a measurement of the signaling output of the NFkB cellular signaling pathway, which is—amongst others—the transcription of the unique target genes described herein by a NFkB transcription factor (TF) element controlled by the NFkB cellular signaling pathway. This realization by the inventors assumes that the TF level is at a quasi-steady state in the sample which can be detected by means of—amongst others—the expression values of the target genes. The NFkB cellular signaling pathway targeted herein is known to be associated with different types of cancer and to support the pro-survival phenotypes of cancer cells as the NFkB cellular signaling pathway is known to regulate genes that control cell proliferation and cell survival processes. Many different types of human tumors are found to have a deregulated activity of the NFkB cellular signaling pathway. Furthermore, studies have shown that the inhibition of constitutive NFkB cellular signaling pathway activity blocks the oncogenic potential of cancerous cells.

The present invention makes it possible to determine the activity of the NFkB cellular signaling pathway by (i) determining a level of an NFkB TF element in the sample, wherein the determining is based at least in part on evaluating a mathematical model relating expression levels of at least six target genes of the NFkB cellular signaling pathway, the transcription of which is controlled by the NFkB TF element, to the level of the NFkB TF element, and by (ii) inferring the activity of the NFkB cellular signaling pathway based on the determined level of the NFkB TF element in the sample. This preferably allows improving the possibilities of characterizing patients that have a cancer, e.g., a diffuse large B-cell lymphoma (DLBCL), a multiple myeloma, a cancer of another haematological origin, or a solid tumor, such as a breast, melanoma, or prostate tumor, which is at least partially driven by a deregulated NFkB cellular signaling pathway, and that are therefore likely to respond to inhibitors of the NFkB cellular signaling pathway. An important advantage of the present invention is that it makes it possible to determine the activity of the NFkB cellular signaling pathway using a single sample, rather than requiring a plurality of samples extracted at different points in time. In particular embodiments, treatment determination can be based on specific NFkB activity. In a particular embodiment the NFkB cellular signaling status can be set at a cutoff value of odds of the NFkB cellular signaling pathway being activate of, for example, 10:1, 5:1, 4:1, 2:1, 1:1, 1:2, 1:4, 1:5, or 1:10.

In one aspect of the invention, provided herein is a computer implemented method for determining the activity level of a NFkB cellular signaling pathway in a subject performed by a computerized device having a processor comprising:

    • a. calculating an activity level of NFkB transcription factor element in a sample isolated from the subject, wherein the activity level of NFkB transcription factor element in the sample is calculated by:
      • i. receiving data on the expression levels of at least six target genes derived from the sample, wherein the NFkB transcription factor element controls transcription of the at least six target genes, and wherein the at least six target genes are selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1;
      • ii. calculating the activity level of the NFkB transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define an activity level of NFkB transcription factor element; and,
    • b. calculating the activity level of the NFkB cellular signaling pathway in the sample based on the calculated activity levels of NFkB transcription factor element in the sample.

In one embodiment, the method further comprises assigning a NFkB cellular signaling pathway activity status to the calculated activity level of the NFkB cellular signaling pathway in the sample wherein the activity status is indicative of either an active NFkB cellular signaling pathway or a passive NFkB cellular signaling pathway.

In one embodiment, the at least six target genes are selected from BIRC3, CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, TNF, TNFAIP2, TRAF1, and VCAM1. In one embodiment, the at least six target genes comprise at least three target genes selected from CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, MMP9, NFKB2, NFKBIA, and TNFAIP2. In one embodiment, the at least three target genes are selected from CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2.

In one embodiment, the status of the NFkB cellular signaling pathway is established by establishing a specific threshold for activity as described further below. In one embodiment, the threshold is set as a probability that the cellular signaling pathway is active, for example, a 10:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:4, 1:5, or 1:10. In one embodiment, the activity status is based, for example, on a minimum calculated activity. In one embodiment, the method further comprises assigning to the calculated NFkB cellular signaling in the sample a probability that the NFkB cellular signaling pathway is active.

As contemplated herein, the level of the NFkB transcription factor element is determined using a calibrated pathway model executed by one or more computer processors, as further described below. The calibrated pathway model compares the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the calibrated pathway model which define a level of a NFkB transcription factor element. In one embodiment, the calibrated pathway model is a probabilistic model incorporating conditional probabilistic relationships that compare the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define a level of a NFkB transcription factor element to determine the level of the NFkB transcription factor element in the sample. In one embodiment, the probabilistic model is a Bayesian network model. In an alternative embodiment, the calibrated pathway model can be a linear or pseudo-linear model. In an embodiment, the linear or pseudo-linear model is a linear or pseudo-linear combination model.

As contemplated herein, the expression levels of the unique set of target genes can be determined using standard methods known in the art. For example, the expression levels of the target genes can be determined by measuring the level of mRNA of the target genes, through quantitative reverse transcriptase-polymerase chain reaction techniques, using probes associated with a mRNA sequence of the target genes, using a DNA or RNA microarray, and/or by measuring the protein level of the protein encoded by the target genes. Once the expression level of the target genes is determined, the expression levels of the target genes within the sample can be utilized in the model in a raw state or, alternatively, following normalization of the expression level data. For example, expression level data can be normalized by transforming it into continuous data, z-score data, discrete data, or fuzzy data.

As contemplated herein, the calculation of NFkB signaling in the sample is performed on a computerized device having a processor capable of executing a readable program code for calculating the NFkB signaling in the sample according to the methods described above. Accordingly, the computerized device can include means for receiving expression level data, wherein the data is expression levels of at least six target genes derived from the sample, a means for calculating the level of a NFkB transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define a level a NFkB transcription factor element; a means for calculating the NFkB cellular signaling in the sample based on the calculated levels of a NFkB transcription factor element in the sample; and a means for assigning a NFkB cellular signaling pathway activity probability or status to the calculated NFkB cellular signaling in the sample, and, optionally, a means for displaying the NFkB signaling pathway activity probability or status.

In accordance with another disclosed aspect, further provided herein is a non-transitory storage medium capable of storing instructions that are executable by a digital processing device to perform the method according to the present invention as described herein. The non-transitory storage medium may be a computer-readable storage medium, such as a hard drive or other magnetic storage medium, an optical disk or other optical storage medium, a random access memory (RAM), read only memory (ROM), flash memory, or other electronic storage medium, a network server, or so forth. The digital processing device may be a handheld device (e.g., a personal data assistant or smartphone), a notebook computer, a desktop computer, a tablet computer or device, a remote network server, or so forth.

Further contemplated herein are methods of treating a subject having a disease or disorder associated with an activated NFkB cellular signaling pathway, or a disorder whose advancement or progression is exacerbated or caused by, whether partially or wholly, an activated NFkB cellular signaling pathway, wherein the determination of the NFkB cellular signaling pathway activity is based on the methods described above, and administering to the subject a NFkB inhibitor if the information regarding the activity level of NFkB cellular signaling pathway is indicative of an active NFkB cellular signaling pathway. In one embodiment, the disorder is one of an auto-immune and other immune disorders, cancer, bronchial asthma, heart disease, diabetes, hereditary hemorrhagic telangiectasia, Marfan syndrome, Vascular Ehlers-Danlos syndrome, Loeys-Dietz syndrome, Parkinson's disease, Chronic kidney disease, Multiple Sclerosis, fibrotic diseases such as liver, Ing, or kidney fibrosis, Dupuytren's disease, or Alzheimer's disease. In a particular embodiment, the subject is suffering from a cancer, for example, a breast cancer, lung cancer, a colon cancer, pancreatic cancer, brain cancer, or breast cancer. In a more particular embodiment, the cancer is a breast cancer.

Also contemplated herein is a kit for measuring the expression levels of at least six or more NFkB cellular signaling pathway target genes, for example, seven, eight, nine, ten, eleven, twelve, or more target genes as described herein. In one embodiment, the kit includes one or more components, for example probes, for example labeled probes, and/or PCR primers, for measuring the expression levels of at least six target genes, at least seven target genes, at least eight target genes, or at least nine or more target genes selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1. In one embodiment, the kit includes one or more components for measurng the expression levels of at least six target genes, at least seven target genes, at least eight target genes, or at least nine or more target genes selected from B1RC3, CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, TNF, TNFAIP2, TRAF1, and VCAM1. In one embodiment, the one or more components comprise one or more components for measuring the expression levels of at least three target genes, at least four target genes, at least five target genes, or at least six or more target genes selected from CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, MMP9, NFKB2, NFKBIA, and TNFAIP2. In one embodiment, the one or more components comprise one or more components for measuring the expression levels of at least three target genes, at least four target genes, at least five target genes, or at least six or more target genes selected from CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2.

As contemplated herein, the one or more components or means for measuring the expression levels of the particular target genes can be selected from the group consisting of: an DNA array chip, an oligonucleotide array chip, a protein array chip, an antibody, a plurality of probes, for example, labeled probes, a set of RNA reverser-transcriptase sequencing components, and/or RNA or DNA, including cDNA, amplification primers. In one embodiment, the kit includes a set of labeled probes directed to a portion of an mRNA or cDNA sequence of the targeted genes as described herein. In one embodiment, the kit includes a set of primers and probes directed to a portion of an mRNA or cDNA sequence of the targeted genes as described further below, wherein, for example, the set includes specific primers or probes selected from the sequences of Table 1. In one embodiment, the labeled probes are contained in a standardized 96-well plate. In one embodiment, the kit further includes primers or probes directed to a set of reference genes, for example, as represented in Table 2. Such reference genes can be, for example, constitutively expressed genes useful in normalizing or standardizing expression levels of the target gene expression levels described herein.

In one embodiment, the kit further includes a non-transitory storage medium containing instructions that are executable by a digital processing device to perform a method according to the present invention as described herein. In one embodiment, the kit includes an identification code that provides access to a server or computer network for analyzing the activity level of the NFkB cellular signaling pathway based on the expression levels of the target genes and the methods described herein.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows schematically and exemplarily canonical and alternative pathways of NFkB activation (see Dolcet X. et al, “NF-kB in development and progression of human cancer”, Virchows Archives, Vol. 446. No. 5, 2005, pages 475 to 482).

FIG. 2 shows schematically and exemplarily a mathematical model, herein, a Bayesian network model, useful in modelling the transcriptional program of the NFkB cellular signaling pathway.

FIG. 3 shows an exemplary flow chart for calculating the activity level of the NFkB cellular signaling pathway based on expression levels of target genes derived from a sample.

FIG. 4 shows an exemplary flow chart for obtaining a calibrated pathway model as described herein.

FIG. 5 shows an exemplary flow chart for calculating the Transcription Factor (TF) Element as described herein.

FIG. 6 shows an exemplary flow chart for calculating the NFkB cellular signaling pathway activity level using discretized observables.

FIG. 7 shows an exemplary flow chart for calculating the NFkB cellular signaling pathway activity level using continuous observables.

FIG. 8 shows an exemplary flow chart for determining Cq values from RT-qPCR analysis of the target genes of the NFkB cellular signaling pathway.

FIGS. 9 to 12 show training results of the exemplary Bayesian network model based on the evidence curated list of target genes (FIG. 9), the 19 target genes shortlist (FIG. 10), the 13 target genes shortlist (FIG. 11), and the 7 target genes shortlist of the NFkB cellular signaling pathway (FIG. 12) (see Tables 3 to 6), respectively. (Legend: 1—ABC DLBCL; 2—Lymphoblasioid cell line; 3—Follicular lymphoma; 4—GCB DLBCL; 5—Memory H-cells, 6—Naïve H-cells, 7—Normal; 8—DLBCL unknown subtype)

FIG. 13 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 3) for diffuse large B-cell lymphoma (DLBCL) samples from GSE34171.

FIGS. 14 to 17 show NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (FIG. 14), the 19 target genes shortlist (FIG. 15), the 13 target genes shortlist (FIG. 16), and the 7 target genes shortlist (FIG. 17)(see Tables 3 to 6), respectively, for normal human bronchial epithelial (NHBE) cell line samples from E-MTAB-1312, which were stimulated with different TNFα concentrations for different stimulation times. (Legend: 1—No TNFα (0.5 h); 2—No TNFα (2 h); 3—No TNFα (4 h); 4—No TNFα (24 h); 5—Low TNFα (0.5 h); 6—Low TNFα (2 h); 7—Low TNFα (4 h); 8—Low TNFα (24 h): 9—Medium TNFα (0.5 h); 10—Medium TNFα (2 h); 11—Medium TNFα (4 h); 12—Medium TNFα (24 h); 13—High TNFα (0.5 h); 14—High TNFα (2 h); 15—High TNFα (4 h); 16—High TNFα (24 h))

FIG. 18 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 3) for THP-1 monocytic cells. (Legend: 1—No LPS; 2—LPS stimulation; 3—LPS stimulation coenzyme Q10)

FIGS. 19 to 22 show NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (FIG. 19), the 19 target genes shortlist (FIG. 20), the 13 target genes shortlist (FIG. 21), and the 7 target genes shortlist (FIG. 22) (see Tables 3 to 6), respectively, for colon samples from GSE4183. (Legend: 1—Normal colon; 2—IBD; 3—Adenoma; 4—CRC)

FIG. 23 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 3) for breast cancer cell lines from GSE10890. (Legend: 1 and 2—Unknown cellular signaling pathway driven cell lines; 3: Wnt cellular signaling pathway driven cell lines)

FIG. 24 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 3) for ovarian samples from GSE20565. (Legend: 1—Primary ovarian carcinoma: 2—Plausible primary ovarian carcinoma; 3—Breast metastasis in ovary; 4—Plausible breast metastasis in ovary)

FIG. 25 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 3) for breast cancer samples from E-MTAB-1006. (Legend: 1—Inflammatory breast cancer; 2—Non-inflammatory breast cancer)

FIG. 26 illustrates a prognosis of glioma patients (GSE16011) depicted in a Kaplan-Meier plot, wherein the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 3) is employed.

FIG. 27 shows training results of the exemplary linear model based on the evidence curated list of target genes (see Table 3). (Legend: 1—ABC DLBCL; 2—Lymphoblastoid cell line; 3—Follicular Lymphoma: 4—GCB DLBCL; 5—Memory B-cells: 6—Naïve B-cells; 7—Normal: 8—DLBCL unknown subtype)

FIG. 28 shows NFkB cellular signaling pathway activity predictions of the trained exemplary linear model using the evidence curated list of target genes (see Table 3) for normal human bronchial epithelial (NHBE) cell line samples from E-MTAB-1312, which were stimulated with different TNFα concentrations for different stimulation times. (Legend: 1—No TNFα (0.5 h); 2—No TNFα (2 h): 3—No TNFα (4 h); 4—No TNFα (24 h); 5—Low TNFα (0.5 h); 6—Low TNFα (2 h); 7—Low TNFα (4 h): 8—Low TNFα (24 h): 9—Medium TNFα (0.5 h): 10—Medium TNFα (2 h); 11—Medium TNFα (4 h); 12—Medium TNFα (24 h); 13—High TNFα (0.5 h); 14—High TNFα (2 h); 15—High TNFα (4 h); 16—High TNFα (24 h))

FIG. 29 shows NFkB cellular signaling pathway activity predictions of the trained exemplary linear model using the evidence curated list of target genes (see Table 3) for colon samples from GSE4183. (Legend: 1—Normal colon; 2—IBD; 3—Adenoma; 4—CRC)

FIG. 30 shows training results of the exemplary Bayesian network model based on the broad literature list of putative target genes of the NFkB cellular signaling pathway (see Table 7). (Legend: 1—ABC DLBCL; 2—Lymphoblastoid cell line; 3—Follicular lymphoma; 4—GCB DLBCL; 5—Memory B-cells; 6—Naïve B-cells; 7—Normal; 8—DLBCL unknown subtype)

FIG. 31 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the broad literature list of putative target genes of the NFkB cellular signaling pathway (see Table 7) for normal human bronchial epithelial (NHBE) cell line samples from E-MTAB-1312, which were stimulated with different TNFα concentrations for different stimulation times. (Legend: 1—No TNFα (0.5 h); 2—No TNFα (2 h); 3—No TNFα (4 h); 4—No TNFα (24 h); 5—Low TNFα (0.5 h): 6—Low TNFα (2 h); 7—Low TNFα (4 h); 8—Low TNFα (24 h); 9—Medium TNFα (0.5 h); 10—Medium TNFα (2 h); 11—Medium TNFα (4 h); 12—Medium TNFα (24 h); 13—High TNFα (0.5 h); 14—High TNFα (2 h); 15—High TNFα (4 h); 16—High TNFα (24 h))

FIG. 32 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the broad literature list of putative target genes of the NFkB cellular signaling pathway (see Table 7) for colon samples from GSE4183. (Legend: 1—Normal colon; 2—IBD; 3—Adenoma; 4—CRC)

DETAILED DESCRIPTION OF THE INVENTION

Provided herein are methods and apparatuses, and in particular computer implemented methods and apparatuses, for determining the activity levels of a NFkB cellular signaling pathway in a subject, wherein the NFkB cellular signaling is calculated by a) calculating an activity level of NFkB transcription factor element in a sample isolated from a subject, and wherein the activity levels of the NFkB transcription factor element in the sample is calculated by measuring the expression levels of a unique set of target genes, wherein the NFkB transcription factor element controls transcription of the target genes, calculating the levels of the NFkB transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the target genes in the sample with expression levels of the target genes in the calibrated pathway model which define a level of a NFkB transcription factor element; and calculating the NFkB cellular signaling in the sample based on the calculated levels of NFkB transcription factor element in the sample.

In particular, the unique set of target genes whose expression level is analyzed in the model includes at least six target genes, at least seven target genes, at least eight target genes, at least nine target genes, at least ten or more target genes selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1. It has been discovered that analyzing a specific set of target genes as described herein in the disclosed pathway model provides for an advantageously accurate NFkB cellular signaling pathway activity determination. Accordingly, such status can be used to, for example but not limited to, identify the presence or absence of disease and/or particular disease state or advancement, diagnose a specific disease or disease state, or diagnose the presence or absence of a particular disease, derive a course of treatment based on the presence or absence of NFkB signaling activity, monitor disease progression in order to, for example, adjust therapeutic protocols based on a predicted drug efficacy in light of the determined activity of the NFkB signaling pathway in the sample, or develop NFkB targeted therapeutics.

Definitions

All terms used herein are intended to have their plain and ordinary meaning as normally ascribed in the art unless otherwise specifically indicated herein.

Herein, the “level” of a TF element denotes the level of activity of the TF element regarding transcription of its target genes.

The term “subject” or “host”, as used herein, refers to any living being. In some embodiments, the subject is an animal, for example a mammal, including a human. In a particular embodiment, the subject is a human. In one embodiment, the human is suspected of having a disorder mediated or exacerbated by an active NFkB cellular signaling pathway, for example, a cancer. In one embodiment, the human has or is suspected of having a breast cancer.

The term “sample”, as used herein, means any biological specimen isolated from a subject. Accordingly, “sample” as used herein is contemplated to encompasses the case where e.g. a tissue and/or cells and/or a body fluid of the subject have been isolated from the subject. Performing the claimed method may include where a portion of this sample is extracted, e.g., by means of Laser Capture Microdissection (LCM), or by scraping off the cells of interest from the slide, or by fluorescence-activated cell sorting techniques. In addition, the term “sample”, as used herein, also encompasses the case where e.g. a tissue and/or cells and/or a body fluid of the subject has been taken from the subject and has been put on a microscope slide, and the claimed method is performed on the slide. In addition, the term “samples,” as used herein, may also encompass circulating tumor cells or CTCs.

The term “NFkB transcriptional factor element” or “NFkB TF element” or “TF element” refers to a protein complex containing at least one or, preferably, a dimer of the NFkB members (NFKB1 or p50/p105, NFKB2 or p52/p100, RELA or p65, REL, and RELB), which is capable of binding to specific DNA sequences, thereby controlling transcription of target genes.

The term “target gene” as used herein, means a gene whose transcription is directly or indirectly controlled by a NFkB transcription factor element. The “target gene” may be a “direct target gene” and/or an “indirect target gene” (as described herein).

As contemplated herein, target genes include at least BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1.

As contemplated herein, the present invention includes:

A) A computer implemented method for determining the activity level of a NFkB cellular signaling pathway in a subject performed by a computerized device having a processor comprising.

    • a. calculating an activity level of NFkB transcription factor element in a sample isolated from the subject, wherein the activity level of NFkB transcription factor element in the sample is calculated by:
      • i. receiving data on the expression levels of at least six target genes derived from the sample, wherein the NFkB transcription factor element controls transcription of the at least six target genes, and wherein the at least six target genes are selected from BCL2L1, B1RC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1;
      • ii. calculating the activity level of the NFkB transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define an activity level of NFkB transcription factor element; and,
    • b. calculating the activity level of the NFkB cellular signaling pathway in the sample based on the calculated activity levels of NFkB transcription factor element in the sample.

In one embodiment, the method further comprises assigning a NFkB cellular signaling pathway activity status to the calculated activity level of the NFkB cellular signaling in the sample, wherein the activity status is indicative of either an active NFkB cellular signaling pathway or a passive NFkB cellular signaling pathway. In one embodiment, the method further comprises displaying the NFkB cellular signaling pathway activity status. In one embodiment, the at least six target genes are selected from BIRC3, CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, TNF, TNFAIP2, TRAF1, and VCAM1. In one embodiment, the at least six target genes comprise at least three target genes selected from CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, MMP9, NFKB2, NFKBIA, and TNFAIP2. In one embodiment, the at least three target genes are selected from CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2. In one embodiment, the calibrated pathway model is a probabilistic model incorporating conditional probabilistic relationships that compare the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define a level of NFkB transcription factor element to determine the activity level of the NFkB transcription factor element in the sample. In one embodiment, the probabilistic model is a Bayesian network model. In one embodiment, the calibrated pathway model is a linear model incorporating relationships that compare the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define a level of NFkB transcription factor element to determine the activity level of the NFkB transcription factor element in the sample.

B) A computer program product for determining the activity level of a NFkB cellular signaling pathway in a subject comprising

    • a. a non-transitory computer readable storage medium having computer readable program code embodied therewith, the computer readable program code executable by at least one processor to:
      • i. calculate a level of NFkB transcription factor element in a sample isolated from a subject, wherein the level of the NFkB transcription factor element in the sample is calculated by:
        • 1. receiving data on the expression levels of at least six target genes derived from the sample, wherein the at least six target genes are selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1;
        • 2. calculating the level of the NFkB transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define an activity level of NFkB transcription factor element; and,
      • ii. calculate the activity level of the NFkB cellular signaling pathway in the sample based on the calculated NFkB transcription factor element level in the sample.

In one embodiment, the computer readable program code is executable by at least one processor to assign a NFkB cellular signaling pathway activity status to the calculated activity level of the NFkB cellular signaling in the sample, wherein the activity status is indicative of either an active NFkB cellular signaling pathway or a passive NFkB cellular signaling pathway. In one embodiment, the computer readable program code is executable by at least one processor to display the NFkB signaling pathway activity status. In one embodiment, the at least six target genes are selected from BIRC3, CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, TNF, TNFAIP2, TRAF1, and VCAM1. In one embodiment, the at least six target genes comprise at least three target genes selected from CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, MMP9, NFKB2, NFKBIA, and TNFAIP2. In one embodiment, the at least three target genes are selected from CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2. In one embodiment, the calibrated pathway model is a probabilistic model incorporating conditional probabilistic relationships that compare the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define a level of NFkB transcription factor element to determine the activity level of NFkB transcription factor element in the sample. In one embodiment, the probabilistic model is a Bayesian network model. In one embodiment, the calibrated pathway model is a linear model incorporating relationships that compare the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define a level of NFkB transcription factor element to determine the activity level of a NFkB transcription factor element in the sample.

C) A method of treating a subject suffering from a disease associated with an activated NFkB cellular signaling pathway comprising:

    • a. receiving information regarding the activity level of a NFkB cellular signaling pathway derived from a sample isolated from the subject, wherein the activity level of the NFkB cellular signaling pathway is determined by:
      • i. calculating an activity level of NFkB transcription factor element in a sample isolated from the subject, wherein the level of the NFkB transcription factor element in the sample is calculated by:
        • 1. receiving data on the expression levels of at least six target genes derived from the sample, wherein the NFkB transcription factor element controls transcription of the at least six target genes, and wherein the at least six target genes are selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1;
        • 2. calculating the level of the NFkB transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define an activity level of the NFkB transcription factor element; and,
      • ii. calculating the activity level of the NFkB cellular signaling pathway in the sample based on the calculated NFkB transcription factor element level in the sample; and,
    • b. administering to the subject a NFkB inhibitor if the information regarding the activity level of the NFkB cellular signaling pathway is indicative of an pathogenically active NFkB cellular signaling pathway.

In one embodiment, the at least six target genes are selected from BIRC3, CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, TNF, TNFAIP2, TRAF1, and VCAM1. In one embodiment, the at least six target genes comprise at least three target genes selected from CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, MMP9, NFKB2, NFKBIA, and TNFAIP2. In one embodiment, the at least three target genes are selected from CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2. In one embodiment, the calibrated pathway model is a probabilistic model incorporating conditional probabilistic relationships that compare the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define a level of NFkB transcription factor element to determine the activity level of the NFkB transcription factor element in the sample. In one embodiment, the probabilistic model is a Bayesian network model. In one embodiment, the calibrated pathway model is a linear model incorporating relationships that compare the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define a level of NFkB transcription factor element to determine the activity level of the NFkB transcription factor element in the human cancer sample. In an illustrative embodiment, the NFkB inhibitor is DHMEQ, bindarit, Bortesomib or BU-32 (proteazome inhibitors), BMS-345541, or glucocorticoids.

In one embodiment, the disease is a cancer. In one embodiment (not limited to), the cancer is a benign tumor (adenoma, hyperplasia) or a solid cancer: colon, breast, a male cancer (prostate, testicular, urethra, penis), pancreatic, liver, gastrointestinal tract cancer, head and neck cancer, lung, brain (medulloblastoma, glioblastoma, glioma), bladder cancer, an endocrine tumor (thyroid, parathyroid, adrenal, neuroendocrine, MEA), a female cancer (ovarian, cervical, endometrial, vagina), kidney cancer, skin cancer (BCC, squamous skin cancer, melanoma), a soft tissue cancer (sarcoma), childhood cancer (retinoblastoma, Wilms tumor), mesothelioma, or a hematological cancer (leukemia, lymphoma), or a glioma.

D) A kit for measuring expression levels of NFkB cellular signaling pathway target genes comprising:

    • a. a set of polymerase chain reaction primers directed to at least six NFkB cellular signaling pathway target genes from a sample isolated from a subject; and
    • b. a set of probes directed to the at least six NFkB cellular signaling pathway target genes;
      • wherein the at least six NFkB cellular signaling pathway target genes are selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1.

In one embodiment, the at least six target genes are selected from BIRC3, CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, TNF, TNFAIP2, TRAF1, and VCAM1. In one embodiment, the at least six target genes comprise at least three target genes selected from CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, MMP9, NFKB2, NFKBIA, and TNFAIP2. In one embodiment, the at least three target genes are selected from CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2. In one embodiment, the probes are labeled. In one embodiment, the set of probes includes at least one of SEQ. ID. NOS. 46, 49, 52, 55, and 58. In one embodiment, the set of primers include at least one of SEQ. ID. NOS. 44 and 45, 47 and 48, 50 and 51, 53 and 54, and 56 and 57. In one embodiment, a computer program product for determining the activity level of a NFkB cellular signaling pathway in the subject comprising a non-transitory computer readable storage medium having computer readable program code embodied therewith, the computer readable program code executable by at least one processor to: (i) calculate a level of NFkB transcription factor element in the sample, wherein the level of the NFkB transcription factor element in the sample is associated with NFkB cellular signaling, and wherein the level of the NFkB transcription factor element in the sample is calculated by: (1) receiving data on the expression levels of the at least six target genes derived from the sample; (2) calculating the level of the NFkB transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define an activity level of NFkB transcription factor element; and, (ii) calculate the activity level of the NFkB cellular signaling pathway in the sample based on the calculated NFkB transcription factor element level in the sample.

E) A kit for determining the activity level of a NFkB cellular signaling pathway in a subject comprising:

    • a. one or more components capable of identifying expression levels of at least six NFkB cellular signaling pathway target genes from a sample of the subject, wherein the at least six NFkB cellular signaling pathway target genes are selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1; and,
    • b. optionally, a non-transitory computer readable storage medium having computer readable program code embodied therewith, the computer readable program code executable by at least one processor to:
      • i. calculate a level of NFkB transcription factor element in the sample, wherein the level of NFkB transcription factor element in the sample is associated with NFkB cellular signaling, and wherein the level of the NFkB transcription factor element in the sample is calculated by:
        • 1. receiving data on the expression levels of the at least six target genes derived from the sample;
        • 2. calculating the level of the NFkB transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define an activity level of the NFkB transcription factor element; and,
      • ii. calculate the activity level of the NFkB cellular signaling pathway in the sample based on the calculated NFkB transcription factor element level in the sample.
        Determining the Activity Level of the NFkB Cellular Signaling Pathway The present invention provides new and improved methods and apparatuses, and in particular computer implemented methods and apparatuses, as disclosed herein, to assess the functional state or activity of the NFkB cellular signaling pathway.

In one aspect of the invention, provided herein is a method of determining NFkB cellular signaling in a subject comprising the steps of:

    • a. calculating a level of NFkB transcription factor element in a sample isolated from a subject, wherein the level of NFkB transcription factor element in the sample is associated with an activity level of the NFkB cellular signaling pathway, and wherein the activity level of the NFkB transcription factor element in the sample is calculated by:
      • i. receiving data on the expression levels of at least six target genes derived from the sample, wherein the NFkB transcription factor element controls transcription of the at least six target genes,
      • ii. calculating the level of NFkB transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least six genes in the sample with expression levels of the at least six target genes in the calibrated pathway model which define an activity level of the NFkB transcription factor element; and,
    • b. calculating the activity level of the NFkB cellular signaling pathway in the sample based on the calculated levels of NFkB transcription factor element in the sample. As contemplated herein, the method of calculating the activity level of the NFkB cellular signaling pathway is performed by a computer processor.

As a non-limiting generalized example, FIG. 2 provides an exemplary flow diagram used to determine the activity level of the NFkB cellular signaling pathway based on a computer implemented mathematical model constructed of three nodes: (a) a transcription factor (TF) element (for example, but not limited to being, discretized into the states “absent” and “present” or as a continuous observable) in a first layer 1; (b) target genes TG1, TG2, TGn (for example, but not limited to being, discretized into the states “down” and “up” or as a continuous observable) in a second layer 2, and; (c) measurement nodes linked to the expression levels of the target genes in a third layer 3. The expression levels of the target genes can be determined by, for example, but not limited to, microarray probesets PS1,1, PS1,2, PS1,3, PS2,1, PSn,1, PSn,m (for example, but limited to being, discretized into the states “low” and “high” or as a continuous observable), but could also be any other gene expression measurements such as, for example, RNAseq or RT-qPCR. The expression of the target genes depends on the activation of the respective transcription factor element, and the measured intensities of the selected probesets depend in turn on the expression of the respective target genes. The model is used to calculate NFKB pathway activity by first determining probeset intensities, i.e., the expression level of the target genes, and calculating backwards in the model what the probability is that the transcription factor element must be present.

The present invention makes it possible to determine the activity of the NFkB cellular signaling pathway by (i) determining a level of an NFkB TF element in the sample, wherein the determining is based at least in part on evaluating a mathematical model relating expression levels of one or more target genes of the NFkB cellular signaling pathway, the transcription of which is controlled by the NFkB TF element, to the level of the NFkB TF element, and by (ii) inferring the activity of the NFkB cellular signaling pathway based on the determined level of the NFkB TF element in the sample. This preferably allows improving the possibilities of characterizing patients that have a cancer, e.g., a diffuse large B-cell lymphoma (DLBCL), a multiple myeloma, a cancer of another haematological origin, or a solid tumor, such as a breast, melanoma, or prostate tumor, which is at least partially driven by a deregulated NFkB cellular signaling pathway, and that are therefore likely to respond to inhibitors of the NFkB cellular signaling pathway. An important advantage of the present invention is that it makes it possible to determine the activity of the NFkB cellular signaling pathway using a single sample, rather than requiring a plurality of samples extracted at different points in time.

Generalized Workflow for Determining the Activity Level of NFkB Cellular Signaling An example flow chart illustrating an exemplary calculation of the activity level of NFkB cellular signaling from a sample isolated from a subject is provided in FIG. 3. First, the mRNA from a sample is isolated (11). Second, the mRNA expression levels of a unique set of at least three or more NFkB target genes, as described herein, are measured (12) using methods for measuring gene expression that are known in the art. Next, the calculation of transcription factor element (13) is calculated using a calibrated pathway model (14), wherein the calibrated pathway model compares the expression levels of the at least three or more target genes in the sample with expression levels of the at least three target genes in the calibrated pathway model which have been correlated with a level of a NFkB transcription factor element. Finally, the activity level of the NFkB cellular signaling pathway is calculated in the sample based on the calculated levels of NFkB transcription factor element in the sample (15). For example, the NFkB signaling pathway is determined to be active if the activity is above a certain threshold, and can be categorized as passive if the activity falls below a certain threshold.

Target Genes

The present invention utilizes the analyses of the expression levels of unique sets of target genes. Particularly suitable target genes are described in the following text passages as well as the examples below (see, e.g., Tables 3 to 6 below).

Thus, according to an embodiment the target genes are selected from the group consisting of the target genes listed in Table 3, Table 4, Table 5, or Table 6 below.

In particular, the unique set of target genes whose expression is analyzed in the model includes at least six target genes, for example, seven, eight, nine, ten, eleven or more, selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1.

In one embodiment, the at least six target genes are selected from BIRC3, CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, TNF, TNFAIP2, TRAF1, and VCAM1. In one embodiment, the at least six target genes comprise at least three target genes, for example, four, five, six or more, selected from CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, MMP9, NFKB2, NFKBIA, and TNFAIP2. In one embodiment, the at least three target genes are selected from CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2.

It has been found by the present inventors that the genes in the successively shorter lists become more and more probative for determining the activity of the NFkB cellular signaling pathway.

Measuring Levels of Gene Expression

Data derived from the unique set of target genes described herein is further utilized to determine the activity level of the NFkB cellular signaling pathway using the methods described herein.

Methods for analyzing gene expression levels in isolated samples are generally known. For example, methods such as Northern blotting, the use of PCR, nested PCR, quantitative real-time PCR (qPCR), RNA-seq, or microarrays can all be used to derive gene expression level data. All methods known in the art for analyzing gene expression of the target genes are contemplated herein.

Methods of determining the expression product of a gene using PCR based methods may be of particular use. In order to quantify the level of gene expression using PCR, the amount of each PCR product of interest is typically estimated using conventional quantitative real-time PCR (qPCR) to measure the accumulation of PCR products in real time after each cycle of amplification. This typically utilizes a detectible reporter such as an intercalating dye, minor groove binding dye, or fluorogenic probe whereby the application of light excites the reporter to fluoresce and the resulting fluorescence is typically detected using a CCD camera or photomultiplier detection system, such as that disclosed in U.S. Pat. No. 6,713,297 which is hereby incorporated by reference.

In some embodiments, the probes used in the detection of PCR products in the quantitative real-time PCR (qPCR) assay can include a fluorescent marker. Numerous fluorescent markers are commercially available. For example, Molecular Probes, Inc. (Eugene, Oreg.) sells a wide variety of fluorescent dyes. Non-limiting examples include Cy5, Cy3, TAMRA, R6G, R110, ROX, JOE, FAM, Texas Red™, and Oregon Green™. Additional fluorescent markers can include IDT ZEN Double-Quenched Probes with traditional 5′ hydrolysis probes in qPCR assays. These probes can contain, for example, a 5 FAM dye with either a 3′ TAMRA Quencher, a 3′ Black Hole Quencher (BHQ, Biosearch Technologies), or an internal ZEN Quencher and 3′ Iowa Black Fluorescent Quencher (IBFQ).

Fluorescent dyes useful according to the invention can be attached to oligonucleotide primers using methods well known in the art. For example, one common way to add a fluorescent label to an oligonucleotide is to react an N-Hydroxysuccinimide (NHS) ester of the dye with a reactive amino group on the target. Nucleotides can be modified to carry a reactive amino group by, for example, inclusion of an allyl amine group on the nucleobase. Labeling via allyl amine is described, for example, in U.S. Pat. Nos. 5,476,928 and 5,958,691, which are incorporated herein by reference. Other means of fluorescently labeling nucleotides, oligonucleotides and polynucleotides are well known to those of skill in the art.

Other fluorogenic approaches include the use of generic detection systems such as SYBR-green dye, which fluoresces when intercalated with the amplified DNA from any gene expression product as disclosed in U.S. Pat. Nos. 5,436,134 and 5,658,751 which are hereby incorporated by reference.

Another useful method for determining target gene expression levels includes RNA-seq, a powerful analytical tool used for transcriptome analyses, including gene expression level difference between different physiological conditions, or changes that occur during development or over the course of disease progression.

Another approach to determine gene expression levels includes the use of microarrays for example RNA and DNA microarray, which are well known in the art. Microarrays can be used to quantify the expression of a large number of genes simultaneously.

Calibrated Pathway Model

As contemplated herein, the expression levels of the unique set of target genes described herein are used to calculate the level NFkB transcription factor element using a calibrated pathway model as further described below. The calibrated pathway model compares the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the calibrated pathway model which define a level of NFkB transcription factor element.

As contemplated herein, the calibrated pathway model is based on the application of a mathematical model. For example, the calibrated model can be based on a probabilistic model, for example a Bayesian network, or a linear or pseudo-linear model.

In one embodiment, the calibrated pathway model is a probabilistic model incorporating conditional probabilistic relationships that compare the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the calibrated pathway model which define a level NFkB transcription factor element to determine the level of the NFkB transcription factor element in the sample. In one embodiment, the probabilistic model is a Bayesian network model.

In an alternative embodiment, the calibrated pathway model can be a linear or pseudo-linear model. In an embodiment, the linear or pseudo-linear model is a linear or pseudo-linear combination model.

A non-limiting exemplary flow chart for a calibrated pathway model is shown in FIG. 4. As an initial step, the training data for the mRNA expression levels is collected and normalized. The data can be collected using, for example microarray probeset intensities (101), real-time PCR Cq values (102), raw RNAseq reads (103), or alternative measurement modalities (104) known in the art. The raw expression level data can then be normalized for each method, respectively, by normalization using a normalization algorithm, for example, frozen robust military analysis (fRMA) or MAS5.0 (111), normalization to average Cq of reference genes (112), normalization of reads into reads/fragments per kilobase of transcript per million mapped reads (RPKM/FPKM) (113), or normalization to w.r.t. reference genes/proteins (114). This normalization procedure leads to a normalized probeset intensity (121), normalized Cq values (122), normalized RPKM/FPKM (123), or normalized measurement (124) for each method, respectively, which indicate target gene expression levels within the training samples.

Once the training data has been normalized, a training sample ID or IDs (131) is obtained and the training data of these specific samples is obtained from one of the methods for determining gene expression (132). The final gene expression results from the training sample are output as training data (133). All of the data from various training samples are incorporated to calibrate the model (including for example, thresholds, CPTs, for example in the case of the probabilistic or Bayesian network, weights, for example, in the case of the linear or pseudo-linear model, etc) (144). In addition, the pathway's target genes and measurement nodes (141) are used to generate the model structure for example, as described in FIG. 2 (142). The resulting model structure (143) of the pathway is then incorporated with the training data (133) to calibrate the model (144), wherein the gene expression levels of the target genes is indicative of the transcription factor element activity. As a result of the transcription factor element calculations in the training samples, a calibrated pathway model (145) is calculated which assigns the NFkB cellular signaling pathway activity level for a subsequently examined sample of interest, for example from a subject with a cancer, based on the target gene expression levels in the training samples.

Transcription Factor Element Calculation

A non-limiting exemplary flow chart for calculating the Transcription Factor Element activity level is provided in FIG. 5. The expression level data (test data) (163) from a sample isolated from a subject is input into the calibrated pathway model (145). The mathematical model may be a probabilistic model, for example a Bayesian network model, a linear model, or pseudo-linear model.

The mathematical model may be a probabilistic model, for example a Bayesian network model, based at least in part on conditional probabilities relating the NFkB TF element and expression levels of the at least six target genes of the NFkB cellular signaling pathway measured in the sample of the subject, or the mathematical model may be based at least in part on one or more linear combination(s) of expression levels of the at least six target genes of the NFkB cellular signaling pathway measured in the sample of the subject. In particular, the determining of the activity of the NFkB cellular signaling pathway may be performed as disclosed in the published international patent application WO 2013/011479 A2 (“Assessment of cellular signaling pathway activity using probabilistic modeling of target gene expression”), and incorporated herein by reference. Briefly, the data is entered into a Bayesian network (BN) inference engine call (for example, a BNT toolbox) (154). This leads to a set of values for the calculated marginal BN probabilities of all the nodes in the BN (155). From these probabilities, the transcription factor (IT) node's probability (156) is determined and establishes the TF's element activity level (157).

Alternatively, the mathematical model may be a linear model. For example, a linear model can be used as described in the published international patent application WO 2014/102668 A2 (“Assessment of cellular signaling pathway activity using linear combination(s) of target gene expressions”), the contents of which are herewith incorporated in their entirety. Further details regarding the calculating/determining of cellular signaling pathway activity using mathematical modeling of target gene expression can also be found in Verhaegh W. et al., “Selection of personalized patient therapy through the use of knowledge-based computational models that identify tumor-driving signal transduction pathways”, Cancer Research, Vol. 74, No. 11, 2014, pages 2936 to 2945. Briefly, the data is entered into a calculated weighted linear combination score (w/c) (151). This leads to a set of values for the calculated weighted linear combination score (152). From these weighted linear combination scores, the transcription factor (TF) node's weighted linear combination score (153) is determined and establishes the TF's element activity level (157).

Procedure for Discretized Observables

A non-limiting exemplary flow chart for calculating the activity level of a NFkB cellular signaling pathway as a discretized observable is shown in FIG. 6. First, the test sample is isolated and given a test sample ID (161). Next, the test data for the mRNA expression levels is collected and normalized (162). The test data can be collected using the same methods as discussed for the training samples in FIG. 5, using microarray probeset intensities (101), real-time PCR Cq values (102), raw RNAseq reads (103), or an alternative measurement modalities (104). The raw expression level data can then be normalized for each method, respectively, by normalization using an algorithm, for example fRMA or MAS5.0 (111), normalization to average Cq of reference genes (112), normalization of reads into RPKM/FPKM (113), and normalization to w.r.t. reference genes/proteins (114). This normalization procedure leads to a normalized probeset intensity (121), normalized Cq values (122), normalized RPKM/FPKM (123), or normalized measurement (124) for each method, respectively.

Once the test data has been normalized, the resulting test data (163) is analyzed in a thresholding step (164) based on the calibrated pathway model (145), resulting in the thresholded test data (165). In using discrete observables, in one non-limiting example, every expression above a certain threshold is, for example, given a value of 1 and values below the threshold are given a value of 0, or in an alternative embodiment, the probability mass above the threshold as described herein is used as a thresholded value. Based on the calibrated pathway model, this value represents the TF's element activity level (157), which is then used to calculate the pathway's activity level (171). The final output gives the pathway's activity level (172) in the test sample being examined from the subject.

Procedure for Continuous Observables

A non-limiting exemplary flow chart for calculating the activity level of a NFkB cellular signaling pathway as a continuous observable is shown in FIG. 7. First, the test sample is isolated and given a test sample ID (161). Next, the test data for the mRNA expression levels is collected and normalized (162). The test data can be collected using the same methods as discussed for the training samples in FIG. 5, using microarray probeset intensities (101), real-time PCR Cq values (102), raw RNAseq reads (103), or an alternative measurement modalities (104). The raw expression level data can then be normalized for each method, respectively, by normalization using an algorithm, for example fRMA (111), normalization to average Cq of reference genes (112), normalization of reads into RPKM/FPKM (113), and normalization to w.r.t. reference genes/proteins (114). This normalization procedure leads to a normalized probeset intensity (121), normalized Cq values (122), normalized RPKM/FPKM (123), or normalized measurement (124) for each method, respectively.

Once the test data has been normalized, the resulting test data (163) is analyzed in the calibrated pathway model (145). In using continuous observables, as one non-limiting example, the expression levels are converted to values between 0 and 1 using a sigmoid function as described in further detail below. The transcription factor element calculation as described herein is used to interpret the test data in combination with the calibrated pathway model, the resulting value represents the TF's element activity level (157), which is then used to calculate the pathway's activity level (171). The final output then gives the pathway's activity level (172) in the test sample.

Kits for Calculating NFkB Signaling Pathway Activity

In some embodiments, the present invention utilizes kits comprising primer and probe sets for the analyses of the expression levels of unique sets of target genes (see Target Gene discussion above). Particularly suitable oligo sequences for use as primers and probes for inclusion in a kit are described in the following text passages (see, e.g., Tables 1 and 2).

Also contemplated herein is a kit for measuring the expression levels of at least six or more NFkB cellular signaling pathway target genes, for example, seven, eight, nine, ten, eleven, twelve, or more target genes as described herein. In one embodiment, the kit includes one or more components, for example probes, for example labeled probes, and/or PCR primers, for measuring the expression levels of at least six target genes, at least seven target genes, at least eight target genes, or at least nine or more target genes selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1. In one embodiment, the kit includes one or more components for measuring the expression levels of at least six target genes, at least seven target genes, at least eight target genes, or at least nine or more target genes selected from BIRC3, CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, TNF, TNFAIP2, TRAF1, and VCAM1. In one embodiment, the one or more components comprise one or more components for measuring the expression levels of at least three target genes, at least four target genes, at least five target genes, or at least six or more target genes selected from CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, 1L8, MMP9, NFKB2, NFKBIA, and TNFAIP2.

In one embodiment, the one or more components comprise one or more components for measuring the expression levels of at least three target genes, at least four target genes, at least five target genes, or at least six or more target genes selected from CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2.

In one embodiment, the kit includes one or more components for measuring the expression levels of at least six or more NFkB cellular signaling pathway target genes, wherein the at least six or more target genes are selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IN8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1, and the one or more components is selected from the PCR primers and probes listed in Table 1. In one embodiment, the at least six or more target genes are selected from BIRC3, CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, TNF, TNFAIP2, TRAF1, and VCAM1, and the one or more components is selected from the PCR primers and probes listed in Table 1. In one embodiment, the at least six target genes comprise at least three target genes selected from CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, MMP9, NFKB2, NFKBIA, and TNFAIP2, and the one or more components is selected from the PCR primers and probes listed in Table 1. In one embodiment, the at least three target genes are selected from CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2, and the one or more components is selected from the PCR primers and probes listed in Table 1. The PCR primers for each gene are designated Forward (For) and Reverse (Rev) and the probes for detection of the PCR products for each gene are labeled Probe. In one non-limiting embodiment, the probes listed in Table 2 are labeled with a 5′ FAM dye with an internal ZEN Quencher and 3′ Iowa Black Fluorescent Quencher (IBFQ).

TABLE 1
Non-limiting example of primers and probes for a
kit for measuring gene expression of NFkB target
genes.
SEQ
ID Target
Oligo Name Sequence 5′-3′ No. Gene
CXCL8_For1 GGCAGCCTTCCTGATTTCTG 44 IL8
(a.k.a.
CXCL8)
CXCL8_Rev1 GGTGGAAAGGTTTGGAGTATG 45 IL8
(a.k.a.
CXCL8)
CXCL8_Probe1 CAGCTCTGTGTGAAGGTGCAGTTT 46 IL8
(a.k.a.
CXCL8)
BIRC3_For GGAGTTCATCCGTCAAGTTCAA 47 BIRC3
BIRC3_Rev TTTCATCTCCTGGGCTGTC 48 BIRC3
BIRC3_Probe ACCCTCATCTACTTGAACAGCTGCT 49 BIRC3
ICAM1_For TGCAGTAATACTGGGGAACC 50 ICAM1
ICAM1_Rev GCTTCGTCAGAATCACGTTGG 51 ICAM1
ICAM1_Probe TGACCATCTACAGCTTTCCGGCG 52 ICAM1
NFKBIA_For CCTCCACTCCATCCTGAAG 53 NFKBIA
NFKBIA_Rev GCCATGGATAGAGGCTAAGT 54 NFKBIA
NFKBIA_Probe ACCAACTACAATGGCCACACGTG 55 NFKBIA
PTGS2_For TTTCAAGACAGATCATAAGCGAG 56 PTGS2
PTGS2_Rev AGCCAGAGTTTCACCGTAAATA 57 PTGS2
PTGS2_Probe TGGGCCATGGGGTGGACTTAAAT 58 PTGS2

In one non-limiting embodiment, the kit includes one or more components for measuring the expression levels of control genes, wherein the one or more components includes a PCR primer set and probe for at least one of the control genes listed in Table 2. The PCR primers for each gene are designated Forward (F) and Reverse (R) and the probes for detection of the PCR products for each gene are labeled Probe (P or FAM). In one non-limiting embodiment, the probes listed in Table 2 are labeled with a 5′ FAM dye with an internal ZEN Quencher and 3′ Iowa Black Fluorescent Quencher (IBFQ).

TABLE 2
Oligo Sequences for Controls
SEQ Refer-
ID ence
Oligo Name Sequence 5′-3′ No. gene
Hum_BACT_F1 CCAACCGCGAGAAGATGA 59 ACTB
Hum_BACT_R1 CCAGAGGCGTACAGGGATAG 60 ACTB
Hum_BACT_P1 CCATGTACGTTGCTATCCAGGCT 61 ACTB
Hum_POLR2A_ AGTCCTGAGTCCGGATGAA 62 POLR2A
F1
Hum_POLR2A_ CCTCCCTCAGTCGTCTCT 63 POLR2A
R1
Hum_POLR2A_ TGACGGAGGGTGGCATCAAATACC 64 POLR2A
P1
Hum_PUM1_F2 GCCAGCTTGTCTTCAATGAAAT 65 PUM1
Hum_PUM1_R2 CAAAGCCAGCTTCTGTTCAAG 66 PUM1
Hum_PUM1_P1 ATCCACCATGAGTTGGTAGGCAGC 67 PUM1
Hum_TBP_F1 GCCAAGAAGAAAGTGAACATCAT 68 TBP
Hum_TBP1_R1 ATAGGGATTCCGGGAGTCAT 69 TBP
Hum_TBP_P1 TCAGAACAACAGCCTGCCACCTTA 70 TBP
K-ALPHA-1_F1 TGACTCCTTCAACACCTTCTTC 71 TUBA1B
K-ALPHA-1_R1 TGCCAGTGCGAACTTCAT 72 TUBA1B
K-ALPHA-1_ CCGGGCTGTGTTTGTAGACTTGGA 73 TUBA1B
FAM1
ALAS1_F1 AGCCACATCATCCCTGT 74 ALAS1
ALAS1_R1 CGTAGATGTTATGTCTGCTCAT 75 ALAS1
ALAS1_FAM1 TTTAGCAGCATCTGCAACCCGC 76 ALAS1
Hum_HPRT1_F1 GAGGATTTGGAAAGGGTGTTTATT 77 HPRT1
Hum_HPRT1_R1 ACAGAGGGCTACAATGTGATG 78 HPRT1
Hum_HPRT1_P1 ACGTCTTGCTCGAGATGTGATGAAGG 79 HPRT1
Hum_RPLP0_F2 TAAACCCTGCGTGGCAAT 80 RPLP0
Hum_RPLP0_R2 ACATTTCGGATAATCATCCAATAGT 81 RPLP0
TG
Hum_RPLP0_P1 AAGTAGTTGGACTTCCAGGTCGCC 82 RPLP0
Hum_B2M_F1 CCGTGGCCTTAGCTGTG 83 B2M
Hum_B2M_R1 CTGCTGGATGACGTGAGTAAA 84 B2M
Hum_B2M_P1 TCTCTCTTTCTGGCCTGGAGGCTA 85 B2M
TPT1_F_PACE AAATGTTAACAAATGTGGCAATTAT 86 TPT1
TPT1_R_PACE AACAATGCCTCCACTCCAAA 87 TPT1
TPT1_P_PACE TCCACACAACACCAGGACTT 88 TPT1
EEF1A1_F_ TGAAAACTACCCCTAAAAGCCA 89 EEF1A1
PACE
EEF1A1_R_ TATCCAAGACCCAGGCATACT 90 EEF1A1
PACE
EEF1A1_P_ TAGATTCGGGCAAGTCCACCA 91 EEF1A1
PACE
RPL41_F_PACE AAGATGAGGCAGAGGTCCAA 92 RPL41
RPL41_R_PACE TCCAGAATGTCACAGGTCCA 93 RPL41
RPL41_P_PACE TGCTGGTACAAGTTGTGGGA 94 RPL41

As contemplated herein, the one or more components for measuring the expression levels of the particular target genes can be selected from the group consisting of: an DNA array chip, an oligonucleotide array chip, a protein array chip, an antibody, a plurality of probes, for example, labeled probes, a set of RNA reverser-transcriptase sequencing components, and/or RNA or DNA, including cDNA, amplification primers. In one embodiment, the kit includes a set of labeled probes directed to the cDNA sequence of the targeted genes as described herein contained in a standardized 96-well plate. In one embodiment, the kit further includes a non-transitory storage medium containing instructions that are executable by a digital processing device to perform a method according to the present invention as described herein.

In accordance with another disclosed aspect, a kit for measuring expression levels of at least six target genes of the NFkB cellular signaling pathway in a sample of a subject comprises:

one or more components for determining the expression levels of the at least six target genes of the NFkB cellular signaling pathway,

wherein the one or more components are, for example, selected from the group consisting of: an DNA array chip, an oligonucleotide array chip, a protein array chip, an antibody, a plurality of probes, RNA sequencing and a set of primers, and

wherein the at least six target genes of the NFkB cellular signaling pathway are selected from the group consisting of: BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1. In one embodiment, the at least six target genes are selected from BIRC3, CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, TNF, TNFAIP2, TRAF1, and VCAM1. In one embodiment, the at least six target genes comprise at least three target genes selected from CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, MMP9, NFKB2, NFKBIA, and TNFAIP2. In one embodiment, the at least three target genes are selected from CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2.

In one embodiment, the PCR cycling is performed in a microtiter or multi-well plate format. This format, which uses plates comprising multiple reaction wells, not only increases the throughput of the assay process, but is also well adapted for automated sampling steps due to the modular nature of the plates and the uniform grid layout of the wells on the plates. Common microtiter plate designs useful according to the invention have, for example 12, 24, 48, 96, 384, or more wells, although any number of wells that physically fit on the plate and accommodate the desired reaction volume (usually 10-100 μl) can be used according to the invention. Generally, the 96 or 384 well plate format can be utilized. In one embodiment, the method is performed in a 96 well plate format. In one embodiment, the method is performed in a 384 well plate format.

In one embodiment, the kit comprises an apparatus comprising a digital processor. In another embodiment, the kit comprises a non-transitory storage medium storing instructions that are executable by a digital processing device. In yet another embodiment, the kit comprises a computer program comprising program code means for causing a digital processing device to perform the methods described herein.

In an additional embodiment, the kit contains one or more components that are for example selected from the group consisting of: a DNA array chip, an oligonucleotide array chip, a protein array chip, an antibody, a plurality of probes, RNA sequencing and a set of primers. In one embodiment, the kit contains a plurality of probes. In one embodiment, the kit contains a set of primers. In one embodiment, the kit contains a 6, 12, 24, 48, 96, or 384-well PCR plate. In one embodiment, the kit includes a 96 well PCR plate. In one embodiment, the kit includes a 384 well PCR plate.

In one embodiment, a kit for measuring the expression levels of NFkB cellular signaling target genes comprises a 96-well plate and a set of labeled probes for detecting expression of a set of NFkB cellular signaling pathway genes comprising BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1. In one embodiment, a kit for measuring the expression levels of NFkB cellular signaling target genes comprises a 96-well plate and a set of labeled probes for detecting expression of a set of NFkB cellular signaling pathway genes comprising BIRC3, CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, TNF, TNFAIP2, TRAF1, and VCAM1. In one embodiment, a kit for measuring the expression levels of NFkB cellular signaling target genes comprises a 96-well plate and a set of labeled probes for detecting expression of a set of NFkB cellular signaling pathway genes comprising CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, 118, MMP9, NFKB2, NFKBIA, and TNFAIP2. In one embodiment, a kit for measuring the expression levels of NFkB cellular signaling target genes comprises a 96-well plate and a set of labeled probes for detecting expression of a set of NFkB cellular signaling pathway genes comprising CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2.

In one embodiment, the kit further comprises an instruction manual measuring the expression levels of NFkB cellular signaling target genes. In another embodiment, the kit further comprises an access code to access a computer program code for calculating the NFkB cellular signaling pathway activity in the sample. In a further embodiment, the kit further comprises an access code to access a website for calculating the NFkB cellular signaling pathway activity in the sample according to the methods described above.

Target Gene Expression Level Determination Procedure

A non-limiting exemplary flow chart for deriving target gene expression levels from a sample isolated from a subject is shown in FIG. 8. In one exemplary embodiment, samples are received and registered in a laboratory. Samples can include, for example, Formalin-Fixed, Paraffin-Embedded (FFPE) samples (181) or fresh frozen (FF) samples (180). FF samples can be directly lysed (183). For FFPE samples, the paraffin can be removed with a heated incubation step upon addition of Proteinase K (182). Cells are then lysed (183), which destroys the cell and nuclear membranes which makes the nucleic acid (NA) available for further processing. The nucleic acid is bound to a solid phase (184) which could for example, be beads or a filter. The nucleic acid is then washed with washing buffers to remove all the cell debris which is present after lysis (185). The clean nucleic acid is then detached from the solid phase with an elution buffer (186). The DNA is removed by DNAse treatment to ensure that only RNA is present in the sample (187). The nucleic acid sample can then be directly used in the RT-qPCR sample mix (188). The RT-qPCR sample mixes contains the RNA sample, the RT enzyme to prepare cDNA from the RNA sample and a PCR enzyme to amplify the cDNA, a buffer solution to ensure functioning of the enzymes and can potentially contain molecular grade water to set a fixed volume of concentration. The sample mix can then be added to a multiwell plate (i.e., 96 well or 384 well plate) which contains dried RT-qPCR assays (189). The RT-qPCR can then be run in a PCR machine according to a specified protocol (190). An example PCR protocol includes i) 30 minutes at 50° C.; ii) 5 minutes at 95° C.; iii) 15 seconds at 95° C.; iv) 45 seconds at 60° C.; v) 50 cycles repeating steps iii and iv. The Cq values are then determined with the raw data by using the second derivative method (191). The Cq values are exported for analysis (192).

Computer Programs and Computer Implemented Methods

As contemplated herein, the calculation of NFkB signaling in the sample is performed on a computerized device having a processor capable of executing a readable program code for calculating the NFkB cellular signaling pathway activity in the sample according to the methods described above. Accordingly, the computerized device can include means for receiving expression level data, wherein the data is expression levels of at least three target genes derived from the sample, a means for calculating the level of NFkB transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least three target genes in the sample with expression levels of the at least three target genes in the model which have been correlated with a level NFkB transcription factor element; a means for calculating the NFkB cellular signaling in the sample based on the calculated levels of NFkB transcription factor element in the sample; and a means for assigning a NFkB cellular signaling pathway activity probability or status to the calculated NFkB cellular signaling in the sample, and a means for displaying the NFkB signaling pathway activity probability or status.

In accordance with another disclosed aspect, a non-transitory storage medium stores instructions that are executable by a digital processing device to perform a method according to the present invention as described herein. The non-transitory storage medium may be a computer-readable storage medium, such as a hard drive or other magnetic storage medium, an optical disk or other optical storage medium, a random access memory (RAM), read only memory (ROM), flash memory, or other electronic storage medium, a network server, or so forth. The digital processing device may be a handheld device (e.g., a personal data assistant or smartphone), a notebook computer, a desktop computer, a tablet computer or device, a remote network server, or so forth.

In accordance with another disclosed aspect, an apparatus comprises a digital processor configured to perform a method according to the present invention as described herein.

In accordance with another disclosed aspect, a computer program comprises program code means for causing a digital processing device to perform a method according to the present invention as described herein. The digital processing device may be a handheld device (e.g., a personal data assistant or smartphone), a notebook computer, a desktop computer, a tablet computer or device, a remote network server, or so forth.

In one embodiment, a computer program or system is provided for predicting the activity status of a NFkB transcription factor element in a human cancer sample that includes a means for receiving data corresponding to the expression level of one or more NFkB target genes in a sample from a host. In some embodiments, a means for receiving data can include, for example, a processor, a central processing unit, a circuit, a computer, or the data can be received through a website.

In one embodiment, a computer program or system is provided for predicting the activity status of a NFkB transcription factor element in a human cancer sample that includes a means for displaying the NFkB pathway signaling status in a sample from a host. In some embodiments, a means for displaying can include a computer monitor, a visual display, a paper print out, a liquid crystal display (LCD), a cathode ray tube (CRT), a graphical keyboard, a character recognizer, a plasma display, an organic light-emitting diode (OLED) display, or a light emitting diode (LED) display, or a physical print out.

In accordance with another disclosed aspect, a signal represents a determined activity of a NFkB cellular signaling pathway in a subject, wherein the determined activity results from performing a method according to the present invention as described herein. The signal can be a digital signal or it can be an analog signal.

In one aspect of the present invention, a computer implemented method is provided for predicting the activity status of a NFkB signaling pathway in a human cancer sample performed by a computerized device having a processor comprising: a) calculating an activity level of a NFkB transcription factor element in a human cancer sample, wherein the level of the NFkB transcription factor element in the human cancer sample is associated with the activity of a NFkB cellular signaling pathway, and wherein the level of the NFkB transcription factor element in the human cancer sample is calculated by i) receiving data on the expression levels of at least six target genes derived from the human cancer sample, wherein the NFkB transcription factor controls transcription of the at least six target genes, and wherein the at least six target genes are selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, 118, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1; ii) calculating the activity level of the NFkB transcription factor element in the human cancer sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least six target genes in the human cancer sample with expression levels of the at least six target genes in the model which have been correlated with an activity level of a NFkB transcription factor element; b) calculating the NFkB cellular signaling pathway activity in the human cancer sample based on the calculated NFkB transcription factor element activity level in the human cancer sample; c) assigning a NFkB cellular signaling pathway activity status to the NFkB cellular signaling pathway in the human cancer sample, wherein the activity status is indicative of either an active NFkB cellular signaling pathway or a passive NFkB cellular signaling pathway; and d) displaying the NFkB signaling pathway activity status.

In one aspect of the invention, a system is provided for determining the activity level of a NFkB cellular signaling pathway in a subject comprising a) a processor capable of calculating an activity level of NFkB transcription factor element in a sample derived from the subject; b) a means for receiving data, wherein the data is an expression level of at least six target genes derived from the sample; c) a means for calculating the level of the NFkB transcription factor element in the sample using a calibrated pathway model, wherein the calibrated pathway model compares the expression levels of the at least six target genes in the sample with expression levels of the at least six target genes in the model which define an activity level of NFkB transcription factor element; d) a means for calculating the activity level of the NFkB cellular signaling pathway in the sample based on the calculated activity level of NFkB transcription factor element in the sample; a means for assigning a NFkB cellular signaling pathway activity status to the calculated activity level of the NFkB cellular signaling pathway in the sample, wherein the activity status is indicative of either an active NFkB cellular signaling pathway or a passive NFkB cellular signaling pathway; and f) a means for displaying the NFkB signaling pathway activity status.

NFkB Mediated Diseases and Disorders and Methods of Treatment

As contemplated herein, the methods and apparatuses of the present invention can be utilized to assess NFkB cellular signaling pathway activity in a subject, for example a subject suspected of having, or having, a disease or disorder wherein the status of the NFkB signaling pathway is probative, either wholly or partially, of disease presence or progression. In one embodiment, provided herein is a method of treating a subject comprising receiving information regarding the activity status of a NFkB cellular signaling pathway derived from a sample isolated from the subject using the methods described herein and administering to the subject a NFkB inhibitor if the information regarding the level of NFkB cellular signaling pathway is indicative of an active NFkB signaling pathway. In a particular embodiment, the NFkB cellular signaling pathway activity indication is set at a cutoff value of odds of the NFkB cellular signaling pathway being active of 10:1, 5:1, 4:1, 2:1, 1:1, 1:2, 1:4, 1:5, 1:10. NFkB inhibitors are known and include, but are not limited to, DHMEQ, bindarit, Bortesomib or BU-32 (proteazome inhibitors), BMS-345541, or glucocorticoids.

In a particular embodiment, the subject is suffering from, or suspected to have a benign or malignant tumor: a cancer or sarcoma or hematological malignancy, or brain tumor, for example, but not limited to, a primary tumor or a metastatic tumor, a solid tumor, for example, melanoma, lung cancer (including lung adenocarcinoma, basal cell carcinoma, squamous cell carcinoma, large cell carcinoma, bronchioloalveolar carcinoma, bronchogenic carcinoma, non-small-cell carcinoma, small cell carcinoma, mesothelioma); breast cancer (including ductal carcinoma, lobular carcinoma, inflammatory breast cancer, clear cell carcinoma, mucinous carcinoma, serosal cavities breast carcinoma); colorectal cancer (colon cancer, rectal cancer, colorectal adenocarcinoma): anal cancer; pancreatic cancer (including pancreatic adenocarcinoma, islet cell carcinoma, neuroendocrine tumors); prostate cancer; prostate adenocarcinoma; ovarian carcinoma (ovarian epithelial carcinoma or surface epithelial-stromal tumor including serous tumor, endometrioid tumor and mucinous cystadenocarcinoma, sex-cord-stromal tumor); liver and bile duct carcinoma (including hepatocellular carcinoma, cholangiocarcinoma, hemangioma); esophageal carcinoma (including esophageal adenocarcinoma and squamous cell carcinoma); oral and oropharyngeal squamous cell carcinoma; salivary gland adenoid cystic carcinoma; bladder cancer; bladder carcinoma; carcinoma of the uterus (including endometrial adenocarcinoma, ocular, uterine papillary serous carcinoma, uterine clear-cell carcinoma, uterine sarcomas and leiomyosarcomas, mixed mullerian tumors); glioma, glioblastoma, medulloblastoma, and other tumors of the brain; kidney cancers (including renal cell carcinoma, clear cell carcinoma, Wilm's tumor); cancer of the head and neck (including squamous cell carcinomas); cancer of the stomach (gastric cancers, stomach adenocarcinoma, gastrointestinal stromal tumor); testicular cancer; germ cell tumor; neuroendocrine tumor, cervical cancer; carcinoids of the gastrointestinal tract, breast, and other organs; signet ring cell carcinoma: mesenchymal tumors including sarcomas, fibrosarcomas, haemangioma, angiomatosis, haemangiopericytoma, pseudoangiomatous stromal hyperplasia, myofibroblastoma, fibromatosis, inflammatory myofibroblastic tumor, lipoma, angiolipoma, granular cell tumor, neurofibroma, schwannoma, angiosarcoma, liposarcoma, rhabdomyosarcoma, osteosarcoma, leiomyoma, leiomysarcoma, skin, including melanoma, cervical, retinoblastoma, head and neck cancer, pancreatic, brain, thyroid, testicular, renal, bladder, soft tissue, adenal gland, urethra, cancers of the penis, myxosarcoma, chondrosarcoma, osteosarcoma, chordoma, malignant fibrous histiocytoma, lymphangiosarcoma, mesothelioma, squamous cell carcinoma: epidermoid carcinoma, malignant skin adnexal tumors, adenocarcinoma, hepatoma, hepatocellular carcinoma, renal cell carcinoma, hypernephroma, cholangiocarcinoma, transitional cell carcinoma, choriocarcinoma, seminoma, embryonal cell carcinoma, glioma anaplastic; glioblastoma multiforme, neuroblastoma, medulloblastoma, malignant meningioma, malignant schwannoma, neurofibrosarcoma, parathyroid carcinoma, medullary carcinoma of thyroid, bronchial carcinoid, pheochromocytoma, Islet cell carcinoma, malignant carcinoid, malignant paraganglioma, melanoma, Merkel cell neoplasm, cystosarcoma phylloide, salivary cancers, thymic carcinomas, and cancers of the vagina among others.

In one embodiment, the methods described herein are useful for treating a host suffering from a lymphoma or lymphocytic or myelocytic proliferation disorder or abnormality. For example, the subject suffering from a Hodgkin Lymphoma of a Non-Hodgkin Lymphoma. For example, the subject can be suffering from a Non-Hodgkin Lymphoma such as, but not limited to: an AIDS-Related Lymphoma; Anaplastic Large-Cell Lymphoma; Angioimmunoblastic Lymphoma; Blastic NK-Cell Lymphoma; Burkitt's Lymphoma; Burkitt-like Lymphoma (Small Non-Cleaved Cell Lymphoma); Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma; Cutaneous T-Cell Lymphoma; Diffuse Large B-Cell Lymphoma; Enteropathy-Type T-Cell Lymphoma; Follicular Lymphoma; Hepatosplenic Gamma-Delta T-Cell Lymphoma; Lymphoblastic Lymphoma; Mantle Cell Lymphoma; Marginal Zone Lymphoma; Nasal T-Cell Lymphoma; Pediatric Lymphoma; Peripheral T-Cell Lymphomas; Primary Central Nervous System Lymphoma; T-Cell Leukemias; Transformed Lymphomas; Treatment-Related T-Cell Lymphomas; or Waldenstrom's Macroglobulinemia.

Alternatively, the subject may be suffering from a Hodgkin Lymphoma, such as, but not limited to: Nodular Sclerosis Classical Hodgkin's Lymphoma (CHL); Mixed Cellularity CHL; Lymphocyte-depletion CHL; Lymphocyte-rich CHL; Lymphocyte Predominant Hodgkin Lymphoma; or Nodular Lymphocyte Predominant HL.

In one embodiment, the subject may be suffering from a specific T-cell, a B-cell, or a NK-cell based lymphoma, proliferative disorder, or abnormality. For example, the subject can be suffering from a specific T-cell or NK-cell lymphoma, for example, but not limited to: Peripheral T-cell lymphoma, for example, peripheral T-cell lymphoma and peripheral T-cell lymphoma not otherwise specified (PTCL-NOS); anaplastic large cell lymphoma, for example anaplastic lymphoma kinase (ALK) positive, ALK negative anaplastic large cell lymphoma, or primary cutaneous anaplastic large cell lymphoma; angioimmunoblastic lymphoma; cutaneous T-cell lymphoma, for example mycosis fungoides, Sfzary syndrome, primary cutaneous anaplastic large cell lymphoma, primary cutaneous CD30+ T-cell lymphoproliferative disorder; primary cutaneous aggressive epidermotropic CD8+ cytotoxic T-cell lymphoma; primary cutaneous gamma-delta T-cell lymphoma; primary cutaneous small/medium CD4+ T-cell lymphoma. and lymphomatoid papulosis; Adult T-cell Leukemia/Lymphoma (ATLL); Blastic NK-cell Lymphoma; Enteropathy-type T-cell lymphoma; Hematosplenic gamma-delta T-cell Lymphoma; Lymphoblastic Lymphoma; Nasal NK/T-cell Lymphomas; Treatment-related T-cell lymphomas; for example lymphomas that appear after solid organ or bone marrow transplantation; T-cell prolymphocytic leukemia; T-cell large granular lymphocytic leukemia; Chronic lymphoproliferative disorder of NK-cells; Aggressive NK cell leukemia; Systemic EBV+ T-cell lymphoproliferative disease of childhood (associated with chronic active EBV infection); Hydroa vacciniforme-like lymphoma; Adult T-cell leukemia/lymphoma; Enteropathy-associated T-cell lymphoma; Hepatosplenic T-cell lymphoma; or Subcutaneous panniculitis-like T-cell lymphoma.

Alternatively, the subject may be suffering from a specific B-cell lymphoma or proliferative disorder such as, but not limited to: multiple myeloma; Diffuse large B cell lymphoma; Follicular lymphoma; Mucosa-Associated Lymphatic Tissue lymphoma (MALT); Small cell lymphocytic lymphoma; Mantle cell lymphoma (MCL); Burkitt lymphoma; Mediastinal large B cell lymphoma; Waldenström macroglobulinemia; Nodal marginal zone B cell lymphoma (NMZL); Splenic marginal zone lymphoma (SMZL); Intravascular large B-cell lymphoma; Primary effusion lymphoma; or Lymphomatoid granulomatosis; Chronic lymphocytic leukemia/small lymphocytic lymphoma; B-cell prolymphocytic leukemia; Hairy cell leukemia; Splenic lymphoma/leukemia, unclassifiable; Splenic diffuse red pulp small B-cell lymphoma; Hairy cell leukemia-variant; Lymphoplasmacytic lymphoma; Heavy chain diseases, for example, Alpha heavy chain disease, Gamma heavy chain disease, Mu heavy chain disease; Plasma cell myeloma; Solitary plasmacytoma of bone; Extraosseous plasmacytoma; Primary cutaneous follicle center lymphoma; T cell/histiocyte rich large B-cell lymphoma; DLBCL associated with chronic inflammation; Epstein-Barr virus (EBV)+ DLBCL of the elderly; Primary mediastinal (thymic) large B-cell lymphoma; Primary cutaneous DLBCL, leg type; ALK+ large B-cell lymphoma; Plasmablastic lymphoma; Large B-cell lymphoma arising in HHV8-associated multicentric; Castleman disease; B-cell lymphoma, unclassifiable, with features intermediate between diffuse large B-cell lymphoma and Burkitt lymphoma; B-cell lymphoma, unclassifiable, with features intermediate between diffuse large B-cell lymphoma and classical Hodgkin lymphoma; Nodular sclerosis classical Hodgkin lymphoma; Lymphocyte-rich classical Hodgkin lymphoma; Mixed cellularity classical Hodgkin lymphoma; or Lymphocyte-depleted classical Hodgkin lymphoma.

In one embodiment, the subject is suffering from a leukemia. For example, the subject may be suffering from an acute or chronic leukemia of a lymphocytic or myelogenous origin, such as, but not limited to: Acute lymphoblastic leukemia (ALL); Acute myelogenous leukemia (AML); Chronic lymphocytic leukemia (CLL); Chronic myelogenous leukemia (CMI): juvenile myelomonocytic leukemia (JMML); hairy cell leukemia (HCL); acute promyelocytic leukemia (a subtype of AML); T-cell prolymphocytic leukemia (TPLL); large granular lymphocytic leukemia; or Adult T-cell chronic leukemia; large granular lymphocytic leukemia (LGL). In one embodiment, the patient suffers from an acute myelogenous leukemia, for example an undifferentiated AML (M0); myeloblastic leukemia (M1; with/without minimal cell maturation); myeloblastic leukemia (M2; with cell maturation); promyelocytic leukemia (M3 or M3 variant [M3V]); myelomonocytic leukemia (M4 or M4 variant with eosinophilia [M4E]); monocytic leukemia (M5); erythroleukemia (M6): or megakaryoblastic leukemia (M7).

In a particular embodiment, the subject is suffering, or suspected to be suffering from, a breast cancer, lung cancer, a colon cancer, pancreatic cancer, or brain cancer. In a particular embodiment, the subject is suffering from, or suspected to be suffering from, a breast cancer.

The sample(s) to be used in accordance with the present invention can be an extracted sample, that is, a sample that has been extracted from the subject. Examples of the sample include, but are not limited to, a tissue, cells, blood and/or a body fluid of a subject. It can be, e.g., a sample obtained from a cancer lesion, or from a lesion suspected for cancer, or from a metastatic tumor, or from a body cavity in which fluid is present which is contaminated with cancer cells (e.g., pleural or abdominal cavity or bladder cavity), or from other body fluids containing cancer cells, and so forth, for example, via a biopsy procedure or other sample extraction procedure. The cells of which a sample is extracted may also be tumorous cells from hematologic malignancies (such as leukemia or lymphoma). In some cases, the cell sample may also be circulating tumor cells, that is, tumor cells that have entered the bloodstream and may be extracted using suitable isolation techniques, e.g., apheresis or conventional venous blood withdrawal. Aside from blood, a body fluid of which a sample is extracted may be urine, gastrointestinal contents, or an extravasate.

In one aspect of the present invention, the methods and apparatuses described herein are used to identify an active NFkB cellular signaling pathway in a subject suffering from a cancer, and administering to the subject an anti-cancer agent, for example a NFkB inhibitor, selected from, but not limited to, DHMEQ, bindarit, Bortesomib or BU-32 (proteazome inhibitors), BMS-345541, or glucocorticoids. Another aspect of the present invention relates to a method (as described herein), further comprising:

determining whether the NFkB cellular signaling pathway is operating abnormally in the subject based on the calculated activity of the NFkB cellular signaling pathway in the subject.

Here, the term “abnormally” denotes disease-promoting activity of the NFkB cellular signaling pathway, for example, a tumor-promoting activity.

The present invention also relates to a method (as described herein) further comprising:

recommending prescribing a drug, for example a NFkB inhibitor, for the subject that corrects for abnormal operation of the NFkB cellular signaling pathway,

wherein the recommending is performed if the NFkB cellular signaling pathway is determined to be operating abnormally in the subject based on the calculated/determined activity of the NFkB cellular signaling pathway.

The present invention also relates to a method (as described herein), wherein the calculating/determining comprises:

calculating the activity of the NFkB cellular signaling pathway in the subject based at least on expression levels of two, three or more target genes of a set of target genes of the NFkB cellular signaling pathway measured in the sample of the subject.

The present invention as described herein can, e.g., also advantageously be used in connection with:

diagnosis based on the determined activity of the NFkB cellular signaling pathway in the subject;

prognosis based on the determined activity of the NFkB cellular signaling pathway in the subject;

drug prescription based on the determined activity of the NFkB cellular signaling pathway in the subject;

prediction of drug efficacy based on the determined activity of the NFkB cellular signaling pathway in the subject;

prediction of adverse effects based on the determined activity of the NFkB cellular signaling pathway in the subject;

monitoring of drug efficacy;

drug development;

assay development;

pathway research;

cancer staging;

enrollment of the subject in a clinical trial based on the determined activity of the NFkB cellular signaling pathway in the subject;

selection of subsequent test to be performed; and

selection of companion diagnostics tests.

Further advantages will be apparent to those of ordinary skill in the art upon reading and understanding the attached figures, the following description and, in particular, upon reading the detailed examples provided herein below.

It shall be understood that an embodiment of the present invention can also be any combination of the dependent claims or above embodiments with the respective independent claim.

These and other aspects of the invention will be apparent from and elucidated with reference to the embodiments described hereinafter.

EXAMPLES

The following examples merely illustrate exemplary methods and selected aspects in connection therewith. The teaching provided therein may be used for constructing several tests and/or kits, e.g., to detect, predict and/or diagnose the abnormal activity of the NFKB cellular signaling pathways. Furthermore, upon using methods as described herein drug prescription can advantageously be guided, drug response prediction and monitoring of drug efficacy (and/or adverse effects) can be made, drug resistance can be predicted and monitored, e.g., to select subsequent test(s) to be performed (like a companion diagnostic test). The following examples are not to be construed as limiting the scope of the present invention.

Example 1: Mathematical Model Construction

As described in detail in the published international patent application WO 2013/011479 A2 (“Assessment of cellular signaling pathway activity using probabilistic modeling of target gene expression”), by constructing a probabilistic model, e.g., a Bayesian network model, and incorporating conditional probabilistic relationships between expression levels of at least six target genes of a cellular signaling pathway, herein, the NFkB cellular signaling pathway, and the level of a transcription factor (TF) element, herein, the NFkB TF element, the TF element controlling transcription of the at least six target genes of the cellular signaling pathway, such a model may be used to determine the activity of the cellular signaling pathway with a high degree of accuracy. Moreover, the probabilistic model can be readily updated to incorporate additional knowledge obtained by later clinical studies, by adjusting the conditional probabilities and/or adding new nodes to the model to represent additional information sources. In this way, the probabilistic model can be updated as appropriate to embody the most recent medical knowledge.

In another easy to comprehend and interpret approach described in detail in the published international patent application WO 2014/102668 A2 (“Assessment of cellular signaling pathway activity using linear combination(s) of target gene expressions”), the activity of a cellular signaling pathway, herein, the NFkB cellular signaling pathway, may be determined by constructing and evaluating a linear or (pseudo-)linear model incorporating relationships between expression levels of at least six target genes of the cellular signaling pathway and the level of a transcription factor (TF) element, herein, the NFkB TF element, the TF element controlling transcription of the at least six target genes of the cellular signaling pathway, the model being based at least in part on one or more linear combination(s) of expression levels of the at least six target genes.

In both approaches, the expression levels of the at least six target genes may, for example, be measurements of the level of mRNA, which can be the result of, e.g., (RT)-PCR and microarray techniques using probes associated with the target genes mRNA sequences, and of RNA-sequencing. In another embodiment, the expression levels of the at least six target genes can be measured by protein levels, e.g., the concentrations and/or activity of the protein(s) encoded by the target genes.

The aforementioned expression levels may optionally be converted in many ways that might or might not suit the application better. For example, four different transformations of the expression levels, e.g., microarray-based mRNA levels, may be:

    • “continuous data”, i.e., expression levels as obtained after preprocessing of microarrays using well known algorithms such as MAS5.0 and fRMA,
    • “z-score”, i.e., continuous expression levels scaled such that the average across all samples is 0 and the standard deviation is 1,
    • “discrete”, i.e., every expression above a certain threshold is set to t and below it to 0 (e.g., the threshold for a probeset may be chosen as the (weighted) median of its value in a set of a number of positive and the same number of negative clinical samples),
    • “fuzzy”, i.e., the continuous expression levels are converted to values between 0 and 1 using a sigmoid function of the following format: 1/(1+exp((thr−expr)/se)), with expr being the continuous expression levels, thr being the threshold as mentioned before and se being a softening parameter influencing the difference between 0 and 1.

One of the simplest linear models that can be constructed is a model having a node representing the transcription factor (TF) element, herein, the NFkB TF element, in a first layer and weighted nodes representing direct measurements of the target genes expression levels, e.g., by one probeset that is particularly highly correlated with the particular target gene, e.g., in microarray or (q)PCR experiments, in a second layer. The weights can be based either on calculations from a training data set or based on expert knowledge. This approach of using, in the case where possibly multiple expression levels are measured per target gene (e.g., in the case of microarray experiments, where one target gene can be measured with multiple probesets), only one expression level per target gene is particularly simple. A specific way of selecting the one expression level that is used for a particular target gene is to use the expression level from the probeset that is able to separate active and passive samples of a training data set the best. One method to determine this probeset is to perform a statistical test, e.g., the t-test, and select the probeset with the lowest p-value. The training data set's expression levels of the probeset with the lowest p-value is by definition the probeset with the least likely probability that the expression levels of the (known) active and passive samples overlap. Another selection method is based on odds-ratios. In such a model, one or more expression level(s) are provided for each of the at least six target genes and the one or more linear combination(s) comprise a linear combination including for each of the at least six target genes a weighted term, each weighted term being based on only one expression level of the one or more expression level(s) provided for the respective target gene. If the only one expression level is chosen per target gene as described above, the model may be called a “most discriminant probesets” model.

In an alternative to the “most discriminant probesets” model, it is possible, in the case where possibly multiple expression levels are measured per target gene, to make use of all the expression levels that are provided per target gene. In such a model, one or more expression level(s) are provided for each of the at least six target genes and the one or more linear combination(s) comprise a linear combination of all expression levels of the one or more expression level(s) provided for the at least six target genes. In other words, for each of the at least six target genes, each of the one or more expression level(s) provided for the respective target gene may be weighted in the linear combination by its own (individual) weight. This variant may be called an “all probesets” model. It has an advantage of being relatively simple while making use of all the provided expression levels.

Both models as described above have in common that they are what may be regarded as “single-layer” models, in which the level of the TF element is calculated based on a linear combination of expression levels of the one or more probeset of the one or more target genes.

After the level of the TF element, herein, the NFkB TF element, has been determined by evaluating the respective model, the determined TF element level can be thresholded in order to infer the activity of the cellular signaling pathway, herein, the NFkB cellular signaling pathway. An exemplary method to calculate such an appropriate threshold is by comparing the determined TF element levels w/c of training samples known to have a passive cellular signaling pathway and training samples with an active cellular signaling pathway. A method that does so and also takes into account the variance in these groups is given by using a threshold

thr = σ wlc pas ⁢ μ wlc act + σ wlc act ⁢ μ wlc pas σ wlc pas + σ wlc act ( 1 )

where σ and μ are the standard deviation and the mean of the determined TF element levels wlc for the training samples. In case only a small number of samples are available in the active and/or passive training samples, a pseudocount may be added to the calculated variances based on the average of the variances of the two groups:

v ~ = v wlc act + v wlc pas 2 ⁢ v ~ wlc act = x ⁢ v ~ + ( n act - 1 ) ⁢ v wlc act x + n act - 1 ⁢ v ~ wlc pas = x ⁢ v ~ + ( n pas - 1 ) ⁢ v wlc pas x + n pas - 1 ( 2 )

where ν is the variance of the determined TF element levels wlc of the groups, x is a positive pseudocount, e.g., 1 or 10, and nact and tgxrs are the number of active and passive samples, respectively The standard deviation a can next be obtained by taking the square root of the variance v.

The threshold can be subtracted from the determined TF element levels wlc for ease of interpretation, resulting in a cellular signaling pathway's activity score in which negative values correspond to a passive cellular signaling pathway and positive values correspond to an active cellular signaling pathway.

As an alternative to the above-described “single-layer” models, a “two-layer” may also be used in an example. In such a model, a summary value is calculated for every target gene using a linear combination based on the measured intensities of its associated probesets (“first (bottom) layer”). The calculated summary value is subsequently combined with the summary values of the other target genes of the cellular signaling pathway using a further linear combination (“second (upper) layer”). Again, the weights can be either learned from a training data set or based on expert knowledge or a combination thereof. Phrased differently, in the “two-layer” model, one or more expression level(s) are provided for each of the at least six target genes and the one or more linear combination(s) comprise for each of the at least six target genes a first linear combination of all expression levels of the one or more expression level(s) provided for the respective target gene (“first (bottom) layer”). The model is further based at least in part on a further linear combination including for each of the at least six target genes a weighted term, each weighted term being based on the first linear combination for the respective target gene (“second (upper) layer”).

The calculation of the summary values can, in an exemplary version of the “two-layer” model, include defining a threshold for each target gene using the training data and subtracting the threshold from the calculated linear combination, yielding the target gene summary. Here the threshold may be chosen such that a negative target gene summary value corresponds to a down-regulated target gene and that a positive target gene summary value corresponds to an up-regulated target gene. Also, it is possible that the target gene summary values are transformed using, e.g., one of the above-described transformations (fuzzy, discrete, etc.), before they are combined in the “second (upper) layer”.

After the level of the TF element has been determined by evaluating the “two-layer” model, the determined TF element level can be thresholded in order to infer the activity of the cellular signaling pathway, as described above.

In the following, the models described above are collectively denoted as “(pseudo-)linear” models. A more detailed description of the training and use of probabilistic models, e.g., a Bayesian network model, is provided in Example 3 below.

Example 2: Selection of Target Genes

A transcription factor (TF) is a protein complex (i.e., a combination of proteins bound together in a specific structure) or a protein that is able to regulate transcription from target genes by binding to specific DNA sequences, thereby controlling the transcription of genetic information from DNA to mRNA. The mRNA directly produced due to this action of the TF complex is herein referred to as a “direct target gene” (of the transcription factor). Cellular signaling pathway activation may also result in more secondary gene transcription, referred to as “indirect target genes”. In the following, (pseudo-)linear models or Bayesian network models (as exemplary mathematical models) comprising or consisting of direct target genes as direct links between cellular signaling pathway activity and mRNA level, are exemplified, however the distinction between direct and indirect target genes is not always evident. Herein, a method to select direct target genes using a scoring function based on available scientific literature data is presented. Nonetheless, an accidental selection of indirect target genes cannot be ruled out due to limited information as well as biological variations and uncertainties. In order to select the target genes, the MEDLINE database of the National Institute of Health accessible at “www.ncbi.nlm.nih.gov/pubmed” and herein further referred to as “Pubmed” was employed to generate a lists of target genes. Furthermore, three additional lists of target genes were selected based on the probative nature of their expression.

Publications containing putative NFkB target genes were searched for by using queries such as (“NFkB” AND “target gene”) in the period of the second and third quarter of 2013. The resulting publications were further analyzed manually following the methodology described in more detail below.

Specific cellular signaling pathway mRNA target genes were selected from the scientific literature, by using a ranking system in which scientific evidence for a specific target gene was given a rating, depending on the type of scientific experiments in which the evidence was accumulated. While some experimental evidence is merely suggestive of a gene being a direct target gene, like for example an mRNA increasing as detected by means of an increasing intensity of a probeset on a microarray of a cell line in which it is known that the NFkB cellular signaling pathway is active, other evidence can be very strong, like the combination of an identified NFkB cellular signaling pathway TF binding site and retrieval of this site in a chromatin immunoprecipitation (ChIP) assay after stimulation of the specific cellular signaling pathway in the cell and increase in mRNA after specific stimulation of the cellular signaling pathway in a cell line.

Several types of experiments to find specific cellular signaling pathway target genes can be identified in the scientific literature:

    • 1. ChIP experiments in which direct binding of a TF of the cellular signaling pathway of interest to its binding site on the genome is shown. Example: By using chromatin immunoprecipitation (ChIP) technology subsequently putative functional NFkB TF binding sites in the DNA of cell lines with and without active induction of the NFkB cellular signaling pathway, e.g., by stimulation with tumor necrosis factor α (TNFα) or lipopolysaccharide (LPS), were identified, as a subset of the binding sites recognized purely based on nucleotide sequence. Putative functionality was identified as ChIP-derived evidence that the TF was found to bind to the DNA binding site.
    • 2. Electrophoretic Mobility Shift (EMSA) assays which show in vitro binding of a TF to a fragment of DNA containing the binding sequence. Compared to ChIP-based evidence EMSA-based evidence is less strong, since it cannot be translated to the in vivo situation.
    • 3. Stimulation of the cellular signaling pathway and measuring mRNA expression using a microarray, RNA sequencing, quantitative PCR or other techniques, using NFkB cellular signaling pathway-inducible cell lines and measuring mRNA profiles measured at least one, but preferably several time points after induction—in the presence of cycloheximide, which inhibits translation to protein, thus the induced mRNAs are assumed to be direct target genes.
    • 4. Similar to 3, but alternatively measure the mRNAs expression further downstream with protein abundance measurements, such as western blot.
    • 5. Identification of TF binding sites in the genome using a bioinformatics approach. Example for the NFkB TF element: Using the NFkB binding motif 5′-GGGRNWYYCC-3′ (R: A or G, N: any nucleotide, W: A or T, Y: C or T), a software program was run on the human genome sequence, and potential binding sites were identified, both in gene promoter regions and in other genomic regions.
    • 6. Similar as 3, only in the absence of cycloheximide.
    • 7. Similar to 4, only in the absence of cycloheximide.

In the simplest form one can give every potential gene 1 point for each of these experimental approaches in which the gene was identified as being a target gene of the NFkB family of transcription factors. Using this relative ranking strategy, one can make a list of most reliable target genes.

Alternatively, ranking in another way can be used to identify the target genes that are most likely to be direct target genes, by giving a higher number of points to the technology that provides most evidence for an in vivo direct target gene. In the list above, this would mean 8 points for experimental approach 1), 7 for 2), and going down to 1 point for experimental approach 8). Such a list may be called a “general list of target genes”.

Despite the biological variations and uncertainties, the inventors assumed that the direct target genes are the most likely to be induced in a tissue-independent manner. A list of these target genes may be called an “evidence curated list of target genes”. Such an evidence curated list of target genes has been used to construct computational models of the NFkB cellular signaling pathway that can be applied to samples coming from different tissue sources.

The following will illustrate exemplary how the selection of an evidence curated target gene list specifically was constructed for the NFkB cellular signaling pathway.

A scoring function was introduced that gave a point for each type of experimental evidence, such as ChIP, EMSA, differential expression, knock down/out, luciferase gene reporter assay, sequence analysis, that was reported in a publication. The same experimental evidence is sometimes mentioned in multiple publications resulting in a corresponding number of points, e.g., two publications mentioning a ChIP finding results in twice the score that is given for a single ChIP finding. Further analysis was performed to allow only for genes that had diverse types of experimental evidence and not only one type of experimental evidence, e.g., differential expression. Finally, an evidence score was calculated for all putative NFkB target genes and all putative NFkB target genes with an evidence score of 5 or more were selected (shown in Table 3). The cut-off level of 5 was chosen heuristically as providing strong enough evidence.

A further selection of the evidence curated list of target genes (listed in Table 3) was made by the inventors. The target genes of the evidence curated list that were proven to be more probative in determining the activity of the NFkB cellular signaling pathway from the training samples were selected. The selection was performed using a combination of the literature evidence score and training results using two different datasets. Three rankings were made based on the evidence score, highest score ranked first and every point less result in a lower rank, and the “soft” odds ratios of all included probesets (see Table 3) calculated as described herein using the GSE12195 and E-MTAB-1312 datasets. The absolute values of the log 2 transformed “soft” odds ratios were used to rank the probesets; the highest odds ratio were ranked first, et cetera. As described herein, samples from ABC DLBCL samples from GSE12195 were chosen as active NFkB training samples whereas the normal samples from this dataset were chosen as the passive NFkB training samples. In addition, a second set of “soft” odds ratios were calculated using samples from E-MTAB-1312, an alternative NFkB training dataset, the control samples were used as passive NFkB samples and samples stimulated with different concentrations of TNFα for 2 hours were selected as active NFkB training samples. Based on the average rank a preferred set of target genes having at least one associated probeset with an average ranking of less than or equal to 20 was selected for the “19 target genes shortlist”. A more preferred set of target genes having an average ranking of less than or equal to 15 was selected for the “13 target genes shortlist”. A most preferred set of target genes having an average ranking of less than or equal to 12 were selected for the “7 target genes shortlist”. The 19 target genes shortlist, the 13 target genes shortlist, and the 7 target genes shortlist are shown in Tables 4 to 6, respectively.

TABLE 3
“Evidence curated list of target genes” of the NFkB cellular signaling pathway used in
the NFkB cellular signaling pathway models and associated probesets used to measure the mRNA
expression level of the target genes.
Target gene Score Probeset Target gene Score Probeset
BCL2L1 5 206665_s_at IL6 10 205207_at
212312_at IL8 12 202859_x_at
215037_s_at 211506_s_at
231228_at IRF1 5 202531_at
BIRC3 11 210538_s_at 238725_at
230499_at MMP9 6 203936_s_at
CCL2 8 216598_s_at NFKB2 14 207535_s_at
CCL3 8 205114_s_at 209636_at
CCL4 5 204103_at 211524_at
CCL5 11 1405_i_at NFKBIA 10 201502_s_at
1555759_a_at NFKBIE 7 203927_at
204655_at PTGS2 13 1554997_a_at
CCL20 5 205476_at 204748_at
CCL22 5 207861_at SELE 5 206211_at
CX3CL1 6 203687_at STAT5A 7 203010_at
823_at TNF 9 207113_s_at
CXCL1 12 204470_at TNFAIP2 5 202509_s_at
CXCL2 15 1569203_at 202510_s_at
209774_x_at TNIP1 12 207196_s_at
230101_at 243423_at
CXCL3 9 207850_at TRAF1 9 205599_at
ICAM1 10 202637_s_at 235116_at
202638_s_at VCAM1 6 203868_s_at
215485_s_at
IL1B 5 205067_at
39402_at

TABLE 4
“19 target genes shortlist” of target
genes of the NFkB cellular
signaling pathway based on the literature
evidence score and “soft” odds ratios
on GSE12195 and E-MAT-1312.
CXCL2
ICAM1
IL6
CCL5
NFKBIA
IL8
TNFAIP2
CXCL3
MMP9
NFKB2
CCL20
CCL2
CXCL1
TNF
IRF1
TRAF1
NFKBIE
VCAM1
BIRC3

TABLE 5
“13 target genes shortlist” of target genes of the
NFkB cellular signaling pathway
based on the literature
evidence score and “soft” odds ratios
on GSE12195 and E-MAT-1312.
CXCL2
ICAM1
IL6
CCL5
NFKBIA
IL8
TNFAIP2
CXCL3
MMP9
NFKB2
CCL20
CCL2
CXCL1

TABLE 6
“7 target genes shortlist” of target genes of the
NFkB cellular signaling pathway
based on the literature
evidence score and “soft” odds ratios
on GSE12195 and E-MAT-1312.
CXCL2
ICAM1
IL6
CCL5
NFKBIA
IL8
TNFAIP2

Example 3: Training and Using the Mathematical Model

Before the mathematical model can be used to infer the activity of the cellular signaling pathway, herein, the NFkB cellular signaling pathway, the model must be appropriately trained.

If the mathematical model is a probabilistic model, e.g., a Bayesian network model, based at least in part on conditional probabilities relating the NFkB TF element and expression levels of the at least six target genes of the NFkB cellular signaling pathway measured in a sample, the training may preferably be performed as described in detail in the published international patent application WO 2013/011479 A2 (“Assessment of cellular signaling pathway activity using probabilistic modeling of target gene expression”).

If the mathematical model is based at least in part on one or more linear combination(s) of expression levels of the at least six target genes of the NFkB cellular signaling pathway measured in the sample, the training may preferably be performed as described in detail in the published international patent application WO 2014/102668 A2 (“Assessment of cellular signaling pathway activity using linear combination(s) of target gene expressions”).

Herein, an exemplary Bayesian network model as shown in FIG. 2 was first used to model the transcriptional program of the NFkB cellular signaling pathway in a simple manner. The model consists of three types of nodes: (a) a transcription factor (TF) element (with states “absent” and “present”) in a first layer 1; (b) target genes TG1, TG2, TGn (with states “down” and “up”) in a second layer 2, and; (c) measurement nodes linked to the expression levels of the target genes in a third layer 3 These can be microarray probesets PS1,1, PS1,2, PS1,3, PS2,1, PSn,1, PSn,m (with states “low” and “high”), as preferably used herein, but could also be other gene expression measurements such as RNAseq or RT-qPCR.

A suitable implementation of the mathematical model, herein, the exemplary Bayesian network model, is based on microarray data. The model describes (i) how the expression levels of the target genes depend on the activation of the TF element, and (ii) how probeset intensities, in turn, depend on the expression levels of the respective target genes. For the latter, probeset intensities may be taken from fRMA pre-processed Affymetrix HG-U133Plus2.0 microarrays, which are widely available from the Gene Expression Omnibus (GEO, www.ncbi.nlm.nih.gov/geo) and ArrayExpress (www.ebi.ac.uk/arrayexpress).

As the exemplary Bayesian network model is a simplification of the biology of a cellular signaling pathway, herein, the NFkB cellular signaling pathway, and as biological measurements are typically noisy, a probabilistic approach was opted for, i.e., the relationships between (i) the TF element and the target genes, and (ii) the target genes and their respective probesets, are described in probabilistic terms. Furthermore, it was assumed that the activity of the oncogenic cellular signaling pathway which drives tumor growth is not transiently and dynamically altered, but long term or even irreversibly altered. Therefore the exemplary Bayesian network model was developed for interpretation of a static cellular condition. For this reason complex dynamic cellular signaling pathway features were not incorporated into the model.

Once the exemplary Bayesian network model is built and calibrated (see below), the model can be used on microarray data of a new sample by entering the probeset measurements as observations in the third layer 3, and inferring backwards in the model what the probability must have been for the TF element to be “present”. Here, “present” is considered to be the phenomenon that the TF element is bound to the DNA and is controlling transcription of the cellular signaling pathway's target genes, and “absent” the case that the TF element is not controlling transcription. This probability is hence the primary read-out that may be used to indicate activity of the cellular signaling pathway, herein, the NFkB cellular signaling pathway, which can next be translated into the odds of the cellular signaling pathway being active by taking the ratio of the probability of it being active vs. it being inactive (i.e., the odds are given by p/(1−p), where p is the predicted probability of the cellular signaling pathway being active).

In the exemplary Bayesian network model, the probabilistic relations have been made quantitative to allow for a quantitative probabilistic reasoning. In order to improve the generalization behavior across tissue types, the parameters describing the probabilistic relationships between (i) the TF element and the target genes have been carefully hand-picked. If the TF element is “absent”, it is most likely that the target gene is “down”, hence a probability of 0.95 is chosen for this, and a probability of 0.05 is chosen for the target gene being “up”. The latter (non-zero) probability is to account for the (rare) possibility that the target gene is regulated by other factors or that it is accidentally observed as being “up” (e.g. because of measurement noise). If the TF element is “present”, then with a probability of 0.70 the target gene is considered “up”, and with a probability of 0.30 the target gene is considered “down”. The latter values are chosen this way, because there can be several causes why a target gene is not highly expressed even though the TF element is present, e.g., because the gene's promoter region is methylated. In the case that a target gene is not up-regulated by the TF element, but down-regulated, the probabilities are chosen in a similar way, but reflecting the down-regulation upon presence of the TF element. The parameters describing the relationships between (ii) the target genes and their respective probesets have been calibrated on experimental data. For the latter, in this example, microarray data was used from patients samples which are known to have an active NFkB cellular signaling pathway whereas normal, healthy samples from the same dataset were used as inactive NFkB cellular signaling pathway samples, but this could also be performed using cell line experiments or other patient samples with known cellular signaling pathway activity status. The resulting conditional probability tables are given by:

A: for upregulated target genes
PSi,j = low PSi,j = high
TGi = down AL i , j + 1 AL i , j + AH i , j + 2 AH i , j + 1 AL i , j + AH i , j + 2
TGi = up PL i , j + 1 PL i , j + PH i , j + 2 PH i , j + 1 PL i , j + PH i , j + 2

B: for downregulated target genes
PSi,j = low PSi,j = high
TGi = down PL i , j + 1 PL i , j + PH i , j + 2 PH i , j + 1 PL i , j + PH i , j + 2
TGi = up AL i , j + 1 AL i , j + AH i , j + 2 AH i , j + 1 AL i , j + AH i , j + 2

In these tables, the variables ALi,j, AHi,j, PLi,j, and PHi,j indicate the number of calibration samples with an “absent” (A) or “present” (P) transcription complex that have a “low” (L) or “high” (H) probeset intensity, respectively. Dummy counts have been added to avoid extreme probabilities of 0 and 1.

To discretize the observed probeset intensities, for each probeset PSi,j a threshold ti,j was used, below which the observation is called “low”, and above which it is called “high”. This threshold has been chosen to be the (weighted) median intensity of the probeset in the used calibration dataset. Due to the noisiness of microarray data, a fuzzy method was used when comparing an observed probeset intensity to its threshold, by assuming a normal distribution with a standard deviation of 0.25 (on a log 2 scale) around the reported intensity, and determining the probability mass below and above the threshold. Herein, an odds ratio calculated in combination with a pseudo-count and using probability masses instead of deterministic measurement values is called a “soft” odds ratio.

Further details regarding the inferring of cellular signaling pathway activity using mathematical modeling of target gene expression can be found in Verhaegh W. et al., “Selection of personalized patient therapy through the use of knowledge-based computational models that identify tumor-driving signal transduction pathways”, Cancer Research, Vol. 74, No. 11, 2014, pages 2936 to 2945.

If instead of the exemplary Bayesian network described above, a (pseudo-)linear model as described in Example 1 above is employed, the weights indicating the sign and magnitude of the correlation between the nodes and a threshold to call whether a node is either “absent” or “present” would need to be determined before the model could be used to infer cellular signaling pathway activity in a test sample. One could use expert knowledge to fill in the weights and the threshold a priori, but typically the model would be trained using a representative set of training samples, of which preferably the ground truth is known, e.g. expression data of probesets in samples with a known “presen” transcription factor complex (=active cellular signaling pathway) or “absent” transcription factor complex (=passive cellular signaling pathway).

Known in the field are a multitude of training algorithms (e.g., regression) that take into account the model topology and changes the model parameters, here, the weights and the threshold, such that the model output, here, a weighted linear score, is optimized. Alternatively, it is also possible to calculate the weights directly from the expression observed levels without the need of an optimization algorithm.

A first method, named “black and white”-method herein, boils down to a ternary system, in which each weight is an element of the set {−1, 0, 1}. If this is put in a biological context, the −1 and 1 correspond to target genes or probesets that are down- and up-regulated in case of cellular signaling pathway activity, respectively. In case a probeset or target gene cannot be statistically proven to be either up- or down-regulated, it receives a weight of 0. In one example, a left-sided and right-sided, two sample t-test of the expression levels of the active cellular signaling pathway samples versus the expression levels of the samples with a passive cellular signaling pathway can be used to determine whether a probe or gene is up- or down-regulated given the used training data. In cases where the average of the active samples is statistically larger than the passive samples, i.e., the p-value is below a certain threshold, e.g., 0.3, the target gene or probeset is determined to be up-regulated. Conversely, in cases where the average of the active samples is statistically lower than the passive samples, the target gene or probeset is determined to be down-regulated upon activation of the cellular signaling pathway. In case the lowest p-value (left- or right-sided) exceeds the aforementioned threshold, the weight of the target gene or probeset can be defined to be 0.

A second method, named “log odds”-weights herein, is based on the logarithm (e.g., base e) of the odds ratio. The odds ratio for each target gene or probeset is calculated based on the number of positive and negative training samples for which the probeset/target gene level is above and below a corresponding threshold, e.g., the (weighted) median of all training samples. A pseudo-count can be added to circumvent divisions by zero. A further refinement is to count the samples above/below the threshold in a somewhat more probabilistic manner, by assuming that the probeset/target gene levels are e.g. normally distributed around its observed value with a certain specified standard deviation (e.g., 0.25 on a 2-log scale), and counting the probability mass above and below the threshold.

Herein, publically available data on the expression of patient samples from activated B-cell like (ABC), diffuse large B-cell lymphoma (DLBCL), which is known to have an active NFkB cellular signaling pathway, and normal cells that are known to have a passive NFkB cellular signaling pathway (GSE12195 available from the Gene Expression Omnibus (GEO, www.ncbi.nlm.nih.gov/geo, last accessed Oct. 9, 2013) was used as an example. Alternatively, one can use patient samples or cell lines stimulated with and deprived of NFkB activating agents such as TNFα and LPS or other inflammatory tissue versus normal tissue, e.g., E-MTAB-1312 or GSE16650.

FIGS. 9 to 12 show training results of the exemplary Bayesian network model based on the evidence curated list of target genes, the 19 target genes shortlist, the 13 target genes shortlist, and the 7 target genes shortlist of the NFkB cellular signaling pathway (see Tables 3 to 6), respectively. In the diagrams, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the NFkB cellular signaling pathway being active resp. inactive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/inactive are larger than the odds that it is “present”/active. The activated B-cell (ABC) group (group 1), which is known to have an active NFkB cellular signaling pathway, was assigned an active NFkB label, whereas the group encompassing the normal samples (group 7) known to have a passive NFkB cellular signaling pathway were labeled NFkB inactive. A perfect score for the training samples was achieved for all four models with all ABC being active and all normal samples having a passive NFkB cellular signaling pathway. Unsurprisingly, the probabilities of the training samples become less extreme as fewer target genes are included in the model. Within the same dataset, the healthy, unstimulated memory B-cells and naïve B-cells (groups 5 and 6, respectively) were correctly predicted to have a passive NFkB cellular signaling pathway with a few exceptions in the 19 and 7 target genes models. The vast majority of the other lymphoma samples in the germinal center B-cell (GCB) (group 4), follicular lymphoma (group 3), lymphoblastoid cell line (group 2) and all but one in further diffuse large B-cell lymphoma (DLBCL) samples with unknown subtype (group 8) were predicted to have an active NFkB cellular signaling pathway in all four models. For GCB, it is known that a high fraction of tumors (>50%) have a mutation in at least one NFkB regulatory genes, which is likely to correlate with aberrant NFkB activity (see, e.g., Campagno M. et al., “Mutations of multiple genes cause deregulation of NF-kappaB in diffuse large B-cell lymphoma”, Nature, Vol. 459, No. 7247, 2009, pages 717 to 721). Also other studies pointed out that constitutive NFkB activation is a common feature for most haematological malignacies (see, e.g., Keutgens A. et al., “Deregulated NF-kB activity in haematological malignacies”, Biochemical Pharmacology, Vol. 72, No. 9, 2006, pages 1069 to 1080), which might partially explain the high fraction of NFkB activity in these groups covering different hematological malignacies. (Legend: 1—ABC DLBCL; 2—Lymphoblastoid cell line; 3—Follicular lymphoma: 4—GCB DLBCL: 5—Memory-B-cells; 6—Naïve B-cells; 7—Normal: 8—DLBCL unknown subtype)

In the following, validation results of the trained exemplary Bayesian network model using the evidence curated list of target genes, the 19 target genes shortlist, the 13 target genes shortlist, and the 7 target genes shortlist, respectively, are shown in FIGS. 13 to 25.

FIG. 13 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 3) for diffuse large B-cell lymphoma (DLBCL) samples from GSE34171. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the NFkB cellular signaling pathway being active resp. inactive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/inactive are larger than the odds that it is “present”/active. All samples were predicted to have an active NFkB cellular signaling pathway. DLBCL lymphomas are known to have an aberrant NFkB activity (see, e.g., Keutgens A. et al., “Deregulated NF-kB activity in haematological malignancies”, Biochemical Pharmacology, Vol. 72, No. 9, 2006, pages 1069 to 1080).

FIGS. 14 to 17 show NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes, the 19 target genes shortlist, the 13 target genes shortlist, and the 7 target genes shortlist (see Tables 3 to 6), respectively, for normal human bronchial epithelial (NHBE) cell line samples from E-MTAB-1312, which were stimulated with different TNFα concentrations for different stimulation times. In the diagrams, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the NFkB cellular signaling pathway being active resp. inactive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/inactive are larger than the odds that it is “present”/active. A stimulation of only 0.5 h is apparently too short for the NFkB cellular signaling pathway to become active (groups 5, 9, and 13), whereas a stimulation for longer than 4 hours, here, 24 hours (groups 8, 12, and 16), appears to lower the NFkB cellular signaling pathway activity, which is expected to be due to asynchronous NFkB oscillations that for longer stimulation times result in a dampened net NFkB cellular signaling pathway activity (see, e.g., D. E. Nelson et al., “Oscillations in NF-κB Signaling Control the Dynamics of Gene Expression”, Science, Vol. 306, No. 5696, 2004, pages 704 to 708). The model using the evidence curated list of target genes shows an almost completely dampened NFkB cellular signaling pathway activity in the 24 hour samples, whereas the models using the 19 target genes shortlist, the 13 target genes shortlist, and the 7 target genes shortlist show a less strong decrease of NFkB cellular signaling pathway activity in the 24 hours samples. All control samples without TNFα stimulation (groups 1 to 4) were correctly predicted to have a passive NFkB cellular signaling pathway in all four models. There seemed to be not so much difference in cellular signaling pathway activity as a result of increased TNFα concentration as is apparent in the 2 and 4 hour stimulation; apparently all concentrations tested in this experiment were enough to have a full-blown NFkB cellular signaling pathway activity, even the lowest concentration. (Legend: 1—No TNFα (0.5 h); 2—No TNFα (2 h); 3—No TNFα (4 h); 4—No TNFα (24 h); 5—Low TNFα (0.5 h); 6—Low TNFα (2 h); 7—Low TNFα (4 h): 8—Low TNFα (24 h); 9—Medium TNFα (0.5 h); 10—Medium TNFα (2 h); 11—Medium TNFα (4 h); 12—Medium TNFα (24 h); 13—High TNFα (0.5 h); 14—High TNFα (2 h); 15—High TNFα (4 h); 16—High TNFα (24 h))

FIG. 18 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 3) for THP-1 monocytic cells. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the NFkB cellular signaling pathway being active resp. inactive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/inactive are larger than the odds that it is “present”/active. The THP-1 cell line is known to express NFkB cellular signaling pathway activity upon stimulation with an immune response inducing agents such as lipopolysaccharide (LPS). The NFkB cellular signaling pathway activity in these monocytic cells is predicted to be low without LPS stimulation (group 1). Upon stimulation of these cells with LPS, the NFkB cellular signaling pathway activity is amplified (group 2). Coenzyme Q10 (CoQ10) has been reported to have anti-inflammatory effects, however, the effect on NFkB cellular signaling pathway activity was reported to be limited (see, e.g., C. Schmelzer and F. Döring, “Identification of LPS-inducible genes downregulated by ubiquinone in human THP-1 monocytes”, Biofactors, Vol. 36, No. 3, 2010, pages 222 to 228). This is also reflected in the high predicted NFkB cellular signaling pathway activities in THP-1 cells treated with CoQ10 and stimulated with LPS (group 3). (Legend: 1—No LPS: 2—LPS stimulation; 3—LPS stimulation+coenzyme Q10)

FIGS. 19 to 22 show NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes, the 19 target genes shortlist, the 13 target genes shortlist, and the 7 target genes shortlist (see Tables 3 to 6), respectively, for colon samples from GSE4183. In the diagrams, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the NFkB cellular signaling pathway being active resp. inactive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/inactive are larger than the odds that it is “present”/active. Most normal samples (group 1) were rightfully predicted with a low probability of NFkB cellular signaling pathway activity by the model using the evidence curated list of target genes, nevertheless the cellular signaling pathway activity for normal samples seems to be higher than expected from other datasets in the 19 target genes shortlist, the 13 target genes shortlist, and the 7 target genes shortlist. On the other hand, all inflammatory bowel disease (IBD) (group 2) samples were predicted by all four models to have an active NFkB cellular signaling pathway significantly higher than the normal samples, which is as expected owing to the inflamed status of the colon in these patients and the NFkB cellular signaling pathway being activated as a result of inflammation. In addition, it is clear from all four models that the NFkB cellular signaling pathway is more active in the more progressed colorectal carcinomas (CRC) (group 4) compared to the benign adenomas (group 2), which might be a result of progression of the tumor into a more malignant tumor resulting in more mutations, inflammation as a result of the progressed tumor, or infiltration of white blood cells as a result of the immune response to the later stage cancers. Potentially, the NFkB cellular signaling pathway activity score might be used to predict the likelihood an adenoma will progress to become malignant. (Legend: 1—Normal colon; 2—IBD; 3—Adenoma; 4—CRC)

FIG. 23 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 3) for breast cancer cell lines from GSE10890. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the NFkB cellular signaling pathway being active resp. inactive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/inactive are larger than the odds that it is “present”/active. Some of the breast cancer cell lines with still an unknown pathway driving cell survival and proliferation (groups 1 and 2) were identified as having an aberrantly active NFkB cellular signaling pathway, which may be causative for cell survival and proliferation. In the 3rd group that was previously identified as having an active Wnt cellular signaling pathway (see the published international patent application WO 2013/011479 A2 “Assessment of cellular signaling pathway activity using probabilistic modeling of target gene expression”) no NFkB cellular signaling pathway active samples were found. (Legend: 1 and 2—Unknown cellular signaling pathway driven cell lines; 3: Wnt cellular signaling pathway driven cell lines)

FIG. 24 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 3) for ovarian samples from GSE20565. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the NFkB cellular signaling pathway being active resp. inactive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/inactive are larger than the odds that it is “present”/active. The fraction of predicted NFkB cellular signaling pathway active samples is significantly higher in primary cancers (groups 1 and 2) compared to breast metastasis in the ovary (groups 3 and 4), p=6.0e-5 (Fisher's exact test). Chronic inflammation has been associated with tumor initiation and progression. Recurring inflammatory processes in the ovaries due to ovulation, endometriosis and pelvic infections have been shown to be correlated with NFkB cellular signaling pathway active tumors (see, e.g., Alvero A. B., “Recent insights into the role of NF-kappaB in ovarian carcinogenesis”, Genome Medicine, Vol. 2, No. 8, 2010, page 56, and Guo R. X. et al., “Increased staining for phosphorylated AKT and nuclear factor-kappaB p65 and their relationship with prognosis in epithelial ovarian cancer”, Pathology International, Vol. 58, No. 12, 2008, pages 746 to 756). In the ovary, carcinogenesis has been linked to inflammatory processes, such as repeated ovulation, endometriosis and pelvic infections, possibly resulting in a higher fraction of NFkB cellular signaling pathway active tumors originating in the ovary compared to the breast. (Legend: 1—Primary ovarian carcinoma; 2—Plausible primary ovarian carcinoma; 3—Breast metastasis in ovary; 4—Plausible breast metastasis in ovary)

FIG. 25 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 3) for breast cancer samples from E-MTAB-1006. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the NFkB cellular signaling pathway being active resp. inactive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/inactive are larger than the odds that it is “present”/active. The average of the logit NFkB odds ratio is significantly higher in the inflammatory breast cancer samples (IBC) (group 1) compared to the non-inflamed breast cancers (nIBC) (group 2), p<0.01 (two-sample t-test). This is likely a reflection of the high inflammatory state in IBC compared to the nIBC. However, the predicted NFkB cellular signaling pathway activities in both groups largely overlap making a clear classification of IBC and nIBC based on NFkB cellular signaling pathway activity in the model's current state cumbersome. (Legend: 1—Inflammatory breast cancer; 2—Non-inflammatory breast cancer)

FIG. 26 illustrates overall survival of 272 glioma patients (GSE16011) depicted in a Kaplan-Meier plot, wherein the trained exemplary Bayesian network model using the evidence curated list of target genes (see Table 3) is employed. In the diagram, the vertical axis indicates the overall survival as a fraction of the patient group and the horizontal axis indicates time in years. The plot indicates that an active NFkB TF element (indicated by the steeper slope of the curve) is a prognostic marker for worse overall survival. (The patient group with a predicted active NFkB TF element consisted of 113 patients (solid line), whereas the patient group with a predicted passive NFkB TF element consisted of 159 patients (dotted line)). The prognostic value of the activity level of the NFkB IT element is also demonstrated in the hazard ratio of the predicted probability of NFkB activity: 1.83 (95% CI: 1.34-2.49, p=7.2e-5).

Further to the exemplary Bayesian network model described above, an exemplary linear model was used to model the transcriptional program of the NFkB cellular signaling pathway in a simple manner. The structure of the model corresponded to the one shown in FIG. 3 of the published international patent application WO 2014/102668 A2 (“Assessment of cellular signaling pathway activity using linear combination(s) of target gene expressions”). More specifically, the exemplary linear model consisted of a TF node, a layer of target gene expression and a layer of mRNA expression levels and made use of continuous expression data, all target genes from the evidence curated list of target genes (see Table 3) with all probesets included and without the use of a pseudocount. The training of the model was performed with the same active and passive training samples from GSE12195 and encompassed calculating the weights of the connections between the target genes expression levels, here represented by means of probeset intensities, and the target genes nodes using the “soft log odds”-method as described herein and subsequently the activity score of the transcription factor complex was calculated by summation of the calculated target genes expression score multiplied by either 1 or −1 for up-regulated or down-regulated target genes, respectively.

FIG. 27 shows training results of the exemplary linear model based on the evidence curated list of target genes (see Table 3). In the diagram, the vertical axis indicates the activity score, wherein positive values correspond to an active NFkB cellular signaling pathway and negative values correspond to a passive NFkB cellular signaling pathway. The activated B-cell (ABC) DLBCL (group 1) and normal (group 7) were used as active and passive training samples, respectively. All training samples were correctly classified; all ABC samples were predicted to have an active NFkB cellular signaling pathway, whereas the normal samples were predicted to have a passive NFkB cellular signaling pathway. Within the same dataset all other lymphoma samples and cell lines and DLBCL (groups 2 to 4, 8) except one were predicted NFkB active, similar to the Bayesian network model using the evidence curated list of target genes (FIG. 3), which is plausible given the literature evidence discussed herein. The healthy, unstimulated memory B-cells and naïve B-cells (groups 5 and 6) are correctly predicted to lack NFkB activity. (Legend: 1—ABC DLBCL; 2—Lymphoblastoid cell line; 3—Follicular lymphoma; 4—GCB DLBCL; 5—Memory B-cells; 6—Naïve B-cells; 7—Normal; 8—DLBCL unknown subtype)

FIG. 28 shows NFkB cellular signaling pathway activity predictions of the trained exemplary linear model using the evidence curated list of target genes (see Table 3) for normal human bronchial epithelial (NHBE) cell line samples from E-MTAB-1312, which were stimulated with different TNFα concentrations for different stimulation times. In the diagram, the vertical axis indicates the activity score, wherein positive values correspond to an active NFkB cellular signaling pathway and negative values correspond to a passive NFkB cellular signaling pathway. NHBE cell lines were unstimulated or stimulated with different TNFα concentrations for different timings. All unstimulated healthy cells (groups 1 to 4) are correctly predicted to have a passive NFkB cellular signaling pathway. A stimulation with all TNFα concentrations for only 0.5 h is predicted to be too short for the NFkB cellular signaling pathway to become active (groups 5, 9, and 13), similar to the Bayesian network model using the evidence curated list of target genes (FIG. 8), whereas stimulation times of 2 to 24 hours resulted in an active NFkB cellular signaling pathway. The lowering of the NFkB cellular signaling pathway activity after 4 hours observed with the Bayesian network model especially using the evidence curated list of target genes (see FIG. 8) could not be reproduced with the trained exemplary linear model. (Legend: 1—No TNFα (0.5 h); 2—No TNFα (2 h); 3—No TNFα (4 h); 4—No TNFα (24 h); 5—Low TNFα (0.5 h); 6—Low TNFα (2 h); 7—Low TNFα (4 h); 8—Low TNFα (24 h); 9—Medium TNFα (0.5 h); 10—Medium TNFα (2 h); 11—Medium TNFα (4 h); 12—Medium TNFα (24 h); 13—High TNFα (0.5 h); 14—High TNFα (2 h); 15—High TNFα (4 h); 16—High TNFα (24 h))

FIG. 29 shows NFkB cellular signaling pathway activity predictions of the trained exemplary linear model using the evidence curated list of target genes (see Table 3) for colon samples from GSE4183. In the diagram, the vertical axis indicates the activity score, wherein positive values correspond to an active NFkB cellular signaling pathway and negative values correspond to a passive NFkB cellular signaling pathway. Most normal samples (group 1) were predicted to have a low NFkB cellular signaling pathway activity, albeit at higher activity scores than expected from other datasets. Compared to normal samples all inflammatory bowel disease samples (group 2) were predicted to have a higher NFkB activity score compared to the normal samples which is very reasonable considering the inflamed status of the colon in these patients which activates the NFkB cellular signaling pathway as one of the inflammatory response. In addition, it is clear that the samples in the adenoma samples (group 3) is on average lower than the more progressed colorectal carcinomas (CRC, group 4), which might be partially explained by the progression of the tumor into a more malignant tumor resulting in more mutations, inflammation as a result of the progressed tumor, or infiltration of white blood cells as a result of the immune response to the later stage cancers. (Legend: 1—Normal colon; 2—IBD; 3—Adenoma; 4—CRC)

Instead of applying the mathematical model, e.g., the exemplary Bayesian network model, on mRNA input data coming from microarrays or RNA sequencing, it may be beneficial in clinical applications to develop dedicated assays to perform the sample measurements, for instance on an integrated platform using qPCR to determine mRNA levels of target genes. The RNA/DNA sequences of the disclosed target genes can then be used to determine which primers and probes to select on such a platform.

Validation of such a dedicated assay can be done by using the microarray-based mathematical model as a reference model, and verifying whether the developed assay gives similar results on a set of validation samples. Next to a dedicated assay, this can also be done to build and calibrate similar mathematical models using mRNA-sequencing data as input measurements.

The set of target genes which are found to best indicate specific cellular signaling pathway activity, based on microarray/RNA sequencing based investigation using the mathematical model, e.g., the exemplary Bayesian network model, can be translated into a multiplex quantitative PCR assay to be performed on a sample and/or a computer to interpret the expression measurements and/or to infer the activity of the NFkB cellular signaling pathway. To develop such a test (e.g., FDA-approved or a CLIA waived test in a central service lab) for cellular signaling pathway activity, development of a standardized test kit is required, which needs to be clinically validated in clinical trials to obtain regulatory approval.

The present invention relates to a method comprising inferring activity of an NFkB cellular signaling pathway based at least on expression levels of one or more target genes of the NFkB cellular signaling pathway measured in a sample. The present invention further relates to an apparatus comprising a digital processor configured to perform such a method, a non-transitory storage medium storing instructions that are executable by a digital processing device to perform such a method, and a computer program comprising program code means for causing a digital processing device to perform such a method.

The method may be used, for instance, in diagnosing an (abnormal) activity of the NFkB cellular signaling pathway, in prognosis based on the inferred activity of the NFkB cellular signaling pathway, in the enrollment in a clinical trial based on the inferred activity of the NFkB cellular signaling pathway, in the selection of subsequent test(s) to be performed, in the selection of companion diagnostics tests, in clinical decision support systems, or the like In this regard, reference is made to the published international patent application WO 2013/011479 A2 (“Assessment of cellular signaling pathway activity using probabilistic modeling of target gene expression”), to the published international patent application WO 2014/102668 A2 (“Assessment of cellular signaling pathway activity using linear combination(s) of target gene expressions”), and to Verhaegh W. et al., “Selection of personalized patient therapy through the use of knowledge-based computational models that identify tumor-driving signal transduction pathways”, Cancer Research, Vol. 74, No. 11, 2014, pages 2936-2945, which describe these applications in more detail.

Example 4: Comparison of the Evidence Curated List with a Broad Literature List

The list of target genes of the NFkB cellular signaling pathway constructed based on literature evidence following the procedure as described herein (“evidence curated list of target genes”, see Table 3) is compared here with a “broad literature list” of putative target genes of the NFkB cellular signaling pathway constructed not following above mentioned procedure. The alternative list is a compilation of genes attributed to responding to activity of the NFkB cellular signaling pathway provided within Thomson-Reuters's Metacore (last accessed Sep. 6, 2013). This database was queried for genes that are transcriptionally regulated directly downstream of the family of NFkB proteins, i.e., NFKB1 or p50/p105, NFKB2 or p52/p100, RELA or p65, REL, and RELB. This query resulted in 343 unique genes. A further selection was made based on the number of publication references supporting the attributed transcriptional regulation of the respective gene by the NFkB family. Genes that had ten or more references were selected for the broad literature list. In other words, no manual curation of the references and no calculation of an evidence score based on the experimental evidence was performed. This procedure resulted in 32 genes, see Table 7. The expression of the genes was measured by 56 probesets on the Affymetrix HG-U133Plus2.0 microarray platform which were selected using the Bioconductor plugin of R and one manually added probeset for DEFB4A, see Table 7.

TABLE 7
“Broad literature list” of putative target genes of the NFkB cellular signaling pathway
used in the NFkB cellular signaling pathway models and associated probesets used to measure
the mRNA expression level of the genes.
Gene Probeset Gene Probeset Gene Probeset
PTGS2 1554997_a_at VCAM1 203868_s_at FASLG 210865_at
204748_at SELE 206211_at 211333_s_at
IL8 202859_x_at IFNB1 208173_at CXCL1 204470_at
211506_s_at IL12B 207901_at IL1B 205067_at
NOS2 210037_s_at BCL2L1 206665_s_at 39402_at
IL6 205207_at 212312_at CXCL10 204533_at
MMP9 203936_s_at 215037_s_at BIRC3 210538_s_at
TNF 207113_s_at 231228_at 230499_at
ICAM1 202637_s_at NFKBIA 201502_s_at MYC 202431_s_at
202638_s_at 231699_at CXCL3 207850_at
215485_s_at SOD2 1566342_at IER3 201631_s_at
CCL2 216598_s_at IL2 207849_at IL23A 216857_at
CCL5 1405_i_at CCL20 205476_at 217328_at
1555759_a_at GCLC 1555330_at 220054_at
204655_at 202922_at 234377_at
BCL2 203684_s_at 202923_s_at 234865_at
203685_at CSF2 210228_at TRAF1 205599_at
207004_at 210229_s_at 235116_at
207005_s_at DEFB4A 207356_at

Subsequently an exemplary Bayesian network model was constructed using the procedure as explained herein. Similarly to the description of the NFkB cellular signaling pathway model based on the evidence curated list, the conditional probability tables of the edges between probesets and their respective putative target genes of this model including the broad literature list were trained using fRMA processed data from GSE12195. The training results are depicted in FIG. 24. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the NFkB cellular signaling pathway being active resp. inactive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/inactive are larger than the odds that it is “present”/active. The activated B-cell (ABC) DLBCL (group 1) were used as active training samples and the normal samples (group 7) were used as passive training samples. The training results depicted in FIG. 24 show a clear separation between passive (group 7) and active (group 1) training samples as expected. Within the same dataset all other lymphoma samples and cell lines and DLBCL (groups 2 to 4, 8) were predicted NFkB active which is plausible given the literature evidence discussed herein. The healthy, unstimulated memory B-cells and naïve B-cells (groups 5 and 6) are correctly predicted a lack of NFkB cellular signaling pathway activity. (Legend: 1—ABC DLBCL; 2—Lymphoblastoid cell line; 3—Follicular lymphoma; 4—GCB DLBCL; 5—Memory B-cells: 6—Naïve B-cells: 7—Normal; 8—DLBCL unknown subtype).

Next the trained exemplary network Bayesian model based on the broad literature list was tested on a number of datasets.

FIG. 31 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the broad literature list of putative target genes of the NFkB cellular signaling pathway (see Table 7) for normal human bronchial epithelial (NHBE) cell line samples from E-MTAB-1312, which were stimulated with different TNFα concentrations for different stimulation times. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the NFkB cellular signaling pathway being active resp. inactive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/inactive are larger than the odds that it is “present”/active. All unstimulated healthy cells up to 24 hours (groups 1 to 3) are correctly predicted to have a passive NFkB cellular signaling pathway. Lack of stimulation for 24 hours resulted in an unexpected activation of the NFkB cellular signaling pathway prediction. A stimulation with all TNFα concentrations for only 0.5 h is predicted by the broad literature Bayesian model also to be too short for the NFkB cellular signaling pathway to become active (groups 5, 9, and 13), whereas stimulation times of 2-24 hours resulted in an active NFkB cellular signaling pathway (groups 5 to 8, 9 to 12 and 13 to 15). The lowering of the NFkB cellular signaling pathway activity after 4 hours observed with the Bayesian network model using the evidence curated list of target genes (see FIG. 8) was not reproduced with the trained broad literature Bayesian network model. (Legend: 1—No TNFα (0.5 h); 2—No TNFα (2 h); 3—No TNFα (4 h); 4—No TNFα (24 h); 5—Low TNFα (0.5 h); 6—Low TNFα (2 h); 7—Low TNFα (4 h); 8—Low TNFα (24 h); 9—Medium TNFα (0.5 h); 10—Medium TNFα (2 h): 11—Medium TNFα (4 h); 12—Medium TNFα (24 h); 13—High TNFα (0.5 h); 14—High TNFα (2 h); 15—High TNFα (4 h); 16—High TNFα (24 h))

FIG. 32 shows NFkB cellular signaling pathway activity predictions of the trained exemplary Bayesian network model using the broad literature list of putative target genes of the NFkB cellular signaling pathway (see Table 7) for colon samples from GSE4183. In the diagram, the vertical axis indicates the odds that the TF element is “present” resp. “absent”, which corresponds to the NFkB cellular signaling pathway being active resp. inactive, wherein values above the horizontal axis correspond to the TF element being more likely “present”/active and values below the horizontal axis indicate that the odds that the TF element is “absent”/inactive are larger than the odds that it is “present”/active. All but one adenoma sample are predicted by the broad literature Bayesian network model to have an active NFkB cellular signaling pathway, which is especially not expected to be the case in normal, healthy colon samples (group 1). (Legend: 1—Normal colon; 2—IBD; 3—Adenoma; 4—CRC)

As evidenced by the above example, the selection of unique NFkB target gene sets in combination with the mathematical models described herein for determining the activity level of NFkB cellular signaling pathway in a sample produces a more robust, precise, and accurate activity status determination than the use of a broader literature list, despite the fact that the number of target genes is larger. By focusing on the specific target genes identified herein, a useful determination of NFkB cellular signaling pathway activity is provided that can be further used in treatment or prognostic modalities as described herein.

This specification has been described with reference to embodiments, which are illustrated by the accompanying Examples. The invention can, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Given the teaching herein, one of ordinary skill in the art will be able to modify the invention for a desired purpose and such variations are considered within the scope of the disclosure.

SEQUENCE LISTING

Sequence Listing:
Seq. No. Gene:
Seq. 1 BCL2
Seq. 2 BCL2L1
Seq. 3 BIRC3
Seq. 4 CCL2
Seq. 5 CCL3
Seq. 6 CCL4
Seq. 7 CCL5
Seq. 8 CCL20
Seq. 9 CCL22
Seq. 10 CSF2
Seq. 11 CX3CL1
Seq. 12 CXCL1
Seq. 13 CXCL2
Seq. 14 CXCL3
Seq. 15 CXCL10
Seq. 16 DEFB4A
Seq. 17 FASLG
Seq. 18 GCLC
Seq. 19 ICAM1
Seq. 20 IER3
Seq. 21 IFNB1
Seq. 22 IL12B
Seq. 23 IL1B
Seq. 24 IL2
Seq. 25 IL23A
Seq. 26 IL6
Seq. 27 IL8
Seq. 28 IRF1
Seq. 29 MMP9
Seq. 30 MYC
Seq. 31 NFKB2
Seq. 32 NFKBIA
Seq. 33 NFKBIE
Seq. 34 NOS2
Seq. 35 PTGS2
Seq. 36 SELE
Seq. 37 SOD2
Seq. 38 STAT5A
Seq. 39 TNF
Seq. 40 TNFAIP2
Seq. 41 TNIP1
Seq. 42 TRAF1
Seq. 43 VCAM1

Claims

1-20. (canceled)

21. A kit for determining an activity level of a NFkB cellular signaling pathway derived from a sample isolated from a subject suffering from a disease associated with an activated NFkB cellular signaling pathway, comprising:

a set of polymerase chain reaction primers directed to at least six NFkB cellular signaling pathway target genes; and

a set of probes directed to the at least six NFkB cellular signaling pathway target genes;

wherein the at least six NFkB cellular signaling pathway target genes are selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1.

22. The kit of claim 21, wherein the at least six NFkB cellular signaling pathway target genes are selected from BIRC3, CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, TNF, TNFAIP2, TRAF1, and VCAM1.

23. The kit of claim 21, wherein the at least six NFkB cellular signaling pathway target genes comprise at least three target genes selected from CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, MMP9, NFKB2, NFKBIA, and TNFAIP2.

24. The kit of claim 23, wherein the at least three target genes are selected from CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2.

25. The kit of claim 21, wherein the disease is a cancer.

26. The kit of claim 25, wherein the cancer is colon, breast, prostate, pancreatic, lung, brain, leukemia, lymphoma, or glioma.

27. The kit of claim 21, further comprising a calibrated pathway model configured to determine the activity level of the NFkB cellular signaling pathway by:

receiving data on the expression levels of the at least six NFkB cellular signaling pathway target genes amplified using the set of polymerase chain reaction primers and analyzed by the set of probes;

determining the level of a NFkB transcription factor element in the sample by comparing the received data on the expression levels of the at least six NFkB cellular signaling pathway target genes in the sample with expression levels of the at least six NFkB cellular signaling pathway target genes in the model which define an activity level of NFkB transcription factor element; and

determining the activity level of the NFkB cellular signaling pathway in the sample based on the determined NFkB transcription factor element level in the sample.

28. The kit of claim 27, wherein the calibrated pathway model is a probabilistic model incorporating conditional probabilistic relationships that compare the expression levels of the at least six NFkB cellular signaling pathway target genes in the sample with expression levels of the at least six NFkB cellular signaling pathway target genes in the model which define a level of NFkB transcription factor element to determine the activity level of NFkB transcription factor element in the sample.

29. The kit of claim 27, wherein the calibrated pathway model is a linear model incorporating relationships that compare the expression levels of the at least six NFkB cellular signaling pathway target genes in the sample with expression levels of the at least six NFkB cellular signaling pathway target genes in the model which define a level of NFkB transcription factor element to determine the activity level of NFkB transcription factor element in the sample.

30. The kit of claim 21, wherein the probes are labeled.

31. A method for determining an activity level of a NFkB cellular signaling pathway derived from a biological sample isolated from a subject suffering from a disease associated with an activated NFkB cellular signaling pathway, comprising:

receiving a biological sample from the subject;

analyzing, using the kit of claim 21, expression levels of at least six NFkB cellular signaling pathway target genes selected from BCL2L1, BIRC3, CCL2, CCL3, CCL4, CCL5, CCL20, CCL22, CX3CL1, CXCL1, CXCL2, CXCL3, ICAM1, IL1B, IL6, IL8, IRF1, MMP9, NFKB2, NFKBIA, NFKBIE, PTGS2, SELE, STAT5A, TNF, TNFAIP2, TNIP1, TRAF1, and VCAM1 by contacting the biological sample with the set of polymerase chain reaction primers directed to the at least six NFkB cellular signaling pathway target genes and the set of probes directed to the at least six NFkB cellular signaling pathway target genes.

32. The method of claim 31, wherein the at least six NFkB cellular signaling pathway target genes comprise at least three target genes selected from CCL2, CCL5, CCL20, CXCL1, CXCL2, CXCL3, ICAM1, IL6, IL8, MMP9, NFKB2, NFKBIA, and TNFAIP2.

33. The method of claim 32, wherein the at least three target genes are selected from CCL5, CXCL2, ICAM1, IL6, IL8, NFKBIA, and TNFAIP2.

34. The method of claim 31, wherein the disease is a cancer.

35. The method of claim 34, wherein the cancer is colon, breast, prostate, pancreatic, lung, brain, leukemia, lymphoma, or glioma.

36. The method of claim 31, wherein analyzing the expression levels of the at least six NFkB cellular signaling pathway target genes comprises a calibrated pathway model configured to determine the activity level of the NFkB cellular signaling pathway by:

receiving data on the expression levels of the at least six NFkB cellular signaling pathway target genes amplified using the set of polymerase chain reaction primers and analyzed using the set of probes;

determining the level of a NFkB transcription factor element in the sample by comparing the received data on the expression levels of the at least six NFkB cellular signaling pathway target genes in the sample with expression levels of the at least six NFkB cellular signaling pathway target genes in the model which define an activity level of NFkB transcription factor element; and

determining the activity level of the NFkB cellular signaling pathway in the sample based on the determined NFkB transcription factor element level in the sample.

37. The method of claim 36, wherein the calibrated pathway model is a probabilistic model incorporating conditional probabilistic relationships that compare the expression levels of the at least six NFkB cellular signaling pathway target genes in the sample with expression levels of the at least six NFkB cellular signaling pathway target genes in the model which define a level of NFkB transcription factor element to determine the activity level of NFkB transcription factor element in the sample.

38. The method of claim 36, wherein the calibrated pathway model is a linear model incorporating relationships that compare the expression levels of the at least six NFkB cellular signaling pathway target genes in the sample with expression levels of the at least six NFkB cellular signaling pathway target genes in the model which define a level of NFkB transcription factor element to determine the activity level of NFkB transcription factor element in the sample.

39. The method of claim 31, wherein the probes are labeled.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: