-
2008-04-22
10/129,560
2000-10-30
US 7,361,507 B1
2008-04-22
WO; PCT/FR00/03028; 20001030
WO; WO01/34786; 20010517
Delia M. Ramirez
2021-02-08
The invention concerns a modified nitrilase with modulated selectivity, characterized in that it comprises in position 162 an amino acid residue different from the original amino acid residue.
Get notified when new applications in this technology area are published.
C12N15/00 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
C12Q1/34 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving hydrolase
C12N9/78 IPC
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
C12P21/06 IPC
Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products
G01N33/00 IPC
Investigating or analysing materials by specific methods not covered by groups -
C07K14/00 IPC
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
C07H21/04 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
This application is a national stage filing of International Application No. PCT/FR00/03028, filed Oct. 30, 2000. This application also claims the benefit of priority to FR 99/14,249, filed on Nov. 8, 1999.
The present invention relates to novel nitrilases with enhanced selectivity, to the method for obtaining them and to the use of said nitrilases.
FIGS. 1A-E show an alignment of the amino acid sequences of nitrilases from several species. The aligned amino acid sequences are p_Athalia1 (SEQ ID NO: 6), p_Athalia2 (SEQ ID NO: 7), p_Athalia3 (SEQ ID NO: 8), p_Tobacco1 (SEQ ID NO: 9), p_Tobacco2 (SEQ ID NO: 10), p_Osativa (SEQ ID NO: 11), p_Athalia4 (SEQ ID NO: 12), b_RhodocJ1 (SEQ ID NO: 13), b_RrhodocPA3 (SEQ ID NO: 14), b_Gterrae (SEQ ID NO: 15), b RrhodocK22 (SEQ ID NO: 16), b Kozaenae (SEQ ID NO: 17), b_CtestosNI1 (NitA; SEQ ID NO: 18), b_Afaecalis (SEQ ID NO: 19) and the consensus sequence (SEQ ID NO: 20). The numbers at the bottom of each sequence panel represent the amino acid position of the NitB (b_Afaecalis of Alcaligenes faecalis) reference sequence (SEQ ID NO: 19). The “**” indicator designates the amino acids of each sequence corresponding to positions 162 and 163 of NitB.
FIG. 2 shows a map of plasmid pRPA-BCAT41
Enzymes which catalyze the hydrolysis of nitrile groups to corresponding carboxylic acids and ammonium ions are nitrilases (Faber, Biotransformations in Organic Chemistry, Springer Verlag, Berlin Heidelberg, 1992, ISBN3-540-55762-8). However, this bioconversion of the nitrile groups to corresponding carboxylic acids, the final result of which consists of hydrolysis of the nitrile groups, may also be carried out in two steps, the first step consisting of the bioconversion of the nitrites to corresponding amides with a nitrile hydratase, the second step consisting in hydrolyzing the amides obtained to corresponding carboxylic acids with amidases.
Nitrilases were first discovered in plants (Thimann and Mahadevan, 1964, Arch. Biochem. Biophys. 105: 133-141) and then isolated in many representatives of soil microflora (Kobayashi and Shimizu, 1994, FEMS Microbiology Letters 120: 217-224): Pseudomonas, Nocardia, Arthrobacter, Fusarium, Rhodoccocus, Klebsiella and Alcaligenes. More recently, nitrilases have been characterized in thermophilic bacteria (Cramp et al., 1997, Microbiology, 143: 2313-2320). Nitrilases have varied substrate specificities but can be grouped into three groups depending on their specificity: nitrilases specific for aliphatic nitriles, those specific for aromatic nitrites or those specific for arylacetonitriles (Kobayashi et al., 1993, Proc. Natl. Acad. Sci. USA 90: 247-251; Kobayashi and Shimizu, 1994, mentioned above; Lévy-Schil et al., 1995, Gene 161: 15-20; Layh et al., 1998, J. Mol. Catal. B: Enzymatic 5: 467-474).
Nitrilases are of value in biocatalysis since many synthetic processes involve the hydrolysis of nitrile groups (Yamamoto et al., 1991, Appl. Environ. Microb. 57: 3028-3032; Faber, Biotransformations in Organic Chemistry, 2nd edn, Springer-Verlag, Berlin, 1995; Lévy-Schil et al., 1995, Gene 161: 15-20; Cowan et al., 1998, Extremophiles 2: 207-216): conversion of adiponitrile to cyanovalerate or adipate, synthesis of nicotinic acid, of p-aminobenzoic acid of tranexamic acid, enantioselective hydrolysis of mandelonitrile. In particular, the nitrilase of Alcaligenes faecalis ATCC8750 (called NitB in this application) and that of Comamonas testosteroni (called NitA in this application) may be used to attain the hydroxy analog of methionine (FR9411301, WO9609403, FR9613077).
Nitrilases have primary structures which align with variable degrees of identity, starting from approximately 30%. Aligning the sequences of several nitrilases reveals the conservation of several residues, including a cysteine residue at position 163 on the sequence of the NitB nitrilase. This residue is involved in the nitrilase reaction mechanism (Kobayashi et al., 1993, Proc. Natl. Acad. Sci. USA 90: 247-251).
For the present invention, the reference sequence is the NitB sequence, all the definitions and indications of particular amino acid positions being given relative to the NitB primary sequence. The attached FIG. 1 represents an alignment of 14 nitrilase sequences described in the state of the art, aligned relative to the NitB sequence as reference, comprising the sequences p_Athalia1 to 4 of Arabidopsis thaliana (SwissProt accession No.: P32961, P32962, P46010, P46011), p_Tobacco1 and 2 of Nicotiana tabacum (GeneBank accession No.: D63331, D83078), b_RhodocJ1 of Rhodococcus rhodocrous J1 (GeneBank accession No.: D11425), b_RrhodocPA3 of Rhodococcus rhodocrous PA34 (GeneBank accession No.: E09026), b_Gterrae of Gordona terrae (Genebank accession No. E12616), b_RrhodocK22 of Rhodococcus rhodocrous K22 (GeneBank accession No. D12583), b_Kozaenae of Klebsiella ozaenae (SwissProt accession No.: P100450), b_CtestosNI1 of Comamonas testosteroni NI1 or NitA (GeneBank accession No.: L32589), and b_Afaecalis of Alcaligenes faecalis JM3 or NitB (SwissProt accession No.: P20960). The numbering of the amino acids of the NitB sequence is given on this figure (numbering at the bottom), as is the consensus sequence with its numbering (numbering at the top). By convention in this application, the residues of the other nitrilases are numbered relative to this cysteine residue and to the sequence of the NitB nitrilase as reference sequence. Based on such an alignment, or on any nitrilase sequence of alignment, it is easy for those skilled in the art to identify, using the definition of the NitB amino acid given by its position and its nature, the position of the corresponding amino acid in another nitrilase sequence.
The Problem of Selectivity
Nitrilase selectivity is defined as the percentage of compounds not having a carboxylic function which are released by the nitrilase-catalyzed hydrolysis of a nitrile. It has been described relatively little, but is observed for a certain number of nitrilases and substrates. Thus, the hydrolysis of 2-methoxymandelonitrile to 2-methoxymandelic acid catalyzed by the nitrilase of Pseudomonas fluorescens DSM 7155 leads to the coproduction of 2-methoxy-mandelamide (Layh et al., 1998, mentioned above). Similarly, the hydrolysis of 2-hydroxy-4-methylthio-butyronitrile (HMTBN) catalyzed by the NitA nitrilase of Comamonas testosteroni NI1 (Lévy-Schil et al., 1995, mentioned above), described in the examples of this application, is accompanied by the coproduction of 2-hydroxy-4-methylthiobutyramide (HMTBM). In the case of a biocatalytic process using such an enzyme/-substrate pair, the high selectivity of the nitrilase for its substrate leads to a coproduction of amide, which represents a loss of yield of the process. This loss of yield may have a considerable economic impact. In addition, this high selectivity leads to the presence of amide contaminating the reaction product. Purification of the carboxylic acid is then necessary and, here again, has an economic impact on the process. The high selectivity of a nitrilase for a given substrate is, consequently, an obstacle to the development of a biocatalytic process using this nitrilase and this substrate.
An increase in enzyme selectivity may also be sought if this increase is accompanied by an increase in the catalytic activity of the enzyme on its substrate. It is in particular the case in methods of decontamination in which rapid degradation of a toxic molecule with an enzyme with maximum specific activity is sought. In this case, the nature of the products derived from the reaction catalyzed by the enzyme has little importance relative to the rate of degradation of the substrate.
It is therefore particularly important to be able to modify nitrilase selectivity, both in terms of an enhancement of this selectivity and in terms of a decrease.
Enhancement of Enzymes
The directed evolution of an enzyme consists in adapting an enzyme to a particular function by repeatedly selecting variants which have enhanced properties (Arnold and Volkov, 1999, Current Opinion in Chemical Biology 3: 54-59; Kuchner and Arnold, 1997, Tibtech 15: 523-530). These variants may be created by several techniques of mutagenesis on the gene encoding the enzyme studied (Skandalis et al., 1997, Chemistry & Biology 4: 8889-898; Crameri et al., 1998, Nature 391: 288-291): chemical mutagenesis (Singer and Fraenkel-Conrat, 1969, Prog. Nucl. Acid Res. Mol. Biol. 9: 1-29), mutagenesis by error-prone PCR (Leung et al., 1989, Technique 1: 11-15), by combinatorial PCR (Crameri et al., 1998, mentioned above; Shao et al., 1998, Nucleic Acids Res. 26:681-683), by directed mutagenesis (Directed Mutagenesis: A Practical Approach, 1991, Edited by M. J. McPBERSON, IRL PRESS), etc.
In the context of a method for enhancing the activity of the NitB nitrilase on HMTBN (2-amino-4-methylthiobutyronitrile), the inventors have noted that a point substitution on NitB in the region of the active site at position 162, by replacing the cysteine residue with an asparagine residue, leads to modification of the selectivity of the nitrilase studied. On the other hand, they have noted that introducing a cysteine residue at position 162 on the sequence of the NitA nitrilase leads to reduction of its selectivity on another of its substrates, AMTBN, thus demonstrating that position 162 in the region of the active site of nitrilases is a key position involved in the selectivity of said nitrilases and that modification of the amino acid residue at this position, consisting in replacing the amino acid of origin with another amino acid, leads to a modulation of the selectivity of nitrilases.
The present invention therefore relates to a modified nitrilase with modulated selectivity, characterized in that it comprises, at position 162, an amino acid residue which is different from the amino acid residue of origin.
According to the invention, the term “modified nitrilase” is intended to mean a nitrilase which is modified relative to a nitrilase of origin, the modification consisting in replacing the amino acid residue of origin at position 162 with another amino acid.
According to the invention, the expression “modulation of the selectivity” is intended to mean a selectivity of the modified nitrilase which is different from the selectivity of the nitrilase of origin, in particular by at least 0.5% relative to the nitrilase of origin, advantageously by at least 1%.
Advantageously, residue 162 is replaced with an amino acid chosen from cysteine, alanine, valine, asparagine, glutamine, isoleucine and serine, it being understood that residue 162 of the nitrilase of origin is different from a cysteine, alanine, valine, asparagine, glutamine, isoleucine or serine, respectively.
Residue 162 is preferably replaced with a cysteine residue.
According to a particular embodiment of the invention, the modulation consists of an enhancement of the selectivity.
According to a second particular embodiment of the invention, the modulation consists of a decrease in the selectivity.
The unmodified nitrilase of origin is chosen from nitrilases of bacterial, yeast, fungal, plant or animal origin.
Among the nitrilases of bacterial origin, mention may be made, in particular, of the following nitrilases: b_RhodocJ1 of Rhodococcus rhodocrous J1 (GeneBank accession No.: D11425), b_RrhodocPA3 of Rhodococcus rhodocrous PA34 (GeneBank accession No.: E09026), b_Gterrae of Gordona terrae (GeneBank accession No.: E12616), b_RrhodocK22 of Rhodococcus rhodocrous K22 (GeneBank accession No.: D12583), b_Kozaenae of Klebsiella ozaenae (SwissProt: accession No.: P100450), b_CtestosNI1 of Comamonas testosteroni NI1 or NitA (GeneBank accession No.: L32589), and b_Afaecalis of Alcaligenes faecalis JM3 or NitB (SwissProt accession No.: P20960). Among the nitrilases of plant origin, mention may be made in particular of: p_Athalia1 to 4 of Arabidopsis thaliana (SwissProt accession No.: P32961, P32962, P46010, P46011), and p_Tobacco1 and 2 of Nicotiana tabacum (GeneBank accession No.: D63331, D83078).
Among the nitrilases of other origins, mention may be made in particular of: those of Saccharomyces cerevisiae (SwissProt accession No.: P40447 and P4044), of Caenorhabditis elegans (GeneBank accession No.: AF069986), of Drosophila melanogaster (GeneBank AF069989) of Homo sapiens (GeneBank accession No.: AF069987) and of Mus musculus (GeneBank accession No.: AF069988).
According to another embodiment of the invention, the nitrilase of origin is a nitrilase obtained by screening DNA libraries, in particular cDNA or genomic DNA from various sources, in particular DNA libraries obtained through random mutations and recombinations of nitrilases, by directed molecular evolution, or by screening a DNA library from soil or from other biotopes.
The present invention also relates to a nucleic acid sequence, in particular a DNA sequence, encoding a modified nitrilase above.
According to a first embodiment of the invention, the nucleic acid sequence according to the invention consists of the nucleic acid sequence of the nitrilase of origin, for which the codon of the residue of origin at position 162 has been replaced with a codon encoding a residue which is different from the residue of origin, in particular the codons encoding the residues alanine, valine, asparagine, glutamine, isoleucine or serine.
The codons of the sequence of origin may be modified by any means known to those skilled in the art for enhancing the enzymes defined previously, in particular by directed mutagenesis.
The present invention also relates to a chimeric gene or expression cassette, comprising, in the direction of transcription, a promoter regulatory sequence which is functional in a host organism, the nucleic acid sequence encoding a modified nitrilase according to the invention and a terminator regulatory sequence which is functional in the same host organism.
The host organism comprises any eukaryotic or prokaryotic organism, which may be differentiated or undifferentiated, in particular bacteria, yeasts, fungi, plant cells and plants.
They are in particular bacteria, for example E. coli, yeasts, in particular of the genera Saccharomyces, Kluyveromyces or Pichia, fungi, in particular of the genera Aspergillus or Penicillium, a baculovirus, or plant cells and plants.
According to the invention, the term “plant cell” is intended to mean any cell which is derived from a plant and which can constitute undifferentiated tissues such as calluses, differentiated tissues such as embryos, parts of plants, plants or seeds.
According to the invention, the term “plant” is intended to mean any differentiated multicellular organism capable of photosynthesis, in particular monocotyledons or dicotyledons, more particularly crop plants which may or may not be intended for animal or human food, such as maize, wheat, rapeseed, soybean, rice, sugar cane, beetroot, tobacco, cotton, etc.
The promoter and terminator regulatory elements are well known to those skilled in the art, depending on the host organisms.
As a regulatory sequence which is a promoter in bacteria, use may be made of any promoter regulatory sequence of a gene expressed naturally in bacteria, for example the promoter of the E. coli tryptophan operon (Denèfle et al., 1987, Gene 56: 61-70).
As a regulatory sequence which is a promoter in yeasts, use may be made of any promoter regulatory sequence of a gene expressed naturally in yeasts, for example the promoter of the S. cerevisiae Mfα1 gene or of the Kluyveromyces lactis lactase gene (van den Berg et al., 1990, Bio/Technology 8: 135-139).
As a regulatory sequence which is a promoter in fungi, use may be made of any promoter regulatory sequence of a gene expressed naturally in fungi, for example the promoter sequence of the Penicillium chrysogenum acid phosphatase gene (Graessle et al., 1997, Appl. Environ. Microbiol. 63:753-756) or the promoter sequence of the Aspergillus nidulans alcohol dehydrogenase I gene (Gwyne et al., 1989, Biochem. Soc. Trans. 17: 338-340).
As a regulatory sequence which is a promoter in plant cells and plants, use may be made of any promoter sequence of a gene expressed naturally in plants, in particular a promoter of bacterial, viral or plant origin, such as, for example, that of a gene of the ribulose-biscarboxylase/oxygenase (RuBisCO) small subunit, a histone promoter (EP 0 507 698), a rice actine promoter, or a promoter of a plant virus gene, such as, for example, that of the cauliflower mosaic virus (CAMV 19S or 35S), or a promoter inducible by pathogens, such as the tobacco PR-Ia, it being possible to use any suitable known promoter.
As a regulatory sequence which is a terminator in bacteria, use may be made of any terminator regulatory sequence of a gene expressed naturally in bacteria, for example the terminator regulatory sequence of the E. coli ribosomal RNA operon (Denèfle et al., 1987, Gene 56: 61-70).
As a regulatory sequence which is a terminator in yeasts, use may be made of any terminator regulatory sequence of a gene expressed naturally in yeasts, for example the terminator of S. cerivisiae phosphoglycerate kinase (PGK) or the terminator of Kluyveromyces lactis lactase (van den Berg et al., 1990, Bio/Technology 8: 135-139).
As a regulatory sequence which is a terminator in fungi, use may be made of any terminator regulatory sequence of a gene expressed naturally in fungi, for example the terminator regulatory sequence of the Trichoderma reesei pyruvate kinase gene (Schindler et al., 1993, Gene 130: 271-275).
As a regulatory sequence which is a terminator in plant cells or plants, use may be made of any terminator regulatory sequence of a gene expressed naturally in plants, for example the terminator of a gene of bacterial origin, such as for example the Agrobacterium tumefaciens nos terminator, of viral origin, such as for example the CaMV 35S terminator, or of plant origin, such as for example a histone terminator (EP 0 633 317).
The present invention also relates to a transformed host organism comprising a chimeric gene as defined above, in particular a host organism defined above into the genome of which the chimeric gene according to the invention has been stably integrated.
The present invention also relates to a method for producing modified nitrilases with reduced selectivity defined above, said method consisting in selectivity defined above, said method consisting in culturing the transformed host organism according to the invention and, where appropriate, in isolating the modified nitrilase, as a mixture or in a purified form.
The present invention also relates to the use of a modified nitrilase according to the invention, in a biocatalysis reaction in a method for synthesizing or degrading chemical compounds.
Finally, the present invention relates to a method for modulating nitrilase selectivity, said method comprising replacing residue 162, in a nitrilase of origin, with an amino acid residue which is different from the amino acid residue of origin. Advantageously, residue 162 is replaced by introducing, into the nucleic acid sequence encoding the unmodified nitrilase of origin, a codon encoding a residue at position 162 which is different from the codon encoding the residue of the nitrilase of origin.
Preferably, the nitrilase obtained using said modulation method is a nitrilase as defined above.
The examples below make it possible to illustrate the present invention, without seeking to limit the scope thereof.
The nitrilase activity on 2-hydroxy-4-methyl-thiobutyronitrile is measured as follows:
A culture sample with a known optical density at 660 nm (OD660) is taken and washed in 100 mM phosphate buffer, pH 7.0. Estimating the dry weight of the sample from the OD660 (one OD660 unit corresponds to a dry weight of 0.35 mg of dry cell/ml), approximately 1 mg of DC is taken up in 1 ml of 100 mM phosphate buffer, pH 7.0, and incubated in a closed 2-ml tube at 35° C. for 10 minutes. The kinetics are initiated by adding 17 μl of the solution of HMTBN at 78%, so as to achieve a concentration of 100 mM in the reaction mixture at the start of the assay. The reaction is incubated at 35° C. with stirring. Every 15 minutes, a 100 μl sample of the suspension is withdrawn and mixed with 900 μl of 100 mM H3PO4, pH 2.5, to stop the reaction. After centrifugation, the supernatant is analyzed by HPLC as described below.
The eluent is composed of HPLC-quality acetonitrile diluted in 50 mM H3PO4 (0.9 liters of 50 mM H3PO4 mixed with 0.1 liter of acetonitrile). This eluent, which is filtered and degassed, percolates through the column with a flow rate of 1 ml/min and a pressure of 140 bar. The column used is a 5 μm C18 Nucleosil column which is 250 mm in length and 4.6 mm in diameter (INTERCHIM. Ref. N5CC18-25F). The volume injected is 5 μl and the detection is performed by reading the absorbence at a wavelength of 215 nm. Under these conditions, the HMTBM, HMTBS (2-hydroxy-4-methylthiobutanoic acid) and HMTBN (2-amino-4-methyl-thiobutanamide) peaks have respective retention times of 9 min, 11 min and 15.8 min. The amounts of HMTBN, the HMTBM and the HMTBS are deduced from the measurement of the surface area of the peaks and comparison with the surface area of the peaks of a calibration mixture of known composition.
The nitrilase activity on 2-amino-4-methyl-thiobutyronitrile is measured as follows:
A cell pellet (between 0.4 and 20 mg of DC) is resuspended in 200 mM borate buffer, pH 9.2, and incubated in a closed 2-ml tube at 30° C. for 10 minutes. The kinetics are initiated by adding a solution of AMTBN in order to obtain a final concentration of 50 mM in the reaction mixture at the start of the assay. The reaction is incubated at 30° C. with stirring. Every 15 minutes, a 50 μl sample of the suspension is withdrawn and mixed with 950 μl of the HPLC eluent (see composition below) to stop the reaction. After centrifugation, the supernatant is analyzed by HPLC as described below.
The eluent is composed of 1% of HPLC-quality acetonitrile diluted in a solution of H3PO4 at 0.5% in water. This eluent, which is filtered and degassed, percolates through the column with a flow rate of 1 ml/min. The column used is a 5 μm C18 Nucleosil column which is 250 mm in length and 4.6 mm in diameter (INTERCHIM. Ref. N5CC18-25F), maintained at a temperature of 40° C. The volume injected is 20 μl and the detection is performed by reading the absorbence at a wavelength of 210 nm. Under these conditions, the AMTBM, AMTBS (2-amino-4-methylthiobutanoic acid) and AMTBN peaks have respective retention times of 4.0 min, 4.5 min and 5.0 min. The amounts of AMTBN, the AMTBM and the AMTBS are deduced from the measurement of the surface area of the peaks and comparison with the surface area of the peaks of a calibration mixture of known composition.
The other techniques used are conventional techniques of molecular biology and microbiology, known to those skilled in the art and described, for example, by Ausubel et al., 1987 (Current Protocols in Molecular Biology, John Wiley and Sons, New. York), Maniatis et al., 1982, (Molecular Cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.), Coligan et al., 1997 (Current Protocols in Protein Science, John Wiley & Sons, Inc).
FIG. 2 represents the map of plasmid pRPA-BCAT41. The sites in brackets are sites which have been eliminated during cloning. Ptrp: tryptophan promoter; nitB: nitrilase gene; TrrnB: transcription terminators; end ROP: end of the gene encoding the ROP protein (Chambers et al., 1988, Gene 68: 139-149); ORI: origin of replication; RNAI/II: RNAs involved in replication (Chambers et al., mentioned above); Tc: tetracyclin resistance gene.
The 1.27 kb fragment containing the Ptrp promoter, the ribosome binding site of the λ phage cII gene (RBScII) and the nitrilase gene of Alcaligenes faecalis ATCC8750 (nitB) was extracted from the plasmid pRPA6BCAT6 (Application FR 96/13077) using the EcoRI and XbaI restriction enzymes, in order to be cloned into the vector pXL642 (described in CIP application Ser. No. 08/194,588) opened with the same restriction enzymes. The resulting plasmid, pRPA-BCAT15, was opened with the StuI and BsmI enzymes and the 4.3 kb fragment was ligated with the 136 bp StuI-BsmI fragment purified from pRPA-BCAT4 (Application FR 96/13077), to produce the plasmid pRPA-BCAT19. The partial sequencing of pRPA-BCAT19 confirmed the replacement of the codon of the Asp279 residue of the nitrilase with the codon of an Asn279 residue. The 1.2 kb EcoRI-XbaI fragment of pRPA-BCAT19 containing the Ptrp::RBScII::nitB fusion was then cloned into the vector pRPA-BCAT28 opened with the same enzymes, to produce the 6.2 kb plasmid pRPA-BCAT29. The vector pRPA-BCAT28 was obtained by ligating the 3.9 kb SspI-ScaI fragment of pXL642 (CIP, application Ser. No. 08/194,588) with the 2.1 kb SmaI fragment of pHP45ΩTc (Fellay et al., 1987, Gene 52: 147-154) in order to replace the ampicillin resistance marker with the tetracycline resistance marker. Destruction of the NdeI site close to the origin of replication of the plasmid pRPA-BCAT29 by partial NdeI digestion and the action of E. coli Polymerase I (Klenow fragment) produced the plasmid pRPA-BCAT41, a map of which is represented in FIG. 2.
Removal of the 0.55 bp Xcm1 fragment from the plasmid pRPA-BCAT41 by Xcm1 digestion and ligation produced the plasmid pRPA-BCAT72.
The codon of cysteine 162 of the nitB gene was modified by site-directed mutagenesis using the primers NitB162 (SEQ ID NO: 1 CGCGTCGGTGCCCTGMASTGCTGGGAGC in which M=A/C and S=G/C) and SR (SEQ ID NO: 2 CGGCAATGATCAGGCCTTCGGC).
An internal 361 bp fragment was amplified by PCR reaction using the primers NitB162, and SR, the matrix pRPA-BCAT41, the Pwo polymerase (Boehringer) and the following incubation program: 5 min at 95° C., five cycles (one minute at 95° C., 1 min at 58° C., 1 min at 72° C.), 35 cycles (45 seconds at 95° C., 30 seconds at 58° C., 30 seconds at 72° C.), 5 min at 72° C.
After purification of the amplified fragment by migration on an agarose gel, and extraction of the fragment using the QIAEX gel extraction kit (Qiagen), the DNA was incubated in the presence of the StuI and BanI restriction enzymes (New England Biolabs) at 37° C. for 16 hours in a buffer recommended by the supplier. Another internal fragment, of 498 bp, was amplified in a similar manner using the primers PCRAF1 (described in Application FR 96/13072) and NitB1 (SEQ ID NO: 3 GCAGCACAGGGCACCGACGC).
After purification of the amplified fragment by migration on agarose gel, and extraction of the fragment using the QIAEX gel extraction kit (Qiagen), the DNA was incubated in the presence of the NdeI and BanI restriction enzymes (New England Biolabs) at 37° C. for 16 h in a buffer recommended by the supplier.
The vector pRPA-BCAT72 was opened with the NdeI and StuI enzymes and the 5.43 kp fragment was purified on agarose gel and extracted using the QIAEX gel extraction kit (Qiagen).
The three fragments described above were then ligated and the ligation mixture was introduced into the E. coli strain DH5alpha by electroporation. The clones obtained were analyzed by restriction with the EcoRI and XbaI enzymes in order to select plasmids having a 1.26 kb insert. After sequencing the region encompassing codon 162 of the nitrilase gene, 2 plasmids carrying the desired codon (AAC instead of TGC) were selected and named pRPA-BCAT75.
These plasmids were introduced into the E. coli strain RPA-BIOCAT496, to give the strains RPA-BIOCAT526 and 527. The RPA-BIOCAT496 strain corresponds to the W strain (ATCC9637) into which the plasmid pRPA-BCAT34 has previously been introduced. The plasmid pRPA-BCAT34 corresponds to the plasmid pXL2035 (Lévy-Schil et al., 1995, Gene 161: 15-20) into which a 475 bp fragment carrying the trpR gene encoding the regulator of the Ptrp promoter has been cloned between the EcoRI and NotI sites. This fragment was extracted from the plasmid pRPA-BCAT30, constructed by cloning into the vector pSL301 (Brosius, 1989, DNA 8: 759-777) a 434 bp AatII-StuI fragment carrying the trpR gene and its promoter extracted from the plasmid pRPG9 (Gunsalus and Yanofsky, 1980, Proc. Natl. Acad. Sci. USA 77: 7117-7121).
The RPA-BIOCAT526, RPA-BIOCAT527 and RPA-BIOCAT497 strains (corresponding to the RPA-BIOCAT496 strain into which the plasmid pRPA-BCAT41 has previously been introduced) were cultured under the conditions described in example 5 of Application FR 96/13072, with the following modifications: preculturing for 8 h, seeding at 1:50 into M9 glucose medium containing 0.4% of casamino acids, 12 μg/ml of tetracycline and 50 μg/ml of kanamycin.
The nitrilase activity of HMTBN was measured on a cell pellet washed in 100 mM potassium phosphate buffer, pH 7, as described above, using 1 mg of DC in a reaction volume of 1 ml. The selectivity of the strains was measured after 2 hours of hydrolysis, relating the surface area of the peak of amide formed to the sum of the surface areas of the peaks of amide and of acid formed. It is expressed as a percentage. The results are given in table 1:
| TABLE 1 |
| Selectivity of strains 526, 527 and 497 |
| Activity | ||
| RPA-BIOCAT | (μmol/h.mgDC1) | Selectivity |
| 497 | 65 | 0.04% |
| 526 | 76 | 0.2% |
| 527 | 65 | 0.2% |
| 1mg DC: weight of dry cells estimated from the optical density of the sample at 660 nm, OD660 (mg DC = OD660 × 0.35) |
These results show that substituting cysteine 162 with an asparagine modifies the selectivity of NitB for the hydrolysis of HMTBN.
The codon of glutamine 162 of the NitA nitrilase was modified to a cysteine codon by site-directed mutagenesis using the QuickChange™ site-directed mutagenesis kit (Stratagene).
The primers NitA 163 (SEQ ID NO. 4 GCATGTTCCCAGCAGCAGAGTCCCCCAAGATTCC) and NitA 162 (SEQ ID NO. 5 GGAATCTTGGGGGACTCTGCTGCTGGGAACATGC) were used under the conditions recommended by the supplier, on DNA of the plasmid pXL2158 (Lévy-Schil et al., 1995, Gene 161: 15-20).
The incubation program for the PCR reaction comprised 30 seconds at 95° C. and 16 cycles of 30 seconds at 95° C.-1 minute at 55° C.-12 minutes at 68° C. After digesting the DNA with DpnI and transforming E. coli XL1-BLUE competent cells (Stratagene) with 1 μl of the reaction mixture, the clones obtained were analyzed by plasmid restriction profile using the BpmI enzyme. Since the mutation introduced modifies a BpmI restriction site, five clones which have lost one of the 3 BpmI sites were selected. The plasmids which they contained were introduced, separately, into the RPA-BIOCAT496 strain, to give the strains RPA-BIOCAT570 to RPA-BIOCAT574.
The plasmid pXL2158 was introduced into the RPA-BIOCAT496 strain to give the RPA-BIOCAT575 strain. The strains RPA-BIOCAT570 to RPA-BIOCAT575 were cultured under the expression conditions described above, replacing tetracycline with ampicillin at 100 μg/ml. The nitrilase activity of these strains was assayed as described above, using 5 mg of cells (as dry weight estimated from the OD660) in a reaction volume of 1 ml and for 1 hour. The selectivity is measured by calculating the ratio of the surface area of the peak corresponding to the amide to the surface area of the peak corresponding to the acid. It is expressed as a percentage. Table 2 gives the results.
| TABLE 2 |
| Selectivity of the strains RPA-BIOCAT570 to 575 on HMTBN |
| Activity | ||
| RPA-BIOCAT | (mmol/h.g DC) | Selectivity |
| 575 | 135 | 17% |
| 570 | 8 | 4.3 |
| 571 | 8 | 4.3 |
| 572 | 4 | 4.5 |
| 573 | 7 | 4.4 |
| 574 | 4 | 4.5 |
These results show that substituting glutamine 162 of NitA with a cysteine allows a 4-fold modulation of selectivity for the hydrolysis of HMTBN.
The RPA-BIOCAT570 and RPA-BIOCAT575 strains were cultured under the expression conditions described above. The nitrilase activity of these strains was assayed using 2-amino-4-methylthiobutanenitrile or AMTBN (C5H10N2S) as substrate, at 50 mM in borate buffer, pH 9.2. The equivalent of 10 mg of RPA-BIOCAT570 cells (expressed as dry weight) and of 0.4 mg of RPA-BIOCAT575 cells (expressed as dry weight) were used at 30° C. for 24 h in a reaction volume of 1 ml. The production of AMTBS and AMTBA were measured by HPLC as described above and the selectivity was calculated in a similar manner. The results are given in table 3.
| TABLE 3 |
| Selectivity of the RPA-BIOCAT570 and 575 strains on AMTBN |
| Assay | Activity | |||
| RPA-BIOCAT | number | (mmol/h.g DC)1 | TT2 at 24 h | Selectivity |
| 575 | 1 | 43 | 98 | 6.3 |
| 575 | 2 | 50 | 100 | 5.6 |
| 570 | 3 | 1.5 | 100 | 1.0 |
| 570 | 2 | 2.7 | 97 | 0.6 |
| 1Activity measured after 30 minutes of hydrolysis | ||||
| 2TT: (initial amount of AMTBN - amount of AMTBN at 24 h/initial amount of AMTBN at 24 h/initial amount of AMTBN |
These results show that substituting glutamine 162 of NitA with cysteine allows a 4-fold modulation of selectivity on a substrate other than HMTBN, in this case AMTBN.
By sequencing the region encompassing codon 162 of the nitB gene harbored by the clones derived from the mutagenesis described in example 2, it was possible to identify clones carrying the CAG codon instead of TGC at position 162. The corresponding plasmids were named pRPA-BCAT78 and carry a nitB insert encoding a nitrilase NitB Q162, in which cysteine 162 is substituted with a glutamine. These plasmids were introduced into the E. coli strain RPA-BIOCAT496, to give the strains RPA-BIOCAT530 and 531. The RPA-BIOCAT530, RPA-BIOCAT531 and RPA-BIOCAT497 strains were cultured under the conditions described in example 3. The nitrilase activity on HMTBN was measured on a cell pellet washed in 100 mM potassium phosphate buffer, pH 7, as described in example 4 of Application FR 96/13072, using 1 mg of DC in a reaction volume of 1 ml. The selectivity of the strains was measured after 2 hours of hydrolysis, relating the molar amount of amide formed to the sum of the molar amounts of amide and of acid formed. It is expressed as a percentage. The results are given in Table 4:
| TABLE 4 |
| Selectivity of strains 530, 531 and 497 |
| Activity | ||
| RPA-BIOCAT | (μmol/h.mg DC1) | Selectivity |
| 497 | 65 | 0.04% |
| 530 | 18 | 0.2% |
| 531 | 22 | 0.2% |
| 1mg DC: weight of dry cells estimated from the optical density of the sample at 660 nm, OD660 (mg DC = OD660 × 0.35) |
These results show that substituting cysteine with a glutamine modifies the selectivity of NitB the hydrolysis of HMTBN.
1. A method for modulating nitrilase selectivity of a nitrilase enzyme chosen from the group consisting of nitrilase p Athalia 1 of Arabidopsis thaliana (SEQ ID NO: 6), nitrilase p Athalia 2 of Arabidopsis thaliana (SEQ ID NO: 7), nitrilase p Athalia 3 of Arabidopsis thaliana (SEQ ID NO: 8), nitrilase p Athalia 4 of Arabidopsis thaliana (SEQ ID NO: 12), nitrilase p Tobacco 1 of Nicotiana tabacum (SEQ ID NO: 9), nitrilase p Tobacco 2 of Nicotiana tabacum (SEQ ID NO: 10), nitrilase b RhodocJ1 of Rhodococcus rhodocrous J1 (SEQ ID NO: 13), nitrilase b RrhodoPA3 of Rhodococcus rhodocrous PA34 (SEQ ID NO: 14), nitrilase b RrhodocK22 of Rhodococcus rhodocrous K22 (SEQ ID NO: 16), nitrilase b Kozaenae of Klebsiella ozaenae (SEQ ID NO: 17) and nitrilase NitA of Comamonas testosteroni (SEQ ID NO: 18), wherein nitrilase selectivity is defined as the percentage of compounds not having a carboxylic function that are released by the nitrilase-catalyzed hydrolysis of a nitrile, comprising replacing the amino acid corresponding to position 162 of SEQ ID NO: 19 (primary sequence of nitrilase NitB of Alcaligenes faecalis) in the nitrilase with a cysteine, wherein the amino acid corresponding to position 162 of SEQ ID NO: 19 in the nitrilase prior to replacement is not cysteine.
2. The method of claim 1 wherein the percentage of compounds not having a carboxylic function that are released by the nitrilase-catalyzed hydrolysis of a nitrile is decreased.
3. The method of claim 1 wherein the nitrilase selectivity of the nitrilase NitA of Comamonas testosteroni (SEQ ID NO: 18) is modulated.