-
2005-12-20
10/055,794
2002-01-17
US 6,977,165 B2
2005-12-20
-
-
Gerry Leffers | Maria Marvich
2022-01-17
Methods are provided for producing a vector that includes at least one splicable intron. In the subject methods, intron containing vectors are produced from donor and acceptor vectors that each include a site specific recombinase site, where the subject donor and acceptor vectors further include splice donor and acceptor sites that, upon site specific recombination of the donor and acceptor vectors, define an intron in the product vector of the recombination step. Also provided are compositions for use in practicing the subject methods, including the donor and acceptor vectors themselves, as well as systems and kits that include the same. The subject invention finds use in a variety of different applications, including the production of expression vectors that encode C-terminal tagged fusion proteins, the production of expression vectors that encode pure protein and not a fusion thereof, and the like.
Get notified when new applications in this technology area are published.
Pursuant to 35 U.S.C. §119(e), this application claims priority to the filing date of U.S. Provisional Patent Application Ser. No. 60/263,358 filed Jan. 18, 2001; the disclosure of which applications is herein incorporated by reference.
1. Field of the Invention
The field of this invention is molecular biology, particularly recombinant DNA engineering.
2. Background of the Invention
The processes of isolating, cloning and expressing genes are central to the field of molecular biology and play prominent roles in research and industry in biotechnology and related fields. Until recently, the isolation and cloning of genes has been achieved in vitro using restriction endonucleases and DNA ligases. Restriction endonucleases are enzymes which recognize and cleave double-stranded DNA at a specific nucleotide sequence, and DNA ligases are enzymes which join fragments of DNA together via the phosphodiester bond. A DNA sequence of interest can be âcutâ or digested into manageable pieces using a restriction endonuclease and then inserted into an appropriate vector for cloning using DNA ligase. However, in order to transfer the DNA of interest into a different vectorâmost often a specialized expression vectorârestriction enzymes must be used again to excise the DNA of interest from the cloning vector, and then DNA ligase is used again to ligate the DNA of interest into the chosen expression vector.
The ability to transfer a DNA of interest to an appropriate expression vector is often limited by the availability or suitability of restriction enzyme recognition sites. Often multiple restriction enzymes must be employed to remove the desired coding region. Further, the reaction conditions used for each enzyme may differ such that it is necessary to perform the excision reaction in separate steps, or it may be necessary to remove a particular enzyme used in an initial restriction enzyme reaction prior to completing subsequent restriction enzyme digestions due to buffer and/or cofactor incompatibility. Many of these extra steps require time-consuming purification of the subcloning intermediate.
There is, therefore, a need to develop protocols and compositions for the rapid transfer of a DNA molecule of interest from one vector to another in vitro or in vivo without the need to rely upon restriction enzyme digestions. To address this need, a number of different sequence specific recombinase based methods have been developed which allow one to transfer sequence material among vectors without restriction enzyme digestions. These systems include the commercially available Creator and Gateway sequence specific recombinase based methods, where representative systems are described in U.S. Pat. Nos. 5,581,808 and 5,888,732; as well as in Published PCT Application Serial Nos. WO 00/12687 and WO 01/05961.
While the above protocols and systems are effective, there is room for improvement. For example, in the above systems, expression vectors that are produced by the methods encode fusion proteins of the gene of interest fused to a sequence encoded by the sequence specific recombinase site of the vector. In many instances, such a fusion sequence is undesirable.
As such, there is continued interest in the improvement of these sequence specific recombinase systems. Of particular interest would be the development of such a system that produced expression vectors where the protein of interest was not expressed a fusion with sequence specific recombinase encoded sequences. The present invention satisfies this interest.
Relevant Literature
References of interest include: U.S. Pat. Nos. 5,527,695; 5,744,336; 5,851,808; 5,888,732; and 5,962,255; as well as in Published PCT Application Serial Nos. WO 00/12687 and WO 01/05961. Also of interest is: Kaartinen & Nagy, Genesis (2001) 31: 126-129; and Yoshimura et al., Mol. Urol. (2001) 5: 81-4.
Methods are provided for producing a vector that includes at least one splicable intron. In the subject methods, intron containing vectors are produced from donor and acceptor vectors that each include a sequence specific recombinase site, where the subject donor and acceptor vectors further include splice donor and acceptor sites that, upon sequence specific recombination of the donor and acceptor vectors, define an intron in the product vector of the recombination step. Also provided are compositions for use in practicing the subject methods, including the donor and acceptor vectors themselves, as well as systems and kits that include the same. The subject invention finds use in a variety of different applications, including the production of expression vectors that encode C-terminal tagged fusion proteins, the production of expression vectors that encode pure protein and not a fusion thereof with N- and/or C-terminal sequence specific recombinase site encoded residues, and the like.
FIG. 1 provides a map of the pDNR-Dual donor vector described in greater detail below.
FIG. 2 provides a map of the pLPS-EGFP acceptor vector described in greater detail below.
FIG. 3 provides a mape of the pDNR-Dual-Luc vector described in greater detail below.
FIG. 4 provides a map of the pLPS-Luc-EGFP vector described in greater detail below.
FIG. 5 provides a flow diagram of a representative method according to the subject invention.
The terms âsequence-specific recombinaseâ and âsite-specific recombinaseâ refer to enzymes or recombinases that recognize and bind to a short nucleic acid site or âsequence-specific recombinase target siteâ, i.e., a recombinase recognition site, and catalyze the recombination of nucleic acid in relation to these sites. These enzymes include recombinases, transposases and integrases.
The terms âsequence-specific recombinase target siteâ, âsite-specific recombinase target siteâ, âsequence-specific target siteâ and âsite-specific target siteâ refer to short nucleic acid sites or sequences, i.e., recombinase recognition sites, which are recognized by a sequence- or site-specific recombinase and which become the crossover regions during a site-specific recombination event. Examples of sequence-specific recombinase target sites include, but are not limited to, lox sites, att sites, dif sites and frt sites.
The term âlox siteâ as used herein refers to a nucleotide sequence at which the product of the cre gene of bacteriophage P1, the Cre recombinase, can catalyze a site-specific recombination event. A variety of lox sites are known in the art, including the naturally occurring loxP, loxB, loxL and loxR, as well as a number of mutant, or variant, lox sites, such as loxP511, loxP514, loxÎ86, loxÎ117, loxC2, loxP2, loxP3 and lox P23.
The term âfrt siteâ as used herein refers to a nucleotide sequence at which the product of the FLP gene of the yeast 2 micron plasmid, FLP recombinase, can catalyze site-specific recombination.
The term âunique restriction enzyme siteâ indicates that the recognition sequence of a given restriction enzyme appears once within a nucleic acid molecule.
A restriction enzyme site or restriction site is said to be located âadjacent to the 3Ⲡend of a sequence-specific recombinase target siteâ if the restriction enzyme recognition site is located downstream of the 3Ⲡend of the sequence-specific recombinase target site. The adjacent restriction enzyme site may, but need not, be contiguous with the last or 3Ⲡmost nucleotide comprising the sequence-specific recombinase target site.
The term âintronâ as used herein refers to a domain of a vector produced by the subject methods that is flanked on the 5Ⲡend by a splice donor site and on the 3Ⲡend by a splice acceptor site, where under appropriate conditions the intron is spliced out of or removed from an mRNA sequence expressed from the vector in which it is present.
The term âsplice donor siteâ as used herein refers to a sequence or domain of a nucleic acid present at the 5Ⲡend of an intron, as defined above, that marks the start of the intron and its boundary with the preceding coding sequence-exon.
The term âsplice acceptor siteâ as used herein refers to a sequence or domain of a nucleic acid present at the 3Ⲡend of an intron,as defined above, that marks the start of the intron and its boundary with the following coding sequence-exon. In the present invention, the splice acceptor site is also meant to include the intron Branch point, which is required together with the splice donor and splice acceptor sequence in order for splicing to occur. The branch point marks the point to which the 5Ⲡend of the intron becomes joined during the process of splicing. For convenience, in the present embodiments, the splice Acceptor sequence and the Branch site are placed adjacent to each other so that they can be encoded within a single synthetic oligonucleotide for ease of vector construction. Thus, they are described here as a single unit. However, they may be further separated, by moving the branch site further 5Ⲡof the splice acceptor sequence, provided that it is not moved 5Ⲡof the splice donor sequence and provided that splicing efficiency is not hindered.
The Term âsplice siteâ as used herein refers to a sequence or domain of a nucleic acid present at either the 5Ⲡend or the 3Ⲡend of an intron as defined above.
The terms âpolylinkerâ or âmultiple cloning siteâ refer to a cluster of restriction enzyme sites, typically unique sites, on a nucleic acid construct that can be utilized for the insertion and/or excision of nucleic acid sequences, such as the coding region of a gene, loxP sites, etc.
The term âtermination sequenceâ refers to a nucleic acid sequence which is recognized by the polymerase of a host cell and results in the termination of transcription. Prokaryotic termination sequences commonly comprise a GC-rich region that has a two-fold symmetry followed by an AT-rich sequence. A commonly used termination sequence is the T7 termination sequence. A variety of termination sequences are known in the art and may be employed in the nucleic acid constructs of the present invention, including the TINT3, TL13, TL2, TR1, TR2, and T6S termination signals derived from the bacteriophage lambda, and termination signals derived from bacterial genes, such as the trp gene of E. coli.
The terms âpolyadenylation sequenceâ (also referred to as a âpoly A+ siteâ or âpoly A+ sequenceâ) as used herein denotes a DNA sequence which directs both the termination and polyadenylation of the nascent RNA transcript. Efficient polyadenylation of the recombinant transcript is desirable, as transcripts lacking a poly A+ tail are typically unstable and rapidly degraded. The poly A+ signal utilized in an expression vector may be âheterologousâ or âendogenousâ. An endogenous poly A+ signal is one that is found naturally at the 3Ⲡend of the coding region of a given gene in the genome. A heterologous poly A+ signal is one which is isolated from one gene and placed 3Ⲡof another gene, e.g., coding sequence for a protein. A commonly used heterologous poly A+ signal is the SV40 poly A+ signal. The SV40 poly A+ signal is contained on a 237 bp BamHI/Bc/l restriction fragment and directs both termination and polyadenylation; numerous vectors contain the SV40 poly A+ signal. Another commonly used heterologous poly A+ signal is derived from the bovine growth hormone (BGH) gene; the BGH poly A+ signal is also available on a number of commercially available vectors. The poly A+ signal from the Herpes simplex virus thymidine kinase (HSV tk) gene is also used as a poly A+ signal on a number of commercial expression vectors.
As used herein, the terms âselectable markerâ or âselectable marker geneâ refer to a gene which encodes an enzymatic activity and confers the ability to grow in medium lacking what would otherwise be an essential nutrient; in addition, a selectable marker may confer upon the cell in which the selectable marker is expressed, resistance to an antibiotic or drug. A selectable marker may be used to confer a particular phenotype upon a host cell. When a host cell must express a selectable marker to grow in selective medium, the marker is said to be a positive selectable marker (e.g., antibiotic resistance genes which confer the ability to grow in the presence of the appropriate antibiotic). Selectable markers can also be used to select against host cells containing a particular gene; selectable markers used in this manner are referred to as negative selectable markers.
As used herein, the term âconstructâ is used in reference to nucleic acid molecules that transfer DNA segment(s) from one cell to another. The term âvectorâ is sometimes used interchangeably with âconstructâ. The term âconstructâ includes circular nucleic acid constructs such as plasmid constructs, phagemid constructs, cosmid vectors, etc., as well as linear nucleic acid constructs including, but not limited to, PCR products. The nucleic acid construct may comprise expression signals such as a promoter and/or an enhancer in operable linkage, and then is generally referred to as an âexpression vectorâ or âexpression constructâ.
The term âexpression constructâ as used herein refers to an expression module or expression cassette made up of a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a particular host organism. Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter and a ribosome binding site, often along with other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals.
The terms âin operable combinationâ, âin operable orderâ and âoperably linkedâ as used herein refer to the linkage of nucleic acid sequences in such a manner that a nucleic acid molecule capable of directing the transcription of a given gene and/or the synthesis of a desired protein molecule is produced. The terms also refer to the linkage of amino acid sequences in such a manner so that the reading frame is maintained and a functional protein is produced.
A cell has been âtransformedâ or âtransfectedâ with exogenous or heterologous DNA when such DNA has been introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a vector or plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA. A âcloneâ is a population of cells derived from a single cell or ancestor by mitosis. A âcell lineâ is a clone of a primary cell that is capable of stable growth in vitro for many generations. An organism, such as a plant or animal, that has been transformed with exogenous DNA is termed âtransgenicâ.
Transformation of prokaryotic cells may be accomplished by a variety of means known in the art, including the treatment of host cells with CaCl2 to make competent cells, electroporation, etc. Transfection of eukaryotic cells may be accomplished by a variety of means known in the art, including calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection, and biolistics.
As used herein, the term âhostâ is meant to include not only prokaryotes, but also eukaryotes, such as yeast, plant and animal cells. A recombinant DNA molecule or gene can be used to transform a host using any of the techniques commonly known to those of ordinary skill in the art. Prokaryotic hosts may include E. coli, S. tymphimurium, Serratia marcescens and Bacillus subtilis. Eukaryotic hosts include yeasts such as Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, mammalian cells and insect cells, and, plant cells, such as Arabidopsis thaliana and Tobaccum nicotiana.
As used herein, the terms ârestriction endonucleasesâ and ârestriction enzymesâ refer to bacterial enzymes, each of which cut double-stranded DNA at or near a specific nucleotide sequence.
âRecombinant DNA technologyâ refers to techniques for uniting two heterologous DNA molecules, usually as a result of in vitro ligation of DNAs from different organisms. Recombinant DNA molecules are commonly produced by experiments in genetic engineering. Synonymous terms include âgene splicingâ, âmolecular cloningâ and âgenetic engineeringâ. The product of these manipulations results in a ârecombinantâ or ârecombinant moleculeâ. The term ârecombinant proteinâ or ârecombinant polypeptideâ as used herein refers to a protein molecule that is expressed from a recombinant DNA molecule.
The ribose sugar is a polar molecule, and therefore, DNA is referred to as having a 5Ⲡto 3Ⲡ, or 5Ⲡto 3â˛, directionality. DNA is said to have â5Ⲡendsâ and â3Ⲡendsâ because mononucleotides are reacted to make oligonucleotides in a manner such that the 5Ⲡphosphate of one mononucleotide pentose ring is attached to the 3Ⲡoxygen of its neighbor via a phosphodiester linkage. Therefore, an end of an oligonucleotide is referred to as the â5Ⲡendâ if its 5Ⲡphosphate is not linked to the 3Ⲡoxygen of a mononucleotide pentose ring and as the â3Ⲡendâ if its 3Ⲡoxygen is not linked to a 5Ⲡphosphate of a subsequent mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, also has a 5Ⲡto 3Ⲡorientation. In either a linear or circular DNA molecule, discrete elements are referred to as being âupstreamâ or â5â˛â of the âdownstreamâ or â3â˛â elements. This terminology reflects the fact that DNA has an inherent 5Ⲡto 3Ⲡpolarity, and transcription typically proceeds in a 5Ⲡto 3Ⲡfashion along the DNA strand. The promoter and enhancer elements which direct transcription of an operably linked coding region, or open reading frame, are generally located 5Ⲡ, or upstream, of the coding region. However, enhancer elements can exert their effect even when located 3Ⲡof the promoter and coding region. Transcription termination and polyadenylation signals are typically located 3Ⲡor downstream of the coding region.
The 3Ⲡend of a promoter is said to be located upstream of the 5Ⲡend of a sequence-specific recombinase target site when, moving in a 5Ⲡto 3Ⲡdirection along the nucleic acid molecule, the 3Ⲡterminus of a promoter precedes the 5Ⲡend of the sequence-specific recombinase target site. When the acceptor construct is intended to permit the expression of a translation fusion, the 3Ⲡend of the promoter is located upstream of both the sequences encoding the amino-terminus of a fusion protein and the 5Ⲡend of the sequence-specific recombinase target site. Thus, the sequence-specific recombinase target site is located within the coding region of the fusion protein (i.e., located downstream of both the promoter and the sequences encoding the affinity domain, such as Gst).
As used herein, the term âadjacentâ, in the context of positioning of genetic elements in the constructs, shall mean within about 0 to 2500, sometimes 0 to 1000 bp and sometimes within about 0 to 500, 0 to 400, 0 to 300 or 0 to 200 bp.
A DNA âcoding sequenceâ is a double-stranded DNA sequence that is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5Ⲡ(amino) terminus and a translation stop codon at the 3Ⲡ(carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. A polyadenylation signal and transcription termination sequence will usually be located 3Ⲡto the coding sequence. A âcDNAâ is defined as copy-DNA or complementary-DNA, and is a product of a reverse transcription reaction from an mRNA transcript. An âexonâ is an expressed sequence transcribed from the gene locus, whereas an âintronâ is a non-expressed sequence that is from the gene locus.
Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell. A âcis-elementâ is a nucleotide sequence, also termed a âconsensus sequenceâ or âmotif,â that interacts with proteins that can upregulate or downregulate expression of a specific gene locus. A âsignal sequenceâ can also be included with the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide, that communicates to the host cell and directs the polypeptide to the appropriate cellular location. Signal sequences can be found associated with a variety of proteins native to prokaryotes and eukaryotes.
A âpromoter sequenceâ is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3Ⲡdirection) coding sequence. For purposes of defining the present invention, the promoter sequence includes, at its 3Ⲡterminus, the transcription initiation site and extends upstream (in the 5Ⲡdirection) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site, as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic promoters often, but not always, contain âTATAâ boxes and âCATâ boxes.
Efficient expression of recombinant DNA sequences in eukaryotic cells requires expression of signals directing the efficient termination and polyadenylation of the resulting transcript. Transcription termination signals are generally found downstream of the polyadenylation signal and are a few hundred nucleotides in length.
As used herein, âan origin of replicationâ or âoriginâ refers to any sequence capable of directing replication of a DNA construct in a suitable prokaryotic or eukaryotic host (e.g., the ColE1 origin and its derivatives; the yeast 2Îź origin). Eukaryotic expression vectors may also contain âviral repliconsâ or âorigins of replicationâ. Viral replicons are viral DNA sequences which allow for the extrachromosomal replication of a vector in a host cell expressing the appropriate replication factors. Vectors which contain either the SV40 or polyoma virus origin of replication replicate to high copy number (up to 104 copies/cell) in cells that express the appropriate viral T antigen. Vectors which contain the replicons from bovine papillomavirus or Epstein-Barr virus replicate extrachromosomally at low copy number (Ë100 copies/cell).
As used herein, the terms ânucleic acid molecule encodingâ, âDNA sequence encodingâ, and âDNA encodingâ refer to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the polypeptide (protein) chain. The DNA sequence thus codes for the amino acid sequence.
As used herein, the term âgeneâ means the deoxyribonucleotide sequences comprising the coding region of a structural gene, i.e., the coding sequence for a protein or polypeptide of interest, including sequences located adjacent to the coding region on both the 5Ⲡand 3Ⲡends for a distance of about 1 kb on either end, such that the gene corresponds to the length of the full-length mRNA. The sequences which are located 5Ⲡof the coding region and which are present on the mRNA are referred to as 5Ⲡnon-translated sequences. The sequences which are located 3Ⲡor downstream of the coding region and which are present on the mRNA are referred to as 3Ⲡnon-translated sequences. The term âgeneâ encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed âintronsâ or âintervening regionsâ or âintervening sequencesâ. Introns are segments of a gene that are transcribed into heteronuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or âspliced outâ from the nuclear or primary transcript; introns therefore are absent in the mature messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
In addition to containing introns, genomic forms of a gene may also include sequences located on both the 5Ⲡand 3Ⲡend of the sequences that are present on the RNA transcript. These sequences are referred to as âflankingâ sequences or regions (these flanking sequences are located 5Ⲡor 3Ⲡto the non-translated sequences present on the mRNA transcript). The 5Ⲡflanking region may contain regulatory sequences such as promoters and enhancers which control or influence the transcription of the gene. The 3Ⲡflanking region may contain sequences which direct the termination of transcription, post-transcriptional cleavage and polyadenylation.
As used herein, the term âpurifiedâ or âto purifyâ refers to the removal of contaminants from a sample. For example, recombinant Cre polypeptides are expressed in bacterial host cells (e.g., as a GST-Cre or (HN)6-Cre fusion protein) and the Cre polypeptides are purified by the removal of host cell proteins; the percent of recombinant Cre polypeptides is thereby enriched or increased in the sample.
As used herein the term âportionâ refers to a fraction of a sequence, gene or protein. âPortionâ may comprise a fraction greater than half of the sequence, gene or protein, equal to half of the sequence, gene or protein or less than half of the sequence, gene or protein. Typically as used herein, two or more âportionsâ combine to comprise a whole sequence, gene or protein.
As used herein, the term âfusion proteinâ refers to a chimeric protein containing a protein of interest joined to an exogenous protein fragment. The fusion partner may enhance solubility of the protein of interest as expressed in a host cell, may provide an affinity tag to allow purification of the recombinant fusion protein from the host cell or culture supernatant, or both. If desired, the fusion protein may be removed from the protein of interest by a variety of enzymatic or chemical means known to the art.
Methods are provided for producing a vector that includes at least one splicable intron. In the subject methods, intron containing vectors are produced from donor and acceptor vectors that each include a site specific recombinase site, where the subject donor and acceptor vectors further include splice donor and acceptor sites that, upon site specific recombination of the donor and acceptor vectors, define an intron in the product vector of the recombination step. Also provided are compositions for use in practicing the subject methods, including the donor and acceptor vectors themselves, as well as systems and kits that include the same. The subject invention finds use in a variety of different applications, including the production of expression vectors that encode C-terminal tagged fusion proteins, the production of expression vectors that encode pure protein and not a fusion thereof, and the like.
Before the subject invention is described further, it is to be understood that the invention is not limited to the particular embodiments of the invention described below, as variations of the particular embodiments may be made and still fall within the scope of the appended claims. It is also to be understood that the terminology employed is for the purpose of describing particular embodiments, and is not intended to be limiting. Instead, the scope of the present invention will be established by the appended claims.
In this specification and the appended claims, the singular forms âa,â âanâ and âtheâ include plural reference unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs.
Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range, and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, the preferred methods, devices and materials are now described.
All publications mentioned herein are incorporated herein by reference for the purpose of describing various invention components that are described in the publications which might be used in connection with the presently described invention.
In further describing the subject invention, the subject methods are reviewed first in greater detail, followed by a review of representative applications in which the subject methods find use, as well as a review of systems, libraries and kits for use in practicing the subject methods.
Methods
As summarized above, the subject invention provides recombinase-based methods for producing intron containing vectors. In other words, the subject invention provides methods of producing vectors that include at least one intron, where the methods are site specific recombinase based methods. By âsite specific recombinaseâ based method is meant that the subject methods employ a recombinase mechanism to produce the subject intron containing vectors. The recombinase mechasism that is employed in the subject methods is one in which a recombinase mediates the transfer of a nucleic acid from a donor to an acceptor vector, where the donor and acceptor vectors each include at least one recombinase recognition site. A variety of different site specific recombinase systems suitable for transferring a nucleic acid from a donor to an acceptor vector are known and may be modified to be useful in the subject invention. Such systems include those described in U.S. Pat. Nos. 5,851,808; 5,888,732; and U.S. Provisional Application Ser. No. 09/616,651, the disclosure of which are herein incorporated by reference, as well as WO 00/12687 and WO 01/05961, the disclosures of the priority documents of which are herein incorporated by reference.
In general, in addition to each including at least one recombinase recognition site, the donor and acceptor vectors each include at least one splice site, e.g., a splice donor site or a splice acceptor site. In certain embodiments, the donor and acceptor vectors each include a single splice site, where in many of these embodiments, the donor vector includes a splice donor site and the acceptor vector includes a splice acceptor site. In yet other embodiments, the donor and acceptor vectors each include splice donor and acceptor sites which are oriented such that they do not form an intron in the donor vectors but, upon recombinase mediated recombination of the donor and acceptor vectors, produce a resultant vector with two distinct introns. In such designs, the acceptors will contain one synthetic intron that encompasses the recombinase recognition sequence and the acceptor partial selectable marker.
Any convenient splice sites (i.e., splice donor and acceptor sites) may be employed in the vectors of the subject method. Representative splice sites or sequences, e.g., domains, of interest that may be employed include both splice sites that require specifically provided factors for splicing, e.g., eukaryotic host factors (as found in a eukaryotic host cells) such that the intron is only spliced in a eukaryotic host cell or an mimetic (e.g., in vivo or in vitro) environment that provides all the relevant factors, and splice sites that are self-splicing or autocatalytic, i.e., do not require specific factors for splicing to occur, and thus are spliced in both eukaryotic and prokaryotic environments, as well as in vitro environments. Examples include the splicing elements of Group I and Group II self-splicing introns found in bacteria, and certain cellular organelles, e.g., the highly conserved in Group I self-splicing intron, P7; the bacterial group II intron L. lactis L1.ltrB; the yeast mitochondrial group II introns al1 and al2; and the bacterial group II intron Sinorhizobium meliloti Rmlnt1 (see Oe Y., et al.,2001; and Martinez-Abarca, F. and Toro, N., 2000)
Any convenient splice acceptor donor and acceptor sites may be employed. Consensus sequences for the 5Ⲡsplice donor site and the 3Ⲡsplice acceptor site used in RNA splicing are well known in the art (See, Moore, et al., 1993, The RNA World, Cold Spring Harbor Laboratory Press, p. 303-358). In addition, modified consensus sequences that maintain the ability to function as 5Ⲡdonor splice sites and 3Ⲡsplice acceptors sites may be used in the practice of the invention. In certain embodiments, splice-donor sites have a characteristic consensus sequence represented as: (A/C)AGGURAGU (where R denotes a purine nucleotide) with the GU in the fourth and fifth positions being required (Jackson, I. J. , Nucleic Acids Research 19: 3715-3798 (1991)). Splice-donor sites are functionally defined by their ability to effect the appropriate reaction within the mRNA splicing pathway. An unpaired splice-donor site is defined herein as a splice-donor site which is present in a donor or acceptor vector, typically a donor vector, and is not accompanied in the vector by a splice-acceptor site positioned 3Ⲡto the unpaired splice-donor site. Upon recombinase mediated recombination between the donor and acceptor vectors, the unpaired splice-donor site results in splicing to a splice-acceptor site originally present in the other vector. A splice-acceptor site is a sequence which, like a splice-donor site, directs the splicing of an intron out of a resultant expression cassette produced upon recombinase mediated recombination of the donor and acceptor vectors. Acting in conjunction with a splice-donor site, the splicing apparatus uses a splice-acceptor site to effect the removal of an intron. Splice-acceptor sites have a characteristic sequence represented as: YYYYYYYYYYNYAG, where Y denotes any pyrimidine and N denotes any nucleotide (Jackson, I. J. , Nucleic Acids Research 19:3715-3798 (1991)). For convenience, in the present embodiments, the splice acceptor sequence is immediately preceded by the intron Branch site and these are considered here as one unit, although the may be separated. The consensus Branch site is: YNYYRAY, where Y denotes any pyrimidine, R any purine, and N denotes any nucleotide.
Specific splice sites of interest include, but are not limited to: (a) the novel consensus intron sequences and the Human hemoglobin Beta donor and acceptor sequences described in Liu Z. et al Anal Biochem 246: 264-267 (1997) and found in the experimental section, infra; (b) the donor and acceptor sequences found in the SV40 late 19s and 16s mRNA introns (see pCMV myc from Clontech ); (c) the splice donor and acceptor sequences found in the rabbit Beta globin intron (found in the vector pCMV-neo-Bam); and the like.
The position of the splice donor and acceptor sequences in the various donor and acceptor vectors determines the location of the intron in the resultant product vector and, therefore, the domain that is spliced out of the resultant vector under appropriate splicing conditions, e.g., in a eukaryotic host cell. Thus, by knowing how the acceptor and donor vectors recombine into a resultant vector, one can position the donor and acceptor splice sites in the donor and acceptor vectors to provide for an intron in any location of the resultant vector, and therefore removal of any sequence of the resultant vector. For example, the donor and acceptor splice sites can be positioned to provide for a spliceable intron in the resultant product vector that includes the 3Ⲡrecombinase recognized site, the 5Ⲡrecombinase recognized site, etc. See, e.g., the experimental section below for more details with respect to a donor and acceptor vector system in which the donor and acceptor splice sites are positioned to provide for a resultant vector in which the 3Ⲡrecombinase site (lox) is present in a spliceable intron.
In many embodiments of interest, the donor and acceptor vectors are further characterized in that one of the donor and acceptor vectors includes only one recombinase recognition site, while the other of the donor and acceptor vectors includes two recombinase recognition sites. As mentioned above, in many embodiments, the donor vector includes two recombinase recognition sites while the acceptor vector includes a single recombinase recognition site. In an alternative embodiment, the donor vector includes a single recombinase recognition site while the acceptor vector includes two recombinase recognition sites. Such a system is described in U.S. application Ser. No. 09/616,651, the disclosure of which is herein incorporated by reference.
A feature of the vectors of these embodiments is that the donor and acceptor vectors must be able to recombine in the presence of a suitable recombinase to produce an expression vector as described above, where the expression vector lacks at least a portion of the initial donor or acceptor vector, i.e., it is a non-fusion expression vector. As such, the donor and acceptor vectors must be able to participate in a recombination event that is other than a fusion event, where by fusion event is meant an event in which two complete vectors are fused in their entirety into one fused vector, e.g., where two plasmids are fused together to produce one plasmid that includes all of material from the initial two plasmids, i.e., a fusion plasmid. As such, the subject methods of these particular embodiments are not fusion methods, where such methods are defined as those methods in which a single vector is produced from two or more initial vectors in their entirety, such that all of the initial vector material of each parent vector, e.g., plasmid, is present in its entirety in the resultant fusion vector.
The donor and acceptor vectors of these particular embodiments are further characterized in that one of the donor and acceptor vectors includes only one recombinase recognition site, while the other of the donor and acceptor vectors includes two recombinase recognition sites. In a first preferred embodiment, the donor vector includes two recombinase recognition sites while the acceptor vector includes a single recombinase recognition site. In an alternative embodiment, the donor vector includes a single recombinase recognition site while the acceptor vector includes two recombinase recognition sites. The donor and acceptor vectors of this first, preferred embodiment and this second, alternative embodiment, are described in greater detail below.
The donor and acceptor vectors described generally above may be linear or circular, e.g., plasmids, and in many embodiments of the subject invention are plasmids. Where the donor and acceptor vectors are plasmids, the donor and acceptor vectors typically range in length from about 2 kb to 200 kb, usually from about 2 kb to 40 kb and more usually from about 2 kb to 10 kb.
The donor and acceptor vectors are further characterized in certain embodiments in that all of the recombinase recognition sites on the donor and acceptor vectors must be recognized by the same recombinase and should be able to recombine with each other, but within this parameter they may be the same or different, but in many embodiments are usually the same. Recombinase recognition sites, i.e., sequence-specific recombinase target sites, of interest include: Cre recombinase activity recognized sites, e.g., loxP, loxP2, loxP511, loxP514, loxB, loxC2, loxL, loxR, loxÎ86, loxÎ117; att, dif; frt; and the like. The particular recombinase recognition site is chosen, at least in part, based on the nature of the recombinase to be employed in the subject methods.
The Donor Vector
As mentioned above, in a preferred embodiment of the subject methods, the donor vector includes two recombinase recognition sites while the acceptor vector includes a single recombinase recognition site. In the donor vector of these embodiments, the donor vector includes two recombinase recognition sites, capable of recombining with each other, e.g., site 1A and site 1B, that flank or border a first or donor domain, i.e., desired donor fragment, where this domain is the portion of the vector that becomes part of the expression vector produced by the subject methods. The length of the donor domain may vary, but in many embodiments ranges from 1 kb to 200 kb, usually from about 1 kb to 10 kb. The portion of the donor vector that is not part of this donor domain, i.e., the part that is 5Ⲡof site 1A and 3Ⲡof site 1B, is referred to herein for clarity as the non-donor domain of the donor vector.
The two recombinase recognition sites of the donor vector are characterized in that they are oriented in the same direction and are capable of recombining with each other. By oriented in the same direction it is meant that they have the same head to tail orientation. Thus, the orientation of site 1A is the same as the orientation of site 1B.
The donor domain flanked by the two recombinase recognition sites, i.e., the portion of the vector 3Ⲡof the first recombinase site 1A and 5Ⲡof the second recombinase site 1B, includes at least the following components: (a) at least one restriction site and (b) at least a portion of a selectable marker, e.g. a coding sequence, a promoter, or a complete selectable marker made up of a coding sequence and a promoter. The donor domain may include at least one restriction site or a plurality of distinct restriction sites, e.g., as found in a multiple cloning site or polylinker, where by restriction site is meant a stretch of nucleotides that has a sequence that is recognized and cleaved by a restriction endonuclease. Where a plurality of restriction sites are present in the donor domain, the number of distinct or different restriction sites typically ranges from about 2 to 5, usually from about 2to 13.
In many embodiments, there are at least two restriction sites, which may or may not be identical depending on the particular protocol employed to produce the donor plasmid, that flank a nucleic acid which is a coding sequence for a protein of interest, where the protein of interest may or may not be known, e.g., it may be a known coding sequence for a known protein or polypeptide or a coding sequence for an as yet unidentified protein or polypeptide, such as where this nucleic acid of interest is a constituent of a library, as discussed in greater detail below. The length of this nucleic acid of interest nucleic acid may vary greatly, but generally ranges from about 18 bp to 20 kb, usually from about 100 bp to 10 kb and more usually from about 1 kb to 3 kb. At least one restriction site and this nucleic acid of interest nucleic acid, when present, are sufficiently close to the 3Ⲡend of the first flanking recombinase site, i.e., recombinase recognition site 1A, such that in the expression vector produced from the donor plasmid, expression of the coding sequence of the nucleic acid of interest is driven by a promoter positioned 5Ⲡof this first recombinase site. As such, the distance separating this restriction site/nucleic acid of interest nucleic acid from the recombinase site typically ranges from about 1 bp to 150 bp, usually from about 1 bp to 50 bp.
In a first preferred embodiment, the donor domain also generally includes a portion of a selectable marker. By portion of a selectable marker is meant a sub-part of a selectable marker, e.g. a coding sequence or a promoter, which can be joined with a second subpart to produce a functioning selectable marker that confers some selectable phenotype on the host cell in which the expression vector produced by the subject methods is to be propogated. Examples of subparts of selectable markers are coding sequences and promoters. As such, in many embodiments, the portion of the selectable marker present on the donor domain is a coding sequence of a marker gene or a promoter capable of driving expression of the coding sequence of the marker gene, where in certain preferred embodiments, the coding sequence of a marker gene is the portion of the selectable marker present on the donor domain. Examples of coding sequences of interest include, but are not limited to, the coding sequences from the following marker genes: the chloramphenicol resistance gene, the ampicillin resistance gene, the tetracycline resistance gene, the kanamycin resistance gene, the streptomycin resistance gene and the SacB gene from B. subtilis encoding sucrase and conferring sucrose sensitivity; and the like. The promoter portions or sub-parts of this selectable marker are any convenient promoters capable of driving expression of the selectable marker in the expression vector produced by the subject methods, see infra, and in many embodiments are bacterial promoters, where particular promoters of interest include, but are not limited to: the Ampicillin resistance promoter, the inducible lac promoter, the tet-inducible promoter from pProTet (PItetO-1)-available from CLONTECH, T7, T3, and SP6 promoters; and the like. The distance of this sub-part or portion of the selectable marker from the 3Ⲡend of the second recombinase recognition site, i.e., site 1B, is sufficient to provide for expression of the marker to occur in the final expression vector, where the other part of selectable marker that is required for efficient expression of the selectable marker is present on the other side, i.e., the 5Ⲡside of the adjacent recombinase recognition site. This distance typically ranges from about 1 bp to 2.5 kb, usually from about 1 bp to 500 bp.
The length of the donor domain flanked by the first and second recombinase sites of the donor plasmid, i.e., the length of the desired donor fragment, may vary greatly, so long as the above described components are present on the donor domain. Generally, the length is at least about 100 bp, usually at least about 500 bp and more usually at least about 900 bp, where the length may be as great as 100 kb or greater, but generally does not exceed about 20 kb and usually does not exceed about 10 kb. Typically, the length of the donor domain ranges from about 100 bp to 100 kb, usually from about 500 bp to 20 kb and more usually from about 900 bp to 10 kb.
In addition to the above described components, the donor vector may include a number of additional elements, where desired, that are present on the non-donor domain or non-desired donor fragment of the donor vector. For example, the non-donor domain generally includes an origin of replication. This origin of replication may be any convenient origin of replication or ori site, where a number of ori sites are known in the art, where particular sites of interest include, but are not limited to: ColE1 and its derivatives, pMB1, other origins that function in prokaryotic cells, the yeast 2 micron origin and the like. Also present on this non-donor domain of certain preferred embodiments is a selective marker gene that provides for negative selection of the non-donor domain under particular conditions, e.g., negative selection conditions. This marker is fully functional and therefor is made up of a coding sequence operably linked to an appropriate promoter, i.e., is provided by a functional expression module or cassette. Markers of interest that are capable of providing for this negative selection include, but are not limited to: SacB, providing sensitivity to sucrose; ccdB; and the like.
This non-donor domain of the donor vector may further include one or more additional components or elements that impart additional functionality to the donor vector. For example, the donor vector may be a vector that is specifically designed for use in conjunction with a yeast two hybrid assay protocol, e.g., such that one can determine whether the gene of interest present in the donor domain encodes a product that binds to a second protein prior to transferal of the gene of interest to an expression vector. In such embodiments, the non-donor domain typically includes the following additional elements: yeast origins of replication, e.g., the yeast 2 micron origin; yeast selection markers, e.g., URA3, Leu, and trp selection markers; and peptide fragments of yeast transcription factors that are expressed as translational fusions to the gene encoded within the donor-domain; where yeast two hybrid systems are known to those of skill in the art and described in: Fields, S. and O-K. Song. 1989. A novel genetic system to detect protein-protein interactions. Nature 340:245-246; Fields, S. and R. Sternglanz. 1994. The two-hybrid system: an assay for protein-protein interactions. Trends Genet. 10: 286-292 and the MATCHMAKER system III user manual, available from CLONTECH.
In other embodiments, the non-donor domain and/or donor domains may contain yet other functional elements that provide specific functions to the donor. For example, Donor vectors can be designed that would also function as prokaryotic expression vectors that express the gene of interest encoded on the donor domain in prokaryotic cells either as a native protein or fused to an affinity or epitope tag. Such vectors may include the following elements in their non-donor or donor domains (e.g., 3Ⲡof the multiple cloning site): inducible bacterial promoters, such as the lac promoter or the PItetO-1 promoter; affinity or epitope tags, e.g., GST, 6x(HN), myc-tag, HA-Tag, GFP and its derivatives. Donor vectors designed to function as retroviral vectors would additionally include retroviral LTRs and packaging signals in the non-donor domain. Donor vectors for expression in mammalian cells might also encode affinity or epitope tags, e.g., GST, 6x(HN), myc-tag, HA-Tag, GFP and its derivatives; and mammalian constitive or inducible promoters, e.g., the CMV promoter, the tet-inducible promoter, the TK promoter; viral promoters, e.g., T7, T3, SP6. In a preferred embodiment of this particular embodiment of the subject invention, the donor vector is as follows. The donor-partial selectable marker comprises the open reading frame (ORF) for a selectable marker gene, and is placed between the two donor sequence-specific recombinase target sites, adjacent to the second-donor sequence-specific recombinase target site. In a more preferred embodiment of the donor construct, the open reading frame of the selectable marker is situated such that its 5Ⲡto 3Ⲡorientation is opposite that of the two donor sequence-specific recombinase target sites.
In another embodiment of the donor construct, the donor construct is a closed circle (e.g., a plasmid or cosmid) comprising, in addition to the two donor sequence-specific recombinase target sites, the unique restriction site or polylinker and the selectable marker gene open reading frame, at least one origin of replication, and at least one donor-functional selectable marker gene. The methods of the present invention should not be limited by the origin of replication selected. For example, origins such as those found in the pUC series of plasmid vectors or of the pBR322 plasmid may be used, as well as others known in the art. Those skilled in the art know that the choice of origin depends on the application for which the donor construct is intended and/or the host strain in which the construct is to be propagated.
A variety of selectable marker genes may be utilized, either for the donor-partial selectable marker or for the donor-functional selectable marker, and such genes may confer either positive- or negative-resistance phenotypes; however, the donor-partial and the donor-functional selectable marker genes should be different from one another. In a preferred embodiment, the selectable markers are selected from the group consisting of the chloramphenicol resistance gene, the ampicillin resistance gene, the tetracycline resistance gene, the kanamycin resistance gene, the streptomycin resistance gene and the sacB gene from B. subtilis encoding sucrase and conferring sucrose sensitivity. In a more preferred embodiment, the donor-partial selectable marker is a portion of the gene (e.g., the open reading frame) for chloramphenicol resistance and the donor-functional selectable marker gene is the gene for ampicillin resistance. In another preferred embodiment of the donor construct, the origin of replication and the donor-functional selectable marker gene lie 5Ⲡof the first-donor sequence-specific recombinase target site.
In another embodiment of the present invention, there is provided a donor construct with all the above-described features, but additionally having a marker gene different from either the donor-functional selectable marker gene or the donor-partial selectable marker gene, wherein the additional marker gene is positioned 5Ⲡof the first sequence-specific recombinase target site such that upon combination with a recombinase, the additional marker gene is located on the undesired second donor fragment. This marker gene provides an additional screen to exclude any products that result in recombinants containing the second donor fragment. The marker gene could be, for example, LacZ. In this case, incorrect recombinants would generate blue colonies on X-Gal plates. Alternatively, a more preferred additional marker would be the sacB gene conferring sucrose sensitivity. In this case, any incorrect clones would be killed when grown on sucrose containing medium. The additional marker provides another screen, thereby enhancing the system by further ensuring that only correct recombination products are obtained following recombination and transformation.
In yet another embodiment of the donor construct, the donor construct further comprises a termination sequence placed 3Ⲡof the restriction site or polylinker sequence but 5Ⲡof the second-donor sequence-specific recombinase target site. In a most preferred embodiment, the termination sequence is placed 5Ⲡof the 3Ⲡend of the donor-partial selectable marker (e.g. the ORF of the selectable marker gene in the preferred embodiment which is in the 5Ⲡto 3Ⲡorientation opposite that of both donor sequence specific recombinase target sites). The present embodiment is not be limited by the termination sequence chosen. In one embodiment, the termination sequence is the Ti termination sequence; however, a variety of termination sequences are known to the art and may be employed in the nucleic acid constructs of the present invention, including the T6S, TINT, TL1, TL2, TR1, and TR2 termination signals derived from the bacteriophage lambda, and termination signals derived from bacterial genes such as the trp gene of E. coli.
In another preferred embodiment of the donor construct, the donor construct further comprises a polyadenylation sequence placed 3Ⲡof the unique restriction site(s) or polylinker but 5Ⲡof the second-donor sequence-specific recombinase target site. In a most preferred embodiment, the polyadenylation sequence is placed 5Ⲡof the 3Ⲡend of the open reading frame of the selectable marker gene similar to the placement described for the termination sequence supra. The present invention should not be limited by the nature of the polyadenylation sequence chosen. In one embodiment, the polyadenylation sequence is selected from the group consisting of the bovine growth hormone polyadenylation sequence, the simian virus 40 polyadenylation sequence and the Herpes simplex virus thymidine kinase polyadenylation sequence.
Also, in a preferred embodiment, the donor construct further comprises a gene or DNA sequence of interest inserted into the unique restriction enzyme site or polylinker. The present invention should not be limited by the size of the DNA of interest inserted into the unique restriction site or polylinker nor the source of DNA (e.g., genomic libraries, cDNA libraries, etc.).
Thus, in a most preferred embodiment of the donor nucleic acid construct, there is provided, in 5Ⲡto 3Ⲡorder: a) a first-donor sequence-specific recombinase target site; b) a nucleic acid or gene of interest; c) termination and polyadenylation sequences; d) an open reading frame for a selectable marker gene in a 5Ⲡto 3Ⲡorientation opposite to that of the first-donor sequence-specific recombinase target site; e) a second-donor sequence-specific recombinase target site in the same 5Ⲡto 3Ⲡorientation as the first donor sequence-specific recombinase target site, wherein the second-donor sequence-specific recombinase target site is able to recombine with said first-donor sequence-specific recombinase target site; f) an origin of replication; and g) a donor-functional selectable marker gene.
In addition to the above features, the donor vector also includes at least one splice site, e.g., a splice donor and/or splice acceptor site. Two representa and non-limiting embodiments are now reviewed. In certain embodiments, the donor vector includes a splice donor site that is positioned to provide for an intron flanking the 3Ⲡsequence specific recombinase site in the product vector. In these embodiments, the splice donor site is positioned between the 5Ⲡand 3Ⲡsequence specific recombinase sites and, more usually, 3Ⲡof the multiple cloning site or gene of interest and 5Ⲡof the second sequence specific recombinase site. These embodiments find use in producing vectors that express the gene of interest as a C-terminal tagged fusion, as a product that does not include sequence encoded by the 3Ⲡsequence specific recombinase site, etc. In certain embodiments, the donor vector also includes a splice acceptor site that is immediately 3Ⲡof the 5Ⲡsequence specific recombinase site. Since the splice acceptor is 5Ⲡof the splice donor sites in the vector, the two splice sites to not make a spliceable intron in the donor vector. However, upon recombination with an appropriate acceptor vector, a product vector in which both the 5Ⲡand 3Ⲡsequence specific recombinase sites are present in distinct introns can be produced. These embodiments are useful in applications where one wishes to express a protein from the product vector in a manner that is free of any residues encoded by the 5Ⲡand 3Ⲡsequence specific recombinase sites.
The Acceptor Vector
As mentioned above, in a preferred embodiment of the subject invention, the acceptor vector employed in the subject methods is a vector that includes a single recombinase site. In these embodiments, the single recombinase site is flanked on one side by a promoter and on the other side, in certain preferred embodiments, by a portion of a selectable marker, e.g., a promoter or a coding sequence, where in many preferred embodiments described further below, this portion or sub-part of the selectable marker is a second promoter, e.g., a bacterial promoter. In these embodiments, the single recombinase site is flanked by two oppositely oriented promoters, where one of promoters drives expression of the gene of interest in the expression vector produced by the subject methods and the second promoter drives expression of the coding sequence of the recombinant-functional selectable marker in the expression vector produced by the subject methods. In these embodiments, the first promoter is a promoter that is capable of driving expression of the gene of interest in the expression vector, where representative promoters include, but are not limited to the CMV promoter, the tet-inducible promoter; retroviral LTR promoter/enhancer sequences, the TK promoter, bacterial promoters, e.g. the lac promoter, the PLtetO-1 promoter; the yeast ADH promoter and the like. The distance between the first promoter and the recombinase site is one that allows for expression in the final expression vector, where the distance typically ranges from about 1 bp to 1000 bp, usually from about 10 bp to 500 bp. The second promoter is a promoter that is capable of driving expression of the recombinant-functional selectable marker, and is generally a bacterial promoter. Bacterial promoters of interest include, but are not limited to: the Ampicillin promoter, the lac promoter, the PLtetO-1 promoter, the T7 promoter and the like. The distance between the bacterial promoter and the recombinase site is sufficient to provide for expression of the selectable marker in the expression vector and typically ranges from about 1 bp to 2.5 kb, usually from about 1 bp to 200 bp.
As indicated above, in yet other preferred embodiments the acceptor vector lacks the portion or subpart of the selectable marker. In these embodiments, the acceptor vector may be used with a donor vector that includes a complete positive selectable marker in the desired donor fragment flanked by the two recombinase sites, i.e., the donor vector portion located between the 3Ⲡend of the first recombinase site and the 5Ⲡend of the second recombinase site. Alternatively, the acceptor vector may be used with a donor vector that only includes a partial selectable positive marker, as described above, where the partial marker is nonetheless functional in the resultant expression vector.
The acceptor vector of the embodiments described above may include a number of additional components or elements which are requisite or desired depending on the nature of the expression vector to be produced from the acceptor vector. In many embodiments of the subject invention, the acceptor vector is an acceptor nucleic acid construct comprising: a) an origin of replication capable of replicating the final desired recombination construct or expression vector; b) an acceptor sequence-specific recombinase target site having a defined 5Ⲡto 3Ⲡorientation; c) a first promoter adjacent to the 5Ⲡend of the acceptor sequence-specific recombinase target site; and d) an acceptor-partial selectable marker, wherein the acceptor-partial selectable marker is capable of recombining with a donor-partial selectable marker from a donor construct (or first donor fragment, once the donor construct is resolved) so creating a recombinant-functional selectable marker in a final desired recombination construct. As in the donor construct, the acceptor construct is not limited by the nature of the sequence-specific recombinase target site employed, and in preferred embodiments the sequence-specific recombinase target site may be selected from the group consisting of loxP, loxP2, loxP511, loxP514, loxB, loxC2, loxL, loxR, loxÎ86, loxÎ117, loxP3, loxP23, att, dif, and frt. The acceptor sequence-specific recombinase target site from the acceptor construct does not have to be identical to those on the donor construct; however, the sequence-specific recombinase target sites on the acceptor and donor constructs must be able to recombine with each other.
In a preferred embodiment, the acceptor-partial selectable marker is a second promoter, wherein the second promoter is oriented such that its 5Ⲡto 3Ⲡorientation is opposite that of the acceptor sequence-specific recombinase target site and the first promoter, and wherein the 3Ⲡend of the second promoter is adjacent to the 3Ⲡend of the acceptor sequence-specific recombinase target site.
The acceptor construct is not limited by the nature of the origin of replication employed. A variety of origins of replication are known in the art and may be employed on the acceptor nucleic acid constructs of the present invention. Those skilled in the art know that the choice of origin depends on the application for which the acceptor construct is intended and/or the host strain in which the construct is to be propagated. In the case of the acceptor construct, the origin of replication is chosen appropriately such that both the acceptor construct and the final desired recombination construct will be able to replicate in the given host cell.
The acceptor construct also is not limited by the nature of the promoters employed. Those skilled in the art know that the choice of the promoter depends upon the type of host cell to be employed for expressing a gene(s) under the transcriptional control of the chosen promoter. A wide variety of promoters functional in viruses, prokaryotic cells and eukaryotic cells are known in the art and may be employed in the acceptor nucleic acid constructs of the present invention. In a preferred embodiment of the invention, the donor construct contains a gene or DNA sequences of interest and when the donor construct recombines with the acceptor construct, the first promoter of the acceptor construct is positioned such that it will drive expression of the gene or DNA sequences of interest. Thus, a promoter capable of driving the gene or DNA sequences of interest should be chosen for the first promoter. Further, in a preferred embodiment of the present invention, the acceptor-partial selectable marker is a promoter capable of driving the expression of the donor-partial selectable marker ORF from the donor construct (e.g., the promoter for the ampicillin gene from the plasmid pUC19) or a viral promoter including, but not limited to, the T7, T3, and Sp6 promoters.
In yet another preferred embodiment of the acceptor construct, the acceptor construct additionally includes a DNA sequence encoding a peptide affinity domain or peptide tag sequence, wherein the affinity domain or tag sequence is 3Ⲡof the first promoter and 5Ⲡof the acceptor sequence-specific recombinase target site, such that the expression of the affinity domain or tag sequence is under control of the first promoter, and such that it is in the same translational frame as the acceptor sequence-specific recombinase target site. The present invention is not limited by the nature of the affinity domain or tag sequence employed; a variety of suitable affinity domains are known in the art, including glutathione-S-transferase, the maltose binding protein, protein A, protein L, polyhistidine tracts, etc.; and tag sequences include, but are not limited to the c-Myc Tag, the HA Tag, the FLAG tag, Green Fluorescent Protein (GFP), etc.
In another preferred embodiment of the acceptor vector construct, the acceptor construct additionally includes a DNA sequence encoding a peptide affinity domain or peptide tag sequence, wherein the affinity domain or tag sequence is 3Ⲡof an intron splice acceptor sequence placed in the acceptor vector 3Ⲡof the partial selectable marker, such that when this vector is recombined with a donor vector of the invention having an appropriately positioned intron splice donor sequence, an expression cassette is generated having a functional synthetic intron and in which the expression of the affinity domain or tag sequence is under control of the first promoter of the acceptor vector, and such that it is in the same translational frame as a gene of interest placed within the donor vector. The present invention is not limited by the nature of the affinity domain or tag sequence employed; a variety of suitable affinity domains are known in the art, including glutathione-S-transferase, the maltose binding protein, protein A, protein L, polyhistidine tracts, etc.; and tag sequences include, but are not limited to the c-Myc Tag, the HA Tag, the FLAG tag, Green Fluorescent Protein (GFP), etc. Since this tag and the gene of interest are in-frame, following splicing, they will be expressed as a single fusion protein, with the Tag being at the C-terminus of the protein.
In another preferred embodiment of the acceptor construct, the acceptor construct further includes an acceptor-functional selectable marker. The present invention is not limited by the nature of the acceptor-functional selectable marker chosen and the selectable marker gene may result in positive or negative selection. In a preferred embodiment, the acceptor-functional selectable marker gene is selected from the group consisting of the chloramphenicol resistance gene, the ampicillin resistance gene, the tetracycline resistance gene, the kanamycin resistance gene, the streptomycin resistance gene and the sacB gene.
In addition to one or more of the above described components, the acceptor vectors may include a number of additional components that impart specific function to the expression vectors that are produced from the acceptor vector according to the subject methods. Additional elements that may be present on the subject acceptor vectors include, but are not limited to: (a) elements requisite for generating vectors suitable for use in yeast two hybrid expression assays, e.g., a GAL4 activation domain coding sequence, a GAL4 DNA-binding domain coding sequence, (as found in pLP-GADT7 and pLP-GBKT7 shown in FIGS. 3A & 3B); (b) elements necessary for study of the localization of a protein in a cell, e.g., tagging elements such as fluorescent protein coding sequences, such as the GFP coding sequences; (c) elements necessary for constitutive, bicistronic expression in mammalian cells, e.g., IRES sites, in combination with selectable markers, e.g. antibiotic resistance, fluorescent protein, etc.; (d) elements necessary for inducible expression of the gene of interest on an expression vector, e.g. inducible promoters such as the tet-responsive promoter, etc.; (e) elements that provide for retroviral expression vectors; and the like.
In addition to the above requisite and optional elements, the acceptor vectors further include at least one splice site. Two representative but non-limiting embodiments are now described further. In a first embodiment, the acceptor vector includes a splice acceptor site positioned 3Ⲡof the single sequence specific recombinase site of the vector. More precisely, this splice acceptor sequence is placed 3Ⲡof the acceptor partial selectable marker sequence. This embodiment finds use in applications where one wishes to produce expression vectors in which the gene of interest is not expressed as a fusion with 3Ⲡsequence specific recombinase site encoded domains, etc. In a second respresentative embodiment, the acceptor vector further includes a splice donor site which is positioned 5Ⲡof the single sequence specific recombinase site, where this embodiment finds use in those situations where one wishes to produce an expression vector in which the gene of interest is expressed as a protein that does not include either N or C-terminal residues encoded by the 5Ⲡand 3Ⲡsequence specific recombinase sites.
Product Vector Generation with a Recombinase
As mentioned above, in the subject methods the donor and acceptor vectors are contacted with a recombinase under conditions sufficient for site specific recombination to occur, specifically under conditions sufficient for a recombinase mediated recombination event to occur that produces the desired intron containing product vector, where product vector production is accomplished without cutting or ligation of the donor and acceptor vectors with restriction endonucleases and nucleic acid ligases. The contact may occur under in vitro or in vivo conditions, as is desired and/or convenient.
In many embodiments, an aqueous reaction mixture is produced by combining the donor and acceptor vectors and the recombinase with water and other requisite and/or desired components to produce a reaction mixture that, under appropriate conditions, results in production of the desired expression vector. The various components may be combined separately or simultaneously, depending on the nature of the particular component and how the components are combined. Conveniently, the components of the reaction mixture are combined in a suitable container. The amount of donor and acceptor vectors that are present in the reaction mixture are sufficient to provide for the desired production of the expression vector product, where the amounts of donor and acceptor vector may be the same or different, but are in many embodiments substantially the same if not the same. In many embodiments, the amount of donor and acceptor vector that is present in the reaction mixture ranges from about 50 ng to 2 Îźg, usually from about 100 ng to 500 ng and more usually from about 150 ng to 300 ng, for a reaction volume ranging from about 5 Îźl to 1000 Îźl, usually from about 10 Îźl to 50 Îźl.
The recombinase that is present in the reaction mixture is one that provides for recombination of the donor and acceptor vectors, i.e. one that recognizes the recombinase recognition sites on the donor and acceptor vectors. As such, the recombinase employed will vary, where representative recombinases include, but are not limited to: recombinases, transposes and integrases, where specific recombinases of interest include, but are not limited to: Cre recombinase (the cre gene has been cloned and expressed in a variety of hosts, and the enzyme can be purified to homogeneity using standard techniques known in the artâpurified Cre protein is available commercially from CLONTECH, Novagen, NEB, and others); FLP recombinase of S. cerevisiae that recognizes the frt site; Int recombinase of bacteriophage Lambda that recognizes the att site; xerC and xerD recombinases of E.coli, which together form a recombinase that recognizes the dif site. the Int protein from the Tn916 transposon; the Tn3 resolvase, the Hin recombinase; the Cin recombinase; the immunoglobulin recombinases; and the like. While the amount of recombinase present in the reaction mixture may vary depending on the particular recombinase employed, in many embodiments the amount ranges from about 0.1 units to 1250 units, usually from about 1 unit to 10 units and more usually from about 1 unit to 2 units, for the above described reaction volumes. The aqueous reaction mixture may include additional components, e.g., a reaction buffer or components thereof, e.g., buffering compounds, such as Tris-HCl; MES; sodium phosphate buffer, sodium acetate buffer; and the like, which are often present in amounts ranging from about 10 mM to 100 mM, usually from about 20 mM to 50 mM; monovalent ions, e.g., sodium, chloride, and the like, which are typically present in amounts ranging from about 10 mM to 500 mM, usually from about 30 mM to 150 mM; divalent cations, e.g., magnesium, calcium and the like, which are often present in amounts ranging from about 1 mM to 20 mM, usually from about 5 mM to 10 mM; and other components, e.g., BSA, EDTA, spermidine and the like; etc (where the above amount ranges are provided for the representative reaction volumes described above). As the reaction mixtures are aqueous reaction mixtures, they also include water.
The subject reaction mixtures are typically prepared at temperatures ranging from about 0-4° C., e.g., on ice, to minimize enzyme activity. Following reaction mixture preparation, the temperature of the reaction mixture is typically raised to a temperature that provides for optimum or maximal recombinase activity, and concomitantly expression vector production. Often, in this portion of the method the temperature will be raised to a temperature ranging from about 4° C. to 37° C., usually from about 10° C. to 25° C., where the mixture will be maintained at this temperature for a period of time sufficient for the desired amount of expression vector production to occur, e.g., for a period of time ranging from about 5 mins to 60 mins, usually from about 10 mins to 15 mins. Following the incubation period, the reaction mixture is subjected to conditions sufficient to inactivate the recombinase, e.g., the temperature of the reaction mixture may be raised to a value ranging from about 65° C. to 70° C. for a period of time ranging from about 5 mins to 10 mins.
Alternatively, contact of the donor and acceptor vectors with the recombinase may occur in vivo, where the donor and acceptor vectors are introduced in a suitable host cell that expresses a recombinase. In this embodiment, the recombination between the donor and acceptor vectors may be accomplished in vivo using a host cell that transiently or constitutively expresses the appropriate site-specific recombinase (e.g., Cre recombinase expressed in the bacterial strain BNN132, available from CLONTECH). pDonor and pAcceptor, i.e., the donor and acceptor vectors respectively, are co-transformed into the host cell using a variety of methods known in the art (e.g., transformation of cells made competent by treatment with CaCl2, electroporation, etc.). The co-transformed host cells are grown under conditions which select for the presence of the recombinant-functional selectable marker created by recombination of pDonor with the pAcceptor (e.g., growth in the presence of chloramphenicol and sucrose when the pDonor vector contains the SacB negative selection marker on the non donor fragment and all or part of the chloramphenicol resistance gene open reading frame and pAcceptor may also contain a promoter necessary for expression of the chloramphenicol open frame). Plasmid DNA is isolated from host cells which grow in the presence of the selective pressure and is subjected to restriction enzyme digestion to confirm that the desired recombination event has occurred.
The present invention also provides a method for the in vitro recombination of nucleic acid constructs, comprising the steps of: a) providing i) a donor nucleic acid construct comprising a donor-partial selectable marker, two donor sequence-specific recombinase target sites each having a defined 5Ⲡto 3Ⲡorientation and wherein the donor sequence-specific recombinase target sites are placed in the donor construct such that they have the same 5Ⲡto 3Ⲡorientation, and a unique restriction enzyme site or polylinker, the restriction enzyme site or polylinker being located 3Ⲡof the first-donor sequence-specific recombinase target site and 5Ⲡof the second-donor sequence-specific recombinase target site; (ii) an acceptor nucleic acid construct comprising an origin of replication, an acceptor sequence-specific recombinase target site having a defined 5Ⲡto 3Ⲡorientation, a first promoter adjacent to the 5Ⲡend of the acceptor sequence-specific recombinase target site, and an acceptor-partial selectable marker, wherein the acceptor-partial selectable marker is capable of recombining with the donor-partial selectable marker from the donor construct to create a recombinant-functional selectable marker in a final desired recombination construct; b) contacting the donor and acceptor constructs in vitro with a site-specific recombinase under conditions such that the desired donor fragment recombines with the acceptor construct to form a final desired recombination construct.
The present invention further provides a method for the recombination of nucleic acid constructs in a host, comprising the steps of: a) providing i) a donor nucleic acid construct comprising a donor-partial selectable marker, two donor sequence-specific recombinase target sites each having a defined 5Ⲡto 3Ⲡorientation and wherein the donor sequence-specific recombinase target sites are placed in the donor construct such that they have the same 5Ⲡto 3Ⲡorientation, and a unique restriction enzyme site or polylinker, the restriction enzyme site or polylinker located 3Ⲡof the first-donor sequence-specific recombinase target site and 5Ⲡof the second-donor sequence-specific recombinase target site; (ii) an acceptor nucleic acid construct comprising an origin of replication, an acceptor sequence-specific recombinase target site having a defined 5Ⲡto 3Ⲡorientation, a first promoter adjacent to the 5Ⲡend of the acceptor sequence-specific recombinase target site, and an acceptor-partial selectable marker, wherein the acceptor-partial selectable marker is capable of recombining with the donor-partial selectable marker from the donor to create a recombinant-functional selectable marker in a final desired recombination construct; and iii) a host cell expressing a site-specific recombinase; b) introducing the donor and acceptor constructs into the host cell under conditions such that the desired donor fragment recombines with the acceptor construct to form the final desired recombination construct which is capable of imparting the ability to the host cell to grow in selective growth medium.
The above methods of producing expression vectors can be employed to rapidly produce a plurality of different expression vectors that are distinct from each other but carry the same coding sequence of interest from a single, original type of donor vector. In other words, the subject methods can be used to rapidly clone a nucleic acid of interest from an initial vector into a plurality of expression vectors. By plurality is meant at least 2, usually at least 5, and more usually at least 10, where the number may be as high as 20, 96 or more. The methods can be performed by one person in a period of time that is a fraction of what it would take by that person of skill in the art to produce the same number and variety of expression vectors using traditional cutting and ligation protocols, where the increase in efficiency obtained by the subject methods is at least about 6 fold, usually at least about 15 fold and more usually at least about 30 fold.
The Resultant Product Vector
The above steps result in the production of an intron containing product vector (i.e. a vector that includes one or more, e.g., one or two, spliceable introns) from donor and acceptor vectors, and in certain embodiments from a portion of one of these vectors and the entirety of the other of these vectors, e.g., from a portion of the donor vector and the entirety of the acceptor vector, where by portion is meant the part of the donor vector that lies 3Ⲡof the first donor sequence-specific recombinase site and 5Ⲡof the second donor sequence-specific recombinase site. The size of the product vector may vary, depending on the nature of the vector. Where the vector is a plasmid, the size of the expression vector may range from about 3 kb to 20 kb, usually from about 4 kb to 8 kb.
The resultant product vector in many embodiments is characterized in that it includes two recombinase recognition sites, i.e., a first and second recombinase recognition site, oriented in the same direction. The distance between the first and second recombinase sites, specifically the distance between the 3Ⲡend of the first recombinase site and the 5Ⲡend of the second recombinase site, ranges in many embodiments from about 100 bp to 100 kb, usually from about 500 bp to 20 kb, depending on whether the coding sequence of a protein of interest or just a restriction site/multiple cloning site, is present between the first and second recombinase recognition sites. The portion of the vector that lies in this inter recombinase region, i.e. 3Ⲡof the first recombinase site and 5Ⲡof the second recombinase site, typically makes up from about 2% to 85%, usually from about 20% to 60% of the entire expression vector.
In many embodiments, the expression vector is further characterized in that 5Ⲡof the first recombinase site is a first promoter, 3Ⲡof the first recombinase site is at least one restriction site; and the second recombinase site located inside a functional selectable marker, i.e., it is flanked by disparate portions or sub-parts of a selectable marker expression module or cassette (e.g., a promoter and a coding sequence), where the second recombinase site is present between the two sub-parts of the selectable marker in a manner such that the selectable marker is functional, i.e., the coding sequence of the selectable marker is expressed. In other words the expression vector includes a selectable marker expression cassette or module made up of a promoter and coding sequence that flank the second recombinase site. In many embodiments, the second recombinase site is flanked by a promoter on its 3Ⲡend and a coding sequence of the selectable marker on its 5Ⲡend. In this embodiment, the first and second promoters, located 5Ⲡof the first recombinase site and 3Ⲡof the second recombinase site, respectively, are oriented in opposite directions.
The expression vector is further characterized by having at least one restriction site, and generally a multiple cloning site, located between the first and second recombinase sites. In many embodiments, located between the first and second recombinase sites, and flanked by two restriction sites, which may or may not be the same, is a nucleic acid of interest, i.e., gene of interest, that includes a coding sequence for a protein of interest whose expression from the expression vector is desired. In these embodiments, the first promoter 5Ⲡof the first recombinase site and the coding sequence for the protein of interest are arranged on either side of the first recombinase site such that they form an expression module or cassette that expresses the encoded protein, i.e., the coding sequence and first promoter flank the first recombinase site in manner such that they are operably linked.
In addition to the above features, the expression vector further includes at least one origin of replication that provides for replication in the host or hosts into which it is placed or transformed during use. Origins of replication of interest include, but are not limited to, those described above in connection with the donor and acceptor vectors.
In certain embodiments, the product vector contains a gene or DNA sequence of interest inserted into the unique restriction enzyme site or polylinker such that the gene or DNA sequence of interest is under the control of the first promoter. The gene or DNA sequence of interest is joined to the 3Ⲡend of the first-recombinant sequence-specific recombinase target site such that a functional transcriptional unit is formed so that the gene or DNA sequence of interest is expressed as a protein driven by the first promoter of the acceptor construct. In a more preferred embodiment, the gene of interest is joined to the 3Ⲡend of the first-recombinant sequence-specific recombinase target site such that a functional translational reading frame is created wherein the gene or DNA sequence of interest is expressed as a fusion protein with an affinity domain or tag sequence derived from the acceptor plasmid and under the expression control of the first promoter of the acceptor construct.
In another preferred embodiment, the gene of interest is joined to the donor splice site such that when the intron is spliced out of the resultant mRNA, the gene of interest is fused in frame to a C-terminal tag derived from the acceptor vector.
In certain embodiments, the product vector further comprises an acceptor-functional selectable marker gene derived from the acceptor construct. If an acceptor-functional selectable marker gene is present in addition to the newly-created recombinant-functional selectable marker, the acceptor-functional selectable marker is a different selectable marker from the newly-created recombinant-functional selectable marker. The present invention should not be limited by the nature of the selectable marker genes chosen; the marker genes may result in positive or negative selection and may be chosen from the group including, but not limited to, the chloramphenicol resistance gene, the ampicillin resistance gene, the tetracycline resistance gene, the kanamycin resistance gene, the streptomycin resistance gene, the strA gene and the sacB gene.
In addition to the above features, the product vector further includes at least one, and typically one to two, spliceable introns. The one or more introns may be positioned anywhere in the product vector. In certain representative embodiments, the 3Ⲡrecombinase recognized site is present in an intron. In other representative embodiments, the 5Ⲡrecombinase recognized site is present in an intron. In yet other representative embodiments, both the 5Ⲡand 3Ⲡrecombinase recognized sites are present in introns.
Utility
The subject methods find use in a variety of different applications, where such applications are generally those protocols and methods in which the transfer of a nucleic acid of interest from one vector to another, e.g., the cloning of a nucleic acid from an initial vector into a final vector, is desired. As such, the subject methods are particularly suited for use in cloning nucleic acids of interest, including whole libraries, from an initial vector into an expression vector, where the product vector may be functionalized to express the polypeptide or protein encoded by the nucleic acid of interest located on it in a variety of different desired environments and/or under desired conditions, e.g., in a cell of interest, in response to a particular stimulus, tagged by a detectable marker, etc.
As such, the product vectors produced by the subject methods find use in a variety of different applications, including the study of polypeptide and protein function and behavior, i.e., in the characterization of a polypeptide or protein, either known or unknown; and the like. In the broadest sense, the subject methods find application in any method where traditional digestion and ligation protocols are employed to transfer or clone a nucleic acid from one vector to another, e.g., cloning digestion and ligation protocols, where the expression vectors produced by the subject methods find use in research applications, as well as other applications, e.g., protein production applications, therapeutic applications, and the like.
Depending on the location of the one or more introns in the product vectors, the product vectors find use in the expression of non-fusion proteins, e.g., proteins free of residues at their N- and C-termini that are encoded by sequence specific recombinase sites; N-and or C-termini tagged proteins, etc.
Systems
Also provided are systems for use in practicing the subject methods. The subject systems at least include a donor vector and an acceptor vector as described above. In addition, the subject systems may include a recombinase which recognizes the recombinase sites present on the donor and acceptor vectors. The systems may also include, where desired, a host cell, e.g., in in vivo methods of expression vector production, as described above. Other components of the subject systems include, but are not limited to: reaction buffer, controls, etc.
Libraries
Also provided are nucleic acid libraries cloned into donor and/or acceptor vectors of the subject invention. These nucleic acid libraries are made up of a plurality of individual donor/acceptor vectors where each distinct constituent member of the library has a different nucleic acid portion or component, e.g., genomic fragment, cDNA, of an original whole nucleic acid library, i.e., fragmented genome, cDNA collection generated from the total or partial mRNA of an mRNA sample, etc. In other words, the libraries of the subject invention are nucleic acid libraries cloned into donor or acceptor vectors according to the subject invention, where the nucleic acid libraries include, but are not limited to, genomic libraries, cDNA libraries, etc. Specific donor/acceptor libraries of interest include, but are not limited to: Human Brain Poly A+ RNA; Human Heart Poly A+ RNA; Human Kidney Poly A+ RNA; Human Liver Poly A+ RNA; Human Lung Poly A+ RNA; Human Pancreas Poly A+ RNA; Human Placenta Poly A+ RNA; Human Skeletal Muscle Poly A+ RNA; Human Testis Poly A+ RNA; Human Prostate Poly A+ RNA and the like. With donor libraries according to the subject invention, the subject methods permit the rapid exchange of either individual clones of interest, groups of clones or potentially an entire cDNA library to a variety of expression vectors.
Kits
Also provided are kits for use in practicing the subject methods. The subject kits at least include at least one donor vector and a recombinase that recognizes the recombinase sites of the donor vector. The subject kits may further include other components that find use in the subject methods, e.g., acceptor vectors; reaction buffers, positive controls, negative controls, etc.
In addition to the above components, the subject kits will further include instructions for practicing the subject methods. These instructions may be present in the subject kits in a variety of forms, one or more of which may be present in the kit. One form in which these instructions may be present is as printed information on a suitable medium or substrate, e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, etc. Yet another means would be a computer readable medium, e.g., diskette, CD, etc., on which the information has been recorded. Yet another means that may be present is a website address which may be used via the internet to access the information at a removed site. Any convenient means may be present in the kits.
The following examples are offered by way of illustration and not by way of limitation.
A.
FIG. 5 provides a flow diagram of a representative recombinase based method according to the subject invention.
B.
In order to test the utility of intron-splicing to enable tagging of a protein of interest in a donor vector with a peptide tag or protein in an acceptor vector, a Donor and Acceptor vector capable of splicing were built using standard molecular biology techniques. The Donor vector was called pDNR-Dual. A map of this vector is provided in FIG. 1 and its sequence is provided below as SEQ ID NO:01. The Acceptor vector was called pLPS-EGFP. A map of this vector is provided in FIG. 2 and its sequence is provided below as SEQ ID NO:02. Further, a luciferase test gene was cloned, using standard techniques into the MCS of pDNR-Dual at the SalI and Apa I sites, so as to generate pDNR-Dual-Luc. A map of this vector is provided in FIG. 3 and the sequence of this vector is provided below as SEQ ID NO:03. In so doing, the Luciferase gene was placed such that it had no stop codon and such that it would be in-frame with the EGFP tag present in pLPS-EGFP following Cre/Lox-based transfer from the Donor to the Acceptor.
The pDNR-Dual-Luc and pLPS-EGFP vectors were then recombined in vitro using Cre according to methods described in Clontech's Creator User Manual (Clontech Laboratories Inc., Palo Alto Calif.) (see also the methods disclosed in U.S. application Ser. No. 09/616,651, the disclosure of which is herein incorporated by reference), and an aliquot of the reaction was transformed in to competent E. coli. Following selection on chloramphenicol and sucrose plates, recombinant clones were isolated and confirmed by standard restriction mapping and sequencing to encode the expectedrecombinant molecule, having the luciferase gene from the donor vector transferred to the acceptor vector. This vector is called pLPS-Luc-EGFP. A map of this vector is provide in FIG. 4 and the sequence of this vector is provided below as SEQ ID NO:04. This construct thus has both a splice donor sequence, provided from the donor vector, and a splice acceptor sequence, provided by the acceptor vector. Together, these create an artificial intron between the 3Ⲡend of the luciferase gene and the 5Ⲡend of the EGFP Tag. This intron being composed of the chloramphenicol open reading frame, the second LoxP site, and the ampicillin promoter sequence.
To test if this construct would generate a properly spliced mRNA, so enabling expression of a luciferase EGFP fusion protein, the pLPS-Luc-EGFP vector was then transfected into HEK293 cells using standard procedures known to the art. For comparison, the HEK293 cells were also transfected with a pLuc-EGFP construct. This construct was made by cloning the luciferase gene (without stop codon) in-frame with EGFP into the pEGFP-N1 vector (available from Clontech Laboraries, Inc. Palo Alto Calif.) using standard molecular biology techniques.
Twenty-four hours after transfection, the cells were examined for EGFP fluorescence using a fluorescence microscope. Both the splicing construct (pLPS-Luc-EGFP) and the direct luciferase-EGFP fusion (pLuc-EGFP) showed equivalent EGFP expression over untransfected control cells.
Extracts of the cells were then made and analyzed by western blotting using an anti-luciferase antibody. Again, both the splicing construct (pLPS-Luc-EGFP) and the direct luciferase-EGFP fusion (pLuc-EGFP) showed equivalent expression of the luciferase-EGFP fusion protein. A further analysis of total RNA extracted from cells transfected with the splicing construct (pLPS-Luc-EGFP) by Northern blotting, demonstrated that the mRNA generated from the construct was being efficiently spliced to remove the chloramphenicol sequences.
| A. | pDNR-dual | ||
| 1 | gcggccgcat aacttcgtat agcatacatt atacgaagtt atcagtcgac ggtaccggac | (SEQ ID NO:01) | |
| 61 | atatgcccgg gaattcctgc aggatccgct cgagaagctt tctagaccat tcgtttggcg | ||
| 121 | cgcgggccca ggtgagtggt cataatcata atcataatca taatcataat cacaactagc | ||
| 181 | ctaggagatc ctggtcatga ctagtgcttg gattctcacc aataaaaaac gcccggcggc | ||
| 241 | aaccgagcgt tctgaacaaa tccagatgga gttctgaggt cattactgga tctatcaaca | ||
| 301 | ggagtccaag cgagctcgat atcaaattac gccccgccct gccactcatc gcagtactgt | ||
| 361 | tgtaattcat taagcattct gccgacatgg aagccatcac aaacggcatg atgaacctga | ||
| 421 | atcgcaagcg gcatcagcac cttgtcgcct tgcgtataat atttgcccat ggtgaaaacg | ||
| 481 | ggggcgaaga agttgtccat attggccacg tttaaatcaa aactggtgaa actcacccag | ||
| 541 | ggattggctg agacgaaaaa catattctca ataaaccctt tagggaaata ggccaggttt | ||
| 601 | tcaccgtaac acgccacatc ttgcgaatat atgtgtagaa actgccggaa atcgtcgtgg | ||
| 661 | tattcactcc agagcgatga aaacgtttca gtttgctcat ggaaaacggt gtaacaaggg | ||
| 721 | tgaacactat cccatatcac cagctcaccg tctttcattg ccatacgaaa ttccggatga | ||
| 781 | gcattcatca ggcgggcaag aatgtgaata aaggccggat aaaacttgtg cttatttttc | ||
| 841 | tttacggtct ttaaaaaggc cgtaatatcc agctgaacgg tctggttata ggtacattga | ||
| 901 | gcaactgact gaaatgcctc aaaatgttct ttacgatgcc attgggatat atcaacggtg | ||
| 961 | gtatatccag tgattttttt ctccatttta gcttccttag ctcctgaaag atccataact | ||
| 1021 | tcgtatagca tacattatac gaagttatgc ggccgcgacg tccacatata cctgccgttc | ||
| 1081 | actattattt agtgaaatga gatattatga tattttctga attgtgatta aaaaggcaac | ||
| 1141 | tttatgccca tgcaacagaa actataaaaa atacagagaa tgaaaagaaa cagatagatt | ||
| 1201 | ttttagttct ttaggcccgt agtctgcaaa tccttttatg attttctatc aaacaaaaga | ||
| 1261 | ggaaaataga ccagttgcaa tccaaacgag agtctaatag aatgaggtcg aaaagtaaat | ||
| 1321 | cgcgcgggtt tgttactgat aaagcaggca agacctaaaa tgtgtaaagg gcaaagtgta | ||
| 1381 | tactttggcg tcacccctta catattttag gtcttttttt attgtgcgta actaacttgc | ||
| 1441 | catcttcaaa caggagggct ggaagaagca gaccgctaac acagtacata aaaaaggaga | ||
| 1501 | catgaacgat gaacatcaaa aagtttgcaa aacaagcaac agtattaacc tttactaccg | ||
| 1561 | cactgctggc aggaggcgca actcaagcgt ttgcgaaaga aacgaaccaa aagccatata | ||
| 1621 | aggaaacata cggcatttcc catattacac gccatgatat gctgcaaatc cctgaacagc | ||
| 1681 | aaaaaaatga aaaatatcaa gttcctgagt tcgattcgtc cacaattaaa aatatctctt | ||
| 1741 | ctgcaaaagg cctggacgtt tgggacagct ggccattaca aaacgctgac ggcactgtcg | ||
| 1801 | caaactatca cggctaccac atcgtctttg cattagccgg agatcctaaa aatgcggatg | ||
| 1861 | acacatcgat ttacatgttc tatcaaaaag tcggcgaaac ttctattgac agctggaaaa | ||
| 1921 | acgctggccg cgtctttaaa gacagcgaca aattcgatgc aaatgattct atcctaaaag | ||
| 1981 | accaaacaca agaatggtca ggttcagcca catttacatc tgacggaaaa atccgtttat | ||
| 2041 | tctacactga tttctccggt aaacattacg gcaaacaaac actgacaact gcacaagtta | ||
| 2101 | acgtatcagc atcagacagc tctttgaaca tcaacggtgt agaggattat aaatcaatct | ||
| 2161 | ttgacggtga cggaaaaacg tatcaaaatg tacagcagtt catcgatgaa ggcaactaca | ||
| 2221 | gctcaggcga caaccatacg ctgagagatc ctcactacgt agaagataaa ggccacaaat | ||
| 2281 | acttagtatt tgaagcaaac actggaactg aagatggcta ccaaggcgaa gaatctttat | ||
| 2341 | ttaacaaagc atactatggc aaaagcacat cattcttccg tcaagaaagt caaaaacttc | ||
| 2401 | tgcaaagcga taaaaaacgc acggctgagt tagcaaacgg cgctctcggt atgattgagc | ||
| 2461 | taaacgatga ttacacactg aaaaaagtga tgaaaccgct gattgcatct aacacagtaa | ||
| 2521 | cagatgaaat tgaacgcgcg aacgtcttta aaatgaacgg caaatggtac ctgttcactg | ||
| 2581 | actcccgcgg atcaaaaatg acgattgacg gcattacgtc taacgatatt tacatgcttg | ||
| 2641 | gttatgtttc taattcttta actggcccat acaagccgct gaacaaaact ggccttgtgt | ||
| 2701 | taaaaatgga tcttgatcct aacgatgtaa cctttactta ctcacacttc gctgtacctc | ||
| 2761 | aagcgaaagg aaacaatgtc gtgattacaa gctatatgac aaacagagga ttctacgcag | ||
| 2821 | acaaacaatc aacgtttgcg cctagcttcc tgctgaacat caaaggcaag aaaacatctg | ||
| 2881 | ttgtcaaaga cagcatcctt gaacaaggac aattaacagt taacaaataa aaacgcaaaa | ||
| 2941 | gaaaatgccg atatcctatt ggcattgacg tcaggtggca cttttcgggg aaatgtgcgc | ||
| 3001 | ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa | ||
| 3061 | taaccctgat aaatgcttca ataatattga aaaaggaaga gtatgagtat tcaacatttc | ||
| 3121 | cgtgtcgccc ttattccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa | ||
| 3181 | acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa | ||
| 3241 | ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg | ||
| 3301 | atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa | ||
| 3361 | gagcaactcg gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc | ||
| 3421 | acagaaaagc atcttaagga tggcatgaca gtaagagaat tatgcagtgc tgccataacc | ||
| 3481 | atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc gaaggagcta | ||
| 3541 | accgcttttt tgcacaacat gggggatcat gtaactcgcc ttgatagttg ggaaccggag | ||
| 3601 | ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca | ||
| 3661 | acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca acaattaata | ||
| 3721 | gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc | ||
| 3781 | tggtttattg ctgataaatc tggagccggt gagcgtgggt ctcgcggtat cattgcagca | ||
| 3841 | ctggggccag atggtaagcc ctcccgtatc gtagttatct acacgacggg gagtcaggca | ||
| 3901 | actatggatg aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg | ||
| 3961 | taactgtcag accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa | ||
| 4021 | tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaat cccttaacgt | ||
| 4081 | gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat | ||
| 4141 | cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg | ||
| 4201 | gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga | ||
| 4261 | gcgcagatac caaatactgt tcttctagtg tagccgtagt taggccacca cttcaagaac | ||
| 4321 | tctgtagcac cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt | ||
| 4381 | ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga taaggcgcag | ||
| 4441 | cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaac gacctacacc | ||
| 4501 | gaactgagat acctacagcg tgagctatga gaaagcgcca cgcttcccga agggagaaag | ||
| 4561 | gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca | ||
| 4621 | gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt | ||
| 4681 | cgatttttyt gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc | ||
| 4741 | tttttacggt tcctggcctt ttgctggcct tttgctcaca tgttctttcc tgcgttatcc | ||
| 4801 | cctgattctg tggataaccg tattaccgcc ttacgcgtgt aaaacgacgg ccagtagatc | ||
| 4861 | tgtaatacga ctcactatag ggcgctagct gctcgccgca gccgaacgac cgagcgcagc | ||
| 4921 | gagtcagtga gcgaggaa | ||
| B. | pLPS-EGFP | ||
| 1 | tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg | (SEQ ID NO:02) | |
| 61 | cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt | ||
| 121 | gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca | ||
| 181 | atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc | ||
| 241 | aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta | ||
| 301 | catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac | ||
| 361 | catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg | ||
| 421 | atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg | ||
| 481 | ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt | ||
| 541 | acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcataa | ||
| 601 | cttcgtatag catacattat acgaagttat agatccaata ttattgaagc atttatcagg | ||
| 661 | gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg | ||
| 721 | ttccgcgcac atttccccga aaagtgccac ctgacgtgga tctcgagctc aagcttcgaa | ||
| 781 | ttcagggttt ccttgacaat atcatactta tcctgtccct tttttttcca cagctaccgg | ||
| 841 | tcgcgagcaa gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg | ||
| 901 | gcgacgtaaa cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg | ||
| 961 | gcaagctgac cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc | ||
| 1021 | tcgtgaccac cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc | ||
| 1081 | agcacgactt cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct | ||
| 1141 | tcaaggacga cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg | ||
| 1201 | tgaaccgcat cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca | ||
| 1261 | agctggagta caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg | ||
| 1321 | gcatcaaggt gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg | ||
| 1381 | accactacca gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact | ||
| 1441 | acctgagcac ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc | ||
| 1501 | tgctggagtt cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagtaaa | ||
| 1561 | gcggccgcga ctctagatca taatcagcca taccacattt gtagaggttt tacttgcttt | ||
| 1621 | aaaaaacctc ccacacctcc ccctgaacct gaaacataaa atgaatgcaa ttgttgttgt | ||
| 1681 | taacttgttt attgcagctt ataatggtta caaataaagc aatagcatca caaatttcac | ||
| 1741 | aaataaagca tttttttcac tgcattctag ttgtggtttg tccaaactca tcaatgtatc | ||
| 1801 | ttaaggcgta aattgtaagc gttaatattt tgttaaaatt cgcgttaaat ttttgttaaa | ||
| 1861 | tcagctcatt ttttaaccaa taggccgaaa tcggcaaaat cccttataaa tcaaaagaat | ||
| 1921 | agaccgagat agggttgagt gttgttccag tttggaacaa gagtccacta ttaaagaacg | ||
| 1981 | tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg cgatggccca ctacgtgaac | ||
| 2041 | catcacccta atcaagtttt ttggggtcga ggtgccgtaa agcactaaat cggaacccta | ||
| 2101 | aagggagccc ccgatttaga gcttgacggg gaaagccggc gaacgtggcg agaaaggaag | ||
| 2161 | ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc acgctgcgcg | ||
| 2221 | taaccaccac acccgccgcg cttaatgcgc cgctacaggg cgcgtcaggt ggcacttttc | ||
| 2281 | ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc | ||
| 2341 | cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaagg aagagtcctg | ||
| 2401 | aggcggaaag aaccagctgt ggaatgtgtg tcagttaggg tgtggaaagt ccccaggctc | ||
| 2461 | cccagcaggc agaagtatgc aaagcatgca tctcaattag tcagcaacca ggtgtggaaa | ||
| 2521 | gtccccaggc tccccagcag gcagaagtat gcaaagcatg catctcaatt agtcagcaac | ||
| 2581 | catagtcccg cccctaactc cgcccatccc gcccctaact ccgcccagtt ccgcccattc | ||
| 2641 | tccgccccat ggctgactaa ttttttttat ttatgcagag gccgaggccg cctcggcctc | ||
| 2701 | tgagctattc cagaagtagt gaggaggctt ttttggaggc ctaggctttt gcaaagatcg | ||
| 2761 | atcaagagac aggatgagga tcgtttcgca tgattgaaca agatggattg cacgcaggtt | ||
| 2821 | ctccggccgc ttgggtggag aggctattcg gctatgactg ggcacaacag acaatcggct | ||
| 2881 | gctctgatgc cgccgtgttc cggctgtcag cgcaggggcg cccggttctt tttgtcaaga | ||
| 2941 | ccgacctgtc cggtgccctg aatgaactgc aagacgaggc agcgcggcta tcgtggctgg | ||
| 3001 | ccacgacggg cgttccttgc gcagctgtgc tcgacgttgt cactgaagcg ggaagggact | ||
| 3061 | ggctgctatt gggcgaagtg ccggggcagg atctcctgtc atctcacctt gctcctgccg | ||
| 3121 | agaaagtatc catcatggct gatgcaatgc ggcggctgca tacgcttgat ccggctacct | ||
| 3181 | gcccattcga ccaccaagcg aaacatcgca tcgagcgagc acgtactcgg atggaagccg | ||
| 3241 | gtcttgtcga tcaggatgat ctggacgaag agcatcaggg gctcgcgcca gccgaactgt | ||
| 3301 | tcgccaggct caaggcgagc atgcccgacg gcgaggatct cgtcgtgacc catggcgatg | ||
| 3361 | cctgcttgcc gaatatcatg gtggaaaatg gccgcttttc tggattcatc gactgtggcc | ||
| 3421 | ggctgggtgt ggcggaccgc tatcaggaca tagcgttggc tacccgtgat attgctgaag | ||
| 3481 | agcttggcgg cgaatgggct gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt | ||
| 3541 | cgcagcgcat cgccttctat cgccttcttg acgagttctt ctgagcggga ctctggggtt | ||
| 3601 | cgaaatgacc gaccaagcga cgcccaacct gccatcacga gatttcgatt ccaccgccgc | ||
| 3661 | cttctatgaa aggttgggct tcggaatcgt tttccgggac gccggctgga tgatcctcca | ||
| 3721 | gcgcggggat ctcatgctgg agttcttcgc ccaccctagg gggaggctaa ctgaaacacg | ||
| 3781 | gaaggagaca ataccggaag gaacccgcgc tatgacggca ataaaaagac agaataaaac | ||
| 3841 | gcacggtgtt gggtcgtttg ttcataaacg cggggttcgg tcccagggct ggcactctgt | ||
| 3901 | cgatacccca ccgagacccc attggggcca atacgcccgc gtttcttcct tttccccacc | ||
| 3961 | ccacccccca agttcgggtg aaggcccagg gctcgcagcc aacgtcgggg cggcaggccc | ||
| 4021 | tgccatagcc tcaggttact catatatact ttagattgat ttaaaacttc atttttaatt | ||
| 4081 | taaaaggatc taggtgaaga tcctttttga taatctcatg accaaaatcc cttaacgtga | ||
| 4141 | gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt cttgagatcc | ||
| 4201 | tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt | ||
| 4261 | ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc | ||
| 4321 | gcagatacca aatactgtcc ttctagtgta gccgtagtta ggccaccact tcaagaactc | ||
| 4381 | tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg | ||
| 4441 | cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg | ||
| 4501 | gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga | ||
| 4561 | actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag ggagaaaggc | ||
| 4621 | ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg | ||
| 4681 | gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg | ||
| 4741 | atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt | ||
| 4801 | tttacggttc ctggcctttt gctggccttt tgctcacatg ttctttcctg cgttatcccc | ||
| 4861 | tgattctgtg gataaccgta ttaccgccat gcat | ||
| C. | pDNR-Dual-Luc | ||
| 1 | gcggccgcat aacttcgtat agcatacatt atacgaagtt atcagtcgac accatggaag | (SEQ ID NO:03) | |
| 61 | acgccaaaaa cataaagaaa ggcccggcgc cattctatcc tctagaggat ggaaccgctg | ||
| 121 | gagagcaact gcataaggct atgaagagat acgccctggt tcctggaaca attgctttta | ||
| 181 | cagatgcaca tatcgaggtg aacatcacgt acgcggaata cttcgaaatg tccgttcggt | ||
| 241 | tggcagaagc tatgaaacga tatgggctga atacaaatca cagaatcgtc gtatgcagtg | ||
| 301 | aaaactctct tcaattcttt atgccggtgt tgggcgcgtt atttatcgga gttgcagttg | ||
| 361 | cgcccgcgaa cgacatttat aatgaacgtg aattgctcaa cagtatgaac atttcgcagc | ||
| 421 | ctaccgtagt gtttgtttcc aaaaaggggt tgcaaaaaat tttgaacgtg caaaaaaaat | ||
| 481 | taccaataat tcagaaaatt attatcatgg attctaaaac ggattaccag ggatttcagt | ||
| 541 | cgatgtacac gttcgtcaca tctcatctac ctcccggttt taatgagtac gattttgtac | ||
| 601 | cagagtcctt tgatcgtgac aaaacaattg cactgataat gaattcctct ggatctactg | ||
| 661 | ggttacctaa gggtgtggcc cttccgcata gaactgcctg cgtcagattc tcgcatgcca | ||
| 721 | gagatcctat ttttggcaat caaatcattc cggatactgc gattttaagt gttgttccat | ||
| 781 | tccatcacgg ttttggaatg tttactacac tcggatattt gatatgtgga tttcgagtcg | ||
| 841 | tcttaatgta tagatttgaa gaagagctgt ttttacgatc ccttcaggat tacaaaattc | ||
| 901 | aaagtgcgtt gctagtacca accctatttt cattcttcgc caaaagcact ctgattgaca | ||
| 961 | aatacgattt atctaattta cacgaaattg cttctggggg cgcacctctt tcgaaagaag | ||
| 1021 | tcggggaagc ggttgcaaaa cgcttccatc ttccagggat acgacaagga tatgggctca | ||
| 1081 | ctgagactac atcagctatt ctgattacac ccgaggggga tgataaaccg ggcgcggtcg | ||
| 1141 | gtaaagttgt tccatttttt gaagcgaagg ttgtggatct ggataccggg aaaacgctgg | ||
| 1201 | gcgttaatca gagaggcgaa ttatgtgtca gaggacctat gattatgtcc ggttatgtaa | ||
| 1261 | acaatccgga agcgaccaac gccttgattg acaaggatgg atggctacat tctggagaca | ||
| 1321 | tagcttactg ggacgaagac gaacacttct tcatagttga ccgcttgaag tctttaatta | ||
| 1381 | aatacaaagg atatcaggtg gcccccgctg aattggaatc gatattgtta caacacccca | ||
| 1441 | acatcttcga cgcgggcgtg gcaggtcttc ccgacgatga cgccggtgaa cttcccgccg | ||
| 1501 | ccgttgttgt tttggagcac ggaaagacga tgacggaaaa agagatcgtg gattacgtcg | ||
| 1561 | ccagtcaagt aacaaccgcg aaaaagttgc gcggaggagt tgtgtttgtg gacgaagtac | ||
| 1621 | cgaaaggtct taccggaaaa ctcgacgcaa gaaaaatcag agagatcctc ataaaggcca | ||
| 1681 | agaagggcgg aaagtccaaa ttgaggatcc gggcccaggt gagtggtcat aatcataatc | ||
| 1741 | ataatcataa tcataatcac aactagccta ggagatcctg gtcatgacta gtgcttggat | ||
| 1801 | tctcaccaat aaaaaacgcc cggcggcaac cgagcgttct gaacaaatcc agatggagtt | ||
| 1861 | ctgaggtcat tactggatct atcaacagga gtccaagcga gctcgatatc aaattacgcc | ||
| 1921 | ccgccctgcc actcatcgca gtactgttgt aattcattaa gcattctgcc gacatggaag | ||
| 1981 | ccatcacaaa cggcatgatg aacctgaatc gccagcggca tcagcacctt gtcgccttgc | ||
| 2041 | gtataatatt tgcccatggt gaaaacgggg gcgaagaagt tgtccatatt ggccacgttt | ||
| 2101 | aaatcaaaac tggtgaaact cacccaggga ttggctgaga cgaaaaacat attctcaata | ||
| 2161 | aaccctttag ggaaataggc caggttttca ccgtaacacg ccacatcttg cgaatatatg | ||
| 2221 | tgtagaaact gccggaaatc gtcgtggtat tcactccaga gcgatgaaaa cgtttcagtt | ||
| 2281 | tgctcatgga aaacggtgta acaagggtga acactatccc atatcaccag ctcaccgtct | ||
| 2341 | ttcattgcca tacgaaattc cggatgagca ttcatcaggc gggcaagaat gtgaataaag | ||
| 2401 | gccggataaa acttgtgctt atttttcttt acggtcttta aaaaggccgt aatatccagc | ||
| 2461 | tgaacggtct ggttataggt acattgagca actgactgaa atgcctcaaa atgttcttta | ||
| 2521 | cgatgccatt gggatatatc aacggtggta tatccagtga tttttttctc cattttagct | ||
| 2581 | tccttagctc ctgaaagatc cataacttcg tatagcatac attatacgaa gttatgcggc | ||
| 2641 | cgcgacgtcc acatatacct gccgttcact attatttagt gaaatgagat attatgatat | ||
| 2701 | tttctgaatt gtgattaaaa aggcaacttt atgcccatgc aacagaaact ataaaaaata | ||
| 2761 | cagagaatga aaagaaacag atagattttt tagttcttta ggcccgtagt ctgcaaatcc | ||
| 2821 | ttttatgatt ttctatcaaa caaaagagga aaatagacca gttgcaatcc aaacgagagt | ||
| 2881 | ctaatagaat gaggtcgaaa agtaaatcgc gcgggtttgt tactgataaa gcaggcaaga | ||
| 2941 | cctaaaatgt gtaaagggca aagtgtatac tttggcgtca ccccttacat attttaggtc | ||
| 3001 | tttttttatt gtgcgtaact aacttgccat cttcaaacag gagggctgga agaagcagac | ||
| 3061 | cgctaacaca gtacataaaa aaggagacat gaacgatgaa catcaaaaag tttgcaaaac | ||
| 3121 | aagcaacagt attaaccttt actaccgcac tgctggcagg aggcgcaact caagcgtttg | ||
| 3181 | cgaaagaaac gaaccaaaag ccatataagg aaacatacgg catttcccat attacacgcc | ||
| 3241 | atgatatgct gcaaatccct gaacagcaaa aaaatgaaaa atatcaagtt cctgagttcg | ||
| 3301 | attcgtccac aattaaaaat atctcttctg caaaaggcct ggacgtttgg gacagctggc | ||
| 3361 | cattacaaaa cgctgacggc actgtcgcaa actatcacgg ctaccacatc gtctttgcat | ||
| 3421 | tagccggaga tcctaaaaat gcggatgaca catcgattta catgttctat caaaaagtcg | ||
| 3481 | gcgaaacttc tattgacagc tggaaaaacg ctggccgcgt ctttaaagac agcgacaaat | ||
| 3541 | tcgatgcaaa tgattctatc ctaaaagacc aaacacaaga atggtcaggt tcagccacat | ||
| 3601 | ttacatctga cggaaaaatc cgtttattct acactgattt ctccggtaaa cattacggca | ||
| 3661 | aacaaacact gacaactgca caagttaacg tatcagcatc agacagctct ttgaacatca | ||
| 3721 | acggtgtaga ggattataaa tcaatctttg acggtgacgg aaaaacgtat caaaatgtac | ||
| 3781 | agcagttcat cgatgaaggc aactacagct caggcgacaa ccatacgctg agagatcctc | ||
| 3841 | actacgtaga agataaaggc cacaaatact tagtatttga agcaaacact ggaactgaag | ||
| 3901 | atggctacca aggcgaagaa tctttattta acaaagcata ctatggcaaa agcacatcat | ||
| 3961 | tcttccgtca agaaagtcaa aaacttctgc aaagcgataa aaaacgcacg gctgagttag | ||
| 4021 | caaacggcgc tctcggtatg attgagctaa acgatgatta cacactgaaa aaagtgatga | ||
| 4081 | aaccgctgat tgcatctaac acagtaacag atgaaattga acgcgcgaac gtctttaaaa | ||
| 4141 | tgaacggcaa atggtacctg ttcactgact cccgcggatc aaaaatgacg attgacggca | ||
| 4201 | ttacgtctaa cgatatttac atgcttggtt atgtttctaa ttctttaact ggcccataca | ||
| 4261 | agccgctgaa caaaactggc cttgtgttaa aaatggatct tgatcctaac gatgtaacct | ||
| 4321 | ttacttactc acacttcgct gtacctcaag cgaaaggaaa caatgtcgtg attacaagct | ||
| 4381 | atatgacaaa cagaggattc tacgcagaca aacaatcaac gtttgcgcct agcttcctgc | ||
| 4441 | tgaacatcaa aggcaagaaa acatctgttg tcaaagacag catccttgaa caaggacaat | ||
| 4501 | taacagttaa caaataaaaa cgcaaaagaa aatgccgata tcctattggc attgacgtca | ||
| 4561 | ggtggcactt ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat | ||
| 4621 | tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa | ||
| 4681 | aggaagagta tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt | ||
| 4741 | tgccttcctg tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag | ||
| 4801 | ttgggtgcac gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt | ||
| 4861 | tttcgccccg aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg | ||
| 4921 | gtattatccc gtattgacgc cgggcaagag caactcggtc gccgcataca ctattctcag | ||
| 4981 | aatgacttgg ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta | ||
| 5041 | agagaattat gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg | ||
| 5101 | acaacgatcg gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta | ||
| 5161 | actcgccttg atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac | ||
| 5221 | accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt | ||
| 5281 | actctagctt cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca | ||
| 5341 | cttctgcgct cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag | ||
| 5401 | cgtgggtctc gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta | ||
| 5461 | gttatctaca cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag | ||
| 5521 | ataggtgcct cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt | ||
| 5581 | tagattgatt taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat | ||
| 5641 | aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta | ||
| 5701 | gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa | ||
| 5761 | acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt | ||
| 5821 | tttccgaagg taactggctt cagcagagcg cagataccaa atactgttct tctagtgtag | ||
| 5881 | ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta | ||
| 5941 | atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca | ||
| 6001 | agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag | ||
| 6061 | cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa | ||
| 6121 | agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga | ||
| 6181 | acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc | ||
| 6241 | gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc | ||
| 6301 | ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt | ||
| 6361 | gctcacatgt tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgcctta | ||
| 6421 | cgcgtgtaaa acgacggcca gtagatctgt aatacgactc actatagggc gctagctgct | ||
| 6481 | cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaa | ||
| D. | pLPS-Luc-EGFP | ||
| 1 | tagttattaa tagtaatcaa ttacggggtc attagttcat agaccatata tggagttccg | (SEQ ID NO:04) | |
| 61 | cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt | ||
| 121 | gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca | ||
| 181 | atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc | ||
| 241 | aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta | ||
| 301 | catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac | ||
| 361 | catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg | ||
| 421 | atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg | ||
| 481 | ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt | ||
| 541 | acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcataa | ||
| 601 | cttcgtatag catacattat acgaagttat cagtcgacac catggaagac gccaaaaaca | ||
| 661 | taaagaaagg cccggcgcca ttctatcctc tagaggatgg aaccgctgga gagcaactgc | ||
| 721 | ataaggctat gaagagatac gccctggttc ctggaacaat tgcttttaca gatgcacata | ||
| 781 | tcgaggtgaa catcacgtac gcggaatact tcgaaatgtc cgttcggttg gcagaagcta | ||
| 841 | tgaaacgata tgggctgaat acaaatcaca gaatcgtcgt atgcagtgaa aactctcttc | ||
| 901 | aattctttat gccggtgttg ggcgcgttat ttatcggagt tgcagttgcg cccgcgaacg | ||
| 961 | acatttataa tgaacgtgaa ttgctcaaca gtatgaacat ttcgcagcct accgtagtgt | ||
| 1021 | ttgtttccaa aaaggggttg caaaaaattt tgaacgtgca aaaaaaatta ccaataattc | ||
| 1081 | agaaaattat tatcatggat tctaaaacgg attaccaggg atttcagtcg atgtacacgt | ||
| 1141 | tcgtcacatc tcatctacct cccggtttta atgagtacga ttttgtacca gagtcctttg | ||
| 1201 | atcgtgacaa aacaattgca ctgataatga attcctctgg atctactggg ttacctaagg | ||
| 1261 | gtgtggccct tccgcataga actgcctgcg tcagattctc gcatgccaga gatcctattt | ||
| 1321 | ttggcaatca aatcattccg gatactgcga ttttaagtgt tgttccattc catcacggtt | ||
| 1381 | ttggaatgtt tactacactc ggatatttga tatgtggatt tcgagtcgtc ttaatgtata | ||
| 1441 | gatttgaaga agagctgttt ttacgatccc ttcaggatta caaaattcaa agtgcgttgc | ||
| 1501 | tagtaccaac cctattttca ttcttcgcca aaagcactct gattgacaaa tacgatttat | ||
| 1561 | ctaatttaca cgaaattgct tctgggggcg cacctctttc gaaagaagtc ggggaagcgg | ||
| 1621 | ttgcaaaacg cttccatctt ccagggatac gacaaggata tgggctcact gagactacat | ||
| 1681 | cagctattct gattacaccc gagggggatg ataaaccggg cgcggtcggt aaagttgttc | ||
| 1741 | cattttttga agcgaaggtt gtggatctgg ataccgggaa aacgctgggc gttaatcaga | ||
| 1801 | gaggcgaatt atgtgtcaga ggacctatga ttatgtccgg ttatgtaaac aatccggaag | ||
| 1861 | cgaccaacgc cttgattgac aaggatggat ggctacattc tggagacata gcttactggg | ||
| 1921 | acgaagacga acacttcttc atagttgacc gcttgaagtc tttaattaaa tacaaaggat | ||
| 1981 | atcaggtggc ccccgctgaa ttggaatcga tattgttaca acaccccaac atcttcgacg | ||
| 2041 | cgggcgtggc aggtcttccc gacgatgacg ccggtgaact tcccgccgcc gttgttgttt | ||
| 2101 | tggagcacgg aaagacgatg acggaaaaag agatcgtgga ttacgtcgcc agtcaagtaa | ||
| 2161 | caaccgcgaa aaagttgcgc ggaggagttg tgtttgtgga cgaagtaccg aaaggtctta | ||
| 2221 | ccggaaaact cgacgcaaga aaaatcagag agatcctcat aaaggccaag aagggcggaa | ||
| 2281 | agtccaaatt gaggatccgg gcccaggtga gtggtcataa tcataatcat aatcataatc | ||
| 2341 | ataatcacaa ctagcctagg agatcctggt catgactagt gcttggattc tcaccaataa | ||
| 2401 | aaaacgcccg gcggcaaccg agcgttctga acaaatccag atggagttct gaggtcatta | ||
| 2461 | ctggatctat caacaggagt ccaagcgagc tcgatatcaa attacgcccc gccctgccac | ||
| 2521 | tcatcgcagt actgttgtaa ttcattaagc attctgccga catggaagcc atcacaaacg | ||
| 2581 | gcatgatgaa cctgaatcgc cagcggcatc agcaccttgt cgccttgcgt ataatatttg | ||
| 2641 | cccatggtga aaacgggggc gaagaagttg tccatattgg ccacgtttaa atcaaaactg | ||
| 2701 | gtgaaactca cccagggatt ggctgagacg aaaaacatat tctcaataaa ccctttaggg | ||
| 2761 | aaataggcca ggttttcacc gtaacacgcc acatcttgcg aatatatgtg tagaaactgc | ||
| 2821 | cggaaatcgt cgtggtattc actccagagc gatgaaaacg tttcagtttg ctcatggaaa | ||
| 2881 | acggtgtaac aagggtgaac actatcccat atcaccagct caccgtcttt cattgccata | ||
| 2941 | cgaaattccg gatgagcatt catcaggcgg gcaagaatgt gaataaaggc cggataaaac | ||
| 3001 | ttgtgcttat ttttctttac ggtctttaaa aaggccgtaa tatccagctg aacggtctgg | ||
| 3061 | ttataggtac attgagcaac tgactgaaat gcctcaaaat gttctttacg atgccattgg | ||
| 3121 | gatatatcaa cggtggtata tccagtgatt tttttctcca ttttagcttc cttagctcct | ||
| 3181 | gaaagatcca taacttcgta tagcatacat tatacgaagt tatagatcca atattattga | ||
| 3241 | agcatttatc agggttattg tctcatgagc ggatacatat ttgaatgtat ttagaaaaat | ||
| 3301 | aaacaaatag gggttccgcg cacatttccc cgaaaagtgc cacctgacgt ggatctcgag | ||
| 3361 | ctcaagcttc gaattcaggg tttccttgac aatatcatac ttatcctgtc cctttttttt | ||
| 3421 | ccacagctac cggtcgcgag caagggcgag gagctgttca ccggggtggt gcccatcctg | ||
| 3481 | gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc | ||
| 3541 | gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg | ||
| 3601 | ccctggccca ccctcgtgac caccctgacc tacggcgtgc agtgcttcag ccgctacccc | ||
| 3661 | gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta cgtccaggag | ||
| 3721 | cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag | ||
| 3781 | ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga ggacggcaac | ||
| 3841 | atcctggggc acaagctgga gtacaactac aacagccaca acgtctatat catggccgac | ||
| 3901 | aagcagaaga acggcatcaa ggtgaacttc aagatccgcc acaacatcga ggacggcagc | ||
| 3961 | gtgcagctcg ccgaccacta ccagcagaac acccccatcg gcgacggccc cgtgctgctg | ||
| 4021 | cccgacaacc actacctgag cacccagtcc gccctgagca aagaccccaa cgagaagcgc | ||
| 4081 | gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactctcgg catggacgag | ||
| 4141 | ctgtacaagt aaagcggccg cgactctaga tcataatcag ccataccaca tttgtagagg | ||
| 4201 | ttttacttgc tttaaaaaac ctcccacacc tccccctgaa cctgaaacat aaaatgaatg | ||
| 4261 | caattgttgt tgttaacttg tttattgcag cttataatgg ttacaaataa agcaatagca | ||
| 4321 | tcacaaattt cacaaataaa gcattttttt cactgcattc tagttgtggt ttgtccaaac | ||
| 4381 | tcatcaatgt atcttaaggc gtaaattgta agcgttaata ttttgttaaa attcgcgtta | ||
| 4441 | aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa aatcccttat | ||
| 4501 | aaatcaaaag aatagaccga gatagggttg agtgttgttc cagtttggaa caagagtcca | ||
| 4561 | ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc | ||
| 4621 | ccactacgtg aaccatcacc ctaatcaagt tttttggggt cgaggtgccg taaagcacta | ||
| 4681 | aatcggaacc ctaaagggag cccccgattt agagcttgac ggggaaagcc ggcgaacgtg | ||
| 4741 | gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg | ||
| 4801 | gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg cgccgctaca gggcgcgtca | ||
| 4861 | ggtggcactt ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat | ||
| 4921 | tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa | ||
| 4981 | aggaagagtc ctgaggcgga aagaaccagc tgtggaatgt gtgtcagtta gggtgtggaa | ||
| 5041 | agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa | ||
| 5101 | ccaggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc atgcatctca | ||
| 5161 | attagtcagc aaccatagtc ccgcccctaa ctccgcccat cccgccccta actccgccca | ||
| 5221 | gttccgccca ttctccgcec catggctgac taattttttt tatttatgca gaggccgagg | ||
| 5281 | ccgcctcggc ctctgagcta ttccagaagt agtgaggagg cttttttgga ggcctaggct | ||
| 5341 | tttgcaaaga tcgatcaaga gacaggatga ggatcgtttc gcatgattga acaagatgga | ||
| 5401 | ttgcacgcag gttctccggc cgcttgggtg gagaggctat tcggctatga ctgggcacaa | ||
| 5461 | cagacaatcg gctgctctga tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt | ||
| 5521 | ctttttgtca agaccgacct gtccggtgcc ctgaatgaac tgcaagacga ggcagcgcgg | ||
| 5581 | ctatcgtggc tggccacgac gggcgttcct tgcgcagctg tgctcgacgt tgtcactgaa | ||
| 5641 | gcgggaaggg actggctgct attgggcgaa gtgccggggc aggatctcct gtcatctcac | ||
| 5701 | cttgctcctg ccgagaaagt atccatcatg gctgatgcaa tgcggcggct gcatacgctt | ||
| 5761 | gatccggcta cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact | ||
| 5821 | cggatggaag ccggtcttgt cgatcaggat gatctggacg aagagcatca ggggctcgcg | ||
| 5881 | ccagccgaac tgttcgccag gctcaaggcg agcatgcccg acggcgagga tctcgtcgtg | ||
| 5941 | acccatggcg atgcctgctt gccgaatatc atggtggaaa atggccgctt ttctggattc | ||
| 6001 | atcgactgtg gccggctggg tgtggcggac cgctatcagg acatagcgtt ggctacccgt | ||
| 6061 | gatattgctg aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc | ||
| 6121 | gccgctcccg attcgcagcg catcgccttc tatcgccttc ttgacgagtt cttctgagcg | ||
| 6181 | ggactctggg gttcgaaatg accgaccaag cgacgcccaa cctgccatca cgagatttcg | ||
| 6241 | attccaccgc cgccttctat gaaaggttgg gcttcggaat cgttttccgg gacgccggct | ||
| 6301 | ggatgatcct ccagcgcggg gatctcatgc tggagttctt cgcccaccct agggggaggc | ||
| 6361 | taactgaaac acggaaggag acaataccgg aaggaacccg cgctatgacg gcaataaaaa | ||
| 6421 | gaaagaataa aacgcacggt gttgggtcgt ttgttcataa acgcggggtt cggtcccagg | ||
| 6481 | gctggcactc tgtcgatacc ccaccgagac cccattgggg ccaatacgcc cgcgtttctt | ||
| 6541 | ccttttcccc accccacccc ccaagttcgg gtgaaggccc agggctcgca gccaacgtcg | ||
| 6601 | gggcggcagg ccctgccata gcctcaggtt actcatatat actttagatt gatttaaaac | ||
| 6661 | ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc atgaccaaaa | ||
| 6721 | tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag atcaaaggat | ||
| 6781 | cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc | ||
| 6841 | taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg | ||
| 6901 | gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag ttaggccacc | ||
| 6961 | acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg | ||
| 7021 | ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga tagttaccgg | ||
| 7081 | ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc ttggagcgaa | ||
| 7141 | cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc acgcttcccg | ||
| 7201 | aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga gagcgcacga | ||
| 7261 | gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt cgccacctct | ||
| 7321 | gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg aaaaacgcca | ||
| 7381 | gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac atgttctttc | ||
| 7441 | ctgcgttatc ccctgattct gtggataacc gtattaccgc catgcat |
A. Consensus Splice Donor and Acceptor Oligos:
Consensus Splice Donor:
(cloned into pDNR-1 at ApaI and AvrII sites)
| Site of Exon/intron boundary | ââââââ|ââ | ||
| top: | ââââCAGGTGAGTTAGGTAAGTGAACATGGTCATAGCTGTTTC | (SEQ ID NOS:05 & 06) | |
| bottom: | CCGGGTCCACTCAATCCATTCACTTGTACCAGTATCGACAAAGGATC |
| Site of Exon/intron boundaryââââââââââââââââââââââââââââââââââ|ââ | ||
| topâââ: AATTCAGGGTTTCCTTGACAATATCATACTTATCCTGTCCCTTTTTTTTCCACAGCTA | (SEQ ID NOS:07 & 08) | |
| bottom:âââââGTCCCAAAGGAACTGTTATAGTATGAATAGGACAGGGAAAAAAAAGGTGTCGATGGCC |
| Site of Exon/intron boundaryââââââââââââââââ|ââ | ||
| topâââ:ââââââââââââââAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGT | (SEQ ID NOS:09 & 10) | |
| bottom:ââââââââââââââTCAACCACCACTCCGGGACCCGTCCAACCATAGTTCCAATGTTCTGTCCA |
| Site of Exon/intron boundaryâââââââââââââââââ|ââ | ||
| Top: | ||
| CGTAGTGTAAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTCATAATCATAATCATAATCATA | (SEQ ID NOS:11 & 12) | |
| ATCATAATCACAACTAGC | ||
| Bottom: | ||
| CCGGGCATCACATTTCAACCACCACTCCGGGACCCGTCCAACCATAGTTCCAATGTTCTGTCCAGTATTAGTATTAGTATTA | ||
| GTATTAGTATTAGTGTTGATCGGATC |
| Topâââ: | GGT CAT AAT CAT AAT CAT AAT CAT AAT CAT AAT CAC AAC TAG | (SEQ ID NOS:13, 14, and 15) | |
| Bottom: | CCA GTA TTA GTA TTA GTA TTA GTA TTA GTA TTA GTG TTG ATC | ||
| Peptide encoded: | Gly His Asn His Asn His Asn His Asn His Asn His Asn stop |
| Oligo for Human Hemoglobin Beta splice acceptor from Intron I: | ||
| Site of Exon/intron boundary | ||
| âââââââââââââââââââââââââââââââ|ââ | ||
| Topâââ: | ||
| AATTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCGATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACC | (SEQ ID NOS:16 & 17) | |
| CTTGGACCCTA | ||
| Bottom: | ||
| GAACCCAAAGACTATCCGTGACTGAGAGAGACGGCTAACCAGATAAAAGGGTGGGAATCCGACGACCACCAGATGGGAAC | ||
| CTGGGATGGCC |
It is evident from the above results and discussion that the subject invention provides an efficient method to transfer a nucleic acid from a first vector to a second vector, where the subject methods do not employ digestion and ligation protocols. Advantages provided by the subject invention include: the ability to transfer or clone a nucleic acid of interest from a single donor into a variety of different expression vectors at substantially the same time and in a known orientation and reading frame; the ability to readily identify successful clones; the ability to transfer many different genes to one or more expression vectors simultaneously; no longer needing to sequence the junctions of the transferred fragment and the expression vector or to resequence the gene transferred and the like. Another advantage of the subject invention is to provide for introns in the product vector, so as to remove any unwanted sequences from the final encoded product, and/or easily produce N- and/or C-terminal tagged fusion proteins. As such, the subject invention represents a significant contribution to the art.
All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.
1. A composition for use in preparing an intron containing vector, said composition comprising:
a donor vector comprising at least one splice site and an acceptor vector comprising at least one splice site, wherein said donor and acceptor vectors each comprise at least one sequence-specific recombinase target site and wherein one of said donor and acceptor vectors comprises two sequence-specific recombinase target sites and the other of said donor and acceptor vectors comprises a single sequence-specific recombinase target site, wherein all of said sequence-specific recombinase target sites are able to recombine with each other.
2. The composition according to claim 1, wherein said donor vector comprises two sequence-specific recombinase target sites and said acceptor vector comprises a single sequence-specific recombinase target site.
3. The composition according to claim 2, wherein said two sequence-specific recombinase target sites on said donor vector are oriented in the same direction.
4. The composition according to claim 1, wherein said donor vector comprises a single sequence-specific recombinase target site and said acceptor comprises two sequence-specific recombinase target sites.
5. The composition according to claim 4, wherein said two sequence-specific recombinase target sites of said acceptor vector are oriented in the same direction.
6. The composition according to claim 1, wherein said system further comprises a sequence specific recombinase.
7. The composition according to claim 1, wherein said sequence-specific recombinase target sites are selected from the group consisting of: lox sites, att sites, dif sites and frt sites.
8. The composition according to claim 1, wherein said donor and acceptor vectors are plasmids, cosmids, bacs, yacs or viruses.
9. The composition according to claim 1 wherein said composition has been inserted.
10. The composition according to claim 1, wherein said at least one splice site in each of said donor and acceptor vectors comprises a splice donor and a splice acceptor sequence.
11. A kit for use in a producing an expression vector, said kit comprises:
(a) a donor vector comprising a splice site; and
(b) an acceptor vector comprising a splice site;
wherein each of said donor and acceptor vectors further comprises at least one sequence-specific recombinase target site and wherein one of said donor and acceptor vectors comprises two sequence-specific recombinase target sites and the other of said donor and acceptor vectors comprises a single sequence-specific recombinase target site, wherein all of said sequence-specific recombinase target sites are able to recombine with each other.
12. The kit according to claim 11, wherein said kit further comprises a sequence specific recombinase that recognizes said sequence-specific recombinase target sites.
13. A method of producing an intron containing vector, said method comprising:
combining a splice site comprising donor vector and a splice sequence comprising acceptor vector, wherein one of said donor and acceptor vectors comprises two sequence-specific recombinase target sites and the other of said donor and acceptor vectors comprises a single sequence-specific recombinase target site, wherein all of said sequence-specific recombinase target sites are able to recombine with each other, with a recombinase under conditions sufficient for site-specific recombination to occur to produce said intron containing vector.
14. The method according to claim 13, wherein said donor vector comprises two sequence-specific recombinase target sites and said acceptor vector comprises a single sequence-specific recombinase target site.
15. The method according to claim 13, wherein said donor vector comprises a single sequence-specific recombinase target site and said acceptor vector comprises two sequence-specific recombinase target sites.
16. The method according to claim 13, wherein said sequence specific recombinase is selected from the group consisting of: recombinases, transposases and integrases.
17. The method according to claim 13, wherein said sequence specific recombinase is Cre recombinase.
18. The method according to claim 13, wherein said sequence-specific recombinase target sites are selected from the group consisting of: lox sites, att sites, dif sites and frt sites.
19. The method according to claim 18, wherein said recombinase recognition sites are lox sites.