-
2006-11-21
10/114,828
2002-04-02
US 7,138,569 B2
2006-11-21
-
-
Anne Kubelik
2022-11-14
The present invention relates to isolated nucleic acid molecules encoding a type IIIβsecreted bacterial protein capable of modifying a cell death pathway in a plant cell. One aspect of the present invention involves an isolated nucleic acid molecule having a nucleotide sequence that encodes the HopPtoD2 protein of Pseudomonas syringae pv. syringae DC 3000. Expression vectors, host cells, and transgenic plants which include the DNA molecules of the present invention are also disclosed. The nucleic acid molecules of the present invention can be used to impart disease resistance to a plant and to make a plant hypersusceptible to colonization by nonpathogenic bacteria.
Get notified when new applications in this technology area are published.
C12N15/82 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
C12N15/63 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
This application claims benefit of U.S. Provisional Patent Application Ser. Nos. 60/280,918, filed Apr. 2, 2001, and 60/356,408, filed Feb. 12, 2002, each of which is hereby incorporated by reference in its entirety.
This work was supported by National Science Foundation Grant Nos. DBI-0077622 and MCB-9982646 and National Research Initiative Competitive Grants Program, U.S. Department of Agriculture, Grant Nos. 97-35303-4488 and 01-35319-10019. The U.S. Government may have certain rights in this invention.
The present invention relates to isolated DNA molecules corresponding to the open reading frames of Pseudomonas syringae pv. tomato DC3000, the isolated avirulence effector proteins and hrp-dependent outer proteins encoded thereby, as well as their various uses.
The plant pathogenic bacterium Pseudomonas syringae is noted for its diverse and host-specific interactions with plants. A specific strain may be assigned to one of at least 40 pathovars based on its host range among different plant species and then further assigned to a race based on differential interactions among cultivars of the host. In host plants the bacteria typically grow to high population levels in leaf intercellular spaces and then produce necrotic lesions. In nonhost plants or in host plants with race-specific resistance, the bacteria elicit the hypersensitive response (HR), a rapid, defense-associated programmed death of plant cells in contact with the pathogen (Alfano & Collmer, J. Bacteriol. 179:5655β5662 (1997)). The ability to produce either of these reactions in plants appears to be directed by hrp (HR and pathogenicity) and hrc (HR and conserved) genes that encode a type III protein secretion pathway and by avr (avirulence) and hop (Hrp-dependent outer protein) genes that encode effector proteins injected into plant cells by the pathway (Alfano & Collmer, J. Bacteriol. 179:5655β5662 (1997)). These effectors may also betray the parasite to the HR-triggering R-gene surveillance system of potential hosts (hence the avr designation), and plant breeding for resistance based on such gene-for-gene (avr-R) interactions may produce complex combinations of races and differential cultivars (Keen, Annu. Rev. Genet. 24:447β463 (1990)). hrp/hrc genes are probably universal among necrosis-causing gram-negative plant pathogens, and they have been sequenced in P. syringae pv. syringae (Psy) 61, Erwinia amylovora Ea321, Xanthomonas campestris pv. vesicatoria (Xcv) 85β10, and Ralstonia solanacearum GMI1000 (Alfano & Collmer, J. Bacteriol. 179:5655β5662 (1997)). Based on their distinct gene arrangements and regulatory components, the hrp/hrc gene clusters of these four bacteria can be divided into two groups: I (Pseudomonas and Erwinia) and II (Xanthomonas and Ralstonia). The discrepancy between the distribution of these groups and the phylogeny of the bacteria provides some evidence that hrp/hrc gene clusters have been horizontally acquired and, therefore, may represent pathogenicity islands (Pais) (Alfano & Collmer, J. Bacteriol. 179:5655β5662 (1997)).
Virulence effector proteins delivered to or into host cells by type III secretion systems are key factors in the pathogenicity of many bacteria, including animal pathogens in the genera Salmonella, Yersinia, Shigella, and Escherichia, and plant pathogens in the genera Pseudomonas, Erwinia, Xanthomonas, Ralstonia, and Pantoea (GalΓ‘n & Collmer, Science 284:1322β1328 (1999)). In plant pathogens, the type III secretion machinery is referred to as the hypersensitive response and pathogenicity (Hrp) system because secretion mutants typically lose their ability to elicit the defense-associated hypersensitive response in nonhost plants and to grow parasitically or be pathogenic in host plants (Alfano & Collmer, J. Bacteriol. 179:5655β5662 (1997)). These phenotypes demonstrate the importance of the Hrp system in bacterium-plant interactions, and global identification of effectors will be important for understanding the pathogenesis of bacteria that use type III secretion systems. Unfortunately, several factors have hindered searches for type III effector genes. These factors include: (i) effectors are often redundant with mutants having only subtle phenotypes; (ii) with few exceptions (see e.g., Miao & Miller, Proc. Natl. Acad. Sci. USA 97:7539β7544 (2000)) motifs that can identify proteins as substrates for type III secretion have not been recognized (Lloyd et al., Mol. Microbiol. 39:520β532) (2001); (iii) many effectors show no similarity to known proteins; and (iv) some pathogens have multiple type III secretion systems which deliver different sets of effectors (Cornelis & Van Gijsegem, Annu. Rev. Microbiol. 54:735β774 (2000)). Thus, a complete inventory of type III effector genes is lacking for any pathogen, although it seems that pathogens such as Salmonella may have many such genes (Worley et al., Mol. Microbiol. 36:749β761 (2000)).
Plant pathogen type III effector proteins are mostly designated Avr or Hop, depending on whether their primary phenotype involves plant reaction or secretion behavior. Many effectors were initially discovered through their ability to betray the pathogen to the host R (resistance) gene surveillance system, thereby rendering the pathogen avirulent on a test plant (Keen, Annu. Rev. Genet. 24:447β463 (1990)). Over 25 effector genes have been identified by Avr or Hop phenotypes in various P. syringae pathovars and races (Vivian & Arnold, J. Plant Pathol. 82:163β178 (2000); Alfano et al., Proc. Natl. Acad. Sci. USA 97:4856β4861 (2000)). The encoded effectors seem to determine both basic pathogenicity and host range, but the number of such proteins produced by any single strain has not been systematically investigated. P. s. tomato DC3000 is known to carry at least three avr genes, avrPto (Ronald et al., J. Bacteriol. 174:1604β1611 (1992)), avrPtoB, and avrE (Lorang & Keen, Mol. Plant-Microbe Interact. 8:49β57 (1995)), with the latter being in the Hrp pathogenicity island along with five other candidate effector genes (Alfano et al., Proc. Natl. Acad. Sci. USA 97:4856β486 (2000); Lorang & Keen, Mol. Plant-Microbe Interact. 8:49β57 (1995)).
The present invention is a further advance in the effort to identify, clone, and sequence Avr and Hop proteins or polypeptides from plant pathogens.
One aspect of the present invention relates to isolated nucleic acid molecules having a nucleotide sequence which (i) encodes a protein or polypeptide including SEQ ID No: 2, SEQ ID No: 4, SEQ ID No: 6, SEQ ID No: 8, SEQ ID No: 10, SEQ ID No: 12, SEQ ID No: 14, SEQ ID No: 16, SEQ ID No: 18, SEQ ID No: 20, SEQ ID No: 22, or SEQ ID No: 24; or (ii) hybridizes, under stringency conditions including a hybridization medium which includes 0.9ΓSSC at a temperature of 42Β° C., to a DNA molecule complementary to SEQ ID No: 1, SEQ ID No: 3, SEQ ID No: 5, SEQ ID No: 7, SEQ ID No: 9, SEQ ID No: 11, SEQ ID No: 13, SEQ ID No: 15, SEQ ID No: 17, SEQ ID No: 19, SEQ ID No: 21, or SEQ ID No: 23; or (iii) includes a nucleotide sequence which is complementary to the nucleic acid molecules of (i) and (ii). Expression vectors, host cells, and transgenic plants which include the DNA molecules of the present invention are also disclosed. Methods of making such host cells and transgenic plant are disclosed.
A further aspect of the present invention relates to isolated effector proteins or polypeptides encoded by the nucleic acid molecules of the present invention. Compositions which contain the proteins or polypeptides are also disclosed.
Yet another aspect of the present invention relates to methods of imparting disease resistance to a plant. According to one approach, this method is carried out by transforming a plant cell with a heterologous DNA molecule of the present invention and regenerating a transgenic plant from the transformed plant cell, wherein the transgenic plant expresses the heterologous DNA molecule under conditions effective to impart disease resistance. According to one approach, this method is carried out by treating a plant with a protein or polypeptide of the present invention under conditions effective to impart disease resistance to the treated plant.
A further aspect of the present invention relates to a method of causing eukaryotic cell death which includes: introducing into a eukaryotic cell a cytotoxic Pseudomonas protein of the present invention, said introducing being performed under conditions effective to cause cell death.
A still further aspect of the present invention relates to a method of treating a cancerous condition which includes introducing a cytotoxic Pseudomonas protein of the present invention into cancer cells of a patient under conditions effective to cause death of cancer cells, thereby treating the cancerous condition.
Yet another aspect of the present invention relates to a method of modifying a metabolic pathway in a cell which includes: introducing into a cell a protein or polypeptide of the present invention which interacts with a native cellular protein involved in a metabolic pathway, wherein the protein or polypeptide modifies the metabolic pathway through its interaction with the native cellular protein.
It is believed that bacteria have evolved effector proteins to make exquisite alterations in host metabolism. While plant resistance and cancer cell toxicity are important uses, as mentioned above, it is believed that these effector proteins can be used to modify or effect metabolic targets in eukaryotes, including both yeasts and higher order species, such as plants and animals. It is noteworthy that several of the effector proteins being claimed in this application have homologs in other phytopathogenic bacteria. Thus, these proteins appear to represent a set of effectors that are conserved among Pseudomonas, Erwinia, Xanthomonas, and Ralstonia spp. By disrupting the function of these effectors through, for example, transgenic expression thereof in a host plant, it is believed that use of these effectors may lead to widely applicable means for controlling diseases of plants.
FIG. 1 is an RNA blot analysis of HrpL-dependent expression of representative virulence-implicated genes. Each well was loaded with 25 ΞΌg of total RNA isolated from CUCPB5114 cultures carrying either vector control pCPP5031 or PnptII-hrpL plasmid pCPP5032 (lanes 2 and 3, respectively). PCR-amplified internal fragments were used as probes; lane 1 in each case contains PCR product of the corresponding probe. AvrPpiB1Pto and AvrPpiB2Pto are 100% identical, therefore their signals cannot be distinguished.
FIGS. 2AβB illustrate assays for Hrp system-dependent secretion in culture or translocation in plants of various Avr and Hop proteins. In FIG. 2A, DC3000 or a DC3000 hrcC mutant (Yuan & He, J. Bacteriol. 178:6399β6402 (1996), which is hereby incorporated by reference in its entirety) carrying test ORFs (i.e., candidate effectors) fused to either the FLAG (F) or hemagglutinin (HA) epitopes were grown in Hrp-inducing media, and cultures were separated into cell (lanes 1β3) and supernatant (lanes 4β5) fractions and analyzed by SDS-PAGE and immunobloting. Lanes: 1 and 4, wild type DC3000; 2 and 5, wild type DC3000(pTestORF); 3 and 6, DC3000 hrcC mutant(pTestORF). As an additional control against leakage, pCPP2318 (which encodes the mature form of Ξ²-lactamase, Ξ²-lac) was included in all strains. The presence of an epitope-tagged protein in the supernatant fraction of the wild type (lane 5), but absence in the hrcC secretion mutant (lane 6), indicated that the test ORF encoded a secreted product. In FIG. 2B, AvrRpt2 translocation assays were performed with a DC3000 AvrRps4 homolog (now designated HopPtoK). Constructs that contained ORFs fused to AvrRpt2 lacking translocation signals were electroporated into P. s. phaseolicola 3121. Test strains were infiltrated into A. thaliana Col-0 (RPS2). Plant responses were scored 18 hr after inoculation for hypersensitive collapse (HR) or no visible response (N).
One aspect of the present invention relates to Pseudomonas syringae pv. syringae DC 3000 nucleic acid molecules which encode Avr or Hop effector proteins.
A first nucleic acid molecule is a homolog of avrPphE of Pseudomonas syringae pv. phaseolicola and has a nucleotide sequence according to SEQ ID No: 1 as follows:
| atgaaaatac ataacgctgg cctaacccca cctttgccgg gcatttcgaa tggaaacgtt | 60 | |
| ggaaaggcgg cgcaatcatc aataactcaa ccgcagagcc agcaaggctc ttatggcttg | 120 | |
| ccaccagaaa gctctgagac tcgccctgat agggcgcgtg cgaactatcc atattcatca | 180 | |
| gtacaaacac ggttgccgcc cgttgcgtct gctgggaaac cgctgcctga tacaccatct | 240 | |
| tctttgcccg gctacttact gttgcgaagg ctggaccatc gccctgtgga tcaggaaggt | 300 | |
| accaaaagtc tgatcccggc agacaaggct gtggctgaag cgcgccgtgc attgcccttt | 360 | |
| ggaagaggca atattgatgt ggatgcgcaa ctttccaatc tggaaagtgg agcccgcacc | 420 | |
| cttgcagcaa ggtgcttgag aaaagatgcc gaggccgccg gtcatgagcc tatgcctgcg | 480 | |
| aatgagccga tgaactggca tgttcttgtt gcgatgtcag gccaggtgtt cggcgcgggc | 540 | |
| aactgtggcg aacatgctcg tatagcgagc ttcgcctatg gagctttggc ccaggaaaac | 600 | |
| ggacgatctg aatatgaaaa catctacttg gctgcatcga ctgaggaaga tcatgtgtgg | 660 | |
| gctgaaaccg acgaatccca gtctggcacc tcaacgattg tcatggatcc gtggtcaaat | 720 | |
| ggttcagcca tatttgcgga ggacagtagg tttgcgaaaa atcgaaatgc tgtagagcgt | 780 | |
| acggatacgt ttaatctttc aaccgcagcc gaagcgggca aaattacgcg tgagacagcc | 840 | |
| gagaaggctt tgacgcaggt cacaacccga ttgcagaaac gcctggcgga tcagcaggag | 900 | |
| caagtctcgc ccatcaaaag tggtcgctat cgaccagaaa aatcggtact tgatgatgca | 960 | |
| tttgtccgca gagtgagcga caagttgacc tcccctgatt tgcggcgtgc actacaggta | 1020 | |
| gatattgaag cggtcggagt cgcaatgtcg ctcggcacca agggcgtcaa ggacgctact | 1080 | |
| cgacaagccc gacctttggt tgagcttgca gtgaaggtcg cctctcctca aggcttggcg | 1140 | |
| agacgagatg tctga | 1155 |
| Met Lys Ile His Asn Ala Gly Leu Thr Pro Pro Leu Pro Gly Ile Ser | |
| ββ1βββββββββββββββ5ββββββββββββββββββ10ββββββββββββββββββ15 | |
| Asn Gly Asn Val Gly Lys Ala Ala Gln Ser Ser Ile Thr Gln Pro Gln | |
| βββββββββββββ20ββββββββββββββββββ25ββββββββββββββββββ30 | |
| Ser Gln Gln Gly Ser Tyr Gly Leu Pro Pro Glu Ser Ser Glu Thr Arg | |
| βββββββββ35ββββββββββββββββββ40ββββββββββββββββββ45 | |
| Pro Asp Arg Ala Arg Ala Asn Tyr Pro Tyr Ser Ser Val Gln Thr Arg | |
| βββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Leu Pro Pro Val Ala Ser Ala Gly Lys Pro Leu Pro Asp Thr Pro Ser | |
| β65ββββββββββββββββββ70ββββββββββββββββββ75ββββββββββββββββββ80 | |
| Ser Leu Pro Gly Tyr Leu Leu Leu Arg Arg Leu Asp His Arg Pro Val | |
| βββββββββββββββββ85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Asp Gln Glu Gly Thr Lys Ser Leu Ile Pro Ala Asp Lys Ala Val Ala | |
| ββββββββββββ100βββββββββββββββββ105βββββββββββββββββ110 | |
| Glu Ala Arg Arg Ala Leu Pro Phe Gly Arg Gly Asn Ile Asp Val Asp | |
| ββββββββ115βββββββββββββββββ120βββββββββββββββββ125 | |
| Ala Gln Leu Ser Asn Leu Glu Ser Gly Ala Arg Thr Leu Ala Ala Arg | |
| ββββ130βββββββββββββββββ135βββββββββββββββββ140 | |
| Cys Leu Arg Lys Asp Ala Glu Ala Ala Gly His Glu Pro Met Pro Ala | |
| 145βββββββββββββββββ150βββββββββββββββββ155βββββββββββββββββ160 | |
| Asn Glu Pro Met Asn Trp His Val Leu Val Ala Met Ser Gly Gln Val | |
| ββββββββββββββββ165βββββββββββββββββ170βββββββββββββββββ175 | |
| Phe Gly Ala Gly Asn Cys Gly Glu His Ala Arg Ile Ala Ser Phe Ala | |
| ββββββββββββ180βββββββββββββββββ185βββββββββββββββββ190 | |
| Tyr Gly Ala Leu Ala Gln Glu Asn Gly Arg Ser Glu Tyr Glu Asn Ile | |
| ββββββββ195βββββββββββββββββ200βββββββββββββββββ205 | |
| Tyr Leu Ala Ala Ser Thr Glu Glu Asp His Val Trp Ala Glu Thr Asp | |
| ββββ210βββββββββββββββββ215βββββββββββββββββ220 | |
| Glu Ser Gln Ser Gly Thr Ser Thr Ile Val Met Asp Pro Trp Ser Asn | |
| 225βββββββββββββββββ230βββββββββββββββββ235βββββββββββββββββ240 | |
| Gly Ser Ala Ile Phe Ala Glu Asp Ser Arg Phe Ala Lys Asn Arg Asn | |
| ββββββββββββββββ245βββββββββββββββββ250βββββββββββββββββ255 | |
| Ala Val Glu Arg Thr Asp Thr Phe Asn Leu Ser Thr Ala Ala Glu Ala | |
| ββββββββββββ260βββββββββββββββββ265βββββββββββββββββ270 | |
| Gly Lys Ile Thr Arg Glu Thr Ala Glu Lys Ala Leu Thr Gln Val Thr | |
| ββββββββ275βββββββββββββββββ280βββββββββββββββββ285 | |
| Thr Arg Leu Gln Lys Arp Leu Ala Asp Gln Gln Glu Gln Val Ser Pro | |
| ββββ290βββββββββββββββββ295βββββββββββββββββ300 | |
| Ile Lys Ser Gly Arp Tyr Arg Pro Glu Lys Ser Val Leu Asp Asp Ala | |
| 305βββββββββββββββββ310βββββββββββββββββ315βββββββββββββββββ320 | |
| Phe Val Arg Arg Val Ser Asp Lys Leu Thr Ser Pro Asp Leu Arg Arg | |
| ββββββββββββββββ325βββββββββββββββββ330βββββββββββββββββ335 | |
| Ala Leu Gln Val Asp Ile Glu Ala Val Gly Val Ala Met Ser Leu Gly | |
| ββββββββββββ340βββββββββββββββββ345βββββββββββββββββ350 | |
| Thr Lys Gly Val Lys Asp Ala Thr Arg Gln Ala Arg Pro Leu Val Glu | |
| ββββββββ355βββββββββββββββββ360βββββββββββββββββ365 | |
| Leu Ala Val Lys Val Ala Ser Pro Gln Gly Leu Ala Arg Arg Asp Val | |
| ββββ370βββββββββββββββββ375βββββββββββββββββ380 |
A second nucleic acid molecule is a homolog of avrRps4 of Pseudomonas syringae pv. pisi and has a nucleotide sequence according to SEQ ID No: 3 as follows:
| atgaatcgca tttcaaccag ctcagtaaat tccagcttca attacacggc ccctacggag | 60 | |
| gaagcgcaaa accgcttcgc ctcagcgccc gacaattccc ctctagttgt caccacaaca | 120 | |
| tctatcgccc aagcgtcgga agggctacaa aggccggggg caacgctaag catgcaggcc | 180 | |
| cagcgactgc gccaattgat ggggagcccg tctgagcagt gccggaggga cacaatgtta | 240 | |
| gctaaagctt ttgatgctca acgcctaaac attaacactc aagcaggctc ttccaacagc | 300 | |
| ccacacttga acgctctcaa cacgctccaa caacgacact tcaaacctgc ggctggtggg | 360 | |
| ctagaaatcc cagttacatc caactcctta ttgggcggtg gcaggcaagt ctatcaaatt | 420 | |
| ggctcatcgt cacgcgagct aagccaccga ccggtcaatg atcaggaccg cgcgcccttc | 480 | |
| agggcgcttg agcggctgca cgccgagttg tttagaggtg ggccgattga gtttgtgcct | 540 | |
| agaggcagca acgtgttggc ctcaaacgtg agggatgtcg acatggacga gttcgatgtc | 600 | |
| atcaactcta aagacggctg ccaaggcatt ggcaccactg gcctgggacc ctgcattgca | 660 | |
| gtgtgtgcaa gaggcatgga tagagaaggg cttccggtgc tgggtgtcta tcaccacagt | 720 | |
| ggtatcggct caccagagga taccatggct actcttgatc aagcgatgcg cgataaaggt | 780 | |
| gctttgcaaa tcaaatactc cctggtaggc ggcatgatca tgcctaaaga ggaagaggct | 840 | |
| ggcagctatg acgacgagca aagctttttg gcattgaaag gcagttattc aatcgaaggg | 900 | |
| gcgcgcttgc atgtatccga aggcgaagag gacgtgcata ccggcgagga caacagtgtc | 960 | |
| aatgttctgc tgatgcctga ccgcgttctg tacggtcgcg acacgctcta ctgctga | 1017 |
| Met Asn Arg Ile Her Thr Ser Ser Val Asn Ser Ser Phe Asn Tyr Thr | |
| ββ1βββββββββββββββ5ββββββββββββββββββ10ββββββββββββββββββ15 | |
| Ala Pro Thr Glu Glu Ala Gln Asn Arg Phe Ala Ser Ala Pro Asp Asn | |
| βββββββββββββ20ββββββββββββββββββ25ββββββββββββββββββ30 | |
| Ser Pro Leu Val Val Thr Thr Thr Ser Ile Ala Gln Ala Ser Glu Gly | |
| βββββββββ35ββββββββββββββββββ40ββββββββββββββββββ45 | |
| Leu Gln Arg Pro Gly Ala Thr Leu Ser Met Gln Ala Gln Arg Leu Arg | |
| βββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Gln Leu Met Gly Ser Pro Ser Glu Gln Cys Arg Arg Asp Thr Met Leu | |
| β65ββββββββββββββββββ70ββββββββββββββββββ75ββββββββββββββββββ80 | |
| Ala Lys Ala Phe Asp Ala Gln Arg Leu Asn Ile Asn Thr Gln Ala Gly | |
| βββββββββββββββββ85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Ser Ser Asn Ser Pro His Leu Asn Ala Leu Asn Thr Leu Gln Gln Arg | |
| ββββββββββββ100βββββββββββββββββ105βββββββββββββββββ110 | |
| His Phe Lys Pro Ala Ala Gly Gly Leu Glu Ile Pro Val Thr Ser Asn | |
| ββββββββ115βββββββββββββββββ120βββββββββββββββββ125 | |
| Ser Leu Leu Gly Gly Gly Arg Gln Val Tyr Gln Ile Gly Ser Per Ser | |
| ββββ130βββββββββββββββββ135βββββββββββββββββ140 | |
| Arg Glu Leu Ser His Arg Pro Val Asn Asp Gln Asp Arg Ala Pro Phe | |
| 145βββββββββββββββββ150βββββββββββββββββ155βββββββββββββββββ160 | |
| Arg Ala Leu Glu Arg Leu His Ala Glu Leu Phe Arg Gly Gly Pro Ile | |
| ββββββββββββββββ165βββββββββββββββββ170βββββββββββββββββ175 | |
| Glu Phe Val Pro Arg Gly Ser Asn Val Leu Ala Ser Asn Val Arg Asp | |
| ββββββββββββ180βββββββββββββββββ185βββββββββββββββββ190 | |
| Val Asp Met Asp Glu Phe Asp Val Ile Asn Ser Lys Asp Gly Cys Gln | |
| ββββββββ195βββββββββββββββββ200βββββββββββββββββ205 | |
| Gly Ile Gly Thr Thr Gly Leu Gly Pro Cys Ile Ala Val Cys Ala Arg | |
| ββββ210βββββββββββββββββ215βββββββββββββββββ220 | |
| Gly Met Asp Arg Glu Gly Leu Pro Val Leu Gly Val Tyr His His Ser | |
| 225βββββββββββββββββ230βββββββββββββββββ235βββββββββββββββββ240 | |
| Gly Ile Gly Ser Pro Glu Asp Thr Met Ala Thr Leu Asp Gln Ala Met | |
| ββββββββββββββββ245βββββββββββββββββ250βββββββββββββββββ255 | |
| Arg Asp Lys Gly Ala Leu Gln Ile Lys Tyr Ser Leu Val Gly Gly Met | |
| ββββββββββββ260βββββββββββββββββ265βββββββββββββββββ270 | |
| Ile Met Pro Lys Glu Glu Glu Ala Gly Per Tyr Asp Asp Glu Gln Ser | |
| ββββββββ275βββββββββββββββββ280βββββββββββββββββ285 | |
| Phe Leu Ala Leu Lys Gly Ser Tyr Ser Ile Glu Gly Ala Arg Leu His | |
| ββββ290βββββββββββββββββ295βββββββββββββββββ300 | |
| Val Ser Glu Gly Glu Glu Asp Val His Thr Gly Glu Asp Asn Ser Val | |
| 305βββββββββββββββββ310βββββββββββββββββ315βββββββββββββββββ320 | |
| Asn Val Leu Leu Met Pro Asp Arg Val Leu Tyr Gly Arp Asp Thr Leu | |
| ββββββββββββββββ325βββββββββββββββββ330βββββββββββββββββ335 | |
| Tyr Cys |
A third nucleic acid molecule is a homolog of avrPphF orf1 of Pseudomonas syringae pv. phaseolicola and has a nucleotide sequence according to SEQ ID No: 5 as follows:
| atgaaaaacg catttgacct gcttgtggaa gggctggcta aggactacaa catgccgccc | 60 | |
| ttgcctgaca agaaacatat cgatgaagtc tattgctttg agtttcaaag tggtatgaac | 120 | |
| gtaaaagtat accaagacga atttcgctgg gtatatttca ccgctgacgt tgggacattt | 180 | |
| caagatagca gtattgacac attaaactac gcgctccagc tgaacaactt tagccttaga | 240 | |
| aaacctttcc tgaccttcgg aatgacgaag gagaaaaatg gtgtattgca tacacgcacc | 300 | |
| cccttgattg aggtagacaa cgtgcaaatg cgcaggatat ttgaggagct tataggcgtg | 360 | |
| gcaggtgaaa tcagaaaaac actaaaactc aaatag | 396 |
| Met Lys Asn Ala Phe Asp Leu Leu Val Glu Gly Leu Ala Lys Asp Tyr | |
| ββ1βββββββββββββββ5ββββββββββββββββββ10ββββββββββββββββββ15 | |
| Asn Met Pro Pro Leu Pro Asp Lys Lys His Ile Asp Glu Val Tyr Cys | |
| βββββββββββββ20ββββββββββββββββββ25ββββββββββββββββββ30 | |
| Phe Glu Phe Gln Ser Gly Met Asn Val Lys Val Tyr Gln Asp Glu Phe | |
| βββββββββ35ββββββββββββββββββ40ββββββββββββββββββ45 | |
| Arp Trp Val Tyr Phe Thr Ala Asp Val Gly Thr Phe Gln Asp Ser Ser | |
| βββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Ile Asp Thr Leu Asn Tyr Ala Leu Gln Leu Asn Asn Phe Per Leu Arg | |
| β65ββββββββββββββββββ70ββββββββββββββββββ75ββββββββββββββββββ80 | |
| Lys Pro Phe Leu Thr Phe Gly Met Thr Lys Glu Lys Asn Gly Val Leu | |
| βββββββββββββββββ85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| His Thr Arg Thr Pro Leu Ile Glu Val Asp Asn Val Gln Met Arg Arp | |
| ββββββββββββ100βββββββββββββββββ105βββββββββββββββββ110 | |
| Ile Phe Glu Glu Leu Ile Gly Val Ala Gly Glu Ile Arg Lys Thr Leu | |
| ββββββββ115βββββββββββββββββ120βββββββββββββββββ125 | |
| Lys Leu Lys | |
| ββββ130 |
A fourth nucleic acid molecule is also homolog of avrPphF orf2 of Pseudomonas syringae pv. phaseolicola and has a nucleotide sequence according to SEQ ID No: 7 as follows:
| gtgtatagcc catcccatac acaacgaata acttcagctc cctctacatc cactcatgtt | 60 | |
| ggtggagata cactgacatc cattcatcag ctttcgcata gtcagagaga gcagtttctg | 120 | |
| aacatgcatg atccaatgag agtaatggga cttgaccatg ataccgagct tttcagaacg | 180 | |
| acggatagtc gctatataaa aaacgataaa ctcgcgggca atccacaatc catggcgagt | 240 | |
| atccttatgc atgaagaact gcgccccaat cgttttgcca gccatacagg tgcccaacca | 300 | |
| cacgaagcaa gggcgtacgt tccgaaaaga ataaaagcca ccgatctagg agttccatca | 360 | |
| ctgaacgtaa tgactggctc gctagcgcga gacggaatta gagcttatga tcacatgagt | 420 | |
| gataatcagg tctctgtcaa aatgcgactg ggagattttc tcgaaagggg tggcaaggtc | 480 | |
| tatgccgacg cttcgtctgt agctgacgat ggggaaacat cacaagctct gattgtcaca | 540 | |
| ttgcccaaag gacagaaagt gccggtcgaa agggtctga | 579 |
| Val Tyr Ser Pro Ser His Thr Gln Arg Ile Thr Ser Ala Pro Ser Thr | |
| ββ1βββββββββββββββ5ββββββββββββββββββ10ββββββββββββββββββ15 | |
| Ser Thr His Val Gly Gly Asp Thr Lou Thr Ser Ile His Gln Leu Ser | |
| βββββββββββββ20ββββββββββββββββββ25ββββββββββββββββββ30 | |
| His Ser Gln Arg Glu Gln Phe Leu Asn Met His Asp Pro Met Arg Val | |
| βββββββββ35ββββββββββββββββββ40ββββββββββββββββββ45 | |
| Met Gly Leu Asp His Asp Thr Glu Leu Phe Arg Thr Thr Asp Ser Arg | |
| βββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Tyr Ile Lys Asn Asp Lys Leu Ala Gly Asn Pro Gln Ser Met Ala Ser | |
| β65ββββββββββββββββββ70ββββββββββββββββββ75ββββββββββββββββββ80 | |
| Ile Leu Met His Glu Glu Leu Arg Pro Asn Arg Phe Ala Ser His Thr | |
| βββββββββββββββββ85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Gly Ala Gln Pro His Glu Ala Arg Ala Tyr Val Pro Lys Arg Ile Lys | |
| ββββββββββββ100βββββββββββββββββ105βββββββββββββββββ110 | |
| Ala Thr Asp Leu Gly Val Pro Ser Leu Asn Val Met Thr Gly Ser Leu | |
| ββββββββ115βββββββββββββββββ120βββββββββββββββββ125 | |
| Ala Arg Asp Gly Ile Arg Ala Tyr Asp His Met Ser Asp Asn Gln Val | |
| ββββ130βββββββββββββββββ135βββββββββββββββββ140 | |
| Ser Val Lys Met Arg Leu Gly Asp Phe Leu Glu Arg Gly Gly Lys Val | |
| 145βββββββββββββββββ150βββββββββββββββββ155βββββββββββββββββ160 | |
| Tyr Ala Asp Ala Ser Ser Val Ala Asp Asp Gly Glu Thr Ser Gln Ala | |
| ββββββββββββββββ165βββββββββββββββββ170βββββββββββββββββ175 | |
| Leu Ile Val Thr Leu Pro Lys Gly Gln Lys Val Pro Val Glu Arg Val | |
| ββββββββββββ180βββββββββββββββββ185βββββββββββββββββ190 |
A fifth nucleic acid molecule is a homolog of avrPphD of Pseudomonas syringae pv. phaseolicola and has a nucleotide sequence according to SEQ ID No: 9 as follows:
| atgaatcctc tacgatctat tcaacacaac attgcaactc ccccaatcag tggcggtcag | 60 | |
| ccattagacg cggtgggccc tcaggcccag caatcccatc ctaaaaggat ttcaccttct | 120 | |
| caattgagcc aaagcgctca ccaggctcta gaacgccttt cagctaatgc cgaacaccaa | 180 | |
| cgccttgcat cactggtacg caacgctctg caggatggca catttcaatt tcaatccagt | 240 | |
| aaccacacgc aagtaaccta taaagcgtca atctgtctgc cagctgacac cgataccgtg | 300 | |
| agaaccgacc acttgattaa taacgagctg acggttcagg cccgattaaa tgatcaatcg | 360 | |
| gagtacgaca tcgtcagcgc acatttgcat ggctcttcga aagccatatc cttcgacgta | 420 | |
| cccagccccc cgcccgcaca tggttcagca tcttctgtct tgagtgaacg gacccatcta | 480 | |
| ggtatgagtc gcgttctctc acaagatgca gtagacagca gtagcctgga aactccgtta | 540 | |
| ctgagctcgc cagaccattc tcgtccgcca tcacagccaa agcccgtgca tatcgggtcg | 600 | |
| gtccgcaggg actctggtag ccttgtttcc gataacccgg tagtgcaggc cctgctatcg | 660 | |
| tttgcgcagg ccgaccaggc atttccacca caggccgcga gcattgccgg ggtccagctg | 720 | |
| gaaatgcggc cacgtcggga tattgagaaa gcacttgagg aattcaaagg cgccttcacg | 780 | |
| gtggtgaagg cgcaactgat gtccggtgcc aactcgtcgg agcgtgtaga tgaggatgtc | 840 | |
| aacgcagaca tccatatccc cttattgctc aaggccatcg agcggggggc tgcggcattt | 900 | |
| ggtccaaacg catcaatcgg ccagaatagc gcgaaagcgt ttctcgcctc atgtgctccc | 960 | |
| aagatcacgt ccaatgacga tgtcctctcc gagttcatca accagaaact caagggggac | 1020 | |
| gacgatcttc aggttcgcct gggcgcacag gaattgttgc atgtagccac caagaaggaa | 1080 | |
| ttccagctcg gcggtctagc cggcagcatc ggggtcagca gcatactcgg ctcggcatgg | 1140 | |
| gagcttggcg cttctgagct gttgaaaaat gccatcttcg gcaaaaattt ctcaccgagc | 1200 | |
| caatatgccc tgcaattggc tggaatcgat tcagtgcctc ctttgattat cgagtccatg | 1260 | |
| gacaccatgt gcgtacttgc catcatcaag ggcatgaagg gtgaggagtg gtccatgagc | 1320 | |
| gatctacttc ccaaggcgtt gaaggccggt gctatttcct cggtggtgtc attccccaat | 1380 | |
| aatgttttgc agtatgcagg tttcaaatcc agagtcggcg atcttgcggc aaactcagtg | 1440 | |
| acaactgaag cggccatctt tggcgccgcc tccggtattc cacccgaggt caaggaaagt | 1500 | |
| gaagagctga tgcgtgctgg cttattccag agcatgaagg acggcgtgat ggctcattca | 1560 | |
| ggcgaggggg tggacaccaa aaaaacgatt gagcggatga cgcgccatgc gctggatatc | 1620 | |
| gctccgggcg aaagcaccgc tgtcaagtcc atggggctgg catcgattgt cgggatgatt | 1680 | |
| ccactgattg ccagcaacaa ggcaaccggg ctgctgtcgg aacaggtact gcgtattttc | 1740 | |
| cggagcgccg tcttcaatcc aatcgaagcc atcgctctga acgcgttggc gcttggcggg | 1800 | |
| cgtgtcaacg ttcccgggct atttgattcc gacaatgcca agcatgcacg cgtggtacaa | 1860 | |
| accatccttg cgcgggccag ccagcacatg gaagctggag accgtgacat ttccgcagag | 1920 | |
| gagctacatc aaatgctggc tccccggagc gagttcctgc gccatgtggg atctgcgatt | 1980 | |
| gtcaacggca tgaatgccag ctttgaggca attcccgccc tggttcggaa gcttggatat | 2040 | |
| ggtgaggctc cattggccga acgtattccg tatcaagacc tggctgtgcc cgacacgtcg | 2100 | |
| cggcagcccg caccctga | 2118 |
| Met Asn Pro Leu Arg Her Ile Gln His Asn Ile Ala Thr Pro Pro Ile | |
| ββ1βββββββββββββββ5ββββββββββββββββββ10ββββββββββββββββββ15 | |
| Ser Gly Gly Gln Pro Leu Asp Ala Val Gly Pro Gln Ala Gln Gln Her | |
| βββββββββββββ20ββββββββββββββββββ25ββββββββββββββββββ30 | |
| His Pro Lys Arg Ile Ser Pro Ser Gln Leu Ser Gln Ser Ala His Gln | |
| βββββββββ35ββββββββββββββββββ40ββββββββββββββββββ45 | |
| Ala Leu Glu Arg Leu Ser Ala Asn Ala Glu His Gln Ary Leu Ala Ser | |
| βββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Leu Val Arg Asn Ala Leu Gln Asp Gly Thr Phe Gln Phe Gln Ser Ser | |
| β65ββββββββββββββββββ70ββββββββββββββββββ75ββββββββββββββββββ80 | |
| Asn His Thr Gln Val Thr Tyr Lys Ala Ser Ile Cys Leu Pro Ala Asp | |
| βββββββββββββββββ85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Thr Asp Thr Val Arg Thr Asp His Leu Ile Asn Asn Glu Leu Thr Val | |
| ββββββββββββ100βββββββββββββββββ105βββββββββββββββββ110 | |
| Gln Ala Arg Leu Asn Asp Gln Ser Glu Tyr Asp Ile Val Ser Ala His | |
| ββββββββ115βββββββββββββββββ120βββββββββββββββββ125 | |
| Leu His Gly Ser Ser Lys Ala Ile Ser Phe Asp Val Pro Ser Pro Pro | |
| ββββ130βββββββββββββββββ135βββββββββββββββββ140 | |
| Pro Ala His Gly Ser Ala Ser Ser Val Leu Ser Glu Arg Thr His Leu | |
| 145βββββββββββββββββ150βββββββββββββββββ155βββββββββββββββββ160 | |
| Gly Met Ser Arg Val Leu Ser Gln Asp Ala Val Asp Ser Ser Ser Leu | |
| ββββββββββββββββ165βββββββββββββββββ170βββββββββββββββββ175 | |
| Glu Thr Pro Leu Leu Ser Ser Pro Asp His Ser Arg Pro Pro Ser Gln | |
| ββββββββββββ180βββββββββββββββββ185βββββββββββββββββ190 | |
| Pro Lys Pro Val His Ile Gly Ser Val Arg Arg Asp Ser Gly Ser Leu | |
| ββββββββ195βββββββββββββββββ200βββββββββββββββββ205 | |
| Val Ser Asp Asn Pro Val Val Gln Ala Leu Leu Ser Phe Ala Gln Ala | |
| ββββ210βββββββββββββββββ215βββββββββββββββββ220 | |
| Asp Gln Ala Phe Pro Pro Gln Ala Ala Ser Ile Ala Gly Val Gln Leu | |
| 225βββββββββββββββββ230βββββββββββββββββ235βββββββββββββββββ240 | |
| Glu Met Arg Pro Arg Arg Asp Ile Glu Lys Ala Leu Glu Glu Phe Lys | |
| ββββββββββββββββ245βββββββββββββββββ250βββββββββββββββββ255 | |
| Gly Ala Phe Thr Val Val Lys Ala Gln Leu Met Ser Gly Ala Asn Ser | |
| ββββββββββββ260βββββββββββββββββ265βββββββββββββββββ270 | |
| Ser Glu Arg Val Asp Glu Asp Val Asn Ala Asp Ile His Ile Pro Leu | |
| ββββββββ275βββββββββββββββββ280βββββββββββββββββ285 | |
| Leu Leu Lys Ala Ile Glu Arg Gly Ala Ala Ala Phe Gly Pro Asn Ala | |
| ββββ290βββββββββββββββββ295βββββββββββββββββ300 | |
| Ser Ile Gly Gln Asn Ser Ala Lys Ala Phe Leu Ala Ser Cys Ala Pro | |
| 305βββββββββββββββββ310βββββββββββββββββ315βββββββββββββββββ320 | |
| Lys Ile Thr Ser Asn Asp Asp Val Leu Ser Glu Phe Ile Asn Gln Lys | |
| ββββββββββββββββ325βββββββββββββββββ330βββββββββββββββββ335 | |
| Leu Lys Gly Asp Asp Asp Leu Gln Val Arg Leu Gly Ala Gln Glu Leu | |
| ββββββββββββ340βββββββββββββββββ345βββββββββββββββββ350 | |
| Leu His Val Ala Thr Lys Lys Glu Phe Gln Leu Gly Gly Leu Ala Gly | |
| ββββββββ355βββββββββββββββββ360βββββββββββββββββ365 | |
| Ser Ile Gly Val Ser Ser Ile Leu Gly Ser Ala Trp Glu Leu Gly Ala | |
| ββββ370βββββββββββββββββ375βββββββββββββββββ380 | |
| Ser Glu Leu Leu Lys Asn Ala Ile Phe Gly Lys Asn Phe Ser Pro Ser | |
| 385βββββββββββββββββ390βββββββββββββββββ395βββββββββββββββββ400 | |
| Gln Tyr Ala Leu Gln Leu Ala Gly Ile Asp Ser Val Pro Pro Leu Ile | |
| ββββββββββββββββ405βββββββββββββββββ410βββββββββββββββββ415 | |
| Ile Glu Ser Met Asp Thr Met Cys Val Leu Ala Ile Ile Lys Gly Met | |
| ββββββββββββ420βββββββββββββββββ425βββββββββββββββββ430 | |
| Lys Gly Glu Glu Trp Ser Met Ser Asp Leu Leu Pro Lys Ala Leu Lys | |
| ββββββββ435βββββββββββββββββ440βββββββββββββββββ445 | |
| Ala Gly Ala Ile Ser Ser Val Val Ser Phe Pro Asn Asn Val Leu Gln | |
| ββββ450βββββββββββββββββ455βββββββββββββββββ460 | |
| Tyr Ala Gly Phe Lys Ser Arg Val Gly Asp Leu Ala Ala Asn Ser Val | |
| 465βββββββββββββββββ470βββββββββββββββββ475βββββββββββββββββ480 | |
| Thr Thr Glu Ala Ala Ile Phe Gly Ala Ala Ser Gly Ile Pro Pro Glu | |
| ββββββββββββββββ485βββββββββββββββββ490βββββββββββββββββ495 | |
| Val Lys Glu Ser Glu Glu Leu Met Arg Ala Gly Leu Phe Gln Ser Met | |
| ββββββββββββ500βββββββββββββββββ505βββββββββββββββββ510 | |
| Lys Asp Gly Val Met Ala His Ser Gly Glu Gly Val Asp Thr Lys Lys | |
| ββββββββ515βββββββββββββββββ520βββββββββββββββββ525 | |
| Thr Ile Glu Arg Met Thr Arg His Ala Leu Asp Ile Ala Pro Gly Glu | |
| ββββ530βββββββββββββββββ535βββββββββββββββββ540 | |
| Ser Thr Ala Val Lys Ser Met Gly Leu Ala Ser Ile Val Gly Met Ile | |
| 545βββββββββββββββββ550βββββββββββββββββ555βββββββββββββββββ560 | |
| Pro Leu Ile Ala Ser Asn Lys Ala Thr Gly Leu Leu Ser Glu Gln Val | |
| ββββββββββββββββ565βββββββββββββββββ570βββββββββββββββββ575 | |
| Leu Arg Ile Phe Arg Ser Ala Val Phe Asn Pro Ile Glu Ala Ile Ala | |
| ββββββββββββ580βββββββββββββββββ585βββββββββββββββββ590 | |
| Leu Asn Ala Leu Ala Leu Gly Gly Arg Val Asn Val Pro Gly Leu Phe | |
| ββββββββ595βββββββββββββββββ600βββββββββββββββββ605 | |
| Asp Ser Asp Asn Ala Lys His Ala Arg Val Val Gln Thr Ile Leu Ala | |
| ββββ610βββββββββββββββββ615βββββββββββββββββ620 | |
| Arg Ala Ser Gln His Met Glu Ala Gly Asp Arg Asp Ile Ser Ala Glu | |
| 625βββββββββββββββββ630βββββββββββββββββ635βββββββββββββββββ640 | |
| Glu Leu His Gln Met Leu Ala Pro Arg Ser Glu Phe Leu Arg His Val | |
| ββββββββββββββββ645βββββββββββββββββ650βββββββββββββββββ655 | |
| Gly Ser Ala Ile Val Asn Gly Met Asn Ala Ser Phe Glu Ala Ile Pro | |
| ββββββββββββ660βββββββββββββββββ665βββββββββββββββββ670 | |
| Ala Leu Val Arg Lys Leu Gly Tyr Gly Glu Ala Pro Leu Ala Glu Arg | |
| ββββββββ675βββββββββββββββββ680βββββββββββββββββ685 | |
| Ile Pro Tyr Gln Asp Leu Ala Val Pro Asp Thr Ser Arg Gln Pro Ala | |
| ββββ690βββββββββββββββββ695βββββββββββββββββ700 | |
| Pro | |
| 705 |
A sixth nucleic acid molecule is another homolog of avrPphD of Pseudomonas syringae pv. phaseolicola and has a nucleotide sequence according to SEQ ID No: 11 as follows:
| atgaatcccc tgcaacctat tcagcacagc attacaaatt cccaaatgag tggtggtcag | 60 | |
| caattagagg cggagggctc tcaggcccac aattcctatt cccatcctga caggatttcg | 120 | |
| ctttcccaat tgagccaaag cgctcaccta gctctagatc acctttcaac tcagcctaat | 180 | |
| accgatcacc aacgcgttgc atcactggta cgcaacgctg tgcaggacgg taagttccaa | 240 | |
| cttcaatcca gtaacgacac gcaagtaacc tataaaactt cagtctgtcc gccagctaac | 300 | |
| gccgacacca tgggggccgc ccacttaatt aataacgagc tgacggttca ggcccgatta | 360 | |
| aatgatcaac ttgagtacga catcgtcagc gctcatttgt atggcccttc ggaagccata | 420 | |
| tccatcgatg catccagtcc tccctcggcc aacgatctag cgtcctctgg cttgagcgaa | 480 | |
| cgtacgcacc taggtatgaa tcgtgtcctc ttacgctacg cggtgccccc tcgggaaacc | 540 | |
| gaagaccaat gtgttatggt gatcgacaaa atgccccccc ccaaacacgg caaaatgtct | 600 | |
| ttcttccgta ccactaatga cttgagcaaa ctgcctttgg gaatggagac gggcgggttg | 660 | |
| tccgacctga aattggctgg ttgtgaacgt atttcttccg tcgagcaggt gaagagtatc | 720 | |
| cgcgcagcgc ttggaggcgg gccgctcacc gtactagate tgcgcgaaga atctcatgcg | 780 | |
| attgtcaacg gtttgcctat caccttacgt ggcccgatgg attgggccaa cgccggccta | 840 | |
| tcccaggttg acggagcggc acgtgaaagt gccatgatta cagaactgaa gcgcactaag | 900 | |
| tctttaacgt tggtcgatgc caattatgta aaaggtaaaa aaagtaatcc tcaaacgaca | 960 | |
| gaactgaaaa atttgaatgt ccggagcgag cgagaagtcg ttacagaggc cggcgcgacc | 1020 | |
| tatcgccgcg tggccattac cgaccataac aggcctagtc cggaagcgac cgacgagcta | 1080 | |
| gtagacatca tgcgccactg cctgcaggca aatgagtcgc tagttgtgca ctgtaacggc | 1140 | |
| ggtcggggcc gtactaccac ggctatgata atggtcgaca tgcttaagaa cgctcgtaac | 1200 | |
| cattccgcag aaaccctcat cacgcgtatg gccaagctaa gctatgacta caacatgacg | 1260 | |
| gatctaggca gcatttctgc actcaagcgg ccattcctag aggacagact aaaatttctg | 1320 | |
| caggcctttc acgactatgc ccgcaacaac ccaagcggat tatctcttaa ttggacacag | 1380 | |
| tggcgcgcaa aaatagcgtt agaatga | 1407 |
| Met Asn Pro Leu Gln Pro Ile Gln His Ser Ile Thr Asn Ser Gln Met | |
| ββ1βββββββββββββββ5ββββββββββββββββββ10ββββββββββββββββββ15 | |
| Ser Gly Gly Gln Gln Leu Glu Ala Glu Gly Ser Gln Ala His Asn Ser | |
| βββββββββββββ20ββββββββββββββββββ25ββββββββββββββββββ30 | |
| Tyr Her His Pro Asp Arg Ile Ser Leu Ser Gln Leu Ser Gln Ser Ala | |
| βββββββββ35ββββββββββββββββββ40ββββββββββββββββββ45 | |
| His Leu Ala Leu Asp His Leu Her Thr Gln Pro Asn Thr Asp His Gln | |
| βββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Arg Val Ala Ser Leu Val Arg Asn Ala Val Gln Asp Gly Lys Phe Gln | |
| β65ββββββββββββββββββ70ββββββββββββββββββ75ββββββββββββββββββ80 | |
| Leu Gln Ser Ser Asn Asp Thr Gln Val Thr Tyr Lys Thr Ser Val Cys | |
| βββββββββββββββββ85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Pro Pro Ala Asn Ala Asp Thr Met Gly Ala Ala His Leu Ile Asn Asn | |
| ββββββββββββ100βββββββββββββββββ105βββββββββββββββββ110 | |
| Glu Leu Thr Val Gln Ala Arg Leu Asn Asp Gln Leu Glu Tyr Asp Ile | |
| ββββββββ115βββββββββββββββββ120βββββββββββββββββ125 | |
| Val Ser Ala His Leu Tyr Gly Pro Ser Glu Ala Ile Ser Ile Asp Ala | |
| ββββ130βββββββββββββββββ135βββββββββββββββββ140 | |
| Ser Ser Pro Pro Ser Ala Asn Asp Leu Ala Ser Ser Gly Len Ser Glu | |
| 145βββββββββββββββββ150βββββββββββββββββ155βββββββββββββββββ160 | |
| Arg Thr His Leu Gly Met Asn Arg Val Leu Leu Arg Tyr Ala Val Pro | |
| ββββββββββββββββ165βββββββββββββββββ170βββββββββββββββββ175 | |
| Pro Arg Glu Thr Glu Asp Gln Cys Val Met Val Ile Asp Lys Met Pro | |
| ββββββββββββ180βββββββββββββββββ185βββββββββββββββββ190 | |
| Pro Pro Lys His Gly Lys Met Ser Phe Phe Arg Thr Thr Asn Asp Leu | |
| ββββββββ195βββββββββββββββββ200βββββββββββββββββ205 | |
| Ser Lys Leu Pro Leu Gly Met Glu Thr Gly Gly Leu Ser Asp Leu Lys | |
| ββββ210βββββββββββββββββ215βββββββββββββββββ220 | |
| Leu Ala Gly Cys Glu Arg Ile Ser Ser Val Glu Gln Val Lys Ser Ile | |
| 225βββββββββββββββββ230βββββββββββββββββ235βββββββββββββββββ240 | |
| Arg Ala Ala Leu Gly Gly Gly Pro Leu Thr Val Leu Asp Leu Arg Glu | |
| ββββββββββββββββ245βββββββββββββββββ250βββββββββββββββββ255 | |
| Glu Ser His Ala Ile Val Asn Gly Leu Pro Ile Thr Leu Arg Gly Pro | |
| ββββββββββββ260βββββββββββββββββ265βββββββββββββββββ270 | |
| Met Asp Trp Ala Asn Ala Gly Leu Ser Gln Val Asp Gly Ala Ala Arg | |
| ββββββββ275βββββββββββββββββ280βββββββββββββββββ285 | |
| Glu Ser Ala Met Ile Thr Glu Leu Lys Arg Thr Lys Ser Leu Thr Leu | |
| ββββ290βββββββββββββββββ295βββββββββββββββββ300 | |
| Val Asp Ala Asn Tyr Val Lys Gly Lys Lys Ser Asn Pro Gln Thr Thr | |
| 305βββββββββββββββββ310βββββββββββββββββ315βββββββββββββββββ320 | |
| Glu Leu Lys Asn Leu Asn Val Arg Ser Glu Arg Glu Val Val Thr Glu | |
| ββββββββββββββββ325βββββββββββββββββ330βββββββββββββββββ335 | |
| Ala Gly Ala Thr Tyr Arg Arg Val Ala Ile Thr Asp His Asn Arg Pro | |
| ββββββββββββ340βββββββββββββββββ345βββββββββββββββββ350 | |
| Ser Pro Glu Ala Thr Asp Glu Leu Val Asp Ile Met Arg His Cys Leu | |
| ββββββββ355βββββββββββββββββ360βββββββββββββββββ365 | |
| Gln Ala Asn Glu Ser Leu Val Val His Cys Asn Gly Gly Arg Gly Arg | |
| ββββ370βββββββββββββββββ375βββββββββββββββββ380 | |
| Thr Thr Thr Ala Met Ile Met Val Asp Met Leu Lys Asn Ala Arg Asn | |
| 385βββββββββββββββββ390βββββββββββββββββ395βββββββββββββββββ400 | |
| His Ser Ala Glu Thr Leu Ile Thr Arg Met Ala Lys Leu Ser Tyr Asp | |
| ββββββββββββββββ405βββββββββββββββββ410βββββββββββββββββ415 | |
| Tyr Asn Met Thr Asp Leu Gly Ser Ile Ser Ala Leu Lys Arg Pro Phe | |
| ββββββββββββ420βββββββββββββββββ425βββββββββββββββββ430 | |
| Leu Glu Asp Arg Leu Lys Phe Leu Gln Ala Phe His Asp Tyr Ala Arg | |
| ββββββββ435βββββββββββββββββ440βββββββββββββββββ445 | |
| Asn Asn Pro Ser Gly Leu Ser Leu Asn Trp Thr Gln Trp Arg Ala Lys | |
| ββββ450βββββββββββββββββ455βββββββββββββββββ460 | |
| Ile Ala Leu Glu | |
| 465 |
A seventh nucleic acid molecule is a homolog of avrPpiC2 of Pseudomonas syringae pv. pisi and has a nucleotide sequence according to SEQ ID No: 13 as follows:
| atgacaatcg tgtctggaca catcggaaaa cacccaagcc taaccactgt tcaagctggg | 60 | |
| tcttcggctt cggtcgagaa tcaaatgcct gatcctgcac agttcagtga tggacggtgg | 120 | |
| aaaaagcttc cgacccaatt gtcgtcaatt acattggcga gattcgatca ggatatttgc | 180 | |
| acqaataatc atggcatcag tcagcgtgca atgtgctttg gcctttcatt gagctggatt | 240 | |
| aacatgattc atgccgggaa agatcatgtt acgccctatg catcggcaga aagaatgagg | 300 | |
| tttctgggtt cctttgaagg ggtggtgcat gctcgtactg ttcataactt ctatcggact | 360 | |
| gagcacaaat ttctgatgga gcaagcttcc gcaaaccccg gagtatcaag tggcgcgatg | 420 | |
| gctggcacag aaagtttatt gcaagctgct gagttgaagg ggttaaagct tcaacctgtt | 480 | |
| ctagaggaca agtcgaactc aggcctaccc ttcctaattg cgtgtaagca gtcagggcgg | 540 | |
| caggtgagca cagatgaagc tgcgctaagc tccttatgtg atgcaattgt agaaaataag | 600 | |
| agaggggtaa tggtgatata cagccaagaa attgcccacg ctttgggctt ttctgtatca | 660 | |
| tcagatggca aaagagcgac cttatttgat cccaatctcg gagagtttca tacacactcg | 720 | |
| aaagcgttgg ctgatactat cgaaaacata tcatcggcag atgggctgcc tttaatcggc | 780 | |
| gttcaagtat tcgcttcaaa aatacactga | 810 |
| Met Thr Ile Val Ser Gly His Ile Gly Lys His Pro Ser Leu Thr Thr | |
| ββ1βββββββββββββββ5ββββββββββββββββββ10ββββββββββββββββββ15 | |
| Val Gln Ala Gly Ser Ser Ala Ser Val Glu Asn Gln Met Pro Asp Pro | |
| βββββββββββββ20ββββββββββββββββββ25ββββββββββββββββββ30 | |
| Ala Gln Phe Ser Asp Gly Arg Trp Lys Lys Leu Pro Thr Gln Leu Ser | |
| βββββββββ35ββββββββββββββββββ40ββββββββββββββββββ45 | |
| Ser Ile Thr Leu Ala Arg Phe Asp Gln Asp Ile Cys Thr Asn Asn His | |
| βββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Gly Ile Ser Gln Arg Ala Met Cys Phe Gly Leu Ser Leu Ser Trp Ile | |
| β65ββββββββββββββββββ70ββββββββββββββββββ75ββββββββββββββββββ80 | |
| Asn Met Ile His Ala Gly Lys Asp His Val Thr Pro Tyr Ala Ser Ala | |
| βββββββββββββββββ85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Glu Arg Met Arg Phe Leu Gly Ser Phe Glu Gly Val Val His Ala Arg | |
| ββββββββββββ100βββββββββββββββββ105βββββββββββββββββ110 | |
| Thr Val His Asn Phe Tyr Arg Thr Glu His Lys Phe Leu Met Glu Gln | |
| ββββββββ115βββββββββββββββββ120βββββββββββββββββ125 | |
| Ala Ser Ala Asn Pro Gly Val Ser Ser Gly Ala Met Ala Gly Thr Glu | |
| ββββ130βββββββββββββββββ135βββββββββββββββββ140 | |
| Ser Leu Leu Gln Ala Ala Glu Leu Lys Gly Leu Lys Leu Gln Pro Val | |
| 145βββββββββββββββββ150βββββββββββββββββ155βββββββββββββββββ160 | |
| Leu Glu Asp Lys Ser Asn Ser Gly Leu Pro Phe Leu Ile Ala Cys Lys | |
| ββββββββββββββββ165βββββββββββββββββ170βββββββββββββββββ175 | |
| Gln Ser Gly Arg Gln Val Ser Thr Asp Glu Ala Ala Leu Ser Ser Leu | |
| ββββββββββββ180βββββββββββββββββ185βββββββββββββββββ190 | |
| Cys Asp Ala Ile Val Glu Asn Lys Arg Gly Val Met Val Ile Tyr Ser | |
| ββββββββ195βββββββββββββββββ200βββββββββββββββββ205 | |
| Gln Glu Ile Ala His Ala Leu Gly Phe Ser Val Ser Ser Asp Gly Lys | |
| ββββ210βββββββββββββββββ215βββββββββββββββββ220 | |
| Arg Ala Thr Leu Phe Asp Pro Asn Leu Gly Glu Phe His Thr His Ser | |
| 225βββββββββββββββββ230βββββββββββββββββ235βββββββββββββββββ240 | |
| Lys Ala Leu Ala Asp Thr Ile Glu Asn Ile Ser Ser Ala Asp Gly Leu | |
| ββββββββββββββββ245βββββββββββββββββ250βββββββββββββββββ255 | |
| Pro Leu Ile Gly Val Gln Val Phe Ala Ser Lys Ile His | |
| ββββββββββββ260βββββββββββββββββ265 |
An eighth nucleic acid molecule is a homolog of avrPpiB1 of Pseudomonas syringae pv. pisi and has a nucleotide sequence according to SEQ ID No: 15 as follows:
| atgcacgcaa atcctttaag ctctttcaac agagctcaac atggcaatct gactaatgta | 60 | |
| gaggccagcc aagttaaatc ggcaggaacc tcttccacca ctaatataga cagtaaaaac | 120 | |
| attgaagaac atgttqcaga cagactcagt gatttaggca gacctgatgg tggatggttt | 180 | |
| ttcgagaagt cacttggcac cttgaaaaat ttaaatcttg agcagttagc cggaatccat | 240 | |
| gatgtactaa aattaacaga tggcgtaaag aacattgtct cttttggagc tcgggaagga | 300 | |
| ggcttcgagt tggcaatgca gtttcgtcat gatttataca gatctcaaca tccggatgaa | 360 | |
| aactcgccgc acgatgccgc aactcattat cttgatgcaa tcagcctgca atcaaacaaa | 420 | |
| tttacaaaac ttgaaaaact acaacatgta gatgtattta aaatgcaaaa cccgttttgg | 480 | |
| gatgtcgggt acaaaaacgg aattgcgcac gcaaaaaaaa tggcattctt cataacgcca | 540 | |
| gagtggctgg gttctgattt ctgtaaacag gaattccagt ggcttagcga aacaaaaaac | 600 | |
| aaagacataa aatctgcatt tgtgatcttt aaagatgtag acttaaaaag caaaaatatg | 660 | |
| acaagtatct tcaattttgc agacttccat aaatcacgcg tcatgatggc aagcacacct | 720 | |
| cccgaatcgg gattgaataa tgtaaaaatc gaaaatagcg ttgacctgaa tttcaagagg | 780 | |
| ttattaactg accgtgagtc atgggaacta aataatttcc taggcgacta a | 831 |
| Met His Ala Asn Pro Leu Ser Ser Phe Asn Arg Ala Gln His Gly Asn | |
| ββ1βββββββββββββββ5ββββββββββββββββββ10ββββββββββββββββββ15 | |
| Leu Thr Asn Val Glu Ala Ser Gln Val Lys Ser Ala Gly Thr Ser Ser | |
| βββββββββββββ20ββββββββββββββββββ25ββββββββββββββββββ30 | |
| Thr Thr Asn Ile Asp Ser Lys Asn Ile Glu Glu His Val Ala Asp Arg | |
| βββββββββ35ββββββββββββββββββ40ββββββββββββββββββ45 | |
| Leu Ser Asp Leu Gly Arg Pro Asp Gly Gly Trp Phe Phe Glu Lys Ser | |
| βββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Leu Gly Thr Leu Lys Asn Leu Asn Leu Glu Gln Leu Ala Gly Ile His | |
| β65ββββββββββββββββββ70ββββββββββββββββββ75ββββββββββββββββββ80 | |
| Asp Val Leu Lys Leu Thr Asp Gly Val Lys Asn Ile Val Ser Phe Gly | |
| βββββββββββββββββ85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Ala Arg Glu Gly Gly Phe Glu Leu Ala Met Gln Phe Arg His Asp Leu | |
| ββββββββββββ100βββββββββββββββββ105βββββββββββββββββ110 | |
| Tyr Arg Ser Gln His Pro Asp Glu Asn Ser Pro His Asp Ala Ala Thr | |
| ββββββββ115βββββββββββββββββ120βββββββββββββββββ125 | |
| His Tyr Leu Asp Ala Ile Ser Leu Gln Ser Asn Lys Phe Thr Lys Leiu | |
| ββββ130βββββββββββββββββ135βββββββββββββββββ140 | |
| Glu Lys Leu Gln His Val Asp Val Phe Lys Met Gln Asn Pro Phe Trp | |
| 145βββββββββββββββββ150βββββββββββββββββ155βββββββββββββββββ160 | |
| Asp Val Gly Tyr Lys Asn Gly Ile Ala His Ala Lys Lys Met Ala Phe | |
| ββββββββββββββββ165βββββββββββββββββ170βββββββββββββββββ175 | |
| Phe Ile Thr Pro Glu Trp Leu Gly Ser Asp Phe Cys Lys Gln Glu Phe | |
| ββββββββββββ180βββββββββββββββββ185βββββββββββββββββ190 | |
| Gln Trp Leu Ser Glu Thr Lys Asn Lys Asp Ile Lys Ser Ala Phe Val | |
| ββββββββ195βββββββββββββββββ200βββββββββββββββββ205 | |
| Ile Phe Lys Asp Val Asp Leu Lys Ser Lys Asn Met Thr Ser Ile Phe | |
| ββββ210βββββββββββββββββ215βββββββββββββββββ220 | |
| Asn Phe Ala Asp Phe His Lys Ser Arg Val Met Met Ala Ser Thr Pro | |
| 225βββββββββββββββββ230βββββββββββββββββ235βββββββββββββββββ240 | |
| Pro Glu Ser Gly Leu Asn Asn Val Lys Ile Glu Asn Ser Val Asp Leu | |
| ββββββββββββββββ245βββββββββββββββββ250βββββββββββββββββ255 | |
| Asn Phe Lys Arg Leu Leu Thr Asp Arg Glu Ser Trp Glu Leu Asn Asn | |
| ββββββββββββ260βββββββββββββββββ265βββββββββββββββββ270 | |
| Phe Leu Gly Asp | |
| ββββββββ275 |
A ninth nucleic acid molecule is a homolog of avrXv3 of Xanthomonas campestris pv. vesicatoria and has a nucleotide sequence according to SEQ ID No: 17 as follows:
| atggggctat gtatttcaaa acactctggt agcagttaca gctacagtga tagcgaccgc | 60 | |
| tggcaagtgc ctgcatgccc tccaaacgcc aggtctgtat ccagtcatca aacagcatct | 120 | |
| gcgagtgaca tcgcatcagg cgatgtggat gaacgtcctg caacgttttc tcattttcaa | 180 | |
| cttgcgcggt gcggtggaga gtacacgctt agcatggttt ctgcagcggc ttatcaagca | 240 | |
| gaaagacggc atcgcggtaa tttaataaaa gatcgtagtc aatccatact cccatgggtc | 300 | |
| caggtatatc attctaaaaa aggtttggat tacagcttcc agatcgacag aactacgact | 360 | |
| gttaaagtgg ctggattcaa ctgctctatc cccaataaca gagggactcg gcatttatac | 420 | |
| agcgctggta cgagtcagac aaacatgcct gtcatcgcag acaacatgag cgcatgcatt | 480 | |
| gctgtcgcgt gtgcggcgga aaacgtggat gctggcacgg gtgaacgtag gccgggggcg | 540 | |
| aaagttcgcg tattccatct actccctttt cgacgcgaag accttgtgcc agaagaagtt | 600 | |
| ttagcttctg tgcgcgatta tctgcgaacg accaaagaac aggggctaac aatgcgcgta | 660 | |
| gctatgcatg gagggaatac agagggtgat ttctcagtca gcactgcgca ggcattgaaa | 720 | |
| ggcctgtttg ctaatgaagg gatcccgctt gaatttgacg agacctgtgc aaaccgaacg | 780 | |
| tctgaaacac tgcttggtgc cgttatctta gatgacaact cgactcattt cataaaacat | 840 | |
| ctggtcgcac aataa | 855 |
| Met Gly Leu Cys Ile Ser Lys His Ser Gly Ser Ser Tyr Ser Tyr Ser | |
| ββ1βββββββββββββββ5ββββββββββββββββββ10ββββββββββββββββββ15 | |
| Asp Ser Asp Arg Trp Gln Val Pro Ala Cys Pro Pro Asn Ala Arg Ser | |
| βββββββββββββ20ββββββββββββββββββ25ββββββββββββββββββ30 | |
| Val Ser Ser His Gln Thr Ala Ser Ala Ser Asp Ile Ala Ser Gly Asp | |
| βββββββββ35ββββββββββββββββββ40ββββββββββββββββββ45 | |
| Val Asp Glu Arg Pro Ala Thr Phe Ser His Phe Gln Leu Ala Arg Cys | |
| βββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Gly Gly Glu Tyr Thr Leu Ser Met Val Ser Ala Ala Ala Tyr Gln Ala | |
| β65ββββββββββββββββββ70ββββββββββββββββββ75ββββββββββββββββββ80 | |
| Glu Arg Arg His Arg Gly Asn Leu Ile Lys Asp Arg Ser Gln Ser Ile | |
| βββββββββββββββββ85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Leu Pro Trp Val Gln Val Tyr His Ser Lys Lys Gly Leu Asp Tyr Ser | |
| ββββββββββββ100βββββββββββββββββ105βββββββββββββββββ110 | |
| Phe Gln Ile Asp Arg Thr Thr Thr Val Lys Val Ala Gly Phe Asn Cys | |
| ββββββββ115βββββββββββββββββ120βββββββββββββββββ125 | |
| Ser Ile Pro Asn Asn Arg Gly Thr Arg His Leu Tyr Ser Ala Gly Thr | |
| ββββ130βββββββββββββββββ135βββββββββββββββββ140 | |
| Ser Gln Thr Asn Met Pro Val Ile Ala Asp Asn Met Ser Ala Cys Ile | |
| 145βββββββββββββββββ150βββββββββββββββββ155βββββββββββββββββ160 | |
| Ala Val Ala Cys Ala Ala Glu Asn Val Asp Ala Gly Thr Gly Glu Arg | |
| ββββββββββββββββ165βββββββββββββββββ170βββββββββββββββββ175 | |
| Arg Pro Gly Ala Lys Val Arg Val Phe His Leu Leu Pro Phe Arg Arg | |
| ββββββββββββ180βββββββββββββββββ185βββββββββββββββββ190 | |
| Glu Asp Leu Val Pro Glu Glu Val Leu Ala Ser Val Arg Asp Tyr Leu | |
| ββββββββ195βββββββββββββββββ200βββββββββββββββββ205 | |
| Arg Thr Thr Lys Glu Gln Gly Leu Thr Met Arg Val Ala Met His Gly | |
| ββββ210βββββββββββββββββ215βββββββββββββββββ220 | |
| Gly Asn Thr Glu Gly Asp Phe Ser Val Ser Thr Ala Gln Ala Leu Lys | |
| 225βββββββββββββββββ230βββββββββββββββββ235βββββββββββββββββ240 | |
| Gly Leu Phe Ala Asn Glu Gly Ile Pro Leu Glu Phe Asp Glu Thr Cys | |
| ββββββββββββββββ245βββββββββββββββββ250βββββββββββββββββ255 | |
| Ala Asn Arg Thr Ser Glu Thr Leu Leu Gly Ala Val Ile Leu Asp Asp | |
| ββββββββββββ260βββββββββββββββββ265βββββββββββββββββ270 | |
| Asn Ser Thr His Phe Ile Lys His Leu Val Ala Gln | |
| ββββββββ275βββββββββββββββββ280 |
A tenth nucleic acid molecule is a homolog of hrmB of Pseudomonas syringae pv. syringae and has a nucleotide sequence according to SEQ ID No: 19 as follows:
| atgatcatcg acaatacgtt cgcgctgaca ctgtcatgcg attacgcgcg tgagcgcctg | 60 | |
| ctgttgatcg gcttgcttga gccgcacaag gacatacctc agcagtgcct tttggctggc | 120 | |
| gctctcaatc cgctcctcaa tgcaggccca ggccttggcc tggatgagaa aagcggcctg | 180 | |
| tatcacgcgt atcaaagcat ccctcgagaa aaactcagcg tgccgacgct caaacgcgaa | 240 | |
| atggcaggtc tgctggagtg gatgaggggc tggcgcgaag caagccaata g | 291 |
| Met Ile Ile Asp Asn Thr Phe Ala Leu Thr Leu Ser Cys Asp Tyr Ala | |
| ββ1βββββββββββββββ5ββββββββββββββββββ10ββββββββββββββββββ15 | |
| Arg Glu Arg Leu Leu Leu Ile Gly Leu Leu Glu Pro His Lys Asp Ile | |
| βββββββββββββ20ββββββββββββββββββ25ββββββββββββββββββ30 | |
| Pro Gln Gln Cys Leu Leu Ala Gly Ala Leu Asn Pro Leu Leu Asn Ala | |
| βββββββββ35ββββββββββββββββββ40ββββββββββββββββββ45 | |
| Gly Pro Gly Leu Gly Leu Asp Glu Lys Her Gly Leu Tyr His Ala Tyr | |
| βββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Gln Ser Ile Pro Arg Glu Lys Leu Ser Val Pro Thr Leu Lys Arg Glu | |
| β65ββββββββββββββββββ70ββββββββββββββββββ75ββββββββββββββββββ80 | |
| Met Ala Gly Leu Leu Glu Trp Met Arg Gly Trp Arg Glu Ala Ser Gln | |
| βββββββββββββββββ85ββββββββββββββββββ90ββββββββββββββββββ95 |
An eleventh nucleic acid molecule is a homolog of hrmA (also known as hopPsyA) of Pseudomonas syringae pv. syringae and has a nucleotide sequence according to SEQ ID No: 21 as follows:
| atgaacccca ttcagtcacg cttctccagt gtgcaagagc tcagacgatc caacgttgat | 60 | |
| attccggcgc tcaaagccaa tggccaactg gaggtcgacg gcaagaggta cgagattcgt | 120 | |
| gcagccgatg acggaacaat ttcggtcctt cgaccggagc aacaatccaa agcgaaaagt | 180 | |
| tttttcaagg gcgcttccca gttgataggt ggcagcagcc agcgcgcgca gattgcccag | 240 | |
| gcgctcaacg agaaggtcgc atcggcacgc actgtcttgc accagagcgc tatgacgggc | 300 | |
| ggacgcttgg acacccttga gcggggcgaa agcagctcag ccacaacagc catcaaaccc | 360 | |
| actgccaaac aggctgcgca aagtactttt aacagctttc atgagtgggc caaacaggca | 420 | |
| gaggcgatgc gaaacccgtc tcgaatggat atctacaaga tctataaaca agatgcacct | 480 | |
| cactcacacc ccatgagcga cgagcagcaa gaagagttcc tgcacacgct aaaggcattg | 540 | |
| aatggcaaaa acggcattga ggtgcgcact caggaccacg acagcgtcag aaataaaaaa | 600 | |
| gaccgcaacc tggacaagta catcgcagag agcccggatg caaagaggtt tttctatcga | 660 | |
| attatcccca aacatgagcg ccgagaagat aagaatcaag ggcgattgac cattggcgtg | 720 | |
| caaccccaat atgcaacaca gttgacccgc gccatggcaa ccctgatagg gaaggaaagt | 780 | |
| gcaatcacgc atggcaaagt aataggcccc gcctgccacg gccaaatgac cgattcggca | 840 | |
| gttttgtata tcaacggtga tgttgcaaag gcagaaaagc tgggcgagaa actgaaacag | 900 | |
| atgagcggca ttcctctgga tgcgttcgtt gagcacaccc ctttgagcat gcaatccctg | 960 | |
| agtaaaggtc tgtcctatgc agaaagcatc ctgggcgaca ccagaggcca tgggatgtcg | 1020 | |
| cgagcggaag tgatcagcga tgccttgagg atggacggga tgccatttct ggccagattg | 1080 | |
| aagctatcac tgtctgccaa tggctatgac ccggacaacc cggcccttcg aaacacgaaa | 1140 | |
| tga | 1143 |
| Met Asn Pro Ile Gln Ser Arg Phe Ser Ser Val Gln Glu Leu Arg Arg | |
| ββ1βββββββββββββββ5ββββββββββββββββββ10ββββββββββββββββββ15 | |
| Ser Asn Val Asp Ile Pro Ala Leu Lys Ala Asn Gly Gln Leu Glu Val | |
| βββββββββββββ20ββββββββββββββββββ25ββββββββββββββββββ30 | |
| Asp Gly Lys Arg Tyr Glu Ile Arg Ala Ala Asp Asp Gly Thr Ile Ser | |
| βββββββββ35ββββββββββββββββββ40ββββββββββββββββββ45 | |
| Val Leu Arg Pro Glu Gln Gln Ser Lys Ala Lys Ser Phe Phe Lys Gly | |
| βββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Ala Ser Gln Leu Ile Gly Gly Ser Ser Gln Arg Ala Gln Ile Ala Gln | |
| β65ββββββββββββββββββ70ββββββββββββββββββ75ββββββββββββββββββ80 | |
| Ala Leu Asn Glu Lys Val Ala Ser Ala Arg Thr Val Leu His Gln Ser | |
| βββββββββββββββββ85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Ala Met Thr Gly Gly Arg Leu Asp Thr Leu Glu Arg Gly Glu Ser Ser | |
| ββββββββββββ100βββββββββββββββββ105βββββββββββββββββ110 | |
| Ser Ala Thr Thr Ala Ile Lys Pro Thr Ala Lys Gln Ala Ala Gln Ser | |
| ββββββββ115βββββββββββββββββ120βββββββββββββββββ125 | |
| Thr Phe Asn Ser Phe His Glu Trp Ala Lys Gln Ala Glu Ala Met Arg | |
| ββββ130βββββββββββββββββ135βββββββββββββββββ140 | |
| Asn Pro Ser Arg Met Asp Ile Tyr Lys Ile Tyr Lys Gln Asp Ala Pro | |
| 145βββββββββββββββββ150βββββββββββββββββ155βββββββββββββββββ160 | |
| His Ser His Pro Met Ser Asp Glu Gln Gln Glu Glu Phe Leu His Thr | |
| ββββββββββββββββ165βββββββββββββββββ170βββββββββββββββββ175 | |
| Leu Lys Ala Leu Asn Gly Lys Asn Gly Ile Glu Val Arg Thr Gln Asp | |
| ββββββββββββ180βββββββββββββββββ185βββββββββββββββββ190 | |
| His Asp Ser Val Arg Asn Lys Lys Asp Arg Asn Leu Asp Lys Tyr Ile | |
| ββββββββ195βββββββββββββββββ200βββββββββββββββββ205 | |
| Ala Glu Ser Pro Asp Ala Lys Arg Phe Phe Tyr Arg Ile Ile Pro Lys | |
| ββββ210βββββββββββββββββ215βββββββββββββββββ220 | |
| His Glu Arg Arg Glu Asp Lys Asn Gln Gly Arg Leu Thr Ile Gly Val | |
| 225βββββββββββββββββ230βββββββββββββββββ235βββββββββββββββββ240 | |
| Gln Pro Gln Tyr Ala Thr Gln Leu Thr Arg Ala Met Ala Thr Leu Ile | |
| ββββββββββββββββ245βββββββββββββββββ250βββββββββββββββββ255 | |
| Gly Lys Glu Ser Ala Ile Thr His Gly Lys Val Ile Gly Pro Ala Cys | |
| ββββββββββββ260βββββββββββββββββ265βββββββββββββββββ270 | |
| His Gly Gln Met Thr Asp Ser Ala Val Leu Tyr Ile Asn Gly Asp Val | |
| ββββββββ275βββββββββββββββββ280βββββββββββββββββ285 | |
| Ala Lys Ala Glu Lys Leu Gly Glu Lys Leu Lys Gln Met Ser Gly Ile | |
| ββββ290βββββββββββββββββ295βββββββββββββββββ300 | |
| Pro Leu Asp Ala Phe Val Glu His Thr Pro Leu Ser Met Gln Ser Leu | |
| 305βββββββββββββββββ310βββββββββββββββββ315βββββββββββββββββ320 | |
| Ser Lys Gly Leu Ser Tyr Ala Glu Ser Ile Leu Gly Asp Thr Arg Gly | |
| ββββββββββββββββ325βββββββββββββββββ330βββββββββββββββββ335 | |
| His Gly Met Ser Arg Ala Glu Val Ile Ser Asp Ala Leu Arg Met Asp | |
| ββββββββββββ340βββββββββββββββββ345βββββββββββββββββ350 | |
| Gly Met Pro Phe Leu Ala Arg Leu Lys Leu Ser Leu Ser Ala Asn Gly | |
| ββββββββ355βββββββββββββββββ360βββββββββββββββββ365 | |
| Tyr Asp Pro Asp Asn Pro Ala Leu Arg Asn Thr Lys | |
| ββββ370βββββββββββββββββ375βββββββββββββββββ380 |
A twelfth nucleic acid molecule is hopPtoB2, a homolog of hopB of Pseudomonas syringae pv. syringae DC3000, and has a nucleotide sequence according to SEQ ID No: 23 as follows:
| gtgccgcgta tcgtcgccgg ccatgcagaa ggcgtgtgcg tggtcaacgg ccggcactat | 60 | |
| gtcgagctgt ccggtagaac ctttcaagtc cattacgaca cacatctgcg cggctggcag | 120 | |
| attgtcgatc cagaaaaccc gttcgccttt tttggccagc agccggtgcg cctagatgaa | 180 | |
| caggggcaat ggcagcttgt cgcccgtcga cgtctgcgtg gcggtggcgt aggtgactcc | 240 | |
| agccatgccc acctgcccga agaaacaccg ggctccagca caggctcgat tccgagcgac | 300 | |
| tacgaaatgc cggccgccat gcaggcaggc cttgatgtcg tgttgagcaa caagccctac | 360 | |
| gacccgaccg ggattggcat ggagtcttac tttgagagct atttcgtgga tctgcgtcag | 420 | |
| agttttgtgg cgcgcaggga aaagctttat gaggatgccc ggacattttt cgccggtttt | 480 | |
| tctccgccgc caaagccgca attgcctccg ctggcgccac ctgttgccat cgacaccctg | 540 | |
| attgaacacg tcttcgcgca gggtaacggc ctggttttga gtgaagcacc gaagtcggtc | 600 | |
| gccagcaaac ggctgctgtt actcaacatg ccgctgctgg ccgaacagcg tgtcaagatt | 660 | |
| ctgtatatcg agcacctgct gaccgacaag cacctgtcta aactggccag gtatcgtcaa | 720 | |
| ctgggcaaaa agagccgctc aggctcgcac gaactcaagc attacctgca cgatctcaac | 780 | |
| cgcgggacgc tgaacaattc cagcaccgac tacgactatt accacctcat caaggcagcg | 840 | |
| catcgctatg gtatcgaggt gcgaccgttc agctcgtcga tcagctaccc gtttctggac | 900 | |
| catccggtat tgagcgcagc caacgacacg actgcagtac aaaaaatgag caattttttc | 960 | |
| ggccatacgc tcatcagcag cgatgtcgca tccgcgccga caaaacgctg ggttgccttg | 1020 | |
| ctcgaccaga agctggccac gacccacgac ggggtattag gcattgccga aatgcagggc | 1080 | |
| gtggtcagtg tgcatgtccg cgacatcccg gcaggccggc cgacgcgcat cactaaaggc | 1140 | |
| acaggcgaac tgccacgcga gggcacgcag gcccgctgcg acttcacgat tgcgttttcc | 1200 | |
| gatccgacgc tgattgtgcc ccaggcgcct cacccgcacg gtaccaaact ggacgacatg | 1260 | |
| ctgctcagag aactgagggg ccaatctgcc ggtgccgggg gcgaacgctg ggccggccag | 1320 | |
| tacggattca tccgtgacga ggacggtgcc tggcggtgga tcgcgcctga ggactggccc | 1380 | |
| gcagacagcc cgatgacggc aatccagcaa tccctgaccg accctgtcta tgagatgcca | 1440 | |
| ctggacactc gaacaacgct tcatacgctg gcgaacttcg aaagaagggg gctcgacatg | 1500 | |
| gagtatttct ttgaagaaag ccagtacgaa actgttcgca acgtattcgc cctgcaccgc | 1560 | |
| aaaaagctgc aacaggatgc ggccttgatc agcgctgtac agttgccgcc tcgtccgacg | 1620 | |
| atgccggccg tcaaccctcg gacgaccacg gcgcagctgt ttgaaacgct gtaccagcac | 1680 | |
| accgatggca tcgtgatcgg cgagtcgcat ttttcggtcg ccagcaagaa aatgatcatc | 1740 | |
| gacaacctgc cgttgctgtc gcagcaaaac gtacgaacgc tgtacatgga gcacttgctc | 1800 | |
| accgacttgc atcaggcgga tctggatcgc tttttcgaaa cagggcaaat gagcaaaacc | 1860 | |
| ctgcttcacg acctgaaagt gctggatcgg ggccatcgca ccgacccgga caaggtttac | 1920 | |
| acctttgagc aactggtcat caaggcgcag cagcacggca tggaagtccg cgccatcgac | 1980 | |
| tgcgcagcca gctaccacct tagtggcctt gacaacgatg gttcaatcac ccgtcagcaa | 2040 | |
| atgatgaact actttgcgtc gcgcaccctg cgcaggcatc aggacgtcat gggctcacac | 2100 | |
| aagtggatcg cgctggtcgg caacagccat tccaatgtct atcaaggcgt cgtgcctggt | 2160 | |
| atcgccgagc tggaaggcgg catcggcctg cgggttatcg acgtggcacc ggggcagtcg | 2220 | |
| aagggtgtca tgcacgacct gggggagctg gtctcggcag acatctcgag aaccaaagta | 2280 | |
| cacatcaaag gcgattatcg agtggagata gaaataccgc gtgcgaagga tgccattcgg | 2340 | |
| ccaccccagc ctgttaccct cgaacagcga ctggccagac cgggattgtt tctggtggaa | 2400 | |
| gagagtgagg gcaatctgct gaccattgtc caccgcgctc gcgacacctg gattcaccgc | 2460 | |
| acgccggtgc tggtcaatgc cgagggcaag ctgtacctgg agcgcgtgcg ctggccgcgc | 2520 | |
| atccacctca aaccctttga tgacatggac gcgctggtag cggcgctgga ggagatgaac | 2580 | |
| ctgacgcggg taggctga | 2598 |
| Val Pro Arg Ile Val Ala Gly His Ala Glu Gly Val Cys Val Val Asn | |
| ββ1βββββββββββββββ5ββββββββββββββββββ10ββββββββββββββββββ15 | |
| Gly Arg His Tyr Val Glu Leu Ser Gly Arg Thr Phe Gln Val His Tyr | |
| βββββββββββββ20ββββββββββββββββββ25ββββββββββββββββββ30 | |
| Asp Thr His Leu Arg Gly Trp Gln Ile Val Asp Pro Glu Asn Pro Phe | |
| βββββββββ35ββββββββββββββββββ40ββββββββββββββββββ45 | |
| Ala Phe Phe Gly Gln Gln Pro Val Arg Leu Asp Glu Gln Gly Gln Trp | |
| βββββ50ββββββββββββββββββ55ββββββββββββββββββ60 | |
| Gln Leu Val Ala Arg Arg Arg Leu Arg Gly Gly Gly Val Gly Asp Ser | |
| β65ββββββββββββββββββ70ββββββββββββββββββ75ββββββββββββββββββ80 | |
| Ser His Ala His Leu Pro Glu Glu Thr Pro Gly Ser Ser Thr Gly Ser | |
| βββββββββββββββββ85ββββββββββββββββββ90ββββββββββββββββββ95 | |
| Ile Pro Ser Asp Tyr Glu Met Pro Ala Ala Met Gln Ala Gly Leu Asp | |
| ββββββββββββ100βββββββββββββββββ105βββββββββββββββββ110 | |
| Val Val Leu Ser Asn Lys Pro Tyr Asp Pro Thr Gly Ile Gly Met Glu | |
| ββββββββ115βββββββββββββββββ120βββββββββββββββββ125 | |
| Ser Tyr Phe Glu Ser Tyr Phe Val Asp Leu Arg Gln Ser Phe Val Ala | |
| ββββ130βββββββββββββββββ135βββββββββββββββββ140 | |
| Arg Arg Glu Lys Leu Tyr Glu Asp Ala Arg Thr Phe Phe Ala Gly Phe | |
| 145βββββββββββββββββ150βββββββββββββββββ155βββββββββββββββββ160 | |
| Ser Pro Pro Pro Lys Pro Gln Leu Pro Pro Leu Ala Pro Pro Val Ala | |
| ββββββββββββββββ165βββββββββββββββββ170βββββββββββββββββ175 | |
| Ile Asp Thr Leu Ile Glu His Val Phe Ala Gln Gly Asn Gly Leu Val | |
| ββββββββββββ180βββββββββββββββββ185βββββββββββββββββ190 | |
| Leu Ser Glu Ala Pro Lys Ser Val Ala Ser Lys Arg Leu Leu Leu Leu | |
| ββββββββ195βββββββββββββββββ200βββββββββββββββββ205 | |
| Asn Met Pro Leu Leu Ala Glu Gln Arg Val Lys Ile Leu Tyr Ile Glu | |
| ββββ210βββββββββββββββββ215βββββββββββββββββ220 | |
| His Leu Leu Thr Asp Lys His Leu Ser Lys Leu Ala Arg Tyr Arg Gln | |
| 225βββββββββββββββββ230βββββββββββββββββ235βββββββββββββββββ240 | |
| Leu Gly Lys Lys Ser Arg Ser Gly Ser His Glu Leu Lys His Tyr Leu | |
| ββββββββββββββββ245βββββββββββββββββ250βββββββββββββββββ255 | |
| His Asp Leu Asn Arg Gly Thr Leu Asn Asn Ser Ser Thr Asp Tyr Asp | |
| ββββββββββββ260βββββββββββββββββ265βββββββββββββββββ270 | |
| Tyr Tyr His Leu Ile Lys Ala Ala His Arg Tyr Gly Ile Glu Val Arg | |
| ββββββββ275βββββββββββββββββ280βββββββββββββββββ285 | |
| Pro Phe Ser Ser Ser Ile Ser Tyr Pro Phe Leu Asp His Pro Val Leu | |
| ββββ290βββββββββββββββββ295βββββββββββββββββ300 | |
| Ser Ala Ala Asn Asp Thr Thr Ala Val Gln Lys Met Ser Asn Phe Phe | |
| 305βββββββββββββββββ310βββββββββββββββββ315βββββββββββββββββ320 | |
| Gly His Thr Leu Ile Ser Ser Asp Val Ala Ser Ala Pro Thr Lys Arp | |
| ββββββββββββββββ325βββββββββββββββββ330βββββββββββββββββ335 | |
| Trp Val Ala Leu Leu Asp Gln Lys Leu Ala Thr Thr His Asp Gly Val | |
| ββββββββββββ340βββββββββββββββββ345βββββββββββββββββ350 | |
| Leu Gly Ile Ala Glu Met Gln Gly Val Val Ser Val His Val Arg Asp | |
| ββββββββ355βββββββββββββββββ360βββββββββββββββββ365 | |
| Ile Pro Ala Gly Arg Pro Thr Arg Ile Thr Lys Gly Thr Gly Glu Leu | |
| ββββ370βββββββββββββββββ375βββββββββββββββββ380 | |
| Pro Arp Glu Gly Thr Gln Ala Arg Cys Asp Phe Thr Ile Ala Phe Ser | |
| 385βββββββββββββββββ390βββββββββββββββββ395βββββββββββββββββ400 | |
| Asp Pro Thr Leu Ile Val Pro Gln Ala Pro His Pro His Gly Thr Lys | |
| ββββββββββββββββ405βββββββββββββββββ410βββββββββββββββββ415 | |
| Leu Asp Asp Met Leu Leu Arg Glu Leu Arg Gly Gln Ser Ala Gly Ala | |
| ββββββββββββ420βββββββββββββββββ425βββββββββββββββββ430 | |
| Gly Gly Glu Arg Trp Ala Gly Gln Tyr Gly Phe Ile Arg Asp Glu Asp | |
| ββββββββ435βββββββββββββββββ440βββββββββββββββββ445 | |
| Gly Ala Trp Arg Trp Ile Ala Pro Glu Asp Trp Pro Ala Asp Ser Pro | |
| ββββ450βββββββββββββββββ455βββββββββββββββββ460 | |
| Met Thr Ala Ile Gln Gln Ser Leu Thr Asp Pro Val Tyr Glu Met Pro | |
| 465βββββββββββββββββ470βββββββββββββββββ475βββββββββββββββββ480 | |
| Leu Asp Thr Arg Thr Thr Leu His Thr Leu Ala Asn Phe Glu Arg Arg | |
| ββββββββββββββββ485βββββββββββββββββ490βββββββββββββββββ495 | |
| Gly Leu Asp Met Glu Tyr Phe Phe Glu Glu Ser Gln Tyr Glu Thr Val | |
| ββββββββββββ500βββββββββββββββββ505βββββββββββββββββ510 | |
| Arg Asn Val Phe Ala Leu His Arg Lys Lys Leu Gln Gln Asp Ala Ala | |
| ββββββββ515βββββββββββββββββ520βββββββββββββββββ525 | |
| Leu Ile Ser Ala Val Gln Leu Pro Pro Arg Pro Thr Met Pro Ala Val | |
| ββββ530βββββββββββββββββ535βββββββββββββββββ540 | |
| Asn Pro Arg Thr Thr Thr Ala Gln Leu Phe Glu Thr Leu Tyr Gln His | |
| 545βββββββββββββββββ550βββββββββββββββββ555βββββββββββββββββ560 | |
| Thr Asp Gly Ile Val Ile Gly Glu Ser His Phe Ser Val Ala Ser Lys | |
| ββββββββββββββββ565βββββββββββββββββ570βββββββββββββββββ575 | |
| Lys Met Ile Ile Asp Asn Leu Pro Leu Leu Ser Gln Gln Asn Val Arg | |
| ββββββββββββ580βββββββββββββββββ585βββββββββββββββββ590 | |
| Thr Leu Tyr Met Glu His Leu Leu Thr Asp Leu His Gln Ala Asp Leu | |
| ββββββββ595βββββββββββββββββ600βββββββββββββββββ605 | |
| Asp Arg Phe Phe Glu Thr Gly Gln Met Ser Lys Thr Leu Leu His Asp | |
| ββββ610βββββββββββββββββ615βββββββββββββββββ620 | |
| Leu Lys Val Leu Asp Arg Gly His Arg Thr Asp Pro Asp Lys Val Tyr | |
| 625βββββββββββββββββ630βββββββββββββββββ635βββββββββββββββββ640 | |
| Thr Phe Glu Gln Leu Val Ile Lys Ala Gln Gln His Gly Met Glu Val | |
| ββββββββββββββββ645βββββββββββββββββ650βββββββββββββββββ655 | |
| Arg Ala Ile Asp Cys Ala Ala Ser Tyr His Leu Ser Gly Leu Asp Asn | |
| ββββββββββββ660βββββββββββββββββ665βββββββββββββββββ670 | |
| Asp Gly Ser Ile Thr Arg Gln Gln Met Met Asn Tyr Phe Ala Ser Arg | |
| ββββββββ675βββββββββββββββββ680βββββββββββββββββ685 | |
| Thr Leu Arg Arg His Gln Asp Val Met Gly Ser His Lys Trp Ile Ala | |
| ββββ690βββββββββββββββββ695βββββββββββββββββ700 | |
| Leu Val Gly Asn Ser His Ser Asn Val Tyr Gln Gly Val Val Pro Gly | |
| 705βββββββββββββββββ710βββββββββββββββββ715βββββββββββββββββ720 | |
| Ile Ala Glu Leu Glu Gly Gly Ile Gly Leu Arg Val Ile Asp Val Ala | |
| ββββββββββββββββ725βββββββββββββββββ730βββββββββββββββββ735 | |
| Pro Gly Gln Ser Lys Gly Val Met His Asp Leu Gly Glu Leu Val Ser | |
| ββββββββββββ740βββββββββββββββββ745βββββββββββββββββ750 | |
| Ala Asp Ile Ser Arg Thr Lys Val His Ile Lys Gly Asp Tyr Arg Val | |
| ββββββββ755βββββββββββββββββ760βββββββββββββββββ765 | |
| Glu Ile Glu Ile Pro Arg Ala Lys Asp Ala Ile Arg Pro Pro Gln Pro | |
| ββββ770βββββββββββββββββ775βββββββββββββββββ780 | |
| Val Thr Leu Glu Gln Arg Leu Ala Arg Pro Gly Leu Phe Leu Val Glu | |
| 785βββββββββββββββββ790βββββββββββββββββ795βββββββββββββββββ800 | |
| Glu Ser Glu Gly Asn Leu Leu Thr Ile Val His Arg Ala Arg Asp Thr | |
| ββββββββββββββββ805βββββββββββββββββ810βββββββββββββββββ815 | |
| Trp Ile His Arg Thr Pro Val Leu Val Asn Ala Glu Gly Lys Leu Tyr | |
| ββββββββββββ820βββββββββββββββββ825βββββββββββββββββ830 | |
| Leu Glu Arg Val Arg Trp Pro Arg Ile His Leu Lys Pro Phe Asp Asp | |
| ββββββββ835βββββββββββββββββ840βββββββββββββββββ845 | |
| Met Asp Ala Leu Val Ala Ala Leu Glu Glu Met Asn Leu Thr Arg Val | |
| ββββ850βββββββββββββββββ855βββββββββββββββββ860 | |
| Gly | |
| 865 |
Fragments of the above-identified proteins or polypeptides as well as fragments of full length proteins can also be used according to the present invention.
Suitable fragments can be produced by several means. Subclones of the gene encoding a known protein can be produced using conventional molecular genetic manipulation for subcloning gene fragments, such as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Laboratory, Cold Springs Harbor, N.Y. (1989), and Ausubel et al. (ed.), Current Protocols in Molecular Biology, John Wiley & Sons (New York, N.Y.) (1999 and preceding editions), each of which is hereby incorporated by reference in its entirety. The subclones then are expressed in vitro or in vivo in bacterial cells to yield a smaller protein or polypeptide that can be tested for activity, e.g., as a product required for pathogen virulence.
In another approach, based on knowledge of the primary structure of the protein, fragments of the protein-coding gene may be synthesized using the PCR technique together with specific sets of primers chosen to represent particular portions of the protein. Erlich, H. A., et al., βRecent Advances in the Polymerase Chain Reaction,β Science 252:1643β51 (1991), which is hereby incorporated by reference. These can then be cloned into an appropriate vector for expression of a truncated protein or polypeptide from bacterial cells as described above.
As an alternative, fragments of a protein can be produced by digestion of a full-length protein with proteolytic enzymes like chymotrypsin or Staphylococcus proteinase A, or trypsin. Different proteolytic enzymes are likely to cleave different proteins at different sites based on the amino acid sequence of the particular protein. Some of the fragments that result from proteolysis may be active virulence proteins or polypeptides.
Chemical synthesis can also be used to make suitable fragments. Such a synthesis is carried out using known amino acid sequences for the polyppetide being produced. Alternatively, subjecting a full length protein to high temperatures and pressures will produce fragments. These fragments can then be separated by conventional procedures (e.g., chromatography, SDS-PAGE).
Variants may also (or alternatively) be modified by, for example, the deletion or addition of amino acids that have minimal influence on the properties, secondary structure and hydropathic nature of the polypeptide. For example, a polypeptide may be conjugated to a signal (or leader) sequence at the N-terminal end of the protein which co-translationally or post-translationally directs transfer of the protein. The polypeptide may also be conjugated to a linker or other sequence for ease of synthesis, purification, or identification of the polypeptide.
The proteins or polypeptides used in accordance with the present invention are preferably produced in purified form (preferably at least about 80%, more preferably 90%, pure) by conventional techniques. Typically, the protein or polypeptide of the present invention is secreted into the growth medium of recombinant host cells (discussed infra). Alternatively, the protein or polypeptide of the present invention is produced but not secreted into growth medium. In such cases, to isolate the protein, the host cell (e.g., E. coli) carrying a recombinant plasmid is propagated, lysed by sonication, heat, or chemical treatment, and the homogenate is centrifuged to remove bacterial debris. The supernatant is then subjected to sequential ammonium sulfate precipitation. The fraction containing the protein or polypeptide of interest is subjected to gel filtration in an appropriately sized dextran or polyacrylamide column to separate the proteins. If necessary, the protein fraction may be further purified by HPLC.
Other DNA molecules encoding other effector proteins or polypeptides can also be identified by determining whether such DNA molecules hybridize under stringent conditions to a nucleic acid molecule as identified above. An example of suitable stringency conditions is when hybridization is carried out at a temperature of about 37Β° C. using a hybridization medium that includes 0.9Γ sodium citrate (βSSCβ) buffer, followed by washing with 0.2ΓSSC buffer at 37Β° C. Higher stringency can readily be attained by increasing the temperature for either hybridization or washing conditions or increasing the sodium concentration of the hybridization or wash medium. Nonspecific binding may also be controlled using any one of a number of known techniques such as, for example, blocking the membrane with protein-containing solutions, addition of heterologous RNA, DNA, and SDS to the hybridization buffer, and treatment with RNase. Wash conditions are typically performed at or below stringency. Exemplary high stringency conditions include carrying out hybridization at a temperature of about 42Β° C. up to and including about 65Β° C. for up to about 20 hours in a hybridization medium containing 1M NaCl, 50 mM Tris-HCl, pH 7.4, 10 mM EDTA, 0.1% sodium dodecyl sulfate (SDS), 0.2% ficoll, 0.2% polyvinylpyrrolidone, 0.2% bovine serum albumin, and 50 ΞΌg/ml E. coli DNA, followed by washing carried out at between about 42Β° C. to about 65Β° C. in a 0.2ΓSSC buffer.
The delivery of effector proteins or polypeptides can be achieved in several ways: (1) as a stable transgene; (2) transiently expressed via Agrobacterium or viral vectors; (3) delivered by the type III secretion systems of disarmed pathogens or recombinant nonpathogenic bacteria which express a functional, heterologous type III secretion system; or (4) delivered via topical application followed by TAT protein transduction domain-mediated spontaneous uptake into cells. Each of these is discussed infra.
The DNA molecule encoding the protein or polypeptide can be incorporated in cells using conventional recombinant DNA technology. Generally, this involves inserting the DNA molecule into an expression system to which the DNA molecule is heterologous (i.e. not normally present). The heterologous DNA molecule is inserted into the expression system or vector in proper sense orientation and correct reading frame. The vector contains the necessary elements for the transcription and translation of the inserted protein-coding sequences.
U.S. Pat. No. 4,237,224 to Cohen and Boyer, which is hereby incorporated by reference in its entirety, describes the production of expression systems in the form of recombinant plasmids using restriction enzyme cleavage and ligation with DNA ligase. These recombinant plasmids are then introduced by means of transformation and replicated in unicellular cultures including prokaryotic organisms and eukaryotic cells grown in tissue culture.
Recombinant genes may also be introduced into viruses, such as vaccina virus. Recombinant viruses can be generated by transfection of plasmids into cells infected with virus.
Suitable vectors include, but are not limited to, the following viral vectors such as lambda vector system gt11, gt WES.tB, Charon 4, and plasmid vectors such as pBR322, pBR325, pACYC177, pACYC1084, pUC8, pUC9, pUC18, pUC19, pLG339, pR290, pKC37, pKC101, SV 40, pBluescript II SK +/β or KS +/β (see βStratagene Cloning Systemsβ Catalog (1993) from Stratagene, La Jolla, Calif., which is hereby incorporated by reference), pQE, pIH821, pGEX, pET series (see F. W. Studier et. al., βUse of T7 RNA Polymerase to Direct Expression of Cloned Genes,β Gene Expression Technology vol. 185 (1990), which is hereby incorporated by reference in its entirety), and any derivatives thereof Recombinant molecules can be introduced into cells via transformation, particularly transduction, conjugation, mobilization, or electroporation. The DNA sequences are cloned into the vector using standard cloning procedures in the art, as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Laboratory, Cold Springs Harbor, N.Y. (1989), which is hereby incorporated by reference in its entirety.
A variety of host-vector systems may be utilized to express the protein-encoding sequence(s). Primarily, the vector system must be compatible with the host cell used. Host-vector systems include but are not limited to the following: bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA; microorganisms such as yeast containing yeast vectors; mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); and plant cells infected by bacteria. The expression elements of these vectors vary in their strength and specificities. Depending upon the host-vector system utilized, any one of a number of suitable transcription and translation elements can be used.
Different genetic signals and processing events control many levels of gene expression (e.g., DNA transcription and messenger RNA (mRNA) translation).
Transcription of DNA is dependent upon the presence of a promoter which is a DNA sequence that directs the binding of RNA polymerase and thereby promotes mRNA synthesis. The DNA sequences of eukaryotic promoters differ from those of prokaryotic promoters. Furthermore, eukaryotic promoters and accompanying genetic signals may not be recognized in or may not function in a prokaryotic system, and, further, prokaryotic promoters are not recognized and do not function in eukaryotic cells.
Similarly, translation of mRNA in prokaryotes depends upon the presence of the proper prokaryotic signals which differ from those of eukaryotes. Efficient translation of mRNA in prokaryotes requires a ribosome binding site called the Shine-Dalgarno (βSDβ) sequence on the mRNA. This sequence is a short nucleotide sequence of mRNA that is located before the start codon, usually AUG, which encodes the amino-terminal methionine of the protein. The SD sequences are complementary to the 3β²-end of the 16S rRNA (ribosomal RNA) and probably promote binding of mRNA to ribosomes by duplexing with the rRNA to allow correct positioning of the ribosome. For a review on maximizing gene expression, see Roberts and Lauer, Methods in Enzymology, 68:473 (1979), which is hereby incorporated by reference in its entirety.
Promoters vary in their βstrengthβ (i.e. their ability to promote transcription). For the purposes of expressing a cloned gene, it is desirable to use strong promoters in order to obtain a high level of transcription and, hence, expression of the gene. Depending upon the host cell system utilized, any one of a number of suitable promoters may be used. For instance, when cloning in E. coli, its bacteriophages, or plasmids, promoters such as the T7 phage promoter, lac promoter, trp promoter, recA promoter, ribosomal RNA promoter, the PR and PL promoters of coliphage lambda and others, including but not limited, to lacUV5, ompF, bla, lpp, and the like, may be used to direct high levels of transcription of adjacent DNA segments. Additionally, a hybrid trp-lacUV5 (tac) promoter or other E. coli promoters produced by recombinant DNA or other synthetic DNA techniques may be used to provide for transcription of the inserted gene.
Bacterial host cell strains and expression vectors may be chosen which inhibit the action of the promoter unless specifically induced. In certain operations, the addition of specific inducers is necessary for efficient transcription of the inserted DNA. For example, the lac operon is induced by the addition of lactose or IPTG (isopropylthio-beta-D-galactoside). A variety of other operons, such as trp, pro, etc., are under different controls.
Specific initiation signals are also required for efficient gene transcription and translation in prokaryotic cells. These transcription and translation initiation signals may vary in βstrengthβ as measured by the quantity of gene specific messenger RNA and protein synthesized, respectively. The DNA expression vector, which contains a promoter, may also contain any combination of various βstrongβ transcription and/or translation initiation signals. For instance, efficient translation in E. coli requires an SD sequence about 7β9 bases 5β² to the initiation codon (βATGβ) to provide a ribosome binding site. Thus, any SD-ATG combination that can be utilized by host cell ribosomes may be employed. Such combinations include but are not limited to the SD-ATG combination from the cro gene or the N gene of coliphage lambda, or from the E. coli tryptophan E, D, C, B or A genes. Additionally, any SD-ATG combination produced by recombinant DNA or other techniques involving incorporation of synthetic nucleotides may be used.
Once the isolated DNA molecule encoding the polypeptide or protein has been cloned into an expression system, it is ready to be incorporated into a host cell. Such incorporation can be carried out by the various forms of transformation noted above, depending upon the vector/host cell system. Suitable host cells include, but are not limited to, bacteria, virus, yeast, mammalian cells, insect, plant, and the like.
Because it is desirable for recombinant host cells to secrete the encoded protein or polypeptide, it is preferable that the host cell also possess a functional type III secretion system. The type III secretion system can be heterologous to host cell (Ham et al., βA Cloned Erwinia chrysanthemi Hrp (Type III Protein Secretion) System Functions in Escherichia coli to Deliver Pseudomonas syringae Avr Signals to Plant Cells and Secrete Avr Proteins in Culture,β Microbiol. 95:10206β10211 (1998), which is hereby incorporated by reference in its entirety) or the host cell can naturally possess a type III secretion system. Host cells which naturally contain a type III secretion system include many pathogenic Gram-negative bacterium, such as numerous Erwinia species, Pseudomonas species, Xanthomonas species, etc. Other type III secretion systems are known and still others are continually being identified. Pathogenic bacteria that can be utilized to deliver effector proteins or polypeptides are preferably disarmed according to known techniques, i.e., as described above. Alternatively, isolation of the effector protein or polypeptide from the host cell or growth medium can be carried out as described above.
Another aspect of the present invention relates to a transgenic plant which express a protein or polypeptide of the present invention and methods of making the same.
In order to express the DNA molecule in isolated plant cells or tissue or whole plants, a plant expressible promoter is needed. Any plant-expressible promoter can be utilized regardless of its origin, i.e., viral, bacterial, plant, etc. Without limitation, two suitable promoters include the nopaline synthase promoter (Fraley et al., Proc. Natl. Acad. Sci. USA 80:4803β4807 (1983), which is hereby incorporated by reference in its entirety) and the cauliflower mosaic virus 35S promoter (O'Dell et al., βIdentification of DNA Sequences Required for Activity of the Cauliflower Mosaic Virus 35S Promoter,β Nature, 313(6005):810β812 (1985), which is hereby incorporated by reference in its entirety). Both of these promoters yield constitutive expression of coding sequences under their regulatory control.
While constitutive expression is generally suitable for expression of the DNA molecule, it should be apparent to those of skill in the art that temporally or tissue regulated expression may also be desirable, in which case any regulated promoter can be selected to achieve the desired expression. Typically, the temporally or tissue regulated promoters will be used in connection with the DNA molecule that are expressed at only certain stages of development or only in certain tissues.
In some plants, it may also be desirable to use promoters which are responsive to pathogen infiltration or stress. For example, it may be desirable to limit expression of the protein or polypeptide in response to infection by a particular pathogen of the plant. One example of a pathogen-inducible promoter is the gst1 promoter from potato, which is described in U.S. Pat. Nos. 5,750,874 and 5,723,760 to Strittmayer et al., each of which is hereby incorporated by reference in its entirety.
Expression of the DNA molecule in isolated plant cells or tissue or whole plants also requires appropriate transcription termination and polyadenylation of mRNA. Any 3β² regulatory region suitable for use in plant cells or tissue can be operably linked to the first and second DNA molecules. A number of 3β² regulatory regions are known to be operable in plants. Exemplary 3β² regulatory regions include, without limitation, the nopaline synthase 3β² regulatory region (Fraley, et al., βExpression of Bacterial Genes in Plant Cells,β Proc. Nat'l. Acad. Sci. USA, 80:4803β4807 (1983), which is hereby incorporated by reference in its entirety) and the cauliflower mosaic virus 3β² regulatory region (Odell, et al., βIdentification of DNA Sequences Required for Activity of the Cauliflower Mosaic Virus 35S Promoter,β Nature, 313(6005):810β812 (1985), which is hereby incorporated by reference in its entirety).
The promoter and a 3β² regulatory region can readily be ligated to the DNA molecule using well known molecular cloning techniques described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, NY (1989), which is hereby incorporated by reference in its entirety.
One approach to transforming plant cells with a DNA molecule of the present invention is particle bombardment (also known as biolistic transformation) of the host cell. This can be accomplished in one of several ways. The first involves propelling inert or biologically active particles at cells. This technique is disclosed in U.S. Pat. Nos. 4,945,050, 5,036,006, and 5,100,792, all to Sanford, et al., each of which is hereby incorporated by reference in its entirety. Generally, this procedure involves propelling inert or biologically active particles at the cells under conditions effective to penetrate the outer surface of the cell and to be incorporated within the interior thereof When inert particles are utilized, the vector can be introduced into the cell by coating the particles with the vector containing the heterologous DNA. Alternatively, the target cell can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle. Biologically active particles (e.g., dried bacterial cells containing the vector and heterologous DNA) can also be propelled into plant cells. Other variations of particle bombardment, now known or hereafter developed, can also be used.
Another method of introducing the DNA molecule into plant cells is fusion of protoplasts with other entities, either minicells, cells, lysosomes, or other fusible lipid-surfaced bodies that contain the DNA molecule. Fraley, et al., Proc. Natl. Acad. Sci. USA, 79:1859β63 (1982), which is hereby incorporated by reference in its entirety.
The DNA molecule may also be introduced into the plant cells by electroporation. Fromm, et al., Proc. Natl. Acad. Sci. USA, 82:5824 (1985), which is hereby incorporated by reference in its entirety. In this technique, plant protoplasts are electroporated in the presence of plasmids containing the DNA molecule. Electrical impulses of high field strength reversibly permeabilize biomembranes allowing the introduction of the plasmids. Electroporated plant protoplasts reform the cell wall, divide, and regenerate.
Another method of introducing the DNA molecule into plant cells is to infect a plant cell with Agrobacterium tumefaciens or Agrobacterium rhizogenes previously transformed with the DNA molecule. Under appropriate conditions known in the art, the transformed plant cells are grown to form shoots or roots, and develop further into plants. Generally, this procedure involves inoculating the plant tissue with a suspension of bacteria and incubating the tissue for 48 to 72 hours on regeneration medium without antibiotics at 25β28Β° C.
Agrobacterium is a representative genus of the Gram-negative family Rhizobiaceae. Its species are responsible for crown gall (A. tumefaciens) and hairy root disease (A. rhizogenes). The plant cells in crown gall tumors and hairy roots are induced to produce amino acid derivatives known as opines, which are catabolized only by the bacteria. The bacterial genes responsible for expression of opines are a convenient source of control elements for chimeric expression cassettes. In addition, assaying for the presence of opines can be used to identify transformed tissue.
Heterologous genetic sequences such as a DNA molecule of the present invention can be introduced into appropriate plant cells by means of the Ti plasmid of A. tumefaciens or the Ri plasmid of A. rhizogenes. The Ti or Ri plasmid is transmitted to plant cells on infection by Agrobacterium and is stably integrated into the plant genome. Schell, J., Science, 237:1176β83 (1987), which is hereby incorporated by reference in its entirety.
Plant tissue suitable for transformation include leaf tissue, root tissue, meristems, zygotic and somatic embryos, and anthers.
After transformation, the transformed plant cells can be selected and regenerated.
Preferably, transformed cells are first identified using, e.g., a selection marker simultaneously introduced into the host cells along with the DNA molecule of the present invention. Suitable selection markers include, without limitation, markers coding for antibiotic resistance, such as kanamycin resistance (Fraley, et al., Proc. Natl. Acad. Sci. USA, 80:4803β4807 (1983), which is hereby incorporated by reference in its entirety). A number of antibiotic-resistance markers are known in the art and other are continually being identified. Any known antibiotic-resistance marker can be used to transform and select transformed host cells in accordance with the present invention. Cells or tissues are grown on a selection media containing an antibiotic, whereby generally only those transformants expressing the antibiotic resistance marker continue to grow.
Once a recombinant plant cell or tissue has been obtained, it is possible to regenerate a full-grown plant therefrom. Thus, another aspect of the present invention relates to a transgenic plant that includes a DNA molecule of the present invention, wherein the promoter induces transcription of the first DNA molecule in response to infection of the plant by an oomycete. Preferably, the DNA molecule is stably inserted into the genome of the transgenic plant of the present invention.
Plant regeneration from cultured protoplasts is described in Evans, et al., Handbook of Plant Cell Cultures Vol. 1: (MacMillan Publishing Co., New York, 1983); and Vasil I. R. (ed.), Cell Culture and Somatic Cell Genetics of Plants, Acad. Press, Orlando, Vol. I, 1984, and Vol. III (1986), each of which is hereby incorporated by reference in their entirety.
It is known that practically all plants can be regenerated from cultured cells or tissues, including but not limited to, all major species of rice, wheat, barley, rye, cotton, sunflower, peanut, corn, potato, sweet potato, bean, pea, chicory, lettuce, endive, cabbage, cauliflower, broccoli, turnip, radish, spinach, onion, garlic, eggplant, pepper, celery, carrot, squash, pumpkin, zucchini, cucumber, apple, pear, melon, strawberry, grape, raspberry, pineapple, soybean, tobacco, tomato, sorghum, and sugarcane.
Means for regeneration vary from species to species of plants, but generally a suspension of transformed protoplasts or a petri plate containing transformed explants is first provided. Callus tissue is formed and shoots may be induced from callus and subsequently rooted. Alternatively, embryo formation can be induced in the callus tissue. These embryos germinate as natural embryos to form plants. The culture media will generally contain various amino acids and hormones, such as auxin and cytokinins. It is also advantageous to add glutamic acid and proline to the medium, especially for such species as corn and alfalfa. Efficient regeneration will depend on the medium, on the genotype, and on the history of the culture. If these three variables are controlled, then regeneration is usually reproducible and repeatable.
After the DNA molecule is stably incorporated in transgenic plants, it can be transferred to other plants by sexual crossing or by preparing cultivars. With respect to sexual crossing, any of a number of standard breeding techniques can be used depending upon the species to be crossed. Cultivars can be propagated in accord with common agricultural procedures known to those in the field.
Diseases caused by the vast majority of bacterial pathogens result in limited lesions. That is, even when everything is working in the pathogen's favor (e.g., no triggering of the hypersensitive response because of R-gene detection of one of the effectors), the parasitic process still triggers defenses after a couple of days, which then stops the infection from spreading. Thus, the very same effectors that enable parasitism to proceed must also eventually trigger defenses. Therefore, premature expression of these effectors is believed to βturn onβ plant defenses earlier (i.e., prior to infection) and make the plant resistant to either the specific bacteria from which the effector protein was obtained or many pathogens. An advantage of this approach is that it involves natural products and plants seem highly sensitive to pathogen effector proteins.
According to one embodiment, a transgenic plant is provided that contains a heterologous DNA molecule of the present invention. When the heterologous DNA molecule is expressed in the transgenic plant, plant defenses are activated, imparting disease resistance to the transgenic plant. The transgenic plant can also contain an R-gene whose product is activated by the protein or polypeptide product of the heterologous DNA molecule. The R gene can be naturally occurring in the plant or heterologously inserted therein. By disease resistance, it is believed that the effector proteins of the present invention can impart to plants resistance against bacterial, viral, and/or fungal diseases.
In addition to imparting disease resistance, it is believed that stimulation of plant defenses in transgenic plants of the present invention will also result in a simultaneous enhancement in growth and resistance to insects.
Alternative to transgenic expression is topical application of the effector proteins to plants. The embodiments of the present invention where the effector polypeptide or protein is applied to the plant can be carried out in a number of ways, including: 1) application of an isolated protein (or composition containing the same) or 2) application of bacteria which do not cause disease and are transformed with a gene encoding the effector protein of the present invention. In the latter embodiment, the effector protein can be applied to plants by applying bacteria containing the DNA molecule encoding the effector protein. Such bacteria are preferably capable of secreting or exporting the protein so that the protein can contact plant cells. In these embodiments, the protein is produced by the bacteria in planta.
Such topical application can be carried out using an effector-TAT protein, which will afford transduction domain-mediated spontaneous uptake of the effector protein into cells. Basically, this is carried out by fusing an 11-amino acid peptide (YGRKKRRQRRR, SEQ ID No: 25) by standard rDNA techniques to the N-terminus of the effector protein, and the resulting tagged protein is taken up into animal cells by a poorly understood process. This peptide is the protein transduction domain (PTD) of the human immunodeficiency virus (HIV) TAT protein (Schwarze et al., βProtein transduction: unrestricted delivery into all cells?β Trends Cell Biol. 10:290β295 (2000), which is hereby incorporated by reference in its entirety). Other PTDs are known and can be used for this purpose (Prochiantz, βMessenger proteins: homeoproteins, TAT and others,β Curr. Opin. Cell Biol. 12:400β406 (2000), which is hereby incorporated by reference in its entirety). See PCT Application Publication No. WO 01/19393 to Collmer et al., which is hereby incorporated by reference in its entirety.
When the effector protein is topically applied to plants, it can be applied as a composition, which includes a carrier in the form, e.g., of water, aqueous solutions, slurries, or dry powders. In this embodiment, the composition contains greater than about 5 nM of the protein of the present invention.
Although not required, this composition may contain additional additives including fertilizer, insecticide, fungicide, nematicide, and mixtures thereof Suitable fertilizers include (NH4)2NO3. An example of a suitable insecticide is Malathion. Useful fungicides include Captan.
Other suitable additives include buffering agents, wetting agents, coating agents, and, in some instances, abrading agents. These materials can be used to facilitate the process of the present invention.
According to one embodiment, a transgenic plant including a heterologous DNA molecule of the present invention expresses one or more effector proteins, wherein the transgenic plant is capable of supporting growth of compatible nonpathogenic bacteria. The compatible nonpathogenic bacteria can be naturally occurring or it can be recombinant. Preferably, the nonpathogenic bacteria is recombinant and expresses one or more useful products. Thus, the transgenic plant becomes a green factory for producing desirable products. Desirable products include, without limitation, products that can enhance the nutritional quality of the plant or products that are desirable in isolated form If desired in isolated form, the product can be isolated from plant tissues. To prevent competition between the non-pathogenic bacteria which express the desired product and those that do not, it is possible to tailor the needs of recombinant, non-pathogenic bacteria so that only they are capable if living in plant tissues expressing a particular effector protein or polypeptide of the present invention.
The effector proteins or polypeptides of the present invention are believed to alter the plant physiology by shifting metabolic pathways to benefit the parasite and by activating or suppressing cell death pathways. Thus, they may also provide useful tools for efficiently altering the nutrient content of plants and delaying or triggering senescence. There are agricultural applications for all of these possible effects.
Thus, a further aspect of the present invention relates more generally to a method of modifying a metabolic pathway in a cell by introducing into the cell an effector protein or polypeptide of the present invention which interacts with a native cellular protein involved in a metabolic pathway of the cell. As a result of introducing the protein or polypeptide into the cell, the protein or polypeptide modifies the metabolic pathway through its interaction with the native cellular protein. By way of example, the HopPsyAPto protein (SEQ ID No: 22) is believed to interact with Mad2.
Yet another aspect of the present invention relates to a method of causing eukaryotic cell death which is carried out by introducing into a eukaryotic cell a Pseudomonas protein which is cytotoxic and causes cell death. One preferred protein of the present invention is HopPsyAPto (SEQ ID No: 22), homolog of HopPsyA. The eukaryotic cell which is treated can be either in vitro or in vivo. When treating eukaryotic cells in vivo, a number of different protein- or DNA-delivery systems can be employed to introduce the effector protein into the target eukaryotic cell.
The protein- or DNA-delivery systems can be provided in the form of pharmaceutical compositions which include the delivery system in a pharmaceutically acceptable carrier, which may include suitable excipients or stabilizers. The dosage can be in solid or liquid form, such as powders, solutions, suspensions, or emulsions. Typically, the composition will contain from about 0.01 to 99 percent, preferably from about 20 to 75 percent of active compound(s), together with the carrier, excipient, stabilizer, etc.
The compositions of the present invention are preferably administered in injectable or topically-applied dosages by solution or suspension of these materials in a physiologically acceptable diluent with a pharmaceutical carrier. Such carriers include sterile liquids, such as water and oils, with or without the addition of a surfactant and other pharmaceutically and physiologically acceptable carrier, including adjuvants, excipients or stabilizers. Illustrative oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, or mineral oil. In general, water, saline, aqueous dextrose and related sugar solution, and glycols, such as propylene glycol or polyethylene glycol, are preferred liquid carriers, particularly for injectable solutions.
Alternatively, the effector proteins can also be delivered via solution or suspension packaged in a pressurized aerosol container together with suitable propellants, for example, hydrocarbon propellants like propane, butane, or isobutane with conventional adjuvants. The materials of the present invention also may be administered in a non-pressurized form such as in a nebulizer or atomizer.
Depending upon the treatment being effected, the compounds of the present invention can be administered orally, topically, transdermally, parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally, by intranasal instillation, by intracavitary or intravesical instillation, intraocularly, intraarterially, intralesionally, or by application to mucous membranes, such as, that of the nose, throat, and bronchial tubes.
Compositions within the scope of this invention include all compositions wherein the compound of the present invention is contained in an amount effective to achieve its intended purpose. While individual needs vary, determination of optimal ranges of effective amounts of each component is within the skill of the art.
One approach for delivering an effector protein into cells involves the use of liposomes. Basically, this involves providing a liposome which includes that effector protein to be delivered, and then contacting the target cell with the liposome under conditions effective for delivery of the effector protein into the cell.
Liposomes are vesicles comprised of one or more concentrically ordered lipid bilayers which encapsulate an aqueous phase. They are normally not leaky, but can become leaky if a hole or pore occurs in the membrane, if the membrane is dissolved or degrades, or if the membrane temperature is increased to the phase transition temperature. Current methods of drug delivery via liposomes require that the liposome carrier ultimately become permeable and release the encapsulated drug at the target site. This can be accomplished, for example, in a passive manner wherein the liposome bilayer degrades over time through the action of various agents in the body. Every liposome composition will have a characteristic half-life in the circulation or at other sites in the body and, thus, by controlling the half-life of the liposome composition, the rate at which the bilayer degrades call be somewhat regulated.
In contrast to passive drug release, active drug release involves using an agent to induce a permeability change in the liposome vesicle. Liposome membranes can be constructed so that they become destabilized when the environment becomes acidic near the liposome membrane (see, e.g., Proc. Natl. Acad. Sci. USA 84:7851 (1987); Biochemistry 28:908 (1989), each of which is hereby incorporated by reference in their entirety). When liposomes are endocytosed by a target cell, for example, they can be routed to acidic endosomes which will destabilize the liposome and result in drug release.
Alternatively, the liposome membrane can be chemically modified such that an enzyme is placed as a coating on the membrane which slowly destabilizes the liposome. Since control of drug release depends on the concentration of enzyme initially placed in the membrane, there is no real effective way to modulate or alter drug release to achieve βon demandβ drug delivery. The same problem exists for pH-sensitive liposomes in that as soon as the liposome vesicle comes into contact with a target cell, it will be engulfed and a drop in pH will lead to drug release.
This liposome delivery system can also be made to accumulate at a target organ, tissue, or cell via active targeting (e.g., by incorporating an antibody or hormone on the surface of the liposomal vehicle). This can be achieved according to known methods.
Different types of liposomes can be prepared according to Bangham et al., J. Mol. Biol. 13:238β252 (1965); U.S. Pat. No. 5,653,996 to Hsu et al.; U.S. Pat. No. 5,643,599 to Lee et al., U.S. Pat. No. 5,885,613 to Holland et al.; U.S. Pat. No. 5,631,237 to Dzau et al.; and U.S. Pat. No. 5,059,421 to Loughrey et al., each of which is hereby incorporated by reference in their entirety.
An alternative approach for delivery of effector proteins involves the conjugation of the desired effector protein to a polymer that is stabilized to avoid enzymatic degradation of the conjugated effector protein. Conjugated proteins or polypeptides of this type are described in U.S. Pat. No. 5,681,811 to Ekwuribe, which is hereby incorporated by reference in its entirety.
Yet another approach for delivery of proteins or polypeptides involves preparation of chimeric proteins according to U.S. Pat. No. 5,817,789 to Heartlein et al., which is hereby incorporated by reference in its entirety. The chimeric protein can include a ligand domain and, e.g., an effector protein of the present invention. The ligand domain is specific for receptors located on a target cell. Thus, when the chimeric protein is delivered intravenously or otherwise introduced into blood or lymph, the chimeric protein will adsorb to the targeted cell, and the targeted cell will internalize the chimeric protein, which allows the effector protein to de-stabilize the cell checkpoint control mechanism, affording its cytotoxic effects.
When it is desirable to achieve heterologous expression of an effector protein of the present invention in a target cell, DNA molecules encoding the desired effector protein can be delivered into the cell. Basically, this includes providing a nucleic acid molecule encoding the effector protein and then introducing the nucleic acid molecule into the cell under conditions effective to express the effector protein in the cell. Preferably, this is achieved by inserting the nucleic acid molecule into an expression vector before it is introduced into the cell.
When transforming mammalian cells for heterologous expression of an effector protein, an adenovirus vector can be employed. Adenovirus gene delivery vehicles can be readily prepared and utilized given the disclosure provided in Berkner, Biotechniques 6:616β627 (1988) and Rosenfeld et al., Science 252:431β434 (1991), WO 93/07283, WO 93/06223, and WO 93/07282, each of which is hereby incorporated by reference in their entirety. Adeno-associated viral gene delivery vehicles can be constructed and used to deliver a gene to cells. The use of adeno-associated viral gene delivery vehicles in vitro is described in Chatterjee et al., Science 258:1485β1488 (1992); Walsh et al., Proc. Nat'l. Acad. Sci. 89:7257β7261 (1992); Walsh et al., J. Clin Invest. 94:1440β1448 (1994); Flotte et al., J. Biol. Chem. 268:3781β3790 (1993); Ponnazhagan et al., J. Exp. Med. 179:733β738 (1994); Miller et al., Proc. Nat'l Acad. Sci. 91:10183β10187 (1994); Einerhand et al., Gene Ther. 2:336β343 (1995); Luo et al., Exp. Hematol. 23:1261β1267 (1995); and Zhou et al., Gene Ther. 3:223β229 (1996), each of which is hereby incorporated by reference in their entirety. In vivo use of these vehicles is described in Flotte et al., Proc. Nat'l Acad. Sci. 90:10613β10617 (1993); and Kaplitt et al., Nature Genet. 8:148β153 (1994), each of which is hereby incorporated by reference in their entirety. Additional types of adenovirus vectors are described in U.S. Pat. No. 6,057,155 to Wickham et al.; U.S. Pat. No. 6,033,908 to Bout et al.; U.S. Pat. No. 6,001,557 to Wilson et al.; U.S. Pat. No. 5,994,132 to Chamberlain et al.; U.S. Pat. No. 5,981,225 to Kochanek et al.; and U.S. Pat. No. 5,885,808 to Spooner et al.; and U.S. Pat. No. 5,871,727 to Curiel, each of which is hereby incorporated by reference in their entirety).
Retroviral vectors which have been modified to form infective transformation systems can also be used to deliver nucleic acid encoding a desired effector protein into a target cell. One such type of retroviral vector is disclosed in U.S. Pat. No. 5,849,586 to Kriegler et al., which is hereby incorporated by reference in its entirety.
Regardless of the type of infective transformation system employed, it should be targeted for delivery of the nucleic acid to a specific cell type. For example, for delivery of the nucleic acid into tumor cells, a high titer of the infective transformation system can be injected directly within the tumor site so as to enhance the likelihood of tumor cell infection. The infected cells will then express the desired effector protein, thereby causing cytotoxic effects.
Particularly preferred is use of the effector proteins of the present invention to treat a cancerous condition (i.e., the eukaryotic cell which is affected is a cancer cell). This can be carried out by introducing or administering to a patient, a cytotoxic Pseudomonas protein under conditions effective to inhibit cancer cell division, thereby treating the cancer condition.
By introducing, it is intended that the effector protein is administered to the patient, preferably in the form of a composition which will target delivery to the cancer cells. Alternatively, when using DNA-based therapies, it is intended that the introducing be carried out by administering a targeted DNA delivery system to the patient such that the cancer cells are targeted and the effector protein is expressed therein. A number of known targeted delivery systems are known in the art and can be employed herewith.
The following Examples are intended to be illustrative and in no way are intended to limit the scope of the present invention.
ORF-specific DNA fragments were amplified by PCR from DC3000 genomic DNA and printed onto amine-coated slides from Cell Associates (Houston). Each DNA sample was printed three times on each slide with a BioRobotics (Boston) Microgrid II Arrayer by using MicroSpot2500 split pins. Slides were blocked according to the recommended protocol from Cell Associates. Of total RNA, 50β100 ΞΌg was used to synthesize cDNA probes for microarray analysis. RNA was mixed with 3 ΞΌg of random hexamers (Invitrogen) in a total volume of 15 ΞΌl and incubated at 65Β° C. for 10 min. Reactions were then placed on ice for 2 min, to which were added 3 ΞΌl of 1 mM FluoroLink Cy3- or Cy5-dUTP (Amersham Biosciences, Piscataway, N.J.), 3 ΞΌl of 0.1 M DTT, 6 ΞΌl of 5Γ first-strand buffer, 0.6 ΞΌl of 50ΓdNTPs mix (25 mM dATP, dCTP, dGTP/10 mM dTTP), and 2 ΞΌl of Superscript II (GIBCO/BRL). Reactions were incubated at room temperature for 10 min, followed by 42Β° C. for 110 min. RNA was hydrolyzed by adding 1.5 ΞΌl of 1 M NaOH at 65Β° C. for 10 min followed by neutralizing with 1.5 ΞΌl of 1 M HCl. cDNA probes were purified by using a PCR purification kit (Qiagen, Valencia, Calif.) and were resuspended in 20 ΞΌl of hybridization buffer (5ΓSSC, 0.1% SDS, and 25% formamide, where 1ΓSSC=0.15 M sodium chloride/0.015 M sodium citrate, pH 7). Denatured probes (99Β° C., 2 min) were hybridized to slides at 60Β° C. overnight in hybridization cassettes (Coming), after which slides were washed twice with 2ΓSSC, 0.1% SDS (60Β° C., 5 min), once with 2ΓSSC (room temperature, 5 min), and once with 0.2ΓSSC (room temperature, 5 min).
Microarray images were visualized by using a ScanArray 5000 (Packard), using laser and PMT settings of 100 and 90, respectively. Images were overlaid and quantified by using IMAGENE 4.1 software (BioDiscovery; Marina Del Rey, Calif.). Ratio data were extracted by using GENESIGHT 2.1 software (BioDiscovery). For these analyses, local background for each spot was corrected, and signals lower than 50 were flagged and eliminated. After flooring low signals to the value of 100, ratios of the overlaid images were calculated for individual spots. 16S rRNA was used and, to normalize the data, the 16S rRNA was expressed to similar levels in both tested strains based on RNA blots. Finally, all of the replicated data were combined, and mean ratio data and SDs were calculated for each ORF.
To corroborate the microarray results, RNA blotting was performed on 10 ORFs from similarly grown cultures. RNA blot analyses were performed as described (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Lab. Press, Plainview, N.Y.(1989), which is hereby incorporated by reference). Of each RNA sample, 25 ΞΌg was resolved on 1.2% formaldehyde-agarose gels and transferred to Nylon membranes (Hybond-N+) by capillary blotting using 20ΓSSC. transferred to Nylon membranes (Hybond-N+) by capillary blotting using 20ΓSSC. RNA was bound to the membrane by UV cross-linking. Probes were generated by PCR amplification from genomic DNA, using ORF-specific primers, and labeled with 32P-dATP by random priming with a DECAprime II kit (Ambion). Hybridization was performed in 5ΓSSC, 50% formamide, 0.1% sodium-lauroylsarcosine,0.02% SDS, and 2% blocking reagent (Roche Molecular Biochemicals) at 42Β° C. overnight. Membranes were then washed twice with 2ΓSSC/0.1% SDS for 15 min, twice with 1ΓSSC/0.1% SDS for 15 min, and once with 0.1ΓSSC/0.1% SDS for 15 min before exposure on a phosphor screen. Signals were detected and evaluated by using a Storm system (Molecular Dynamics) (FIG. 1).
The microarray experiments were in qualitative agreement with the RNA blot. These data indicate that Hrp promoter candidates with E values smaller (more significant) than 1eβ4 are expressed at levels detected by the microarray and RNA blotting. However, within this group there was no apparent relationship between the magnitude of the E value and the level of expression. Furthermore, one of 16 examined ORFs (see Fouts et al. (Proc. Natl. Acad. Sci USA 99: 2275β2280 (2002), which is hereby incorporated by reference in its entirety) with an E value substantially lower than this threshold, AvrXv3 (4eβ6), was expressed at a level that was detected only by RNA blot analysis (Table 1 below), indicating that significant E values do not always predict strong expression.
| TABLE 1 |
| Results of Microarray Analysis |
| GenBank | Amino | ||||
| Des- | accession | acid | BLASTP | HMM | Microarray |
| ignation | number1 | % identity | p value | E-value | signal ratio2 |
| HopPsyAPto | L14926 | 52 | 9eβ93 | 1.0eβ5 | 11 Β± 9 |
| AvrPphEPto | U16817 | 67 | 1eβ117 | 2.5eβ4 | β5 Β± 2 |
| AvrPphFPto | AF231452 | 51 | 3eβ36 | 1.7eβ6 | β3 Β± 2 |
| AvrPphD1Pto | AJ277494 | 89 | 0 | 1.9eβ6 | β30 Β± 17 |
| AvrXv3Pto | AF190120 | 27 | 7eβ12 | 3.4eβ6 | ND |
| AvrPpiB1Pto | X84843 | 100 | 1eβ152 | 7.8eβ6 | 11 Β± 9 |
| AvrPpiB2Pto | X84843 | 100 | 1eβ150 | 7.8eβ6 | 10 Β± 6 |
| AvrPphD2Pto | AJ277494 | 53 | 2eβ44 | 3.0eβ5 | β27 Β± 11 |
| HopPtoB23 | AF232004 | 2.6eβ3 | ND | ||
| AvrRps4Pto | L43559 | 72 | 2eβ44 | 2.5eβ2 | ND |
| Reference genes |
| 16S rRNA* | 1 |
| 23S rRNA** | 1 |
| 1GenBank accession number AF232004 is for DC3000 sequences, all others are for homologs originally found in other bacteria. | |
| 2Microarray signal is the mean ratio and standard deviation from 3 replicates of 2 independent experiments, calculated as described in the Materials and Methods. AvrPpiB1Pto and AvrPpiB2Pto are 100% identical, so their signals cannot be distinguished. AvrPphD1Pto and AvrPphD2Pto are 62% identical. ND = not detected. | |
| 3HopPtoB1 is secreted in a Hrp-dependent manner; HopPtoB2 has duplicated regions of homology with HopPtoB1. |
By using an iterative process involving computational and gene expression data, an initial inventory of P. s. tomato DC3000 candidate type III secretion effector proteins was obtained. These are the presumed prime agents of host metabolic subversion. These analyses have revealed that the Hrp regulon, the primary regulon known to be expressed during infection, seems to control at least 48 genes and a subsidiary regulon directing phytotoxin production. The iterative process focused on Hrp promoters in DC3000 and featured microarray experiments that tested the activity of novel Hrp promoters and demonstrated the validity of this approach for genomewide transcriptional profiling in DC3000. These findings suggest that the P. syringae Hrp regulon is more complex than expected and encompasses more than type III secretion system genes and effector genes.
The global search for DC3000 ORFs that are similar to known Avr/Hop proteins yielded AvrXv3Pto, AvrPtoB, and the AvrPphD families as the only candidate effectors shared with Xanthomonas spp. (Noel et al., Mol. Microbiol. 41:1271β1281 (2001), which is hereby incorporated by reference in its entirety). Notably missing were members of the AvrBs2 and AvrBs3 families, which are widespread in Xanthomonas spp., or any members of the AvrRxv/YopJ family, which are found in genera as diverse as Salmonella, Yersinia, Xanthomonas, Erwinia, and Rhizobium, and have also been reported in another strain of P. syringae (i.e., P. s. syringae B728a) (GalΓ‘n & Collmer, Science 284:1322β1328 (1999); Alfano et al., Proc. Natl. Acad. Sci. USA 97:4856β4861 (2000), each of which is hereby incorporated by reference in its entirety). However, it is important to note that further searches after closure and annotation of the DC3000 genome may yield additional homologs of known effectors. In addition, genomic projects with other pathogens will enlarge the set of candidate effector genes available for comparison.
The majority of P. syringae avr genes that have been cloned on the basis of Avr phenotype have come from three pathovars that parasitize legumes glycinea, phaseolicola, and pisi. P. s. tomato has a different host range and diverges from these other pathovars in rRNA comparisons (Manceau & Horvais, Appl. Environ. Microbiol. 63:498β505 (1997), which is hereby incorporated by reference in its entirety). Nevertheless, of the 15 avr gene families found in these legume-attacking pathovars, 6 are also found in DC3000. This finding suggests the existence of a core set of P. syringae effectors in addition to those in the Hrp pathogenicity island CEL.
The analyses described above and reported in Fouts et al. (Proc. Natl. Acad. Sci USA 99: 2275β2280 (2002), which is hereby incorporated by reference in its entirety) revealed a striking apparent redundancy among the candidate effector protein genes hopPtoA, hopPtoB, avrPphDPto, and avrPpiB1Pto, as well as in three Hrp-related factors that may play a role in type III protein translocation across bacterial and plant cell walls.
All of the analyzed candidate effector genes seem to be expressed in a HrpL-dependent manner except for avrRps4Pto, hopPtoA2, and hopPtoB2 (avrXv3Pto was HrpL-activated, but relatively poorly). avrRps4Pto was cloned originally from Pseudomonas syringae pisi and renders recombinant DC3000 avirulent on most Arabidopsis accessions (Hinsch & Staskawicz, Mol. Plant-Microbe Interact. 9:55β61 (1996), which is hereby incorporated by reference in its entirety), and avrXv3 is from an Xanthomonas campestris pv. vesicatoria race that is avirulent on tomato carrying the Xv3 R gene (Astua-Monge et al., Mol. Plant-Microbe Interact. 13:911β921 (2000), which is hereby incorporated by reference in its entirety). There exists a possibility that poor expression of these two avr genes in DC3000 is a factor in the virulence of DC3000 on Arabidopsis and tomato carrying the cognate R genes.
Secretion assays were performed using P. s. tomato DC3000 strains carrying a pML123 derivative containing a PCR-cloned ORF (encoding a candidate Hrp-secreted protein) fused to nucleotide sequences that encoded either the HA or FLAG epitopes along with their native ribosome binding sites and an engineered stop codon (Labes et al., Gene 89:37β46 (1990), which is hereby incorporated by reference in its entirety).
Four effector proteins were tested for their secretion from the above-identified strains. Primers and the constructs used to prepare the transform the host strains are identified as follows:
For HopPtoC expression, the hopPtoC gene was cloned using forward primer (agtcggatccgaatagggcgctgaaaatatgacaatcgtgtc, SEQ ID No: 26) containing a BamHI site and reverse primer (agtcctcgagtcacttgtcatcgtcgtccttgtagtcgtgtatttttgaagcgaa, SEQ ID No: 27) containing an XhoI site and FLAG epitope codons. The hopPtoC gene was cloned into plasmid vector pLN50.
For HopPtoD1 expression, the hopPtoD1 gene was cloned using forward primer (ccacacattggatccgattacttcatccgggacagctgatagcgc, SEQ ID No: 28) containing a BamHI site and reverse primer (attctcgagtcatttatcatcatcatctttataatcgggtgcgggctgccgcgac, SEQ ID No: 29) containing an XhoI site and FLAG epitope codons. The hopPtoD1 gene was cloned into plasmid vector pLN167.
For HopPtoD2 expression, the hopPtoD2 gene was cloned using forward primer (atgcaagcttatccaatgcctttcgtca, SEQ ID No: 30) containing a HindIII site and reverse primer (atgcctcgagtcaagcgtaatctggaacatcgtatgggtattctaacgctatttttgc, SEQ ID No: 31) containing an XhoI site and HA epitope codons. The hopPtoD2 gene was cloned into plasmid vector pLN130.
For HopPtoJ expression, the hopPtoJ gene was cloned using forward primer (agtaaagcttgagctgcacgcatgcgag, SEQ ID No: 32) containing a HindIII site and reverse primer (agtatctagatcacttgtcatcgtcgtccttgtagtcttgtgcgaccagatgttt, SEQ ID No: 33) containing an XbaI site and FLAG epitope codons. The hopPtoJ gene was cloned into plasmid vector pLN164.
Constructs carrying different epitope-tagged ORFs were electroporated into DC3000 and a DC3000 hrcC mutant and grown in Hrp-inducing conditions (Yuan & He, J. Bacteriol. 178:6399β6402 (1996), which is hereby incorporated by reference in its entirety). Additionally, all of the DC3000 strains also carried pCPP2318, a construct that contains blaM lacking signal peptide sequences (Charkowski et al., J. Bacteriol. 179:3866β3874 (1997), which is hereby incorporated by reference in its entirety). DC3000 cultures were separated into cell-bound and supernatant fractions as described (van Dijk et al., J. Bacteriol. 181:4790β4797 (1999), which is hereby incorporated by reference in its entirety). Proteins were separated with SDS-PAGE by standard procedures (Sambrook et al., Molecular Cloning Second Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) (1989), which is hereby incorporated by reference in its entirety), transferred to polyvinylidene difluoride membranes, and immunoblotted using anti-FLAG (Sigma Chemical Co., St. Louis, Mo.), -HA (Roche Molecular Biochemicals, Indianapolis, Ind.), or -Ξ²-lactamase (5 Primeβ3 Prime Inc., Boulder, Colo.) as primary antibodies. Primary antibodies were recognized by goat anti-rabbit immunoglobulin G-alkaline phosphatase conjugate (Sigma Chemical Co.), which were visualized by chemiluminescence using a Western-Light chemilumincescence detection system (Tropix, Bedford, Mass.) and X-Omat X-ray film.
Each of these DC3000 proteins were found to be secreted (FIG. 2A). Because the secretability of these proteins was demonstrated (and the avirulence activity of these DC3000 homologs is unknown), the proteins were renamed as HopPtoC (AvrPpiC2 homolog), HopPtoD1 and HopPtoD2 (AvrPphD homologs), and HopPtoJ (AvrXv3 homolog).
Arabidopsis thaliana accession Columbia (Col-0) and rps2β201 mutant plants were grown in a growth chamber with 12 hr of light at 24Β° C. (22Β° C. at night) and 70% relative humidity. For HopPtoK expression, the hopPtoK gene was cloned using forward primer (gcgaattcatcggtttaatcacgcaaggc, SEQ ID No: 34) containing a EcoRI site and reverse primer (ttggtacctcagcagtagagcgtgt, SEQ ID No: 35) containing an KpnI site. The hopPtoK gene was cloned into plasmid vector phopPtoK. In addition, a hopPtoK-β²avrRpt2 fusion was prepared using SEQ ID No: 34 (above) as forward primer and reverse primer (aaggatccgcagagcgtgtcgcgacc, SEQ ID No: 36) containing an BamHI site to clone the hopPtoK gene. The partial avrRpt2 gene with the N terminal 40 codons deleted was amplified using standard PCR procedures and cloned into pMOD (Madison, Wis.). After confirmation by sequence analysis, it was cloned into the KpnI and SalI sites of the broad-host-plasmid pLK, resulting in pΞavrRpt2. DNA fragments spanning 200 bp upstream of the Hrp boxes and the complete ORFs for hopPtoK was cloned into pΞavrRpt2 to produce phopPtoK-ΞavrRpt2. Additionally, the full-length hopPtoK was cloned using PCR into pLK to generate phopPtoK. Each construct was introduced in P. s. phaseolicola 3121 by electroporation. Bacterial strains in 10 mM MgCl2 at a cell density of 108 cfu/ml were infiltrated into A. thaliana Col-0 plants with a needleless syringe. Plant responses were documented 18 hours postinoculation.
The AvrRpt2 translocation assay was used to test whether the DC3000 ORF that is similar to AvrRps4 (Hinsch & Staskawicz, Mol. Plant-Microbe Interact. 9:55β61 (1996), which is hereby incorporated by reference in its entirety) was translocated into Arabidopsis plant cells (Mudgett et al., Proc. Natl. Acad. Sci. USA 97:13324β13329 (2000);Guttman & Greenberg, Mol. Plant-Microbe Interact. 14:145β155) (2001), each of which is hereby incorporated by reference in its entirety). P. s. phaseolicola carrying a broad-host-range plasmid expressing the AvrRps4 homolog fused to the Avr domain of AvrRpt2 (but lacking the secretion signals of AvrRpt2) elicited an RPS2-dependent HR on A. thaliana Col-0 (FIG. 2B), indicating that the amino terminus of the AvrRps4 homolog supplied sufficient information to direct translocation of the fusion protein into plant cells. Consequently, the AvrRps4 homolog was renamed HopPtoK. P. s. phaseolicola expressing HopPtoK did not elicit an HR, indicating that although translocated into host cells, HopPtoK is probably not recognized by the RPS4 protein present in A. thaliana Col-0, in contrast to its P. s. pisi 151 homolog (Hinsch & Staskawicz, Mol. Plant-Microbe Interact. 9:55β61 (1996), which is hereby incorporated by reference in its entirety).
Effector proteins of the present invention will be cloned into pFLAG-CTC (Kodak) to generate an in-frame fusion with the FLAG epitope, which will permit monitoring of protein production with anti-FLAG monoclonal antibodies. The FLAG-tagged genes will then be cloned under the control of the GAL1 promoter in the yeast shuttle vector p415GAL1 (Mumberg et al., 1994). These regulatable promoters of Saccharomyces cerevisiae will allow comparison of transcriptional activity and heterologous expression. The recombinant plasmids will be transformed into uracil auxotrophic yeast strains FY833/4, then selected for growth on SC-Ura (synthetic complete medium lacking uracil) based on the presence of the URA3 gene on the plasmid. The transformants will then be streaked onto SC-Ura medium plates containing either 2% galactose (which will induce expression of the effector proteins) or 2% glucose. The presence or absence of growth on the plates supplemented with 2% galactose will be observed. If no growth is observed on 2% galactose (but growth is observed in the 2% glucose control), this result will suggest that the effector protein is having a cytotoxic effect on the transformed yeast. Empty vector controls will also be used. FLAG-tagged nontoxic Avr proteins will be used to confirm that the recombinant effector genes were differentially expressed, as expected, on plates containing galactose. To further confirm the results, albeit at lower expression levels, the recombinant effector gene will be recloned into p416GALS, which expresses foreign genes at a substantially lower level than p415GAL1.
To determine whether effector proteins induce cell death on tobacco leaves, a transformation system that delivers the effector gene on T-DNA of Agrobacterium tumefaciens will be used (Rossi et al., Plant Mol. Biol. Reporter 11:220β229 (1993); van den Ackerveken et al., Cell 87:1307β1316 (1996), each of which is hereby incorporated by reference in its entirety). This delivery system works better than biolistics for transiently transforming whole plant leaves. For these experiments, vector pTA7002, kindly provided by Nam-Hai Chua and his colleagues at Rockefeller University, will be used. The unique property of this vector is that it contains an inducible expression system that uses the regulatory mechanism of the glucocorticoid receptor (Picard et al., Cell 54:1073β1080 (1988); Aoyama and Chua, Plant J. 11(3):605β612 (1997); McNellis et al., Plant J. 14(2):247β257 (1998), each of which is hereby incorporated by reference in its entirety). pTA7002 encodes a chimeric transcription factor consisting of the DNA-binding domain of GAL4, the transactivating domain of the herpes viral protein VP16, and the receptor domain of the rat glucocorticoid receptor. Also contained on this vector is a promoter containing GAL4 upstream activating sequences (UAS) upstream of a multiple cloning site. Thus, any gene cloned downstream of the promoter containing the GAL4-UAS can be induced by glucocorticoids, of which a synthetic glucocorticoid, dexamethasone (DEX), is available commercially. Effector proteins of the present invention will be PCR-cloned downstream of the GAL4-UAS. Thereafter, plant leaves from several different test plants will be infiltrated with Argrobacterium carrying recombinant pTA7002 carrying the effector ORF and after 48 hours these plants will be sprayed with DEX to induce expression of the effectors.
Tobacco (Nicotiana tabacum) and tomato (Lycopersicon esculentum) will be grown under greenhouse conditions and then maintained at 25Β° C. with daylight and supplemental halide illumination for HR and virulence assays. Bacteria will be grown overnight on King's medium B agar supplemented with appropriate antibiotics, suspended in 5 mM MES pH 5.6, and then infiltrated with a needleless syringe into the leaves of test plants at 108 cfu/ml for HR assays and 104 cfu/ml for pathogenicity assays (Charkowski et al., J. Bacteriol. 180:5211β5217 (1998), which is hereby incorporated by reference in its entirety). All assays will be repeated at least four times on leaves from different plants. Bacterial growth in tomato leaves will be assayed by excising disks from infiltrated areas with a cork borer, comminuting the tissue in 0.5 ml of 5 mM MES, pH 5.6, with an appropriate pestle, and then dilution plating the homogenate on King's medium B agar with 50 ΞΌg/ml rifampicin and 2 ΞΌg/ml cycloheximide to determine bacterial populations. The mean and SD from three leaf samples will be determined for each time point.
Plant leaves will be examined to determine the response of plant tissue to the expression of the effector proteins. In particular, plant tissues will be examined for tissue necrosis indicative of a hypersensitive response.
Although the invention has been described in detail for the purposes of illustration, it is understood that such detail is solely for that purpose, and variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention which is defined by the following claims.
1. An isolated nucleic acid molecule comprising a nucleotide sequence which
encodes a protein or polypeptide comprising SEQ ID No: 12.
2. The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule comprises the nucleotide sequence according to SEQ ID No: 11.
3. The nucleic acid molecule according to claim 1, wherein the nucleic acid molecule is DNA.
4. An expression system comprising a vector into which is inserted the nucleic acid molecule according to claim 3.
5. The expression system according to claim 4, wherein the nucleic acid molecule is inserted in sense orientation relative to a promoter.
6. A host cell comprising the nucleic acid molecule according to claim 3.
7. The host cell according to claim 6, wherein the host cell is a bacterial cell or a plant cell.
8. The host cell according to claim 7, wherein the bacterial cell is Agrobacterium.
9. A transgenic plant comprising the nucleic acid molecule according to claim 3.
10. A method of making a transgenic plant cell comprising:
providing nucleic acid molecule according to claim 3, and
transforming a plant cell with the nucleic acid molecule, whereby the nucleic acid molecule is expressed by the transformed plant cell.
11. A method of making a transgenic plant comprising:
transforming a plant cell with the nucleic acid molecule according to claim 3, whereby the nucleic acid molecule is expressed by the transformed plant cell, and
regenerating a transgenic plant from the transformed plant cell.
12. A method of making a plant hypersusceptible to colonization by nonpathogenic bacteria, said method comprising:
transforming a plant cell with the nucleic acid molecule of claim 3, and
regenerating a transgenic plant from the transformed plant cell,
wherein a transgenic plant expresses a protein or polopeptide encoded by a nucleic acid molecule, thereby rendering the transgenic plant hypersusceptible to colonization by nonpathogenic bacteria.