-
2005-06-28
10/152,886
2002-05-21
US 6,912,470 B2
2005-06-28
-
-
John S. Brusca
2022-05-21
Five protein families cooperate to form the warhead structure that characterizes enediyne compounds, both chromoprotein enediynes and non-chromoprotein enediynes. The protein families include a polyketide synthase and thioesterase protein which form a polyketide synthase catalytic complex involved in warhead formation in enediynes. Genes encoding a member of each of the five protein families are found in all enediyne biosynthetic loci. The genes and proteins may be used in genetic engineering applications to design new enediyne compounds and in methods to identify new enediyne biosynthetic loci.
Get notified when new applications in this technology area are published.
This application claims benefit under 35 USC § 119 of provisional applications U.S. Ser. No. 60/291,959 filed on May 21, 2001 and U.S. Ser. No. 60/334,604 filed on Dec. 3, 2001 which are hereby incorporated by reference in their entirety for all purposes.
The present invention relates to the field of microbiology, and more specifically to genes and proteins involved in the production of enediynes.
Enediyne natural products are characterized by the presence of the enediyne ring structure also referred to as the warhead. The labile enediyne ring structure undergoes a thermodynamically favorable Bergman cyclization resulting in transient formation of a biradical species. The biradical species is capable of inducing irreversible DNA damage in the cell. This reactivity gives rise to potential biological activity against both bacterial and tumor cell lines. Enediynes have potential as anticancer agents because of their ability to cleave DNA. Calicheamicin is currently in clinical trials as an anticancer agent for acute myeloid leukemia (Nabhan C. and Tallman M S, Clin Lymphoma (2002) March; 2 Suppl 1:S19-23). Enediynes also have utility as anti-infective agents. Accordingly, processes for improving production of existing enediynes or producing novel modified enediynes are of great interest to the pharmaceutical industry.
Enediynes are a structurally diverse group of compounds. Chromoprotein enediynes refer to enediynes associated with a protein conferring stability to the complex under physiological conditions. Non-chromoprotein enediynes refer to enediynes that require no additional stabilization factors. The structure of the chromoprotein enediynes neocarzinostatin and C-1027, and the non-chromoprotein enediynes calicheamicin and dynemicin are shown below with the dodecapolyene backbone forming the warhead structure in each enediyne highlighted in bold.
Efforts at discovering the genes responsible for synthesis of the warhead structure that characterizes enediynes have been unsuccessful. Genes encoding biosynthetic enzymes for the aryltetrasaccharide of calicheamicin, and for calicheamicin resistance are described in WO 00/37608. Additional genes involved in the biosynthesis of the chromoprotein enediyne C-1027 have been isolated (Liu, et al. Antimicrobial Agents and Chemotherapy, vol. 44, pp 382-292 (2000); WO 00/40596). Isotopic incorporation experiments have indicated that the enediyne backbones of esperamicin, dynemycin, and neocarzinostatin are acetate derived (Hansens, O. D. et al. J. Am. Chem Soc. 11, vol 111 pp. 3295-3299 (1989); Lam, K. et al. J. Am. Chem. Soc. vol. 115, pp 12340-12345 (1993); Tokiwa, Y et al. J. Am. Chem Soc. vol. 113 pp. 4107-4110). However, both PCR and DNA probes homologous to type I and type II PKSs have failed to identify the presence of PKS genes associated with biosynthesis of enediynes in known enediyne producing microorganisms (WO 00/40596; W. Liu & B. Shen, Antimicrobial Agents Chemotherapy, vol. 44 No. 2 pp. 382-392 (2000)).
Elucidation of the genes involved in biosynthesis of enediynes, particularly the warhead structure, would provide access to rational engineering of enediyne biosynthesis for novel drug leads and makes it possible to construct overproducing strains by de-regulating the biosynthetic machinery. Elucidation of PKS genes involved in the biosynthesis of enediynes would contribute to the field of combinatorial biosynthesis by expanding the repertoire of PKS genes available for making novel enediynes via combinatorial biosynthesis.
Existing screening methods for identifying enediyne-producing microbes are laborious, time-consuming and have not provided sufficient discrimination to date to detect organisms producing enediyne natural products at low levels. There is a need for improved tools to detect enediyne-producing organisms. There is also a need for tools capable of detecting organisms that produce enediynes at levels that are not detected by traditional culture tests.
One embodiment of the present invention is an isolated, purified or enriched nucleic acid comprising a sequence selected from the group consisting of: (a) SEQ ID NOS: 2, 14, 24, 34, 44, 54, 64, 74, 84, 94; sequences complementary to SEQ ID NOS: 2, 14, 24, 34, 44, 54, 64, 74, 84, 94; fragments comprising 2000, preferably 3000, more preferably 4000, still more preferably 5000, still more preferably 5600 and most preferably 5750 consecutive nucleotides of SEQ ID NOS: 2, 14, 24, 34, 44, 54, 64, 74, 84, 94; and fragments comprising 2000, preferably 3000, more preferably 4000, still more preferably 5000, still more preferably 5600 and most preferably 5750 consecutive nucleotides of the sequences complementary to SEQ ID NOS: 2, 14, 24, 34, 44, 54, 64, 74, 84, 94; (b) SEQ ID NOS: 4, 6, 16, 26, 36, 46, 56, 66, 76, 86, 96; sequences complementary to SEQ ID NOS: 4, 6, 16, 26, 36, 46, 56, 66, 76, 86, 96; fragments comprising 150, preferably 200, more preferably 250, still more preferably 300, still more preferably 350 and most preferably 400 consecutive nucleotides of the sequences complementary to SEQ ID NOS: 4, 6, 16, 26, 36, 46, 56, 66, 76, 86, 96; and fragments comprising 150, preferably 200, more preferably 250, still more preferably 300, still more preferably 350 and most preferably 400 consecutive nucleotides of the sequences complementary to SEQ ID NOS: 4, 6, 16, 26, 36, 46, 56, 66, 76, 86, 96; (c) SEQ ID NOS: 8, 18, 28, 38, 48, 58, 68, 78, 88, 98; sequences complementary to SEQ ID NOS: 8, 18, 28, 38, 48, 58, 68, 78, 88, 98; fragments comprising 700, preferably 750, more preferably 800, still more preferably 850, still more preferably 900 and most preferably 950 consecutive nucleotides of SEQ ID NOS: 8, 18, 28, 38, 48, 58, 68, 78, 88, 98; and fragments comprising 700, preferably 750, more preferably 800, still more preferably 850, still more preferably 900 and most preferably 950 consecutive nucleotides of the sequences complementary to SEQ ID NOS: 8, 18, 28, 38, 48, 58, 68, 78, 88, 98; (d) SEQ ID NOS: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100; sequences complementary to SEQ ID NOS: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100; fragments comprising 600, preferably 700, more preferably 750, still more preferably 800, still more preferably 850 and most preferably 900 consecutive nucleotides of SEQ ID NOS: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, and fragments comprising 600, preferably 700, more preferably 750, still more preferably 800, still more preferably 850 and most preferably 900 consecutive nucleotides of SEQ ID NOS: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, and (e) SEQ ID NOS: 12, 22, 32, 42, 52, 62, 72, 82, 92, 102; sequences complementary to SEQ ID NOS: 12, 22, 32, 42, 52, 62, 72, 82, 92, 102; fragments comprising 700, preferably 750, more preferably 800, still more preferably 850, still more preferably 900 and most preferably 950 consecutive nucleotides of the sequences complementary to SEQ ID NOS: 12, 22, 32, 42, 52, 62, 72, 82, 92, 102; and fragments comprising 700, preferably 750, more preferably 800, still more preferably 850, still more preferably 900 and most preferably 950 consecutive nucleotides of SEQ ID NOS: 12, 22, 32, 42, 52, 62, 72, 82, 92, 102. One aspect of the present invention is an isolated, purified or enriched nucleic acid capable of hybridizing to the nucleic acid of this embodiment under conditions of high stringency. Another aspect of the present invention is an isolated, purified or enriched nucleic acid capable of hybridizing to the nucleic acid of this embodiment under conditions of moderate stringency. Another aspect of the present invention is an isolated, purified or enriched nucleic acid capable of hybridizing to the nucleic acid of this embodiment under low stringency. Another aspect of the present invention is an isolated, purified or enriched nucleic acid having at least 70% homology to the nucleic acid of this embodiment by analysis with BLASTN version 2.0 with the default parameters. Another aspect of the present invention is an isolated, purified or enriched nucleic acid having at least 99% homology to the nucleic acid of this embodiment as determined by analysis with BLASTN version 2.0 with the default parameters.
Another embodiment is an isolated, purified or enriched nucleic acid that encodes an enediyne polyketide synthase protein comprising a polypeptide selected from the group consisting of: (a) SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93; (b) polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83 or 93 during synthesis a warhead structure in an enediyne compound; and (c) fragments of the polypeptides of (a) and (b), which fragments have the ability to substitute for a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 in the synthesis of the warhead structure in an enediyne compound. In one aspect of this embodiment, the nucleic acid encoding an enediyne polyketide synthase protein may be used in genetic engineering applications to synthesize the warhead structure of an enediyne compound.
Another embodiment is an isolated, purified or enriched nucleic acid that encodes an enediyne polyketide synthase catalytic complex comprising (a) a polypeptide selected from the group consisting of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93; polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83 or 93 during synthesis a warhead structure in an enediyne compound; and fragments thereof, which fragments have the ability to substitute for a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 in the synthesis of the warhead structure in an enediyne compound; and (b) a polypeptide selected from the group consisting of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95; polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95 during synthesis of a warhead structure in an enediyne compound; and fragments thereof, which fragments have the ability to substitute for a polypeptide of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95 in the synthesis of the warhead structure in an enediyne compound. In one aspect of this embodiment, the nucleic acid encoding an enediyne polyketide synthase catalytic complex may be used in genetic engineering application to synthesize the warhead structure of an enediyne compound.
Another embodiment is an isolated, purified or enriched nucleic acid encoding a gene cassette comprising: (a) a nucleic acid encoding an enediyne polyketide synthase catalytic complex as described above, and (b) at least one nucleic acid encoding a polypeptide selected from the group consisting of (i) SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97, polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97 during synthesis of a warhead structure in an enediyne compound; and fragments thereof, which fragments have the ability to substitute for a polypeptide of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97 in the synthesis of the warhead structure in an enediyne compound; (ii) SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99; polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99 during synthesis of a warhead structure in an enediyne compound; and fragments thereof, which fragments have the ability to substitute for a polypeptide of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99 in the synthesis of the warhead structure in an enediyne compound; and (iii) SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101; polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101 during synthesis of a warhead structure in an enediyne compound; and fragments thereof, which fragments have the ability to substitute for a polypeptide of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101 in the synthesis of the warhead structure in an enediyne compound. In one aspect of this embodiment, the nucleic acid encoding the gene cassette may be used in genetic engineering application to synthesize the warhead structure of an enediyne compound.
Another embodiment is an isolated, purified or enriched nucleic acid encoding a gene cassette comprising: (a) a nucleic acid encoding a polypeptide selected from the group consisting of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93; a polypeptide having at least 75% homology to a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83 or 93 during synthesis a warhead structure in an enediyne compound; or a fragment thereof, which fragment has the ability to substitute for a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 in the synthesis of the warhead structure in an enediyne compound; (b) at least one nucleic acid encoding a polypeptide selected from the group consisting of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95; a polypeptide having at least 75% homology to a polypeptide of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95 during synthesis of a warhead structure in an enediyne compound; or a fragment thereof, which fragment has the ability to substitute for a polypeptide of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95 in the synthesis of the warhead structure in an enediyne compound; (c) at least one nucleic acid encoding a polypeptide selected from the group consisting of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97; a polypeptide having at least 75% homology to a polypeptide of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97 during synthesis of a warhead structure in an enediyne compound; and a fragment thereof, which fragment has the ability to substitute for a polypeptide of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97 in the synthesis of the warhead structure in an enediyne compound; (d) at least one nucleic acid encoding a polypeptide selected from SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99; a polypeptide having at least 75% homology to a polypeptide of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99 during synthesis of a warhead structure in an enediyne compound; and a fragment thereof, which fragment has the ability to substitute for a polypeptide of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99 in the synthesis of the warhead structure in an enediyne compound; and (e) at least one nucleic acid encoding a polypeptide selected from SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101; a polypeptide having at least 75% homology to a polypeptide of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101 during synthesis of a warhead structure in an enediyne compound; and a fragment thereof, which fragment has the ability to substitute for a polypeptide of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101 in the synthesis of the warhead structure in an enediyne compound. In one aspect of this embodiment, the nucleic acid encoding the gene cassette may be used in genetic engineering application to synthesize the warhead structure of an enediyne compound.
Another embodiment of the present invention is an isolated or purified polypeptides comprising a sequence selected from the group consisting of: (a) SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 and fragments comprising 1300, preferably 1450, more preferably 1550, still more preferably 1650, still more preferably 1750 and most preferably 1850 consecutive amino acids of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93; (b) SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95; and fragments comprising 40, preferably 60, more preferably 80, still more preferably 100, still more preferably 120 and most preferably 130 consecutive amino acids of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95; (c) SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97; and fragments comprising 220, preferably 240, more preferably 260, still more preferably 280, still more preferably 300 and most preferably 310 consecutive amino acids of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97; (d) SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99; and fragments comprising 520, preferably 540, more preferably 560, still more preferably 580, still more preferably 600 and most preferably 620 consecutive amino acids of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99; and (e) SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101; and fragments comprising 220, preferably 240, more preferably 260, still more preferably 280, still more preferably 300 and most preferably 320 consecutive amino acids of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91 and 101. One aspect of the present invention is an isolated or purified polypeptide having at least 70% homology to the polypeptide of this embodiment by analysis with BLASTP algorithm with the default parameters. Another aspect of the present invention is an isolated or purified polypeptide having at least 99% homology to the polypeptides of this embodiment as determined by analysis with BLASTP algorithm with the default parameters.
Another embodiment is an isolated or purified enediyne polyketide synthase comprising a polypeptide selected from the group consisting of (a) SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93; (b) polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83 or 93 during synthesis a warhead structure in an enediyne compound; and (c) fragments of the polypeptides of (a) and (b), which fragments have the ability to substitute for a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 in the synthesis of the warhead structure in an enediyne compound. In one aspect of this embodiment, the enediyne polyketide synthase protein may be used in genetic engineering applications to synthesize the warhead structure of an enediyne compound.
Another embodiment is an isolated, purified enediyne polyketide synthase catalytic complex comprising (a) a polypeptide selected from the group consisting of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93, polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83 or 93 during synthesis a warhead structure in an enediyne compound; and fragments thereof, which fragments have the ability to substitute for a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 in the synthesis of the warhead structure in an enediyne compound; and (b) a polypeptide selected from the group consisting of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95; polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95 during synthesis of a warhead structure in an enediyne compound; and fragments thereof, which fragments have the ability to substitute for a polypeptide of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95 in the synthesis of the warhead structure in an enediyne compound. In one aspect of this embodiment, the enediyne polyketide synthase catalytic complex may be used in genetic engineering applications to synthesize the warhead structure of an enediyne compound.
In another embodiment, the invention is a polypeptide selected from the group consisting of: (a) SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97; (b) polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97 during synthesis of a warhead structure in an enediyne compound, and (c) fragments of (a) or (b), which fragments have the ability to substitute for a polypeptide of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97 in the synthesis of the warhead structure in an enediyne compound. In one aspect, the polypeptide of this embodiment may be used with an enediyne polyketide synthase catalytic complex of the invention in genetic engineering applications to synthesize the warhead structure of an enediyne compound.
In another embodiment, the invention is a polypeptide selected from the group consisting of (a) SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99; (b) polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99 during synthesis of a warhead structure in an enediyne compound; and (c) fragments of (a) or (b), which fragments have the ability to substitute for a polypeptide of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99 in the synthesis of the warhead structure in an enediyne compound. In one aspect, the polypeptide of this embodiment may be used with an enediyne polyketide synthase catalytic complex of the invention in genetic engineering applications to synthesize the warhead structure of an enediyne compound.
In another embodiment, the invention is a polypeptide selected from the group consisting of (a) SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101; (b) polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for a polypeptide of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101 during synthesis of a warhead structure in an enediyne compound; and (c) fragments of (a) or (b), which fragments have the ability to substitute for a polypeptide of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101 in the synthesis of the warhead structure in an enediyne compound. In one aspect of this embodiment, the polypeptide of this embodiment may be used with an enediyne polyketide synthase catalytic complex of the invention in genetic engineering applications to synthesize the warhead structure of an enediyne compound.
An enediyne gene cluster may be identified using compositions of the invention such as hybridization probes or PCR primers Hybridization probes or PCR primers according to the invention are derived from protein families associated with the warhead structure characteristic of enediynes. To identify enediyne gene clusters, the hybridization probes or PCR primers are derived from any one or more nucleic acid sequences corresponding to the five protein families designated herein as PKSE, TEBC, UNBL, UNBV and UNBU. The compositions of the invention are used as probes to identify enediyne biosynthetic genes, enediyne gene fragments, enediyne gene clusters, or enediyne producing organisms from samples including potential enediyne producing microorganisms The samples may be in the form of environmental biomass, pure or mixed microbial culture, isolated genomic DNA from pure or mixed microbial culture, genomic DNA libraries from pure or mixed microbial culture. The compositions are used in polymerase chain reaction, and nucleic acid hybridization techniques well known to those skilled in the art.
Environmental samples that harbour microorganisms with the potential to produce enediynes are identified by PCR methods. Nucleic acids contained within the environmental sample are contacted with primers derived from the invention so as to amplify target orthosomycin biosynthetic gene sequences. Environmental samples deemed to be positive by PCR are then pursued to identify and isolate the enediyne gene cluster and the microorganism that contains the target gene sequences. The enediyne gene cluster may be identified by generating genomic DNA libraries (for example, cosmid, BAC, etc.) representative of genomic DNA from the population of various microorganisms contained within the environmental sample, locating genomic DNA clones that contain the target sequences and possibly overlapping clones (for example, by hybridization techniques or PCR), determining the sequence of the desired genomic DNA clones and deducing the ORFs of the enediyne biosynthetic locus. The microorganism that contains the enediyne biosynthetic locus may be identified and isolated, for example, by colony hybridization using nucleic acid probes derived from either the invention or the newly identified enediyne biosynthetic locus. The isolated enediyne biosynthetic locus may be introduced into an appropriate surrogate host to achieve heterologous production of the enediyne compound(s); alternatively, if the microorganism containing the enediyne biosynthetic locus is identified and isolated it may be subjected to fermentation to produce the enediyne compound(s).
A microorganism that harbours an enediyne gene cluster is first identified and isolated as a pure culture, for example, by colony hybridization using nucleic acid probes derived from the invention. Beginning with a pure culture, a genomic DNA library (for example, cosmid, BAC, etc.) representative of genomic DNA from this single species is prepared, genomic DNA clones that contain the target sequences and possibly overlapping clones are located using probes derived from the invention (for example, by hybridization techniques or PCR), the sequence of the desired genomic DNA clones is determined and the ORFs of the enediyne biosynthetic locus are deduced. The microorganism containing the enediyne biosynthetic locus may be subjected to fermentation to produce the enediyne compound(s) or the enediyne biosynthetic locus may be introduced into an appropriate surrogate host to achieve heterologous production of the enediyne compound(s).
An enediyne gene cluster may also be identified in silico using one or more sequences selected from enediyne-specific nucleic acid code, and enediyne-specific polypeptide code as taught by the invention. A query from a set of query sequences stored on computer readable medium is read and compared to a subject selected from the reference sequences of the invention. The level of similarity between said subject and query is determined and queries sequences representing enediyne genes are identified.
Thus another embodiment of the invention is a method of identifying an enediyne biosynthetic gene or gene fragment comprising providing a sample containing genomic DNA, and detecting the presence of a nucleic acid sequence coding for a polypeptide from at least one or the groups consisting of: (a) SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93; and polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 as determined using the BLASTP algorithm with the default parameters; (b) SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95; and polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95 as determined using the BLASTP algorithm with the default parameters; (c) SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97; and polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97as determined using the BLASTP algorithm with the default parameters; (d) SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99; and polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99 as determined using the BLASTP algorithm with the default parameters; and (e) SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101; and polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91 and 101 as determined using the BLASTP algorithm with the default parameters. One aspect of this embodiment provides detecting a nucleic acid sequence coding a polypeptide from at least two of the above groups (a), (b), (c), (d) and (e). Another aspect of this embodiment provides detecting a nucleic acid sequence coding a polypeptide from at least three of the groups (a), (b), (c), (d) and (e). Another aspect of this embodiment provides detecting a nucleic acid sequence coding a polypeptide from at least four of the groups (a), (b), (c), (d) and (e). Another aspect of this embodiment provides detecting a nucleic acid sequence coding a polypeptide from each of the groups (a), (b), (c), (d) and (e). Another aspect of this embodiment of the invention provide the further step of using the nucleic acid detected to isolate an enediyne gene cluster from the sample containing genomic DNA. Another aspect of this embodiment of the invention comprises identifying an organism containing the nucleic acid sequence detected from the genomic DNA in the sample.
It is understood that the invention, having provided, compositions and methods to identify enediyne biosynthetic gene cluster, further provides enediynes produced by the biosynthetic gene clusters identified.
FIG. 1 is a block diagram of a computer system which implements and executes software tools for the purpose of comparing a query to a subject, wherein the subject is selected from the reference sequences of the invention.
FIGS. 2A, 2B, 2C and 2D are flow diagrams of a sequence comparison software that can be employed for the purpose of comparing a query to a subject, wherein the subject is selected from the reference sequences of the invention, wherein FIG. 2A is the query initialization subprocess of the sequence comparison software, FIG. 2B is the subject datasource initialization subprocess of the sequence comparison software, FIG. 2C illustrates the comparison subprocess and the analysis subprocess of the sequence comparison software, and FIG. 2D is the Display/Report subprocess of the sequence comparison software.
FIG. 3 is a flow diagram of the comparator algorithm (238) of FIG. 2C which is one embodiment of a comparator algorithm that can be used for pairwise determination of similarity between a query/subject pair.
FIG. 4 is a flow diagram of the analyzer algorithm (244) of FIG. 2C which is one embodiment of an analyzer algorithm that can be used to assign identity to a query sequence, based on similarity to a subject sequence, where the subject sequence is a reference sequence of the invention.
FIG. 5 is a schematic representation comparing the calicheamicin enediyne biosynthetic locus from Micromonospora echinospora subsp. calichensis (CALI), the macromomycin (auromomycin) enediyne biosynthetic locus from Streptomyces macromycetius (MACR), and a chromoprotein enediyne biosynthetic locus from Streptomyces ghanaensis (009C). Open reading frames in each locus are identified by boxes; gray boxes indicate ORFs that are not common to the three enediyne loci, black boxes indicate ORFs that are common to the three enediyne loci and are labeled using a four-letter protein family designation. The scale is in kilobases.
FIG. 6 illustrates the 5 genes conserved throughout ten enediyne biosynthetic loci from diverse genera, including both chromoprotein and non-chromoprotein enediyne loci.
FIG. 7 is a graphical depiction of the domain architecture typical of enediyne polyketide synthases (PKSE).
FIG. 8 is an amino acid clustal alignment of enediyne polyketide synthase (PKSE) sequences from ten enediyne biosynthetic loci, wherein the sequences aligned are SEQ ID NO: 1 (residues 1-1936) representing the PKSE from Streptomyces macromycetius (MACR); SEQ ID NO: 13 (residues 1-1919) representing the PKSE from Micromonospora echinospora subsp. calichensis (CALI), SEQ ID NO: 23 (residues 1-1956) representing the PKSE from Streptomyces ghanaensis (009C), SEQ ID NO: 33 (residues 1-1977) representing the PKSE from Streptomyces carzinostaticus subsp. neocarzinostatius (NEOC), SEQ ID NO: 43 (residues 1-1939) representing the PKSE from Amycolatopsis orientalis ATOC 43491 (007A), SEQ ID NO: 53 (residues 1-1958) representing the PKSE from Kitasatosporia sp. (028D), SEQ ID NO: 63 (residues 1-1927) representing the PKSE from Micromonospora megalomicea (054A), SEQ ID NO: 73 (residues 1-1892) representing the PKSE from Saccharothrix aerocolonigenes (132H), SEQ ID NO: 83 (residues 1-1933) representing the PKSE from Streptomyces kaniharaenais (135E) and SEQ ID NO: 93 (residues 1-1958) representing the PKSE from Streptomyces citricolor (145B). Approximate domain boundaries are indicated above the alignment. Conserved residues or motifs important for the function of each domain are highlighted in black.
FIG. 9a is an amino acid clustal alignment of acyl carrier protein (ACP) domains in enediyne polyketide synthase (PKSE) proteins, namely SEQ ID NO: 1 (residues 939-1009) of the PKSE of macromomycin from Streptomyces macromyceticus (MACR), SEQ ID NO: 33 (residues 975-1046) of the PKSE of neocazinostatin from Streptomyces carzinostaticus subsp. neocarzinostaticus (NEOC), SEQ ID NO: 13 (residues 939-1009) of calicheamicin from Micromonospora echinospora subsp. calichensis (CALI), and the publicly available ACP domain of the actinorhodin Type II PKS system (1AF8). FIG. 9b depicts the space-filling side-chains of the conserved residues on the three dimensional structure of the ACP of the actinorhodin Type II PKS system (1AF8).
FIG. 10 is an amino acid clustal alignment sequences of 4′-phosphopantetheinyl transferase (PPTE) domains in enediyne polyketide synthase (PKSE) proteins, namely SEQ ID NO: 33 (residues 1620-1977) of neocazinostatin from Streptomyces carzinostaticus subsp. neocarzinostaticus (NEOC), SEQ ID NO: 1 (residues 1582-1936) of macromomycin from Streptoniyces macromyceticus (MACR), SEQ ID NO: 13 (residues 1582-1919) of calicheamicin from Micromonospora echinospora subsp. calichensis (CALI) and the publicly available 4′-phosphopantetheinyl transferase of Bacillus subtilis (Sfp). Conserved residues are boxed. The known secondary structure of Sfp is shown below the aligned sequences and the predicted secondary structure of the PPTE domain of the PKSE is shown above the aligned sequences wherein the boxes indicate α-helices and the arrows indicate β-sheets. FIG. 10B shows how the conserved residues of the 4′-phosphopantetheinyl transferase Sfp co-ordinate a magnesium ion and coenzyme A; corresponding residues in the neocarzinostatin PPTE domain are shown in bold.
FIG. 11 is an amino acid clustal alignment of the publicly available 4-hydroxybenzoyl-CoA thioesterase (1BVQ) of Pseudomonas sp. strain CBS-3 (superimposed with secondary structure of 1BVQ), and eleven enediyne thioesterase (TEBC) proteins, namely SEQ ID NO: 3 (residues 1-162) and SEQ ID NO: 5 (residues 1-157) both of macromomycin from Streptomyces macromyceticus (MACR), SEQ ID NO: 15 (residues 1-148) of calicheamicin from Micromonospora echinospora subsp. calichensis (CALI), SEQ ID NO: 25 (residues 1-152) from Streptomyces ghanaensis (009C), SEQ ID NO: 35 (residues 1-153) of neocazinostatin from Streptomyces carzinostaticus subsp. neocarzinostaticus (NEOC), SEQ ID NO: 45 (residues 1-146) from Amycolatopsis orientalis (007A), SEQ ID NO: 55 (residues 1-158) from Kitasatosporia sp. (028D), SEQ ID NO: 65 (residues 1-154) from Micromonospora megalomicea (054A), SEQ ID NO: 75 (residues 1-143) from Saccharothrix aerocolonigenes (132H), SEQ ID NO: 85 (residues 1-154) from Streptomyces kaniharaensis (135E) and SEQ ID NO: 95 (residues 1-165) from Streptomyces citricolor (145B) Alpha-helices (α) and beta-sheets (β) are depicted by arrows.
FIG. 12 is an amino acid clustal alignment of ten enediyne UNBL proteins, namely SEQ ID NO: 7 (residues 1-327) of macromomycin from Streptomyces macromyceticus (MACR), SEQ ID NO: 17 (residues 1-322) of calicheamicin from Micromonospora echinospora subsp. calichensis (CALI), SEQ ID NO: 27 (residues 1-329) from Streptomyces ghanaensis (009C), SEQ ID NO: 37 (residues 1-328) of neocazinostatin from Streptomyces carzinostaticus subsp. neocarzinostaticus (NEOC), SEQ ID NO: 47 (residues 1-324) from Amycolatopsis orientalis ATCC 43491 (007A), SEQ ID NO: 57 (residues 1-327) of Kitasatosporia sp. (028D), SEQ ID NO: 67 (residues 1-322) from Micromonospora megalomicea (054A), SEQ ID NO: 77 (residues 1-313) from Saccharothrix aerocolonigenes (132H), SEQ ID NO: 87 (residues 1-323) from Streptomyces kaniharaensis (135E) and SEQ ID NO: 97 (residues 1-324) from Streptomyces citricolor (145B). Areas of high conservation are shown in the bottom line of the alignment.
FIG. 13 is an amino acid clustal alignment of ten enediyne UNBV proteins, namely SEQ ID NO: 9 (residues 1-642) of macromomycin from Streptomyces macromyceticus (MACR), SEQ ID NO: 19 (residues 1-651) of calicheamicin from Micromonospora echinospora subsp. calichensis (CALI), SEQ ID NO: 29 (residues 1-636) from Streptomyces ghanaensis (009C), SEQ ID NO: 39 (residues 1-636) of neocazinostatin from Streptomyces carzinostaticus subsp. neocarzinostaticus (NEOC), SEQ ID NO: 49 (residues 1-654) from Amycolatopsis orientalis ATCC 43491 (007A), SEQ ID NO: 59 (residues 1-676) of Kitasatosporia sp. (028D), SEQ ID NO: 69 (residues 1-659) from Micromonospora megalomicea (054A), SEQ ID NO: 79 (residues 1-647) from Saccharothrix aerocolonigenes (132H), SEQ ID NO: 89 (residues 1-655) from Streptomyces kaniharaensis (135E) and SEQ ID NO: 99 (1-659) from Streptomyces citricolor (145B). The putative N-terminal signal sequence that targets these proteins for secretion is highlighted.
FIG. 14 is an amino acid clustal alignment of enediyne UNBU proteins from ten enedyine biosynthetic loci, namely SEQ ID NO: 11 (residues 1-433) of macromomycin from Streptomyces macromyceticus (MACR), SEQ ID NO: 21 (residues 1-321) of calicheamicin from Micromonospora echinospora subsp. calichensis (CALI), SEQ ID NO: 31 (residues 1-382) from Streptomyces ghanaensis (009C), SEQ ID NO: 41 (residues 1-364) of neocazinostatin from Streptomyces carzinostaticus subsp. neocarzinostaticus (NEOC), SEQ ID NO: 51 (residues 1-329) from Amycolatopsis orientalis ATCC 43491 (007A), SEQ ID NO: 61 (residues 1-338) of Kitasatosporia sp. (028D), SEQ ID NO: 71 (residues 1-354) from Micromonospora megalomicea (054A), SEQ ID NO: 81 (residues 1-336) from Saccharothrix aerocolonigenes (132H), SEQ ID NO: 91 (residues 1-346) from Streptomyces kaniharaensis (135E) and SEQ ID NO: 101 (residues 1-337) from Streptomyces citricolor (145B). The putative transmembrane domains that anchor this family of proteins within the cell membrane are highlighted.
FIG. 15 shows restriction site and functional maps of plasmids pECO1202-CALI-1 and pECO1202-CALI-4 of the invention. The open reading frames of the genes forming an expression cassette according to the invention are shown as arrows pointing in the direction of transcription.
FIG. 16 shows restriction site and functional maps of plasmids pECO1202-CALI-5, pECO1202-CALI-2, pECO1202-CALI-3, pECO1202-CALI-6 and pECO1202-CALI-7. The open reading frames of the genes forming the expression cassette according to the invention are shown as arrows pointing in the direction of transcription.
FIG. 17 is an immunoblot analysis of His-tagged TEBC protein in total protein extracts from recombinant S. lividans TK24 clones harboring the pECO1202-CALI-2 or the pECO1202-CALI-4 expression vector.
FIG. 18 is an immunoblot analysis of His-tagged TEBC protein in fractionated extracts from recombinant S. lividans TK24 clones harboring the pECO1202-CALI-2 expression vector.
The invention provides enediyne related compositions. The compositions can be used to produce enediyne-related compounds. The compositions can also be used to identify enediyne natural products, enediyne genes, enediyne gene clusters and enediyne producing organisms. The invention rests on the surprising discovery that all enediynes, including chromoprotein enediynes and non-chromoprotein enediynes, use a conserved set of genes for formation of the warhead structure.
To provide the compositions and methods of the invention, a sample of the microorganism Streptomyces macromyceticus was obtained and the biosynthetic locus for the chromoprotein enediyne macromomycin was identified. The gene cluster was identified as the biosynthetic locus for macromomycin from Streptomyces macromyceticus NRRL B-5335 (sometimes referred to herein as MACR), firstly by confirming the sequence encoding the apoprotein associated with the chromoprotein, which sequence is disclosed in Samy T S et al., J. Biol. Chem (1983) January 10; 258(1) pp. 183-91, and secondly using the genome scanning procedure disclosed in co-pending application U.S. Ser. No. 09/910,813.
A sample of the microorganism Micromonospora echinospora subsp. calichensis was then obtained and the full biosynthetic locus for the non-chromoprotein enediyne calicheamicin was identified. The gene cluster was identified as the biosynthetic locus for calicheamicin from Micromonospora echinospora subsp. calichensis NRRL 15839 (sometimes referred to herein as CALI) by comparing the sequence with the partial locus for CALI which was disclosed in WO 00/40596. We were able to overcome the problems encountered in prior attempts to isolate and clone the entire biosynthetic locus by using a shotgun-based approach as described in co-pending application U.S. Ser. No. 09/910,813.
We identified two further enediyne natural products biosynthetic loci from organisms not previously reported to produce enediyne compounds, namely a chromoprotein enediyne from Streptomyces ghanaensis NRRL B-12104 (sometimes referred to herein as 009C), and a chromoprotein enediyne from Amycolatopsis orientalis ATCC 43491 (sometimes referred to herin as 007A). The presence of an apoprotein encoding gene in 009C and 007A confirms that 009C and 007A produce chromoprotein enediyne compounds.
Comparison of the MACR, CALI, 009C and 007A loci revealed that all loci contain at least one a member of five (5) protein families. The five protein families are referred to throughout the description and figures by reference to a four-letter designation as indicated Table 1.
| TABLE 1 |
| Family descriptions |
| Families | Function |
| PKSE | unusual polyketide synthase, found only in enediyne biosynthetic loci and involved in |
| warhead formation; believed to act iteratively. | |
| TEBC | thioesterase unique to enediyne biosynthetic loci, significant similarity to small (130-150 aa) |
| proteins of the 4-hydroxybenzoyl-CoA thioesterase family in a number of bacteria. | |
| UNBL | unique to enediyne biosynthetic loci, these proteins are rich in basic amino acids and |
| contain several conserved or invariant histidine residues. | |
| UNBV | unique to enediyne biosynthetic loci, secreted proteins, contain putative cleavable N- |
| terminal signal sequence, believed to be associated with stabilization and/or export of the | |
| enediyne chromophore and/or late modifications in the biosynthesis of enediyne | |
| chromophores. | |
| UNBU | unique to enediyne biosynthetic loci, C-terminal domain homology to bacterial putative ABC |
| transporters and permease transport systems, integral membrane proteins with seven or | |
| eight putative membrane-spanning alpha helices, believed to be involved in transport of | |
| enediynes and/or intermediates across the cell membrane. | |
A member of each of the five protein families was found in each of the more than ten biosynthetic loci for chromoprotein and non-chromoprotein enediynes studied. Two of the five protein families, PKSE and TEBC, form a polyketide synthase catalytic complex involved in formation of the warhead structure that distinguishes enediyne compounds. The other three protein families conserved throughout chromoprotein and non-chromoprotein enediyne biosynthetic loci are also associated with the warhead structure that characterizes enediyne compounds. Nucleic acid sequences and polypeptide sequences related to these five protein families form the basis for the compositions and methods of the invention.
We have discovered at least one member of each of the protein families PKSE, TEBC, UNBL, UNBV and UNBU in all of the 10 enediyne biosynthetic loci studied, including MACR, CALI, 009C, 007A, an enediyne biosynthetic locus from Kitasatosporia sp. (sometimes referred to herein as 028D), an enediyne biosynthetic locus from Micromonospora megalomicea (sometimes referred to herein as 054A), an enediyne biosynthetic locus from Saccharothrix aerocolonigenes (sometimes referred to herein as 132H), an enediyne biosynthetic locus from Streptomyces kaniharaensis (sometimes referred to herein as 135E), an enediyne biosynthetic locus from Streptomyces citricolor (sometimes referred to herein as 145B), and the biosynthetic locus for the chromoprotein enediyne neocarzinostatin from Streptomyces carzinostaticus (sometimes referred to herein as NEOC).
The protein families PKSE, TEBC, UNBL, UNBV and UNBU of the present invention are associated with warhead formation in enediyne compounds and are found in both chromoprotein and non-chromoprotein enediyne biosynthetic loci. Members of the protein families PKSE, TEBC, UNBL, UNBV and UNBU found within an enediyne biosynthetic loci are necessarily present in a single operon and are therefore not necessarily transcriptionally linked to one another. However, the members of the protein families PKSE, TEBC, UNBL, UNBV and UNBU that are found within a single enediyne biosynthetic locus are functionally linked to one another in that they act in a concerted fashion in the production of an enediyne product. Although expression of functionally linked enediyne specific genes encoding members of the PKSE, TEBC, UNBL, UNBV and UNBU protein families may be under control of distinct transcriptional promoters, they may nonetheless be expressed in a concerted fashion.
Due to high overall sequence conservation between members of the PKSE, TEBC, UNBL, UNBV and UNBU protein families, it is expected that members of the PKSE, TEBC, UNBL, UNBV and UNBU protein families may be exchanged for another member of the same protein family while retaining the ability of the new enediyne biosynthetic system to synthesize the warhead structure of an enediyne compound. Thus, it is contemplated that genes encoding a polypeptide from protein families PKSE, TEBC, UNBL, UNBV and UNBU from two or more different enediyne biosynthetic systems may be combined so as to obtain a full complement of the five-gene enediyne cassette of the invention, wherein one or more genes in the enediyne cassette has inherent or engineered optimal properties.
Representative nucleic acid sequences and polypeptide sequences drawn from each of the ten enediyne loci described herein are provided in the accompanying sequence listing as examples of the compositions of the invention. Referring to the sequence listing, a nucleic acid sequence encoding a member of the PKSE protein family of the invention from the biosynthetic locus for macromomycin from Streptomyces macromyceticus (MACR) is provided in SEQ ID NO: 2, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 1. Nucleic acid sequences encoding two members of the TEBC protein family from MACR are provided in SEQ ID NOS: 4 and 6 with the corresponding deduced polypeptide sequences provided in SEQ ID NOS: 3 and 5 respectively. A nucleic acid sequence encoding a member of the UNBL protein family from MACR is provided in SEQ ID NO: 8 with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 7. A nucleic acid sequence encoding a member of the protein family UNBV from MACR is provided in SEQ ID NO: 10 with the corresponding deduced polypeptide provided in SEQ ID NO: 9. A nucleic acid sequence encoding a member of the protein family UNBU from MACR is provided in SEQ ID NO: 12 with the corresponding deduced polypeptide provided in SEQ ID NO: 11.
A nucleic acid sequence encoding a member of the PKSE protein family of the invention from the biosynthetic locus for calicheamicin from Micromonospora echinospora subsp calichensis (CALI) is provided in SEQ ID NO: 14, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 13 A nucleic acid sequence encoding a member of the TEBC protein family from CALI is provided in SEQ ID NO: 16, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 15. A nucleic acid sequence encoding a member of the UNBL protein family from CALI is provided in SEQ ID NO: 18, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 17. A nucleic acid sequence encoding a member of the UNBV protein family from CALI is provided in SEQ ID NO: 20, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 19. A nucleic acid sequence encoding a member of the UNBU protein family from CALI is provided in SEQ ID NO: 22, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 21.
A nucleic acid sequence encoding a member of the PKSE protein family of the invention from the enediyne biosynthetic locus from Streptomyces ghanaensis (009C) is provided in SEQ ID NO: 24, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 23. A nucleic acid sequence encoding a member of the TEBC protein family from 009C is provided in SEQ ID NO: 26, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 25. A nucleic acid sequence encoding a member of the UNBL protein family from 009C is provided in SEQ ID NO: 28, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 27. A nucleic acid sequence encoding a member of the UNBV protein family from 009C is provided in SEQ ID NO: 30, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 29. A nucleic acid sequence encoding a member of the UNBU protein family from 009C is provided in SEQ ID NO: 32, with the corresponding deduced polypeptide sequence provided in SEQ: ID NO: 31.
A nucleic acid sequence encoding a member of the PKSE protein family of the invention from the biosynthetic locus for neocazinostatin from Streptomyces carzinostaticus subsp. neocarzinostaticus (NEOC) is provided in SEQ ID NO: 34, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 33. A nucleic acid sequence encoding a member of the TEBC protein family from NEOC is provided in SEQ ID NO: 36, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 35. A nucleic acid sequence encoding a member of the UNBL protein family from NEOC is provided in SEQ ID NO: 38, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 37. A nucleic acid sequence encoding a member of the UNBV protein family from NEOC is provided in SEQ ID NO: 40, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 39. A nucleic acid sequence encoding a member of the UNBU protein family from NEOC is provided in SEQ ID NO: 42, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 41.
A nucleic acid sequence encoding a member of the PKSE protein family of the invention from the enediyne biosynthetic locus from Amycolatopsis orientalis (007A) is provided in SEQ ID NO: 44, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 43. A nucleic acid sequence encoding a member of the TEBC protein family from 007A is provided in SEQ ID NO: 46, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 45. A nucleic acid sequence encoding a member of the UNBL protein family from 007A is provided in SEQ ID NO: 48, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 47 A nucleic acid sequence encoding a member of the UNBV protein family from 007A is provided in SEQ ID NO: 50, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 49. A nucleic acid sequence encoding a member of the UNBU protein family from 007A is provided in SEQ ID NO: 52, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 51.
A nucleic acid sequence encoding a member of the PKSE protein family of the invention from the enediyne biosynthetic locus from Kitasatosporia sp. (028D) is provided in SEQ ID NO: 54, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 53. A nucleic acid sequence encoding a member of the TEBC protein family from 028D is provided in SEQ ID NO: 56, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 55. A nucleic acid sequence encoding a member of the UNBL protein family from 028D is provided in SEQ ID NO: 58, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 57. A nucleic acid sequence encoding a member of the UNBV protein family from 028D is provided in SEQ ID NO: 60, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 59. A nucleic acid sequence encoding a member of the UNBU protein family from 028D is provided in SEQ ID NO: 62, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 61.
A nucleic acid sequence encoding a member of the PKSE protein family of the invention from the enediyne biosynthetic locus from Micromonospora megalomicea (054A) is provided in SEQ ID NO: 64, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 63. A nucleic acid sequence encoding a member of the TEBC protein family from 054A is provided in SEQ ID NO: 66, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 65. A nucleic acid sequence encoding a member of the UNBL protein family from 054A is provided in SEQ ID NO: 68, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 67. A nucleic acid sequence encoding a member of the UNBV protein family from 054A is provided in SEQ ID NO: 70, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 69. A nucleic acid sequence encoding a member of the UNBU protein family from 054A is provided in SEQ ID NO: 72, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 71.
A nucleic acid sequence encoding a member of the PKSE protein family of the invention from the enediyne biosynthetic locus from Saccharothrix aerocolonigenes (132H) is provided in SEQ ID NO: 74, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 73. A nucleic acid sequence encoding a member of the TEBC protein family from 132H is provided in SEQ ID NO: 76, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 75. A nucleic acid sequence encoding a member of the UNBL protein family from 132H is provided in SEQ ID NO: 78, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 77. A nucleic acid sequence encoding a member of the UNBV protein family from 132H is provided in SEQ ID NO: 80, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 79. A nucleic acid sequence encoding a member of the UNBU protein family from 132H is provided in SEQ ID NO: 82, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 81.
A nucleic acid sequence encoding a member of the PKSE protein family of the invention from the enediyne biosynthetic locus from Streptomyces kaniharaensis (135E) is provided in SEQ ID NO: 84, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 83. A nucleic acid sequence encoding a member of the TEBC protein family from 135E is provided in SEQ ID NO: 86, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 85. A nucleic acid sequence encoding a member of the UNBL protein family from 135E is provided in SEQ ID NO: 88, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 87. A nucleic acid sequence encoding a member of the UNBV protein family from 135E is provided in SEQ ID NO: 90, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 89. A nucleic acid sequence encoding a member of the UNBU protein family from 135E is provided in SEQ ID NO: 92, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 91.
A nucleic acid sequence encoding a member of the PKSE protein family of the invention from the enediyne biosynthetic locus from Streptomyces citricolor (145B) is provided in SEQ ID NO: 94, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 93. A nucleic acid sequence encoding a member of the TEBC protein family from 145B is provided in SEQ ID NO: 96, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 95. A nucleic acid sequence encoding a member of the UNBL protein family from 145B is provided in SEQ ID NO: 98, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 97. A nucleic acid sequence encoding a member of the UNBV protein family from 145B is provided in SEQ ID NO: 100, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 99. A nucleic acid sequence encoding a member of the UNBU protein family from 145B is provided in SEQ ID NO: 102, with the corresponding deduced polypeptide sequence provided in SEQ ID NO: 101.
As used herein, PKSE refers to a family of polyketide synthase proteins that are uniquely associated with enediyne biosynthetic loci and that are involved in synthesis of the warhead structure that characterizes enediyne compounds. Representative members of the protein family PKSE include the polypeptides of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, and 93. Other members of protein family PKSE include polypeptides having at least 75%, preferably 80%, more preferably, 85% still more preferably 90% and most preferably 95% or more homology to a polypeptide having the sequence of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 as determined using the BLASTP algorithm with the default parameters and having the ability to substitute for another PKSE protein and retaining the ability to act in a concerted fashion with a TEBC protein during synthesis of a warhead structure of an enediyne compound. Other members of the protein family PKSE include fragments, analogs and derivatives of the above polypeptides, which fragments, analogs and derivatives have the ability to substitute for another PKSE protein and retain the ability to act in a concerted fashion with TEBC during synthesis of a warhead structure of an enediyne compound.
TEBC refers to a family of thioesterase proteins unique to enediyne biosynthesis which together with a protein from the protein family PKSE forms an enediyne polyketide catalytic complex and is involved in synthesis of a warhead structure that characterizes enediyne compounds. Representative members of the protein family TEBC include the polypeptides of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, and 95. Other members of protein family TEBC include polypeptides having at least 75%, preferably 80%, more preferably, 85% still more preferably 90% and most preferably 95% or more homology to a polypeptide having the sequence of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, and 95 as determined using the BLASTP algorithm with the default parameters and retaining the ability to act in a concerted fashion with a protein from the protein family PKSE during synthesis of a warhead structure in an enediyne compound. Other members of the protein family TEBC include fragments, analogs and derivatives of the above polypeptides, which fragments, analogs and derivatives have the ability to substitute for another TEBC protein and retain the ability to act in a concerted fashion with a PKSE protein during formation of a warhead structure in an enediyne compound.
UNBL refers to a family of proteins indicative of enediyne biosynthetic loci and which are rich in basic amino acids and contain several conserved or invariant histidine residues Representative members of the protein family UNBL include the polypeptides of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87 and 97. Other members of protein family UNBL include polypeptides having at least 75%, preferably 80%, more preferably, 85% still more preferably 90% and most preferably 95% or more homology to a polypeptide having the sequence of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87 and 97 as determined using the BLASTP algorithm with the default parameters and that are present in a gene cluster associated with the biosynthesis of an enediyne compound. Other members of the protein family UNBL include fragments, analogs and derivatives of the above polypeptides, which fragments, analogs and derivatives have the ability to substitute for another UNBL protein and retain the ability to act in a concerted fashion with genes in an enediyne biosynthetic locus to form a warhead structure of an enediyne compound.
UNBV refers to a family of proteins indicative of enediyne biosynthetic loci and which may contain a cleavable N-terminal signal sequence Representative members of the protein family UNBV include the polypeptides of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89 and 99. Other members of protein family UNBV include polypeptides having at least 75%, preferably 80%, more preferably, 85% still more preferably 90% and most preferably 95% or more homology to a polypeptide having the sequence of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89 and 99 as determined using the BLASTP algorithm with the default parameters and that are present in a gene cluster associated with the biosynthesis of an enediyne compound. Other members of the protein family UNBV include fragments, analogs and derivatives of the above polypeptides, which fragments, analogs and derivatives have the ability to substitute for another UNBV protein and retain the ability to act in a concerted fashion with genes in an enediyne biosynthetic locus to form a warhead structure in an enediyne compound.
UNBU refers to a family of membrane proteins indicative of enediyne biosynthetic loci. Representative members of the protein family UNBU include the polypeptides of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91 and 101. Other members of protein family UNBU include polypeptides having at least 75%, preferably 80%, more preferably, 85% still more preferably 90% and most preferably 95% or more homology to a polypeptide having the sequence of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91 and 101 as determined using the BLASTP algorithm with the default parameters and that are present in a gene cluster associated with the biosynthesis of an enediyne compound. Other members of the protein family UNBU include fragments, analogs and derivatives of the above polypeptides, which fragments, analogs and derivatives have the ability to substitute for another UNBU protein and retain the ability to act in a concerted fashion with genes in an enediyne biosynthetic locus to form the warhead structure in an enediyne compound.
“Enediyne producer” or “enediyne-producing organism” refers to a microorganism which carries the genetic information necessary to produce an enediyne compound, whether or not the organism is known to produce an enediyne product. The terms apply equally to organisms in which the genetic information to produce an enediyne compound is found in the organism as it exists in its natural environment, and to organisms in which the genetic information is introduced by recombinant techniques. For the sake of particularity, specific organisms contemplated herein include organisms of the family Micromonosporaceae, of which preferred genera include Micromonospora, Actinoplanes and Dactylosporangium; the family Streptomycetaceae, of which preferred genera include Streptomyces and Kitasatospora; the family Pseudonocardiaceae, of which preferred genera are Amycolatopsis and Saccharopolyspora; and the family Actinosynnemataceae, of which preferred genera include Saccharothrix and Actinosynnema; however the terms are intended to encompass all organisms containing genetic information necessary to produce an enediyne compound.
“Enediyne biosynthetic gene product” refers to any enzyme involved in the biosynthesis of an enediyne, whether a chromoprotein enediyne or a non-chromoprotein enediyne. These gene products are located in any enediyne biosynthetic locus in an organism of the family Micromonosporaceae, of which preferred genera include Micromonospora, Actinoplanes and Dactylosporangium; the family Streptomycetaceae, of which preferred genera include Streptomyces and Kitasatospora; the family Pseudonocardiaceae, of which preferred genera are Amycolatopsis and Saccharopolyspora. For the sake of particularity, the enediyne biosynthetic loci described herein are associated with Streptomyces macromyceticus, Micromonospora echinospora subsp. calichensis, Streptomyces ghanaensis, Streptomyces carzinostaticus subsp. neocarzinostaticus, Amycolatopsis orientalis, Kitasatosporia sp., Micromonospora megalomicea, Saccharothrix aerocolonigenes, Streptomyces kaniharaensis, and Streptomyces citricolor; however, it should be understood that this term encompasses enediyne biosynthetic enzymes (and genes encoding such enzymes) isolated from any microorganism of the genus Streptomyces, Micromonospora, Amycolatopsis, Kitesatosporia, or Saccharithrix and furthermore that these genes may have novel homologues in any microorganism, actinomycete or non-actinomycete, that falls within the scope of the claims stated herein Specific embodiments include the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101.
The term “isolated” means that the material is removed from its original environment, e.g. the natural environment if it is naturally occurring. For example, a naturally-occurring polynucleotide or polypeptide present in a living organism is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
The term “purified” does not require absolute purity; rather, it is intended as a relative definition. Individual nucleic acids obtained from a library have been conventionally purified to electrophoretic homogeneity. The purified nucleic acids of the present invention have been purified from the remainder of the genomic DNA in the organism by at least 104 to 106 fold. However, the term “purified” also includes nucleic acids which have been purified from the remainder of the genomic DNA or from other sequences in a library or other environment by at least one order of magnitude, preferably two or three orders of magnitude, and more preferably four or five orders of magnitude.
“Recombinant” means that the nucleic acid is adjacent to “backbone” nucleic acid to which it is not adjacent in its natural environment. “Enriched” nucleic acids represent 5% or more of the number of nucleic acid inserts in a population of nucleic acid backbone molecules. “Backbone” molecules include nucleic acids such as expression vectors, self-replicating nucleic acids, viruses, integrating nucleic acids, and other vectors or nucleic acids used to maintain or manipulate a nucleic acid of interest. Preferably, the enriched nucleic acids represent 15% or more, more preferably 50% or more, and most preferably 90% or more, of the number of nucleic acid inserts in the population of recombinant backbone molecules.
“Recombinant polypeptides” or “recombinant proteins” refers to polypeptides or proteins produced by recombinant DNA techniques, i.e. produced from cells transformed by an exogenous DNA construct encoding the desired polypeptide or protein “Synthetic” polypeptides or proteins are those prepared by chemical synthesis.
The term “gene” means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as, where applicable, intervening regions (introns) between individual coding segments (exons).
The term “operon” means a transctional gene cassette under the control of a single transcriptional promoter, which gene cassette encodes polypeptides that may act in a concerted fashion to carry out a biochemical pathway and/or cellular process.
A DNA or nucleotide “coding sequence” or “sequence encoding” a particular polypeptide or protein, is a DNA sequence which is transcribed and translated into a polypeptide or protein when placed under the control of appropriate regulatory sequences.
“Oligonucleotide” refers to a nucleic acid, generally of at least 10, preferably 15 and more preferably at least 20 nucleotides, preferably no more than 100 nucleotides, that are hybridizable to a genomic DNA molecule, a cDNA molecule, or an mRNA molecule encoding a gene, mRNA, cDNA or other nucleic acid of interest.
A promoter sequence is “operably linked to” a coding sequence recognized by RNA polymerase which initiates transcription at the promoter and transcribes the coding sequence into mRNA.
“Plasmids” are designated herein by a lower case p followed by capital letters and/or numbers. The starting plasmids herein are commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described herein are known in the art and will be apparent to the skilled artisan.
“Digestion” of DNA refers to enzymatic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinary skilled artisan. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37° C. are ordinarily used, but may vary in accordance with the suppliers instructions. After digestion, gel electrophoresis may be performed to isolate the desired fragment.
Two deposits have been made with the International Depositary Authority of Canada, Bureau of Microbiology, Health Canada, 1015 Arlington Street, Winnipeg, Manitoba, Canada R3E 3R2 on Apr. 3, 2002. The first deposit is an E. coli DH10B strain harbouring a cosmid clone (020CN) of a partial biosynthetic locus for macromomycin from Streptomyces macromyceticus, including open reading frames coding for the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9 and 11, which deposit was assigned deposit accession number IDAC030402-1. The second deposit is an E. coli DH10B strain harbouring a cosmid clone (061CR) of a partial biosynthetic locus for calicheamicin from Micromonospora echinospora subsp. calichensis, including open reading frames coding for the polypeptides of SEQ ID NOS: 13, 15, 17, 19, and 21, which deposit was assigned accession number IDAC 030402-2. The E. coli strain deposits are referred to herein as “the deposited strains”.
The deposited strains comprise a member from each of the protein families PKSE, TEBC, UNBL, UNBV and UNBU drawn from a chromoprotein enediyne biosynthetic locus (macromomycin) and a member from each of the protein families PKSE, TEBC, UNBL, UNBV and UNBU drawn from a non-chromoprotein enediyne biosynthetic locus (calicheamicin). The sequence of the polynucleotides comprised in the deposited strains, as well as the amino acid sequence of any polypeptide encoded thereby are controlling in the event of any conflict with any description of sequences herein.
The deposit of the deposited strains has been made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for Purposes of Patent Procedure. The deposited strains will be irrevocably and without restriction or condition released to the public upon the issuance of a patent. The deposited strains are provided merely as convenience to those skilled in the art and are not an admission that a deposit is required for enablement, such as that required under 35 U.S C. §112. A license may be required to make, use or sell the deposited strains or nucleic acids therein, and compounds derived therefrom, and no such license is hereby granted.
Representative nucleic acid sequences encoding members of the five protein families are provided in the accompanying sequence listing as SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102. Representative polypeptides representing members of the five protein families are provided in the accompanying sequence listing as SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101.
One aspect of the present invention is an isolated, purified, or enriched nucleic acid comprising one of the sequences of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, the sequences complementary thereto, or a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400 or 500 consecutive bases of one of the sequences of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102 or the sequences complementary thereto. The isolated, purified or enriched nucleic acids may comprise DNA, including cDNA, genomic DNA, and synthetic DNA. The DNA may be double stranded or single stranded, and if single stranded may be the coding or non-coding (anti-sense) strand. Alternatively, the isolated, purified or enriched nucleic acids may comprise RNA.
As discussed in more detail below, the isolated, purified or enriched nucleic acids of one of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102 may be used to prepare one of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100 or 100 consecutive amino acids of one of the polypeptides of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101.
Accordingly, another aspect of the present invention is an isolated, purified or enriched nucleic acid which encodes one of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100 or 150 consecutive amino acids of one of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101. The coding sequences of these nucleic acids may be identical to one of the coding sequences of one of the nucleic acids of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, or a fragment thereof or may be different coding sequences which encode one of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100 or 150 consecutive amino acids of one of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 as a result of the redundancy or degeneracy of the genetic code. The genetic code is well known to those of skill in the art and can be obtained, for example, from Stryer, Biochemistry, 3rd edition, W. H. Freeman & Co., New York.
The isolated, purified or enriched nucleic acid which encodes one of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, may include, but is not limited to: (1) only the coding sequences of one of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102; (2) the coding sequences of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102 and additional coding sequences, such as leader sequences or proprotein sequences; or (3) the coding sequences of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102 and non-coding sequences, such as introns or non-coding sequences 5′ and/or 3′ of the coding sequence. Thus, as used herein, the term “polynucleotide encoding a polypeptide” encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
The invention relates to polynucleotides based on SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102 but having polynucleotide changes that are “silent”, for example changes which do not alter the amino acid sequence encoded by the polynucleotides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102. The invention also relates to polynucleotides which have nucleotide changes which result in amino acid substitutions, additions, deletions, fusions and truncations of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101. Such nucleotide changes may be introduced using techniques such as site directed mutagenesis, random chemical mutagenesis, exonuclease III deletion, and other recombinant DNA techniques.
The isolated, purified or enriched nucleic acids of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, the sequences complementary thereto, or a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400 or 500 consecutive bases of one of the sequence of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, or the sequences complementary thereto may be used as probes to identify and isolate DNAs encoding the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 respectively.
For example, a genomic DNA library may be constructed from a sample microorganism or a sample containing a microorganism capable of producing an enediyne. The genomic DNA library is then contacted with a probe comprising a coding sequence or a fragment of the coding sequence, encoding one of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or a fragment thereof under conditions which permit the probe to specifically hybridize to sequences complementary thereto. In one embodiment, the probe is an oligonucleotide of about 10 to about 30 nucleotides in length designed based on a nucleic acid of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102. Genomic DNA clones which hybridize to the probe are then detected and isolated. Procedures for preparing and identifying DNA clones of interest are disclosed in Ausubel et al., Current Protocols in Molecular Biology, John Wiley 503 Sons, Inc 1997; and Sambrook et al., Molecular Cloning A Laboratory Manual 2d Ed., Cold Spring Harbor Laboratory Press, 1989. In another embodiment, the probe is a restriction fragments or a PCR amplified nucleic acid derived from SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102.
The isolated, purified or enriched nucleic acids of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, the sequences complementary thereto, or a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400 or 500 consecutive bases of one of the sequences of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, or the sequences complementary thereto may be used as probes to identify and isolate related nucleic acids. In some embodiments, the related nucleic acids may be genomic DNAs (or cDNAs) from potential enediyne producers. In one embodiment, isolated, purified or enriched nucleic acids of SEQ ID NOS: 2, 14, 24, 34, 44, 54, 64, 74, 84, 94 the sequences complementary thereto, or a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400 or 500 consecutive bases of one of the sequences of SEQ ID NOS: 2, 14, 24, 34, 44, 54, 64, 74, 84, 94 or the sequences complementary thereto may be used as probes to identify and isolate related nucleic acids. In such procedures, a nucleic acid sample containing nucleic acids from a potential enediyne-producer is contacted with the probe under conditions which permit the probe to specifically hybridize to related sequences. The nucleic acid sample may be a genomic DNA (or cDNA) library from the potential enediyne-producer. Hybridization of the probe to nucleic acids is then detected using any of the methods known in the art, including those referred to herein.
Hybridization may be carried out under conditions of low stringency, moderate stringency or high stringency. As an example of nucleic acid hybridization, a polymer membrane containing immobilized denatured nucleic acids is first prehybridized for 30 minutes at 45° C. in a solution consisting of 0.9 M NaCl, 50 mM NaH2PO4, pH 7.0, 5.0 mM Na2EDTA, 0.5% SDS, 10× Denhardt's, and 0.5 mg/ml polyriboadenylic acid. Approximately 2×107 cpm (specific activity 4-9×108 cpm/ug) of 32P end-labeled oligonucleotide probe are then added to the solution. After 12-16 hours of incubation, the membrane is washed for 30 minutes at room temperature in 1×SET (150 mM NaCl, 20 mM Tris hydrochloride, pH 7.8, 1 mM Na2EDTA) containing 0.5% SDS, followed by a 30 minute wash in fresh 1×SET at Tm−10 C for the oligonucleotide probe where Tm is the melting temperature. The membrane is then exposed to auto-radiographic film for detection of hybridization signals.
By varying the stringency of the hybridization conditions used to identify nucleic acids, such as genomic DNAs or cDNAs, which hybridize to the detectable probe, nucleic acids having different levels of homology to the probe can be identified and isolated. Stringency may be varied by conducting the hybridization at varying temperatures below the melting temperatures of the probes. The melting temperature of the probe may be calculated using the following formulas
For oligonucleotide probes between 14 and 70 nucleotides in length the melting temperature (Tm) in degrees Celcius may be calculated using the formula: Tm=81.5+16.6(log [Na+])+0.41(fraction G+C)−(600/N) where N is the length of the oligonucleotide.
If the hybridization is carried out in a solution containing formamide, the melting temperature may be calculated using the equation Tm=81.5+16.6(log [Na+])+0.41(fraction G+C)−(0.63% formamide)−(600/N) where N is the length of the probe.
Prehybridization may be carried out in 6×SSC, 5× Denhardt's reagent, 0.5% SDS, 0.1 mg/ml denatured fragmented salmon sperm DNA or 6×SSC, 5× Denhardt's reagent, 0.5% SDS, 0.1 mg/ml denatured fragmented salmon sperm DNA, 50% formamide. The composition of the SSC and Denhardt's solutions are listed in Sambrook et al., supra.
Hybridization is conducted by adding the detectable probe to the hybridization solutions listed above. Where the probe comprises double stranded DNA, it is denatured by incubating at elevated temperatures and quickly cooling before addition to the hybridization solution. It may also be desirable to similarly denature single stranded probes to eliminate or diminish formation of secondary structures or oligomerization. The filter is contacted with the hybridization solution for a sufficient period of time to allow the probe to hybridize to cDNAs or genomic DNAs containing sequences complementary thereto or homologous thereto. For probes over 200 nucleotides in length, the hybridization may be carried out at 15-25° C. below the Tm. For shorter probes, such as oligonucleotide probes, the hybridization may be conducted at 5-10° C. below the Tm. Preferably, the hybridization is conducted in 6×SSC, for shorter probes. Preferably, the hybridization is conducted in 50% formamide containing solutions, for longer probes.
All the foregoing hybridizations would be considered to be examples of hybridization performed under conditions of high stringency.
Following hybridization, the filter is washed for at least 15 minutes in 2×SSC, 0.1% SDS at room temperature or higher, depending on the desired stringency. The filter is then washed with 0.1×SSC, 0.5% SDS at room temperature (again) for 30 minutes to 1 hour.
Nucleic acids which have hybridized to the probe are identified by autoradiography or other conventional techniques.
The above procedure may be modified to identify nucleic acids having decreasing levels of homology to the probe sequence. For example, to obtain nucleic acids of decreasing homology to the detectable probe, less stringent conditions may be used. For example, the hybridization temperature may be decreased in increments of 5° C. from 68° C. to 42° C. in a hybridization buffer having a Na+ concentration of approximately 1 M. Following hybridization, the filter may be washed with 2×SSC, 0.5% SDS at the temperature of hybridization. These conditions are considered to be “moderate stringency” conditions above 50° C. and “low stringency” conditions below 50° C. A specific example of “moderate stringency” hybridization conditions is when the above hybridization is conducted at 55° C. A specific example of “low stringency” hybridization conditions is when the above hybridization is conducted at 45° C.
Alternatively, the hybridization may be carried out in buffers, such as 6×SSC, containing formamide at a temperature of 42° C. In this case, the concentration of formamide in the hybridization buffer may be reduced in 5% increments from 50% to 0% to identify clones having decreasing levels of homology to the probe. Following hybridization, the filter may be washed with 6×SSC, 0.5% SDS at 50° C. These conditions are considered to be “moderate stringency” conditions above 25% formamide and “low stringency” conditions below 25% formamide A specific example of “moderate stringency” hybridization conditions is when the above hybridization is conducted at 30% formamide. A specific example of “low stringency” hybridization conditions is when the above hybridization is conducted at 10% formamide.
Nucleic acids which have hybridized to the probe are identified by autoradiography or other conventional techniques.
For example, the preceding methods may be used to isolate nucleic acids having a sequence with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% homology to a nucleic acid sequence selected from the group consisting of the sequences of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases thereof, and the sequences complementary thereto. Homology may be measured using BLASTN version 2.0 with the default parameters. For example, the homologous polynucleotides may have a coding sequence which is a naturally occurring allelic variant of one of the coding sequences described herein. Such allelic variant may have a substitution, deletion or addition of one or more nucleotides when compared to the nucleic acids of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, or the sequences complementary thereto.
Additionally, the above procedures may be used to isolate nucleic acids which encode polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, or at least 70% homology to a polypeptide having the sequence of one of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof as determined using the BLASTP version 2.2.2 algorithm with default parameters.
Structural features common to the biosynthesis of all enediyne compounds require one or more proteins selected from a group of 5 specific protein families, namely PKSE, TEBC, UNBL, UNBV and UNBU. Thus, a polypeptide representing a member of any one of these five protein families or a polynucleotide encoding a polypeptide representing a member of any one of these five protein families is considered indicative of an enediyne gene cluster, a enediyne natural product or an enediyne producing organism. It is not necessary that a member of each of the five protein families considered indicative of an enediyne compound be detected to identify an enediyne biosynthetic locus and an enediyne-producing organism. Rather, the presence of at least one, preferably two, more preferably three, still more preferably four, and most preferably five of the protein families PKSE, TEBC, UNBV and UNBU indicates the presence of an enediyne natural product, an enediyne biosynthetic locus or an enediyne producing organism.
To identify an enediyne natural product, an enediyne gene cluster or an enediyne-producing organism, nucleic acids from cultivated microorganisms or from an environmental sample, e.g soil, potentially harboring an organism having the genetic capacity to produce an enediyne compound may be contacted with a probe based on nucleotide sequences coding a member of the five protein families PKSE, TEBC, UNBL, UNBV and UNBU.
In such procedures, nucleic acids are obtained from cultivated microorganisms or from an environmental sample potentially harboring an organism having the genetic capacity to produce an enediyne compound. The nucleic acids are contacted with probes designed based on the teachings and compositions of the invention under conditions which permit the probe to specifically hybridize to any complementary sequences indicative of the presence of a member of the PKSE, TEBC, UNBL, UNBV and UNBU protein families of the invention. The presence of at least one, preferably two, more preferably three, still more preferably 4 or 5 of the PKSE, TEBC, UNBL, UNBV and UNBU protein families indicates the presence of an enediyne gene cluster or an enediyne producing organism
Diagnostic nucleic acid sequences encoding members of the PKSE, TEBC, UNBL, UNBV and UNBU protein families for identifying enediyne genes, biosynthetic loci, and microorganisms that harbor such genes or gene clusters may be employed on complex mixtures of microorganisms such as those from environmental samples (e.g., soil). A mixture of microorganisms refers to a heterogeneous population of microorganisms consisting of more than one species or strain. In the absence of amplification outside of its natural habitat, such a mixture of microorganisms is said to be uncultured. A cultured mixture of microorganisms may be obtained by amplification or propagation outside of its natural habitat by in vitro culture using various growth media that provide essential nutrients. However, depending on the growth medium used, the amplification may preferentially result in amplification of a sub-population of the mixture and hence may not be always desirable If desired, a pure culture representing a single species or strain may obtained from either a cultured or uncultured mixture of microorganisms by established microbiological techniques such as serial dilution followed by growth on solid media so as to isolate individual colony forming units.
Enediyne biosynthetic genes and/or enediyne biosynthetic gene clusters may be identified from either a pure culture or cultured or uncultured mixtures of microorganisms employing the diagnostic nucleic acid sequences disclosed in this invention by experimental techniques such as PCR, hybridization, or shotgun sequencing followed by bioinformatic analysis of the sequence data. The identification of one or more members of the protein families PKSE, TEBC, UNBL, UNBV and UNBU or enediyne gene clusters including one or more members of the protein families PKSE, TEBC, UNBL, UNBV and UNBU in a pure culture of a single organism directly distinguishes such an enediyne-producer. The identification of one or more members of the protein families PKSE, TEBC, UNBL, UNBV and UNBU or enediyne gene clusters including one or more members of the protein families PKSE, TEBC, UNBL, UNBV and UNBU in a cultured or uncultured mixture of microorganisms requires further steps to identify and isolate the microorganism(s) that harbor(s) them so as to obtain pure cultures of such microorganisms.
By way of example, the colony lift technique (Ausubel et al., Current Protocols in Molecular Biology, John Wiley 503 Sons, Inc. 1997; and Sambrook et al., Molecular Cloning: A Laboratory Manual 2d Ed., Cold Spring Harbor Laboratory Press, 1989) may be used to to identify microorganisms that harbour enediyne genes and/or enediyne biosynthetic loci from a cultured mixture of microorganisms. In such a procedure, the mixture of microorganisms is grown on an appropriate solid medium. The resulting colony forming units are replicated on a solid matrix such as a nylon membrane. The membrane is contacted with detectable diagnostic nucleic acid sequences, the positive colony forming units are identified, and the corresponding colony forming units on the original medium are identified, purified, and amplified.
Nucleic acids encoding a member of the protein families PKSE, TEBC, UNBL, UNBV and UNBU may be used to survey a number of environmental samples for the presence of organisms that have the potential to produce enediyne compounds, i.e., those organisms that contain enediyne biosynthetic genes and/or an enediyne biosynthetic locus. One protocol for use of a survey to identify polypeptides encoded by DNA isolated from uncultured mixtures of microorganisms is outlined in Seow et al. (1997) J. Bacteriol. Vol. 179 pp. 7360-7368.
Where necessary, conditions which permit the probe to specifically hybridize to complementary sequences from an enediyne-producer may be determined by placing a probe based on a member of the protein families PKSE, TEBC, UNBL, UNBV and UNBU in contact with complementary sequences obtained from an enediyne-producer as well as control sequences which are not from an enediyne-producer. In some analyses, the control sequences may be from organisms related to enediyne-producers. Alternatively, the control sequences are not related to enediyne-producers. Hybridization conditions, such as the salt concentration of the hybridization buffer, the formamide concentration of the hybridization buffer, or the hybridization temperature, may be varied to identify conditions which allow the probe to hybridize specifically to nucleic acids from enediyne-producers.
If the sample contains nucleic acids from enediyne-producers, specific hybridization of the probe to the nucleic acids from the enediyne-producer is then detected. Hybridization may be detected by labeling the probe with a detectable agent such as a radioactive isotope, a fluorescent dye or an enzyme capable of catalyzing the formation of a detectable product. Many methods for using the labeled probes to detect the presenceof nucleic acids in a sample are familiar to those skilled in the art. These include Southern Blots, Northern Blots, colony hybridization procedures, and dot blots.
Another aspect of the present invention is an isolated or purified polypeptide comprising the sequence of one of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof. As discussed above, such polypeptides may be obtained by inserting a nucleic acid encoding the polypeptide into a vector such that the coding sequence is operably linked to a sequence capable of driving the expression of the encoded polypeptide in a suitable host cell For example, the expression vector may comprise a promoter, a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for modulating expression levels, an origin of replication and a selectable marker.
Promoters suitable for expressing the polypeptide or fragment thereof in bacteria include the E. coli lac or trp promoters, the lacl promoter, the lacZ promoter, the T3 promoter, the T7 promoter, the gpt promoter, the lambda PR promoter, the lambda PL promoter, promoters from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), and the acid phosphatase promoter. Fungal promoters include the α factor promoter. Eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, heat shock promoters, the early and late SV40 promoter, LTRs from retroviruses, and the mouse metallothionein-I promoter. Other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses may also be used.
Mammalian expression vectors may also comprise an origin of replication, any necessary ribosome binding sites, a polyadenylation site, splice donors and acceptor sites, transcriptional termination sequences, and 5′ flanking nontranscribed sequences. In some embodiments, DNA sequences derived from the SV40 splice and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
Vectors for expressing the polypeptide or fragment thereof in eukaryotic cells may also contain enhancers to increase expression levels. Enhancers are cis-acting elements of DNA, usually from about 10 to about 300 bp in length that act on a promoter to increase its transcription. Examples include the SV40 enhancer on the late side of the replication origin bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adenovirus enhancers
In addition, the expression vectors preferably contain one or more selectable marker genes to permit selection of host cells containing the vector. Examples of selectable markers that may be used include genes encoding dihydrofolate reductase or genes conferring neomycin resistance for eukaryotic cell culture, genes conferring tetracycline or ampicillin resistance in E coli, and the S. cerevisiae TRP1 gene.
In some embodiments, the nucleic acid encoding one of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof is assembled in appropriate phase with a leader sequence capable of directing secretion of the translated polypeptides or fragments thereof. Optionally, the nucleic acid can encode a fusion polypeptide in which one of the polypeptide of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof is fused to heterologous peptides or polypeptides, such as N-terminal identification peptides which impart desired characteristics such as increased stability or simplified purification or detection.
The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is ligated to the desired position in the vector following digestion of the insert and the vector with appropriate restriction endonucleases. Alternatively, appropriate restriction enzyme sites can be engineered into a DNA sequence by PCR. A variety of cloning techniques are disclosed in Ausbel et al. Current Protocols in Molecular Biology, John Wiley 503 Sons, Inc. 1997 and Sambrook et al., Molecular Cloning: A Laboratory Manual 2d Ed., Cold Spring Harbour Laboratory Press, 1989. Such procedures and others are deemed to be within the scope of those skilled in the art.
The vector may be, for example, in the form of a plasmid, a viral particle, or a phage. Other vectors include derivatives of chromosomal, nonchromosomal and synthetic DNA sequences, viruses, bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. A variety of cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989).
Particular bacterial vectors which may be used include the commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, Wis., USA) pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174 pBluescript II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8 and pCM7. Particular eukaryotic vectors include pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia). However, any other vector may be used as long as it is replicable and stable in the host cell.
The host cell may be any of the host cells familiar to those skilled in the art, including prokaryotic cells or eukaryotic cells. As representative examples of appropriate hosts, there may be mentioned bacteria cells, such as E. coli, Streptomyces lividans, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, fungal cells, such as yeast, insect cells such as Drosophila S2 and Spodoptera Sf9, animal cells such as CHO, COS or Bowes melanoma, and adenoviruses. The selection of an appropriate host is within the abilities of those skilled in the art.
The vector may be introduced into the host cells using any of a variety of techniques, including electroporation, transformation, transfection, transduction, viral infection, gene guns, or Ti-mediated gene transfer. Where appropriate, the engineenred host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention. Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter may be induced by appropriate means (e.g., temperature shift or chemical induction) and the cells may be cultured for an additional period to allow them to produce the desired polypeptide or fragment thereof.
Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification. Microbial cells employed for expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents. Such methods are well known to those skilled in the art. The expressed polypeptide or fragment thereof can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the polypeptide. If desired, high performance liquid chromatography (HPLC) can be employed for final purification steps.
Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts (described by Gluzman, Cell, 23:175(1981), and other cell lines capable of expressing proteins from a compatible vector, such as the C127, 3T3, CHO, HeLa and BHK cell lines.
The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Depending upon the host employed in a recombinant production procedure, the polypeptide produced by host cells containing the vector may be glycosylated or may be non-glycosylated. Polypeptides of the invention may or may not also include an initial methionine amino acid residue.
Alternatively, the polypeptides of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof can be synthetically produced by conventional peptide synthesizers. In other embodiments, fragments or portions of the polynucleotides may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides.
Cell-free translation systems can also be employed to produce one of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof using mRNAs transcribed form a DNA construct comprising a promoter operably linked to a nucleic acid encoding the polypeptide or fragment thereof. In some embodiments, the DNA construct may be linearized prior to conducting an in vitro transcription reaction. The transcribed mRNA is then incubated with an appropriate cell-free translation extract, such as a rabbit reticulocyte extract, to produce the desired polypeptide or fragment thereof.
The present invention also relates to variants of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof. The term “variant” includes derivatives or analogs of these polypeptides. In particular, the variants may differ in amino acid sequence from the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination.
The variants may be naturally occurring or created in vitro. In particular, such variants may be created using genetic engineering techniques such as site directed mutagenesis, random chemical mutagenesis, Exonuclease III deletion procedures, and standard cloning techniques. Alternatively, such variants, fragments, analogs, or derivatives may be created using chemical synthesis or modification procedures.
Other methods of making variants are also familiar to those skilled in the art. These include procedures in which nucleic acid sequences obtained from natural isolates are modified to generate nucleic acids which encode polypeptides having characteristics which enhance their value in industrial or laboratory applications. In such procedures, a large number of variant sequences having one or more nucleotide differences with respect to the sequence obtained from the natural isolate are generated and characterized. Preferably, these nucleotide differences result in amino acid changes with respect to the polypeptides encoded by the nucleic acids from the natural isolates.
For example, variants may be created using error prone PCR. In error prone PCR, DNA amplification is performed under conditions where the fidelity of the DNA polymerase is low, such that a high rate of point mutation is obtained along the entire length of the PCR product. Error prone PCR is described in Leung, D. W., et al., Technique, 1:11-15 (19 89) and Caldwell, R. C. & Joyce G. F., PCR Methods Applic., 2:28-33 (1992). Variants may also be created using site directed mutagenesis to generate site-specific mutations in any cloned DNA segment of interest. Oligonucleotide mutagenesis is described in Reidhaar-Olson, J. F. and Sauer, R. T., Science, 241:53-57 (1988). Variants may also be created using directed evolution strategies such as those described in U.S. Pat. Nos. 6,361,974 and 6,372,497.
The variants of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, may be (i) variants in which one or more of the amino acid residues of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code.
Conservative substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics. Typically seen as conservative substitutions are the following replacements: replacements of an aliphatic amino acid such as Ala, Val, Leu and lie with another aliphatic amino acid; replacement of a Ser with a Thr or vice versa; replacement of an acidic residue such as Asp or Glu with another acidic residue; replacement of a residue bearing an amide group, such as Asn or Gln, with another residue bearing an amide group; exchange of a basic residue such as Lys or Arg with another basic residue; and replacement of an aromatic residue such as Phe or Tyr with another aromatic residue.
Other variants are those in which one or more of the amino acid residues of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 includes a substituent group.
Still other variants are those in which the polypeptide is associated with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol).
Additional variants are those in which additional amino acids are fused to the polypeptide, such as leader sequence, a secretory sequence, a proprotein sequence or a sequence which facilitates purification, enrichment, or stabilization of the polypeptide.
In some embodiments, the fragments, derivatives and analogs retain the same biological function or activity as the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101. In other embodiments, the fragment, derivative or analogue includes a fused herterologous sequence which facilitates purification, enrichment, detection, stabilization or secretion of the polypeptide that can be enzymatically cleaved, in whole or in part, away from the fragment, derivative or analogue.
Another aspect of the present invention are polypeptides or fragments thereof which have at least 70%, at least 80%, at least 85%, at least 90%, or more than 95% homology to one of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof. Homology may be determined using a program, such as BLASTP version 2.2.2 with the default parameters, which aligns the polypeptides or fragments being compared and determines the extent of amino acid identity or similarity between them. It will be appreciated that amino acid “homology” includes conservative substitutions such as those described above.
The polypeptides or fragments having homology to one of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof may be obtained by isolating the nucleic acids encoding them using the techniques described above.
Alternatively, the homologous polypeptides or fragments may be obtained through biochemical enrichment or purification procedures. The sequence of potentially homologous polypeptides or fragments may be determined by proteolytic digestion, gel electrophoresis and/or microsequencing. The sequence of the prospective homologous polypeptide or fragment can be compared to one of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof using a program such as BLASTP version 2.2.2 with the default parameters.
The polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments, derivatives or analogs thereof comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof invention may be used in a variety of application. For example, the polypeptides or fragments, derivatives or analogs thereof may be used to biocatalyze biochemical reactions. In particular, the polypeptides of the PKSE family, namely SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 fragments, derivatives or analogs thereof; the TEBC family, namely SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95 or fragments, derivatives or analogs thereof, may be used in any combination, in vitro or in vivo, to direct the synthesis or modification of an enediyne warhead or a substructure thereof. Polypeptides of the UNBL family, namely SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97 or fragments, derivatives or analogs thereof; may be used in vitro or in vivo to direct or aid the synthesis or modification of an enediyne warhead or a substructure thereof. Polypeptides of the UNBV family, namely SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99 or fragments, derivatives or analogs thereof, may be used in vitro or in vivo to direct or aid the synthesis or modification of an enediyne warhead or a substructure thereof. Polypeptides of the UNBU family, namely SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101 or fragments, derivatives or analogs thereof may be used in vitro or in vivo to direct or aid the synthesis or modification of an enediyne warhead or a substructure thereof.
The polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments, derivatives or analogues thereof comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof, may also be used to generate antibodies which bind specifically to the polypeptides or fragments, derivatives or analogues. The antibodies generated from SEQ ID NOS: 1, 3, 5, 7, 9, 11 may be used to determine whether a biological sample contains Streptomyces macromyceticus or a related microorganism, The antibodies generated from SEQ ID NOS: 13, 15, 17, 19, 21 may be used to determine whether a biological sample contains Micromonospora echinospora subsp. calichensis or a related microorganism. The antibodies generated from SEQ ID NOS: 23, 25, 27, 29, 31 may be used to determine whether a biological sample contains Streptomyces ghanaensis or a related microorganism. The antibodies generated from SEQ ID NOS: 33, 35, 37, 39, 41 may be used to determine whether a biological sample contains Streptomyces carzinostaticus subsp. neocarzinostaticus or a related microorganism. The antibodies generated from 43, 45, 47, 49, 51 may be used to determine whether a biological sample contains Amycolatopsis orientalis or a related microorganism. The antibodies generated from 53, 55, 57, 59, 61 may be used to determine whether a biological sample contains Kitasatosporia sp. or a related microorganism. The antibodies generated from SEQ ID NOS: 63, 65, 67, 69, 71 may be used to determine whether a biological sample contains Micromonospora megalomicea or a related microorganism The antibodies generated from SEQ ID NOS: 73, 75, 77, 79, 81 may be used to determine whether a biological sample contains Saccharothrix aerocolonigenes or a related microorganism. The antibodies generated from SEQ ID NOS: 83, 85, 87, 89, 91 may be used to determine whether a biological sample contains Streptomyces kaniharaensis or a related microorganism. The antibodies generated from SEQ ID NOS: 93, 95, 97, 99, 101 may be used to determine whether a biological sample contains Streptomyces citricolor or a related microorganism.
In such procedures, a biological sample is contacted with an antibody capable of specifically binding to one of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof. The ability of the biological sample to bind to the antibody is then determined. For example, binding may be determined by labeling the antibody with a detectable label such as a fluorescent agent, an enzymatic label, or a radioisotope. Alternatively, binding of the antibody to the sample may be detected using a secondary antibody having such a detectable label thereon. A variety of assay protocols may be used to detect the presence of Micromonospora echinospora subsp. calichensis, Streptomyces ghanaensis, Streptomyces carzinostaticus subsp. neocarzinostaticus, Amycolatopsis orientalis, Kitasatosporia sp., Micromonospora megalomicea, Saccharothrix aerocolonigenes, Streptomyces kaniharaensis, Streptomyces citricolor or the the present of polypeptides related to SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 in a sample. Particular assays include ELISA assays, sandwich assays, radioimmunoassays, and Western Blots. Alternatively, antibodies generated from SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 may be used to determine whether a biological sample contains related polypeptides that may be involved in the biosynthesis of enediyne natural products or other enediyne-like compounds.
Polyclonal antibodies generated against the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal. The antibody so obtained will then bind the polypeptide itself. In this manner, even a sequence encoding only a fragment of the polypeptide can be used to generate antibodies which may bind to the whole native polypeptide. Such antibodies can then be used to isolate the polypeptide from cells expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kholer and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
Techniques described for the production of single chain antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce single chain antibodies to the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof. Alternatively, transgenic mice may be used to express humanized antibodies to these polypeptides or fragments thereof.
Antibodies generated against the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof may be used in screening for similar polypeptides from a sample containing organisms or cell-free extracts thereof. In such techniques, polypeptides from the sample is contacted with the antibodies and those polypeptides which specifically bind the antibody are detected. Any of the procedures described above may be used to detect antibody binding. One such screening assay is described in “Methods for measuring Cellulase Activities”, Methods in Enzymology, Vol 160, pp. 87-116.
As used herein, the term “enediyne-specific nucleic acid codes” encompass the nucleotide sequences of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, fragments of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, nucleotide sequences homologous to SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, or homologous to fragments of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, and sequences complementary to all of the preceding sequences. The fragments include portions of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102 comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400 or 500 consecutive nucleotides of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102. Preferably, the fragments are novel fragments. Homologous sequences and fragments of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102 refer to a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 80%, 75% or 70% homology to these sequences. Homology may be determined using any of the computer programs and parameters described herein, including BLASTN and TBLASTX with the default parameters. Homologous sequences also include RNA sequences in which uridines replace the thymines in the nucleic acid codes of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102. The homologous sequences may be obtained using any of the procedures described herein or may result from the correction of a sequencing error. It will be appreciated that the nucleic acid codes of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102 can be represented in the traditional single character format in which G, A, T and C denote the guanine, adenine, thymine and cytosine bases of the deoxyribonucleic acid (DNA) sequence respectively, or in which G, A, U and C denote the guanine, adenine, uracil and cytosine bases of the ribonucleic acid (RNA) sequence (see the inside back cover of Stryer, Biochemistry, 3rd edition, W. H. Freeman & Co., New York) or in any other format which records the identity of the nucleotides in a sequence.
“Enediyne-specific polypeptide codes” encompass the polypeptide sequences of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 which are encoded by the cDNAs of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101; polypeptide sequences homologous to the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, or fragments of any of the preceding sequences. Homologous polypeptide sequences refer to a polypeptide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75% or 70% homology to one of the polypeptide sequences of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101. Polypeptide sequence homology may be determined using any of the computer programs and parameters described herein, including BLASTP version 2.2.2 with the default parameters or with any user-specified parameters. The homologous sequences may be obtained using any of the procedures described herein or may result from the correction of a sequencing error. The polypeptide fragments comprise at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100 or 150 consecutive polypeptides of the polypeptides of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101. Preferably the fragments are novel fragments. It will be appreciated that the polypeptide codes of the SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101 can be represented in the traditional single character format or three letter format (see the inside back cover of Stryer, Biochemistry, 3rd edition, W. H. Freeman & Co., New York) or in any other format which relates the identity of the polypeptides in a sequence.
A single sequence selected from enediyne-specific nucleic acid codes and enediyne-specific polypeptide codes is sometimes referred to herein as a subject sequence.
It will be readily appreciated by those skilled in the art that the enediyne-specific nucleic acid codes, a subset thereof, enediyne-specific polypeptide codes, a subset thereof, and a subject sequence can be stored, recorded and manipulated on any medium which can be read and accessed by a computer. As used herein, the words “recorded” and “stored” refer to a process for storing information on a computer medium. A skilled artisan can readily adopt any of the presently known methods for recording information on a computer readable medium to generate manufactures comprising one or more of the enediyne-specific nucleic acid codes, a subset thereof, enediyne-specific polypeptide codes, a subset thereof, and a subject sequence.
Computer readable media include magnetically readable media, optically readable media, electronically readable media and magnetic/optical media. For example, the computer readable media may be a hard disk, a floppy disk, a magnetic tape, CD-ROM, Digital Versatile Disk (DVD), Random Access Memory (RAM), or Read Only Memory (ROM) as well as other types of media known to those skilled in the art.
The enediyne-specific nucleic acid codes, a subset thereof and a subject sequence may be stored and manipulated in a variety of data processor programs in a variety of formats. For example, the enediyne-specific nucleic acid codes, a subset thereof, enediyne-specific polypeptide codes, a subset thereof, and a subject sequence may be stored as ASCII or text in a word processing file, such as MicrosoftWORD or WORDPERFECT in a variety of database programs familiar to those of skill in the art, such as DB2 or ORACLE. In addition, many computer programs and databases may be used as sequence comparers, identifiers or sources of query nucleotide sequences or query polypeptide sequences to be compared to the enediyne-specific nucleic acid codes, a subset thereof, the enediyne-specific polypeptide codes, a subset thereof, and a subject sequence.
The following list is intended not to limit the invention but to provide guidance to programs and databases useful with the enediyne-specific nucleic acid codes, a subset thereof, enediyne-specific polypeptide codes, a subset thereof, and a subject sequence. The program and databases which may be used include, but are not limited to: MacPattern (EMBL), DiscoveryBase (Molecular Applications Group), GeneMine (Molecular Applications Group) Look (Molecular Applications Group), MacLook (Molecular Applications Group), BLAST and BLAST2 (NCBI), BLASTN and BLASTX (Altschul et al., J. Mol. Biol. 215:403 (1990)), FASTA (Person and Lipman, Proc. Nalt. Acad. Sci. USA, 85:2444 (1988)), FASTDB (Brutlag et al. Comp. App. Biosci. 6-237-245, 1990), Catalyst (Molecular Simulations Inc.), Catalyst/SHAPE (Molecular Simulations Inc.), Cerius2.DBAccess (Molecular Simulations Inc.), HypoGen (Molecular Simulations Inc.), Insight II (Molecular Simulations Inc.), Discover (Molecular Simulations Inc.), CHARMm (Molecular Simulations Inc.), Felix (Molecular Simulations Inc.), DelPhi (Molecular Simulations Inc.), QuanteMM (Molecular Simulations Inc.), Homology (Molecular Simulations Inc.), Modeler (Molecular Simulations Inc.), ISIS (Molecular Simulations Inc.), Quanta/Protein Design (Molecular Simulations Inc.), WetLab (Molecular Simulations Inc.), WetLab Diversity Explorer (Molecular Simulations Inc.), Gene Explorer (Molecular Simulations Inc.), SeqFold (Molecular Simulations Inc.), the MDL Available Chemicals Directory database, the MDL Drug Data Report data base, the Comprehensive Medicinal Chemistry database, Derwents' World Drug Index database, the BioByteMasterFile database, the Genbank database, and the Gensyqn database. Many other programs and databases would be apparent to one of skill in the art given the present disclosure.
Embodiments of the present invention include systems, particularly computer systems that store and manipulate the sequence information described herein. As used herein, “a computer system”, refers to the hardware components, software components, and data storage components used to analyze enediyne-specific nucleic acid codes, a subset thereof, enediyne-specific polypeptide codes, a subset thereof, or a subject sequence.
Preferably, the computer system is a general purpose system that comprises a processor and one or more internal data storage components for storing data, and one or more data retrieving devices for retrieving the data stored on the data storage components. A skilled artisan can readily appreciate that any one of the currently available computer systems are suitable.
One example of a computer system is Illustrated in FIG. 1. The computer system of FIG. 4 will includes a number of components connected to a central system bus 116, including a central processing unit 118 with internal 118 and/or external cache memory 120, system memory 122, display adapter 102 connected to a monitor 100, network adapter 126 which may also be referred to as a network interface, internal modem 124, sound adapter 128, IO controller 132 to which may be connected a keyboard 140 and mouse 138, or other suitable input device such as a trackball or tablet, as well as external printer 134, and/or any number of external devices such as external modems, tape storage drives, or disk drives. One skilled in the art will readily appreciate that not all components illustrated in FIG. 1 are required to practice the invention and, likewise, additional components not illustrated in FIG. 1 may be present in a computer system contemplated for use with the invention.
One or more host bus adapters 114 may be connected to the system bus 116. To host bus adapter 114 may optionally be connected one or more storage devices such as disk drives 112 (removable or fixed), floppy drives 110, tape drives 108, digital versatile disk DVD drives 106, and compact disk CD ROM drives 104. The storage devices may operate in read-only mode and/or in read-write mode. The computer system may optionally include multiple central processing units 118, or multiple banks of memory 122.
Arrows 142 in FIG. 1 indicate the interconnection of internal components of the computer system. The arrows are illustrative only and do not specify exact connection architecture.
Software for accessing and processing the reference sequences (such as sequence comparison software, analysis software as well as search tools, annotation tools, and modeling tools etc.) may reside in main memory 122 during execution.
In one embodiment, the computer system further comprises a sequence comparison software for comparing the nucleic acid codes of a query sequence stored on a computer readable medium to a subject sequence which is also stored on a computer readable medium; or for comparing the polypeptide code of a query sequence stored on a computer readable medium to a subject sequence which is also stored on computer readable medium A “sequence comparison software” refers to one or more programs that are implemented on the computer system to compare nucleotide sequences with other nucleotide sequences stored within the data storage means. The design of one example of a sequence comparison software is provided in FIGS. 2A, 2B, 2C and 2D.
The sequence comparison software will typically employ one or more specialized comparator algorithms. Protein and/or nucleic acid sequence similarities may be evaluated using any of the variety of sequence comparator algorithms and programs known in the art. Such algorithms and programs include, but are no way limited to, TBLASTN, BLASTN, BLASTP, FASTA, TFASTA, CLUSTAL, HMMER, MAST, or other suitable algorithm known to those skilled in the art. (Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85(8): 2444-2448; Altschul et al., 1990, J. Mol. Biol. 215(3):403-410; Thompson et al., 1994, Nucleic Acids Res. 22(2):4673-4680, Higgins et al., 1996, Methods Enzymol. 266:383-402; Altschul et al., 1990, J. Mol. Biol. 215(3):403-410; Altschul et al., 1993, Nature Genetics 3:266-272, Eddy S. R., Bioinformatics 14:755-763, 1998; Bailey T L et al, J Steroid Biochem Mol Biol 1997 May; 62(1):29-44). One example of a comparator algorithm is illustrated in FIG. 3. Sequence comparator algorithms identified in this specification are particularly contemplated for use in this aspect of the invention.
The sequence comparison software will typically employ one or more specialized analyzer algorithms. One example of an analyzer algorithm is illustrated in FIG. 4. Any appropriate analyzer algorithm can be used to evaluate similarities, determined by the comparator algorithm, between a query sequence and a subject sequence (referred to herein as a query/subject pair). Based on context specific rules, the annotation of a subject sequence may be assigned to the query sequence. A skilled artisan can readily determine the selection of an appropriate analyzer algorithm and appropriate context specific rules. Analyzer algorithms identified elsewhere in this specification are particularly contemplated for use in this aspect of the invention.
FIGS. 2A, 2B, 2C and 2D together provide a flowchart of one example of a sequence comparison software for comparing query sequences to a subject sequence. The software determines if a gene or set of genes represented by their nucleotide sequence, polypeptide sequence or other representation (the query sequence) is significantly similar to the enediyne-specific nucleic acid codes, a subset thereof, enediyne-specific polypeptide codes, a subset thereof, of the invention (the subject sequence). The software may be implemented in the C or C++ programming language, Java, Perl or other suitable programming language known to a person skilled in the art.
Referring to FIG. 2A, the query sequence(s) may be accessed by the program by means of input from the user 210, accessing a database 208 or opening a text file 206. The “query initialization process” allows a query sequence to be accessed and loaded into computer memory 122, or under control of the program stored on a disk drive 112 or other storage device in the form of a query sequence array 216. The query array 216 is one or more query nucleotide or polypeptide sequences accompanied by some appropriate identifiers.
A dataset is accessed by the program by means of input from the user 228, accessing a database 226, or opening a text file 224. The “subject data source initialization process” of FIG. 2B refers to the method by which a reference dataset containing one or more sequence selected from the enediyne-specific nucleic acid codes, a subset thereof, enediyne-specific polypeptide codes, a subset thereof, or a subject sequence is loaded into computer memory 122, or under control of the program stored on a disk drive 112 or other storage device in the form of a subject array 234. The subject array 234 comprises one or more subject nucleotide or polypeptide sequences accompanied by some appropriate identifiers.
The “comparison subprocess” of FIG. 2C is the process by which the comparator algorithm 238 is invoked by the software for pairwise comparisons between query elements in the query sequence array 216, and subject elements in the subject array 234. The “comparator algorithm” of FIG. 2C refers to the pairwise comparisons between a query sequence and subject sequence, i.e. a query/subject pair from their respective arrays 216, 234. Comparator algorithm 238 may be any algorithm that acts on a query/subject pair, including but not limited to homology algorithms such as BLAST, Smith Waterman, Fasta, or statistical representation/probabilistic algorithms such as Markov models exemplified by HMMER, or other suitable algorithm known to one skilled in the art. Suitable algorithms would generally require a query/subject pair as input and return a score (an indication of likeness between the query and subject), usually through the use of appropriate statistical methods such as Karlin Altschul statistics used in BLAST, Forward or Viterbi algorithms used in Markov models, or other suitable statistics known to those skilled in the art.
The sequence comparison software of FIG. 2C also comprises a means of analysis of the results of the pairwise comparisons performed by the comparator algorithm 238. The “analysis subprocess” of FIG. 2C is a process by which the analyzer algorithm 244 is invoked by the software. The “analyzer algorithm” refers to a process by which annotation of a subject is assigned to the query based on query/subject similarity as determined by the comparator algorithm 238 according to context-specific rules coded into the program or dynamically loaded at runtime. Context-specific rules are what the program uses to determine if the annotation of the subject can be assigned to the query given the context of the comparison. These rules allow the software to qualify the overall meaning of the results of the comparator algorithm 238.
In one embodiment, context-specific rules may state that for a set of query sequences to be considered representative of an enediyne locus the comparator algorithm 238 must determine that the set of query sequences contain at least one query sequence that shows a statistical similarity to reference sequences corresponding to a nucleic acid sequence code for a polypeptide from two of the groups consisting of: (1) SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 and polypeptides having at least 75% homology to a polypeptide sequence of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93, (2) SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95 and polypeptides having at least 75% homology to a polypeptide sequence of SEQ ID NOS: 3, 5, 15, 25, 35, 45, 55, 65, 75, 85, 95; (3) SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97, and polypeptides having at least 75% homology to a polypeptide sequence of SEQ ID NOS: 7, 17, 27, 37, 47, 57, 67, 77, 87, 97; (4) SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99 and polypeptides having at least 75% homology to a polypeptide sequence of SEQ ID NOS: 9, 19, 29, 39, 49, 59, 69, 79, 89, 99, (5) SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101 and polypeptides having at least 75% homology to a polypeptide sequence of SEQ ID NOS: 11, 21, 31, 41, 51, 61, 71, 81, 91, 101. Of course preferred context specific rules may specify a wide variety of thresholds for identifying enediyne-biosynthetic genes or enediyne-producing organisms without departing from the scope of the invention. Some thresholds contemplate that at least one query sequence in the set of query sequences show a statistical similarity to the nucleic acid code corresponding to 2 or 3 or 4 or 5 of the above 5 groups polypeptides diagnostic of enediyne biosynthetic genes. Other context specific rules set the level of homology required in each of the group may be set at 70%, 80%, 85%, 90%, 95% or 98% in regards to any one or more of the subject sequences.
In another embodiment context-specific rules may state that for a query sequence to be considered an enediyne polyketide synthase, the comparator algorithm 238 must determine that the query sequence shows a statistical similarity to subject sequences corresponding to a nucleic acid sequence code for a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93, polypeptides having at least 75% homology to a polypeptide of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93 and fragment comprising at least 500 consecutive amino acids of the polypeptides of SEQ ID NOS: 1, 13, 23, 33, 43, 53, 63, 73, 83, 93. Of course preferred context specific rules may specify a wide variety of thresholds for identifying enediyne polyketide synthase proteins without departing from the scope of the invention. Some context specific rules set level of homology required of the query sequence at 70%, 80%, 85%, 90%, 95% or 98% in regards to the reference sequences.
Thus, the analysis subprocess may be employed in conjunction with any other context specific rules and may be adapted to suit different embodiments. The principal function of the analyzer algorithm 244 is to assign meaning or a diagnosis to a query or set of queries based on context specific rules that are application specific and may be changed without altering the overall role of the analyzer algorithm 244.
Finally the sequence comparison software of FIG. 2 comprises a means of returning of the results of the comparisons by the comparator algorithm 238 and analyzed by the analyzer algorithm 244 to the user or process that requested the comparison or comparisons. The “display/report subprocess” of FIG. 2D is the process by which the results of the comparisons by the comparator algorithm 238 and analyses by the analyzer algorithm 244 are returned to the user or process that requested the comparison or comparisons. The results 240, 246 may be written to a file 252, displayed in some user interface such as a console, custom graphical interface, web interface, or other suitable implementation specific interface, or uploaded to some database such as a relational database, or other suitable implementation specific database.
Once the results have been returned to the user or process that requested the comparison or comparisons the program exits.
The principle of the sequence comparison software of FIG. 2 is to receive or load a query or queries, receive or load a reference dataset, then run a pairwise comparison by means of the comparator algorithm 238, then evaluate the results using an analyzer algorithm 244 to arrive at a determination if the query or queries bear significant similarity to the reference sequences, and finally return the results to the user or calling program or process.
FIG. 3 is a flow diagram illustrating one embodiment of comparator algorithm 238 process in a computer for determining whether two sequences are homologous. The comparator algorithm receives a query/subject pair for comparison, performs an appropriate comparison, and returns the pair along with a calculated degree of similarity.
Referring to FIG. 3, the comparison is initiated at the beginning of sequences 304. A match of (x) characters is attempted 306 where (x) is a user specified number. If a match is not found the query sequence is advanced 316 by one polypeptide with respect to the subject, and if the end of the query has not been reached 318 another match of (x) characters is attempted 306. Thus if no match has been found the query is incrementally advanced in entirety past the initial position of the subject, once the end of the query is reached 318, the subject pointer is advanced by 1 polypeptide and the query pointer is set to the beginning of the query 318. If the end of the subject has been reached and still no matches have been found a null homology result score is assigned 324 and the algorithm returns the pair of sequences along with a null score to the calling process or program. The algorithm then exits 326. If instead a match is found 308, an extension of the matched region is attempted 310 and the match is analyzed statistically 312. The extension may be unidirectional or bidirectional. The algorithm continues in a loop extending the matched region and computing the homology score, giving penalties for mismatches taking into consideration that given the chemical properties of the polypeptide side chains not all mismatches are equal. For example a mismatch of a lysine with an arginine both of which have basic side chains receive a lesser penalty than a mismatch between lysine and glutamate which has an acidic side chain. The extension loop stops once the accumulated penalty exceeds some user specified value, or of the end of either sequence is reached 312. The maximal score is stored 314, and the query sequence is advanced 316 by one polypeptide with respect to the subject, and if the end of the query has not been reached 318 another match of (x) characters is attempted 306. The process continues until the entire length of the subject has been evaluated for matches to the entire length of the query. All individual scores and alignments are stored 314 by the algorithm and an overall score is computed 324 and stored. The algorithm returns the pair of sequences along with local and global scores to the calling process or program. The algorithm then exits 326.
Comparator algorithm 238 algorithm may be represented in pseudocode as follows:
| INPUT: | Q[m]: query, m is the length | |
| S[n]: subject, n is the length |
| x: | x is the size of a segment |
| START: | |
| for each i in [l,n] do |
| for each j in [l,m] do |
| if ( j + x − 1 ) <= m and ( i + x − 1 ) <= n then |
| if Q(j, j+x−1) = S(i, i+x−1) then |
| k=1; | |
| while Q(j, j+x−1+k ) = S(i, i+x−1+ k) do |
| k++; |
| Store highest local homology |
| Compute overall homology score | |
| Return local and overall homology scores | |
| END. | |
The comparator algorithm 238 may be written for use on nucleotide sequences, in which case the scoring scheme would be implemented so as to calculate scores and apply penalties based on the chemical nature of nucleotides. The comparator algorithm 238 may also provide for the presence of gaps in the scoring method for nucleotide or polypeptide sequences.
BLAST is one implementation of the comparator algorithm 238. HMMER is another implementation of the comparator algorithm 238 based on Markov model analysis. In a HMMER implementation a query sequence would be compared to a mathematical model representative of a subject sequence or sequences rather than using sequence homology.
FIG. 4 is a flow diagram illustrating an analyzer algorithm 244 process for detecting the presence of an enediyne biosynthetic locus. The analyzer algorithm of FIG. 4 may be used in the process by which the annotation of a subject is assigned to the query based on their similarity as determined by the comparator algorithm 238 and according to context-specific rules coded into the program or dynamically loaded at runtime. Context sensitive rules are what determines if the annotation of the subject can be assigned to the query given the context of the comparison. Context specific rules set the thresholds for determining the level and quality of similarity that would be accepted in the process of evaluating matched pairs.
The analyzer algorithm 244 receives as its input an array of pairs that had been matched by the comparator algorithm 238. The array consists of at least a query identifier, a subject identifier and the associated value of the measure of their similarity. To determine if a group of query sequences includes sequences diagnostic of an enediyne biosynthetic gene cluster, a reference or diagnostic array 406 is generated by accessing a data source and retrieving enediyne specific information 404 relating to enediyne-specific nucleic acid codes and enediyne-specific polypeptide codes. Diagnostic array 406 consists at least of subject identifiers and their associated annotation. Annotation may include reference to the five protein families diagnostic of enediyne biosynthetic genes clusters, i.e. PKSE, TEBC, UNBL, UNBV and UNBU. Annotation may also include information regarding exclusive presence in loci of a specific structural class or may include previously computed matches to other databases, for example databases of motifs.
Once the algorithm has successfully generated or received the two necessary arrays 402, 406, and holds in memory any context specific rules, each matched pair as determined by the comparator algorithm 238 can be evaluated. The algorithm will perform an evaluation 408 of each matched pair and based on the context specific rules confirm or fail to confirm the match as valid 410. In cases of successful confirmation of the match 410 the annotation of the subject is assigned to the query. Results of each comparison are stored 412. The loop ends when the end of the query/subject array is reached. Once all query/subject pairs have been evaluated against enediyne-specific nucleic acid codes and enediyne-specific polypeptide codes, a final determination can be made if the query set of ORFs represents an enediyne locus 416.
The algorithm then returns the overall diagnosis and an array of characterized query/subject pairs along with supporting evidence to the calling program or process and then terminates 418.
The analyzer algorithm 244 may be configured to dynamically load different diagnostic arrays and context specific rules. It may be used for example in the comparison of query/subject pairs with diagnostic subjects for other biosynthetic pathways, such as chromoprotein enediyne-specific nucleic acid codes or non-chromoprotein enediyne-specific polypeptide codes, or other sets of annotated subjects.
The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples.
Macromomycin is a chromoprotein enediyne produced by Streptomyces macromyceticus (NRRL B-5335) Macromomycin is believed to be a derivative of a larger chromoprotein enediyne compound referred to as auromomycin (Vandre and Montgomery (1982) Biochemistry Vol 21 pp. 3343-3352, Yamashita et al. (1979) J. Antibiot. Vol. 32 pp. 330-339). Thus, throughout the specification, reference to macromomycin is intended to encompass the molecules referred to by some authors as auromomycin. Likewise, reference to the biosynthetic locus for macromomycin is intended to encompass the biosynthetic locus that directs the synthesis of the molecules some authors have referred to as macromomycin and auromomycin.
Streptomyces macromyceticus (NRRL B-5335) was obtained from the Agricultural Research Service collection (National Center for Agricultural Utilization Research, 1815 N. University Street, Peoria, Ill. 61604) and cultured using standard microbiological techniques (Kieser et al., supra). The organism was propagated on oatmeal agar medium at 28 degrees Celsius for several days. For isolation of high molecular weight genomic DNA, cell mass from three freshly grown, near confluent 100 mm petri dishes was used. The cell mass was collected by gentle scraping with a plastic spatula. Residual agar medium was removed by repeated washes with STE buffer (75 mM NaCl; 20 mM Tris-HCl, pH 8.0; 25 mM EDTA). High molecular weight DNA was isolated by established protocols (Kieser et al. supra) and its integrity was verified by field inversion gel electrophoresis (FIGE) using the preset program number 6 of the FIGE MAPPER™ power supply (BIORAD). This high molecular weight genomic DNA serves for the preparation of a small size fragment genomic sampling library (GSL), i.e., the small insert library, as well as a large size fragment cluster identification library (CIL), i.e., the large insert library. Both libraries contained randomly generated S. macromyceticus genomic DNA fragments and, therefore, are representative of the entire genome of this organism.
For the generation of the S. macromyceticus GSL library, genomic DNA was randomly sheared by sonication. DNA fragments having a size range between 1.5 and 3 kb were fractionated on a agarose gel and isolated using standard molecular biology techniques (Sambrook et al., supra). The ends of the obtained DNA fragments were repaired using T4 DNA polymerase (Roche) as described by the supplier. This enzyme creates DNA fragments with blunt ends that can be subsequently cloned into an appropriate vector. The repaired DNA fragments were subcloned into a derivative of pBluescript SK+ vector (Stratagene) which does not allow transcription of cloned DNA fragments. This vector was selected as it contains a convenient polylinker region surrounded by sequences corresponding to universal sequencing primers such as T3, T7, SK, and KS (Stratagene). The unique EcoRV restriction site found in the polylinker region was used as it allows insertion of blunt-end DNA fragments. Ligation of the inserts, use of the ligation products to transform E. coli DH10B (Invitrogen) host and selection for recombinant clones were performed as previously described (Sambrook et al., supra). Plasmid DNA carrying the S. macromyceticus genomic DNA fragments was extracted by the alkaline lysis method (Sambrook et al., supra) and the insert size of 1.5 to 3 kb was confirmed by electrophoresis on agarose gels. Using this procedure, a library of small size random genomic DNA fragments is generated that covers the entire genome of the studied microorganism. The number of individual clones that can be generated is infinite but only a small number is further analyzed to sample the microorganism's genome.
A CIL library was constructed from the S. macromyceticus high molecular weight genomic DNA using the SuperCos-1 cosmid vector (Stratagene™). The cosmid arms were prepared as specified by the manufacturer. The high molecular weight DNA was subjected to partial digestion at 37 degrees Celsius with approximately one unit of Sau3AI restriction enzyme (New England Biolabs) per 100 micrograms of DNA in the buffer supplied by the manufacturer. This enzyme generates random fragments of DNA ranging from the initial undigested size of the DNA to short fragments of which the length is dependent upon the frequency of the enzyme DNA recognition site in the genome and the extent of the DNA digestion. At various timepoints, aliquots of the digestion were transferred to new microfuge tubes and the enzyme was inactivated by adding a final concentration of 10 mM EDTA and 0.1% SDS. Aliquots judged by FIGE analysis to contain a significant fraction of DNA in the desired size range (30-50 kb) were pooled, extracted with phenol/chloroform (1:1 vol:vol), and pelletted by ethanol precipitation.
The 5′ ends of Sau3AI DNA fragments were dephosphorylated using alkaline phosphatase (Roche) according to the manufacturers specifications at 37 degrees Celcius for 30 min. The phosphatase was heat inactivated at 70 degrees Celcius for 10 min and the DNA was extracted with phenol/chloroform (1:1 vol:vol), pelletted by ethanol precipitation, and resuspended in sterile water. The dephosphorylated Sau3AI DNA fragments were then ligated overnight at room temperature to the SuperCos-1 cosmid arms in a reaction containing approximately four-fold molar excess SuperCos-1 cosmid arms.
The ligation products were packaged using Gigapack® III XL packaging extracts (Stratagene™) according to the manufacturer's specifications. The CIL library consisted of 864 isolated cosmid clones in E coli DH10B (Invitrogen). These clones were picked and inoculated into nine 96-well microtiter plates containing LB broth (per liter of water: 10.0 g NaCl; 10.0 g tryptone; 5.0 g yeast extract) which were grown overnight and then adjusted to contain a final concentration of 25% glycerol. These microtiter plates were stored at −80 degrees Celcius and served as glycerol stocks of the CIL library. Duplicate microtiter plates were arrayed onto nylon membranes as follows Cultures grown on microtiter plates were concentrated by pelleting and resuspending in a small volume of LB broth. A 3×3 96-pin-grid was spotted onto nylon membranes.
The membranes, representing the complete CIL library, were then layered onto LB agar and incubated ovenight at 37 degrees Celcius to allow the colonies to grow. The membranes were layered onto filter paper pre-soaked with 0.5 N NaOH/1.5 M NaCl for 10 min to denature the DNA and then neutralized by transferring onto filter paper pre-soaked with 0.5 M Tris (pH 8)/1.5 M NaCl for 10 min. Cell debris was gently scraped off with a plastic spatula and the DNA was crosslinked onto the membranes by UV irradiation using a GS GENE LINKER™ UV Chamber (BIORAD). Considering an average size of 8 Mb for an actinomycete genome and an average size of 35 kb of genomic insert in the CIL library, this library represents roughly a 4-fold coverage of the microorganism's entire genome.
The GSL library was analyzed by sequence determination of the cloned genomic DNA inserts. The universal primers KS or T7, referred to as forward (F) primers, were used to initiate polymerization of labeled DNA. Extension of at least 700 bp from the priming site can be routinely achieved using the TF, BDT v2.0 sequencing kit as specified by the supplier (Applied Biosystems). Sequence analysis of the small genomic DNA fragments (Genomic Sequence Tags, GSTs) was performed using a 3700 ABI capillary electrophoresis DNA sequencer (Applied Biosystems). The average length of the DNA sequence reads was ˜700 bp. Further analysis of the obtained GSTs was performed by sequence homology comparison to various protein sequence databases. The DNA sequences of the obtained GSTs were translated into amino acid sequences and compared to the National Center for Biotechnology Information (NCBI) nonredundant protein database and the proprietary Ecopia natural product biosynthetic gene Decipher™ database using previously described algorithms (Altschul et al., supra). Sequence similarity with known proteins of defined function in the database enables one to make predictions on the function of the partial protein that is encoded by the translated GST.
A total of 479 S. macromyceticus GSTs obtained with the forward sequencing primer were analyzed by sequence comparison using the Blast algorithm (Altschul et al., supra). Sequence alignments displaying an E value of at least e-5 were considered as significantly homologous and retained for further evaluation. GSTs showing similarity to a gene of interest can be at this point selected and used to identify larger segments of genomic DNA from the CIL library that include the gene(s) of interest. Several S. macromyceticus GSTs that contained genes of interest were pursued. One of these GSTs encoded a portion of an oxidoreductase based on Blast analysis of the forward read and a portion of the macromomycin apoprotein based on Blast analysis of the reverse read. Oligonucleotide probes derived from such GSTs were used to screen the CIL library and the resulting positive cosmid clones were sequenced. Overlapping cosmid clones provided in excess of 125 kb of sequence information surrounding the macromomycin apoprotein gene (FIG. 5).
Hybridization oligonucleotide probes were radiolabeled with P32 using T4 polynucleotide kinase (New England Biolabs) in 15 microliter reactions containing 5 picomoles of oligonucleotide and 6.6 picomoles of [γ-P32]ATP in the kinase reaction buffer supplied by the manufacturer. After 1 hour at 37 degrees Celcius, the kinase reaction was terminated by the addition of EDTA to a final concentration of 5 mM. The specific activity of the radiolabeled oligonucleotide probes was estimated using a Model 3 Geiger counter (Ludlum Measurements Inc., Sweetwater, Tex.) with a built-in integrator feature. The radiolabeled oligonucleotide probes were heat-denatured by incubation at 85 degrees Celcius for 10 minutes and quick-cooled in an ice bath immediately prior to use.
The S. macromyceticus CIL library membranes were pretreated by incubation for at least 2 hours at 42 degrees Celcius in Prehyb Solution (6×SSC; 20 mM NaH2PO4; 5× Denhardt's; 0.4% SDS; 0.1 mg/ml sonicated, denatured salmon sperm DNA) using a hybridization oven with gentle rotation. The membranes were then placed in Hyb Solution (6×SSC; 20 mM NaH2PO4; 0.4% SDS; 0.1 mg/ml sonicated, denatured salmon sperm DNA) containing 1×106 cpm/ml of radiolabeled oligonucleotide probe and incubated overnight at 42 degrees Celcius using a hybridization oven with gentle rotation. The next day, the membranes were washed with Wash Buffer (6×SSC, 0.1% SDS) for 45 minutes each at 46, 48, and 50 degrees Celcius using a hybridization oven with gentle rotation. The S. macromyceticus CIL membranes were then exposed to X-ray film to visualize and identify the positive cosmid clones. Positive clones were identified, cosmid DNA was extracted from 30 ml cultures using the alkaline lysis method (Sambrook et al., supra) and the inserts were entirely sequenced using a shotgun sequencing approach (Fleischmann et al., (1995) Science, 269:496-512).
Sequencing reads were assembled using the Phred-Phrap™ algorithm (University of Washington, Seattle, USA) recreating the entire DNA sequence of the cosmid insert. Reiterations of hybridizations of the CIL library with probes derived from the ends of the original cosmid allow indefinite extension of sequence information on both sides of the original cosmid sequence until the complete sought-after gene cluster is obtained. The structure of macromomycin (auromomycin) has not been elucidated, however the apoprotein component has been well characterized (Van Roey and Beerman (1989) Proc Natl Acad Sci USA Vol. 86 pp. 6587-6591). An unusual polyketide synthase (PKSE) was found approximately 40 kb upstream of the macromomycin apoprotein gene (FIG. 5). No other polyketide synthase or fatty acid synthase gene cluster was found in the vicinity of the macromomycin apoprotein gene, suggesting that the PKSE may be the only polyketide synthase involved in the biosynthesis of macromomycin (auromomycin).
Four other enediyne-specific genes clustered with or in close proximity to the PKSE gene were found in the macromomycin biosynthetic locus. These genes and the polypeptides that they encode have been assigned the family designations TEBC, UNBL, UNBV, and UNBU. The macromomycin locus contains two copies of the TEBC gene (FIG. 6, Table 2). Table 2 lists the results of sequence comparison using the Blast algorithm (Altschul et al., supra) for each of these enediyne-specific polypeptides from the macromomycin locus. Homology was determined using the BLASTP algorithm with the default parameters.
| TABLE 2 |
| MACR locus |
| GenBank homology | proposed function of | |||||
| Family | #aa | Accession, #aa | probability | identity | similarity | GenBank match |
| PKSE | 1936 | T37056, 2082aa | 6e-86 | 273/897 (30.43%) | 372/897 (41.47%) | multi-domain beta keto-acyl |
| synthase, Streptomyces coelicolor | ||||||
| NP_485686.1, 1263aa | 5e-82 | 256/900 (28.44%) | 388/900 (43.11%) | heterocyst glycolipid synthase, | ||
| Nostoc sp | ||||||
| AAL01060.1, 2573aa | 6e-78 | 244/884 (27.6%) | 376/884 (42.53%) | polyunsaturated fatty acid | ||
| synthase, Photobacterium | ||||||
| profundum | ||||||
| TEBC1 | 162 | NP_249659.1, 148aa | 4e-06 | 38/134 (28.36%) | 59/134 (44.03%) | hypothetical protein, |
| Pseudomonas aeruginosa | ||||||
| CAB50777.1, 150aa | 4e-06 | 39/145 (26.9%) | 65/145 (44.83%) | hypothetical protein, | ||
| Pseudomonas putida | ||||||
| NP_214031.1, 128aa | 2e-04 | 33/129 (25.58%) | 55/129 (42.64%) | hypothetical protein, | ||
| Aquifex aeolicus | ||||||
| TEBC2 | 157 | NP_242865.1, 138aa | 0.27 | 31/131 (23%) | 50/131 (37%) | 4-hydroxybenzoyl-CoA |
| thioesterase, Bacillus halodurans | ||||||
| UNBL | 327 | NP_422192.1, 423aa | 0.095 | 30/86 (34.88%) | 40/86 (46.51%) | peptidase, Caulobacter creacentus |
| UNBV | 642 | NO HOMOLOG | ||||
| UNBU | 433 | NP_486037.1, 300aa | 1e-06 | 49/179 (27.37%) | 83/179 (46.37%) | hypothetical protein, Nostoc sp. |
| NP_107088.1, 503aa | 2e-04 | 72/280 (25.71%) | 126/280 (45%) | hypothetical protein, | ||
| Mesorhizobium loti | ||||||
| NP_440874.1, 285aa | 4e-04 | 47/193 (24.35%) | 86/193 (44.56%) | hypothetical protein, | ||
| Synechocystis sp | ||||||
The macromomycin genes listed in Table 2 are arranged as depicted in FIG. 6. The UNBL, UNBV, UNBU, PKSE, and TEBC1 genes span approximately 10.5 kb and are tandemly arranged in the order listed. Thus these five genes may constitute an operon. A second TEBC gene (TEBC2) is found approximately 6.6 kb downstream of the 5-gene enediyne-specific cassette. The macromomycin enediyne-specific cassette is composed of six functionally linked genes and polypeptides, five of which may be expressed as a single operon.
Calicheamicin is a non-chromoprotein enediyne produced by Micromonospora echinospora subsp. calichensis NRRL 15839. Both GSL and CIL genomic DNA libraries of M. echinospora genomic DNA were prepared as described in Example 1. A total of 288 GSL clones were sequenced with the forward primer and analyzed by sequence comparison using the Blast algorithm (Altschul et al., supra) to identify those clones that contained inserts related to the macromomycin (auromomycin) biosynthetic genes, particularly the PKSE. Such GST clones were identified and were used to isolate cosmid clones from the M. echinospora CIL library. Overlapping cosmid clones were sequenced and assembled as described in Example 1. The resulting DNA sequence information was more than 125 kb in length and included the calicheamicin genes described in WO 00/37608. The calicheamicin biosynthetic genes disclosed in WO 00/37608 span only from 37140 bp to 59774 bp in FIG. 5 and do not include the unusual PKS gene (PKSE) and four other flanking genes (UNBL, UNBV, UNBU, and TEBC) that are homologuous to those in the macromomycin biosynthetic locus. Table 3 lists the results of sequence comparison using the Blast algorithm (Altschul et al., supra) for each of these enediyne-specific polypeptides from the calicheamicin locus. Homology was determined using the BLASTP algorithm with the default parameters.
| TABLE 3 |
| CALI locus |
| GenBank homology | proposed function of | |||||
| Family | #aa | Accession, #aa | probability | identity | similarity | GenBank match |
| PKSE | 1919 | AAF26923.1, 2439aa | 1e-60 | 228/876 (26.03%) | 317/876 (36.19%) | polyketide synthase, Polyangium |
| cellulosum | ||||||
| NP_485686.1, 1263aa | 5e-59 | 148/461 (32.1%) | 210/461 (45.55%) | heterocyst glycolipid synthase, | ||
| Nostoc sp | ||||||
| T37056, 2082aa | 9e-58 | 161/466 (34.55%) | 213/466 (45.71%) | multi-domain beta keto-acyl syn- | ||
| thase, Streptomyces coelicolor | ||||||
| TEBC | 148 | NP_249659.1, 148aa | 8e-06 | 41/133 (30.83%) | 62/133 (46.62%) | hypothetical protein, |
| Pseudomonas aeruginosa | ||||||
| AAD49752.1, 148aa | 1e-05 | 41/138 (29.71%) | 63/138 (45.65%) | orf1, Pseudomonas aeruginosa | ||
| NP_242865.1, 138aa | 2e-04 | 32/130 (24.62%) | 56/130 (43.08%) | 4-hydroxybenzoyl-CoA | ||
| thioesterase, Bacillus halodurans | ||||||
| UNBL | 322 | NO HOMOLOG | ||||
| UNBV | 651 | NO HOMOLOG | ||||
| UNBU | 321 | NP_486037.1, 300aa | 8e-09 | 61/210 (29.05%) | 99/210 (47.14%) | hypothetical protein, Nostoc sp |
| NP_ 107088.1, 503aa | 5e-05 | 58/208 (27.88%) | 96/208 (46.15%) | hypothetical protein, | ||
| Mesorhizobium loti | ||||||
The calicheamicin genes listed in Table 3 are arranged as depicted in FIG. 6. The UNBL, UNBV, UNBU, PKSE, and TEBC genes span approximately 10.5 kb and are tandemly arranged in the order listed. Thus these five genes may constitute an operon. Therefore, the calicheamicin enediyne-specific cassette is composed of five functionally linked genes and polypeptides that may be expressed as a single operon.
The genomic sampling method described in Example 1 was applied to genomic DNA from Streptomyces ghanaensis NRRL B-12104. S. ghanaensis has not previously been described to produce enediyne compounds. Both GSL and CIL genomic DNA libraries of S. ghanaensis genomic DNA were prepared as described in Example 1. A total of 435 GSL clones were sequenced with the forward primer and analyzed by sequence comparison using the Blast algorithm (Altschul et al., supra).
Surprisingly, two GSTs from S. ghanaensis were identified as encoding portions of genes in the 5-gene cassette common to both the macromomycin and calicheamicin enediyne biosynthetic loci. One of these GSTs encoded a portion of a TEBC homologue and the other encoded a portion of a UNBV homologue. These S. ghanaensis GSTs were subsequently found in a genetic locus referred to herein as 009C (FIG. 5). As in the macromomycin and calicheamicin enediyne biosynthetic loci, the UNBV and TEBC genes in 009C were found to flank a PKSE gene and adjacent to UNBL and UNBU genes. The 009C locus included a gene encoding a homologue of the macromomycin apoprotein approximately 50 kb downstream of the UNBV-UNBU-UNBL-PKSE-TEBC cassette. The presence of the 5-gene cassette in the vicinity of an apoprotein suggests that 009C represents a biosynthetic locus for an unknown chromoprotein enediyne that was not previously described to be produced by S. ghanaensis NRRL B-12104.
Table 4 lists the results of sequence comparison using the Blast algorithm (Altschul et al., supra) for each of these enediyne-specific polypeptides from the 009C locus. Homology was determined using the BLASTP algorithm with the default parameters.
| TABLE 4 |
| 009C locus |
| GenBank homology | proposed function of | |||||
| Family | #aa | Accession, #aa | probability | identity | similarity | GenBank match |
| PKSE | 1956 | T37056, 2082aa | 1e-101 | 298/902 (33.04%) | 395/902 (43.79%) | multi-domain beta keto-acyl |
| synthase, Streptomyces coelicolor | ||||||
| NP_485686.1, 1263aa | 2e-99 | 274/900 (30.44%) | 407/900 (45.22%) | heterocyst glycolipid synthase, | ||
| Nostoc sp | ||||||
| BAB69208 1, 2365aa | 3e-89 | 282/880 (32.05%) | 366/880 (41.59%) | polyketide synthase, Streptomyces | ||
| avermitilis | ||||||
| TEBC | 152 | NP_249659.1, 148aa | 5e-07 | 39/131 (29.77%) | 59/131 (45.04%) | hypothetical protein, |
| Pseudomonas aeruginosa | ||||||
| NP_231474.1, 155aa | 2e-04 | 30/129 (23.26%) | 62/129 (48.06%) | hypothetical protein, Vibrio | ||
| cholerae | ||||||
| NP_214031.1, 128aa | 2e-04 | 31/128 (24.22%) | 55/128 (42.97%) | hypothetical protein, Aquifex | ||
| aeolicus | ||||||
| UNBL | 329 | NO HOMOLOG | ||||
| UNBV | 636 | NP_615809.1, 2275aa | 6e-05 | 72/314 (22.93%) | 114/314 (36.31%) | cell surface protein, |
| Methanosarcina acetivorans | ||||||
| UNBU | 382 | NP_486037.1, 300aa | 4e-07 | 46/175 (26.29%) | 81/175 (46.29%) | hypothetical protein, Nostoc sp |
| NP_107088.1, 503aa | 6e-06 | 68/255 (26.67%) | 118/255 (46.27%) | hypothetical protein, | ||
| Mesorhizobium loti | ||||||
The 009C genes listed in Table 4 are arranged as depicted in FIG. 6. The UNBL, UNBV, UNBU, PKSE, and TEBC genes span approximately 10.5 kb and are tandemly arranged In the order listed. These five genes may constitute an operon. Therefore, the 009C enediyne-specific cassette is composed of five functionally linked genes and polypeptides that may be expressed as a single operon.
Neocarzinostatin is a chromoprotein enediyne produced by Streptomyces carzinostaticus subsp. neocarzinostaticus ATCC 15944. The neocarzinostatin biosynthetic locus was sequenced and was shown to contain, in addition to the neocarzinostatin apoprotein gene, the 5-gene cassette that is present in the macromomycin and calicheamicin enediyne biosynthetic loci. The genes and proteins involved in the biosynthesis of neocarzinostatin are disclosed in co-pending application U.S. Ser. No. 60/354,474. The presence of the 5-gene cassette in the neocarzinostatin biosynthetic locus reconfirms that it is present in all enediyne biosynthetic loci.
Table 5 lists the results of sequence comparison using the Blast algorithm (Altschul et al., supra) for each of these enediyne-specific polypeptides from the neocarzinostatin locus. Homology was determined using the BLASTP algorithm with the default parameters.
| TABLE 5 |
| NEOC locus |
| GenBank homology | proposed function of | |||||
| Family | #aa | Accession, #aa | probability | identity | similarity | GenBank match |
| PKSE | 1977 | T37056, 2082aa | 7e-93 | 285/891 (31.99%) | 384/891 (43.1%) | multi-domain beta keto-acyl |
| synthase, Streptomyces coelicolor | ||||||
| NP_485686.1, 1283aa | 8e-88 | 261/890 (29.33%) | 397/890 (44.61%) | heterocyst glycolipid synthase, | ||
| Nostoc ap | ||||||
| BAB69208.1, 2365aa | 2e-85 | 276/876 (31.51%) | 370/876 (42.24%) | polyketide synthase, Streptomyces | ||
| avermitilis | ||||||
| TEBC | 153 | NP_249659.1, 148aa | 3e-06 | 37/129 (28.68%) | 56/129 (43.41%) | hypothetical protein, |
| Pseudomonas aeruginosa | ||||||
| CAB50777.1, 150aa | 1e-04 | 32/114 (28.07%) | 53/114 (46.49%) | hypothetical protein, | ||
| Pseudomonas putida | ||||||
| NP_214031.1, 128aa | 2e-04 | 34/129 (26.36%) | 55/129 (42.64%) | hypothetical protein, Aquifex | ||
| aeolicus | ||||||
| UNBL | 328 | |||||
| UNBV | 636 | NP_618575.1, 1881aa | 2e-05 | 77/317 (24.29%) | 117/317 (36.91%) | cell surface protein, |
| Methanosarcina acetivorans | ||||||
| UNBU | 364 | NP_107088.1, 503aa | 2e-05 | 49/158 (31.01%) | 79/158 (50%) | hypothetical protein, |
| Mesorhizobium loti | ||||||
| NP_486037.1, 300aa | 8e-05 | 33/126 (26.19%) | 60/126 (47.62%) | hypothetical protein, Nostoc sp | ||
The neocarzinostatin genes listed in Table 5 are arranged as depicted in FIG. 6. The UNBL, UNBV, UNBU, PKSE, and TEBC genes span approximately 10.5 kb and are tandemly arranged in the order listed. Thus these five genes may constitute an operon. Therefore, the neocarzinostatin enediyne-specific cassette is composed of five functionally linked genes and polypeptides that may be expressed as a single operon.
The genomic sampling method described in Example 1 was applied to genomic DNA from Amycolatopsis orientalis ATCC 43491. A. orientalis has not previously been described to produce enediyne compounds. Both GSL and CIL genomic DNA libraries of A. orientalis genomic DNA were prepared as described in Example 1.
A total of 1025 GSL clones were sequenced with the forward primer and analyzed by sequence comparison using the Blast algorithm (Altschul et al., supra). Several secondary metabolism loci were identified and sequenced as described in Example 1. One of these loci (herein referred to as 007A) includes a 5-gene cassette common to all enediyne biosynthetic loci. The arrangement of the five genes of the cassette in 007A is shown in FIG. 6 Interestingly, the A. orientalis genome also contains an enediyne apoprotein gene that is similar to that from the macromomycin and 009C loci as well as other chromoprotein enediynes (data not shown). Therefore, A. orientalis, the producer of the well-known glycopeptide antibiotic vancomycin, has the genomic potential to produce a chromoprotein enediyne.
Table 6 lists the results of sequence comparison using the Blast algorithm (Altschul et al., supra) for each of the enediyne-specific polypeptides from the 007A locus. Homology was determined using the BLASTP algorithm with the default parameters.
| TABLE 6 |
| 007A locus |
| GenBank homology | proposed function of | |||||
| Family | #aa | Accession, #aa | probability | identity | similarity | GenBank match |
| PKSE | 1939 | T37056, 2082aa | 5e-96 | 291/906 (32.12%) | 399/906 (44.04%) | multi-domain beta keto-acyl |
| synthase, Streptomyces coelicolor | ||||||
| NP_485686.1, 1263aa | 9e-87 | 255/897 (28.43%) | 395/897 (44.04%) | heterocyst glycolipid synthase, | ||
| Nostoc sp | ||||||
| BAB69208.1, 2365aa | 8e-86 | 285/926 (30.78%) | 393/926 (42.44%) | modular polyketide synthase, | ||
| Streptomyces avermitilis | ||||||
| TEBC | 146 | NP_214031.1, 128aa | 0.052 | 28/124 (22.58%) | 51/124 (41.13%) | hypothetical protein, Aquifex |
| aeolicus | ||||||
| UNBL | 324 | NO HOMOLOG | ||||
| UNBV | 654 | NP_618575.1, 1881aa | 0.001 | 80/332 (24.1%) | 117/332 (35.24%) | cell surface protein, |
| Methanosarcina acetivorans | ||||||
| UNBU | 329 | NP_486037.1, 300aa | 0.005 | 56/245 (22.86%) | 96/245 (39.18%) | hypothetical protein, Nostoc sp |
The 007A genes listed in Table 6 are arranged as depicted in FIG. 6. The UNBL, UNBV, and UNBU genes span approximately 4 kb and are tandemly arranged in the order listed. The PKSE and TEBC genes span approximately 6.5 kb and are tandemly arranged in the order listed. Thus these five genes may constitute two operons. The two putative operons are separated by approximately 5 kb. Although these two clusters of genes may not be transcriptionally linked to one another, they are still functionally linked. Therefore, the 007A enediyne-specific cassette is composed of five functionally linked genes and polypeptides, three of which may be expressed as a one operon and two of which may be expressed as a second operon.
The genomic sampling method described in Example 1 was applied to genomic DNA from Kitasatosporia sp. CECT 4991. This organism was not previously described to produce enediyne compounds. Both GSL and CIL genomic DNA libraries of Kitasatosporia sp. genomic DNA were prepared as described in Example 1.
A total of 1390 GSL clones were sequenced with the forward primer and analyzed by sequence comparison using the Blast algorithm (Altschul et al., supra). Surprisingly, two GSTs from Kitasatosporia sp. were identified as encoding portions of genes in the 5-gene cassette common to enediyne biosynthetic loci. One of these GSTs encoded a portion of a PKSE homologue and the other encoded a portion of a UNBV homologue. These Kitasatosporia sp. GSTs were subsequently found in a genetic locus referred to herein as 028D which includes a 5-gene cassette common to all enediyne biosynthetic loci. The arrangement of the five genes of the cassette in 028D is shown in FIG. 6. Therefore, Kitasatosporia sp. CECT 4991 has the genomic potential to produce enediyne compound(s).
Table 7 lists the results of sequence comparison using the Blast algorithm (Altschul et al., supra) for each of the enediyne-specific polypeptides from the 028D locus. Homology was determined using the BLASTP algorithm with the default parameters
| TABLE 7 |
| 028D locus |
| GenBank homology | proposed function of | |||||
| Family | #aa | Accession, #aa | probability | identity | similarity | GenBank match |
| PKSE | 1958 | BAB69208.1, 2365aa | 1e-81 | 273/926 (29.48%) | 354/926 (38.23%) | polyketide synthase, Streptomyces |
| avermitilis | ||||||
| T37056, 2082aa | 3e-78 | 263/895 (29.39%) | 356/895 (39.78%) | multi-domain beta keto-acyl | ||
| synthase, Streptomyces coelicolor | ||||||
| NP_485686.1, 1263aa | 7e-71 | 231/875 (26.4%) | 345/875 (39.43%) | heterocyst glycolipid synthase, | ||
| Nostoc sp | ||||||
| TEBC | 158 | NP_249659.1, 148aa | 1e-04 | 38/133 (28.57%) | 61/133 (45.86%) | hypothetical protein, |
| Pseudomonas aeruginosa | ||||||
| AAD49752.1, 148aa | 3e-04 | 38/138 (27.54%) | 62/138 (44.93%) | orf1, Pseudomonas aeruginosa | ||
| NP_231474.1, 155aa | 7e-04 | 31/127 (24.41%) | 61/127 (48.03%) | hypothetical protein, Vibrio | ||
| cholerae | ||||||
| UNBL | 327 | NO HOMOLOG | ||||
| UNBV | 676 | NO HOMOLOG | ||||
| UNBU | 338 | NP_486037.1, 300aa | 5e-08 | 66/240 (27.5%) | 105/240 (43.75%) | hypothetical protein, Nostoc sp |
| NP_440874.1, 285aa | 2e-04 | 51/190 (26.84%) | 98/190 (51.58%) | hypothetical protein, | ||
| Synechocystis sp | ||||||
The 028D genes listed in Table 7 are arranged as depicted in FIG. 6. The UNBV, UNBU, PKSE, and TEBC genes span approximately 9.5 kb and are tandemly arranged in the order listed. Thus these four genes may constitute an operon. This putative operon is separated from the UNBL gene, which is oriented in the opposite direction relative to the putative operon, by approximately 10.5 kb. Although the UNBL gene cannot be transcriptionally linked to the other genes, it is still functionally linked to the former. Therefore, the 028D enediyne-specific cassette is composed of five functionally linked genes and polypeptides, four of which may be expressed as a single operon. Although expression of functionally linked enediyne-specific genes may be under control of distinct transcriptional promoters they may, nonetheless, be expressed in a concerted fashion. As depicted in FIG. 6, the 028D biosynthetic locus is unique in that it is the only example whose enediyne-specific genes are not all oriented in the same direction.
The genomic sampling method described in Example 1 was applied to genomic DNA from Micromonospora megalomicea NRRL 3275. This organism was not previously described to produce enediyne compounds. Both GSL and CIL genomic DNA libraries of M. megalomicea genomic DNA were prepared as described in Example 1.
A total of 1390 GSL clones were sequenced with the forward primer and analyzed by sequence comparison using the Blast algorithm (Altschul et al., supra). Surprisingly, one GST from M. megalomicea was identified as encoding a portion of the PKSE gene present in the 5-gene cassette common to biosynthetic loci. The forward read of this GST encoded the C-terminal portion of the KS domain and the N-terminal portion of the AT domain of a PKSE gene. The complement of the reverse read of this GST encoded the C-terminal portion of the AT domain of a PKSE gene. This M. megalomicea GST was subsequently found in a genetic locus referred to herein as 054A which includes a 5-gene cassette common to all enediyne biosynthetic loci. The arrangement of the five genes of the cassette in 054A is shown in FIG. 6. Therefore, M. megalomicea has the genomic potential to produce enediyne compound(s).
Table 8 lists the results of sequence comparison using the Blast algorithm (Altschul et al., supra) for each of the enediyne-specific polypeptides from the 054A locus. Homology was determined using the BLASTP algorithm with the default parameters.
| TABLE 8 |
| 054A locus |
| GenBank homology | proposed function of | |||||
| Family | #aa | Accession, #aa | probability | identity | similarity | GenBank match |
| PKSE | 1927 | NP_485686.1, 1263aa | 3e-76 | 247/886 (27.88%) | 365/886 (41.2%) | heterocyst glycolipid synthase, |
| Nostoc sp | ||||||
| T37056, 2082aa | 3e-75 | 269/903 (29.79%) | 354/903 (39.2%) | multi-domain beta keto-acyl | ||
| synthase, Streptomyces coelicolor | ||||||
| BAB69208.1, 2365aa | 9e-74 | 277/923 (30.01%) | 359/923 (38.89%) | polyketide synthase, Streptomyces | ||
| avermitilis | ||||||
| TEBC | 154 | NP_249659.1, 148aa | 2e-06 | 43/147 (29.25%) | 66/147 (44.9%) | hypothetical protein, |
| Pseudomonas aeruginosa | ||||||
| AAD49752.1, 148aa | 2e-05 | 42/147 (28.57%) | 65/147 (44.22%) | orf1, Pseudomonas aeruginosa | ||
| CAB50777.1, 150aa | 1e-04 | 40/139 (28.78%) | 61/139 (43.88%) | hypothetical protein, | ||
| Pseudomonas putida | ||||||
| UNBL | 322 | NO HOMOLOG | ||||
| UNBV | 659 | CAC44518.1, 706aa | 0.048 | 50/166 (30.12%) | 67/166 (40.36%) | putative secreted esterase, |
| Streptomyces coelicolor | ||||||
| UNBU | 354 | NP_486037.1, 300aa | 5e-06 | 66/268 (24.63%) | 118/268 (44.03%) | hypothetical protein, Nostoc sp |
The 054A genes listed in Table 8 are arranged as depicted in FIG. 6. The UNBL, PKSE, and TEBC genes span approximately 7.5 kb and are tandemly arranged in the order listed. The UNBV and UNBU genes span approximately 3 kb and are tandemly arranged in the order listed. Thus these five genes may constitute two operons. The two putative operons are separated by approximately 2 kb. Therefore, the 054A enediyne-specific cassette is composed of five functionally linked genes and polypeptides, three of which may be expressed as a one operon and two of which may be expressed as another operon.
The genomic sampling method described in Example 1 was applied to genomic DNA from Saccharothrix aerocolonigenes ATCC 39243. This organism was not previously described to produce enediyne compounds Both GSL and CIL genomic DNA libraries of Saccharothrix aerocolonigenes genomic DNA were prepared as described in Example 1.
A total of 513 GSL clones were sequenced with the forward primer and analyzed by sequence comparison using the Blast algorithm (Altschul et al., supra). Several secondary metabolism loci were identified and sequenced as described in Example 1. One of these loci (herein referred to as 132H) includes a 5-gene cassette common to all enediyne biosynthetic loci. The arrangement of the five genes of the cassette in 132H is shown in FIG. 6. Therefore, Saccharothrix aerocolonigenes has the genomic potential to produce enediyne compound(s).
Table 9 lists the results of sequence comparison using the Blast algorithm (Altschul et al., supra) for each of these enediyne-specific polypeptides from the 132H locus. Homology was determined using the BLASTP algorithm with the default parameters.
| TABLE 9 |
| 132H locus |
| GenBank homology | proposed function of | |||||
| Family | #aa | Accession, #aa | probability | identity | similarity | GenBank match |
| PKSE | 1892 | BAB69208.1, 2365aa | 1e-108 | 312/872 (35.78%) | 404/872 (46.33%) | polyketide synthase, Streptomyces |
| avermitilis | ||||||
| T37056, 2082aa | 1e-101 | 290/886 (32.73%) | 407/886 (45.94%) | multi-domain beta keto-acyl | ||
| synthase, Streptomyces coelicolor | ||||||
| T30183, 2756aa | 4e-94 | 271/886 (30.59%) | 398/886 (44.92%) | hypothetical protein. Shewanella | ||
| sp | ||||||
| TEBC | 143 | NP_442358.1, 138aa | 0.001 | 32/127 (25.2%) | 48/127 (37.8%) | hypothetical protein, |
| Synechocystis sp. | ||||||
| UNBL | 313 | NO HOMOLOG | ||||
| UNBV | 647 | AAD34550.1, 1529aa | 0.012 | 76/304 (25%) | 105/304 (34.54%) | esterase, Aspergillus terreus |
| UNBU | 336 | NP_486037.1, 300aa | 1e-04 | 42/1 72 (24.42%) | 79/172 (45.93%) | hypothetical protein, Nostoc sp |
| NP_440874.1, 285aa | 1e-04 | 48/181 (26.52%) | 90/181 (49.72%) | hypothetical protein, | ||
| Synechocystis sp | ||||||
The 132H genes listed in Table 9 are arranged as depicted in FIG. 6. The UNBL, UNBV, UNBU, PKSE, and TEBC genes span approximately 10.5 kb and are tandemly arranged in the order listed. Thus, these five genes may constitute an operon. Therefore, the 132H enediyne-specific cassette is composed of five functionally linked genes and polypeptides that may be expressed as a single operon.
The genomic sampling method described in Example 1 was applied to genomic DNA from Streptomyces kaniharaensis ATCC 21070 This organism was not previously described to produce enediyne compounds. Both GSL and CIL genomic DNA libraries of S. kaniharaensis genomic DNA were prepared as described in Example 1.
A total of 1020 GSL clones were sequenced with the forward primer and analyzed by sequence comparison using the Blast algorithm (Altschul et al., supra). Surprisingly, one GST from S. kaniharaensis was identified as encoding a portion of the PKSE gene present in the 5-gene cassette common to biosynthetic loci. The forward read of this GST encoded the N-terminal portion of the KS domain of a PKSE gene. The complement of the reverse read of this GST encoded the C-terminal portion of the AT domain of a PKSE gene. This S. kaniharaensis GST was subsequently found in a genetic locus referred to herein as 135E which includes a 5-gene cassette common to all enediyne biosynthetic loci. The arrangement of the five genes of the cassette in 135E is shown in FIG. 6 Therefore, S. kaniharaensis has the genomic potential to produce enediyne compound(s).
Table 10 lists the results of sequence comparison using the Blast algorithm (Altschul et al., supra) for each of the enediyne-specific polypeptides from the 135E locus. Homology was determined using the BLASTP algorithm with the default parameters.
| TABLE 10 |
| 135E locus |
| GenBank homology | proposed function of | |||||
| Family | #aa | Accession, #aa | probability | identity | similarity | GenBank match |
| PKSE | 1933 | T37056, 2082aa | 1e-65 | 282/909 (31.02%) | 365/909 (40.15%) | multi-domain beta keto-acyl |
| synthase, Streptomyces coelicolor | ||||||
| BAB69208.1, 2365aa | 3e-84 | 285/925 (30.81%) | 366/925 (39.57%) | polyketide synthase, Streptomyces | ||
| avermitilis | ||||||
| T30937, 1053aa | 2e-69 | 246/907 (27.12%) | 356/907 (39.25%) | glycolipid synthase, Nostoc | ||
| punctiforme | ||||||
| TEBC | 154 | NP_249659.1, 146aa | 2e-07 | 41/132 (31.06%) | 63/132 (47.73%) | hypothetical protein, |
| Pseudomonas aeruginosa | ||||||
| AAD49752.1, 148aa | 2e-06 | 40/132 (30.3%) | 62/132 (46.97%) | orf1, Pseudomonas aeruginosa | ||
| NP_214031.1, 128aa | 5e-04 | 35/127 (27.56%) | 60/127 (47.24%) | hypothetical protein, Aquifex | ||
| aeolicus | ||||||
| UNBL | 323 | NO HOMOLOG | ||||
| UNBV | 655 | CAC44518.1, 706aa | 9e-04 | 41/135 (30.37%) | 59/135 (43.7%) | putative secreted esterase, |
| Streptomyces coelicolor | ||||||
| UNBU | 346 | NP_486037.1, 300aa | 4e-09 | 52/191 (27.23%) | 87/191 (45.55%) | hypothetical protein, Nostoc sp |
| NP_440874.1, 285aa | 9e-06 | 47/197 (23.86%) | 89/197 (45.18%) | hypothetical protein, | ||
| Synechocystis sp | ||||||
The 135E genes listed in Table 10 are arranged as depicted in FIG. 6. The UNBL, UNBV, and UNBU genes span approximately 4 kb and are tandemly arranged in the order listed. The PKSE and TEBC genes span approximately 6.5 kb and are tandemly arranged in the order listed. Thus these five genes may constitute two operons. The two putative operons are separated by approximately 6 kb. Although these two clusters of genes may not be transcriptionally linked to one another, they are still functionally linked. Therefore, the 135E enediyne-specific cassette is composed of five functionally linked genes and polypeptides, three of which may be expressed as a one operon and two of which may be expressed as another operon.
The genomic sampling method described in Example 1 was applied to genomic DNA from Streptomyces citricolor IFO 13005. This organism was not previously described to produce enediyne compounds. Both GSL and CIL genomic DNA libraries of S. citricolor genomic DNA were prepared as described in Example 1.
A total of 1245 GSL clones were sequenced with the forward primer and analyzed by sequence comparison using the Blast algorithm (Altschul et al., supra). Several secondary metabolism loci were identified and sequenced as described in Example 1. One of these loci (herein referred to as 145B) includes a 5-gene cassette common to all enediyne biosynthetic loci. The arrangement of the five genes of the cassette in 145B is shown in FIG. 6. Therefore, S citricolor has the genomic potential to produce enediyne compound(s).
Table 11 lists the results of sequence comparison using the Blast algorithm (Altschul et al., supra) for each of the enediyne-specific polypeptides from the 145B locus. Homology was determined using the BLASTP algorithm with the default parameters.
| TABLE 11 |
| 145B locus |
| GenBank homology | proposed function of GenBank | |||||
| Family | #aa | Accession, #aa | probability | identity | similarity | match |
| PKSE | 1958 | T37056, 2082aa | 4e-88 | 285/929 (30.68%) | 378/929 (40.69%) | multi-domain beta keto-acyl |
| synthase, Streptomyces coelicolor | ||||||
| BAB69208.1,2365aa | 3e-82 | 284/923 (30.77%) | 375/923 (40.63%) | polyketide synthase, Streptomyces | ||
| avermitilis | ||||||
| AAL01060.1,2573aa | 5e-78 | 240/855 (28.07%) | 354/855 (41.4%) | polyunsaturated fatty acid | ||
| synthase, Photobacterium | ||||||
| profundum | ||||||
| TEBC | 165 | NP_249659.1,148aa | 2e-07 | 39/133 (29.32%) | 60/133 (45.11%) | hypothetical protein, |
| Pseudomonas aeruginosa | ||||||
| NP_231474.1,155aa | 3e-04 | 30/127 (23.62%) | 60/127 (47.24%) | hypothetical protein. Vibrio | ||
| choleree | ||||||
| CAB50777 1,150aa | 4e-04 | 37/135 (27.41%) | 58/135 (42.96%) | hypothetical protein, | ||
| Pseudomonas pulida | ||||||
| UNBL | 324 | NO HOMOLOG | ||||
| UNBV | 659 | NP_618575.1,1881aa | 0.003 | 57/245 (23.27%) | 85/245 (34.69%) | cell surface protein, |
| Methanosarcina acetivorans | ||||||
| UNBU | 337 | NP_486037.1,300aa | 0.002 | 62/267 (23.22%) | 109/267 (40.82%) | hypothetical protein, Nostoc sp. |
The 145B genes listed in Table 11 are arranged as depicted in FIG. 6. The UNBV, and UNBU genes span approximately 3 kb and are tandemly arranged in the order listed. The PKSE and TEBC genes span approximately 6.5 kb and are tandemly arranged In the order listed. Thus these four genes may constitute two operons. The two putative operons are separated by approximately 9.5 kb that includes the UNBL gene. Although these genes may not be transcriptionally linked to one another, they are still functionally linked. Therefore, the 145B enediyne-specific cassette is composed of five functionally linked genes and polypeptides, four of which may be expressed as two operons each containing two genes.
The amino acid sequences of the PKSE, TEBC, UNBL, UNBV, and UNBU protein families from the ten enediyne biosynthetic loci described above were compared to one another by multiple sequence alignment using the Clustal algorithm (Thompson et al., 1994, Nucleic Acids Res. 22(2):4673-4680; Higgins et al., 1996, Methods Enzymol. 266:383-402, Higgins and Sharp (1988) Gene Vol. 73 pp. 237-244). The alignments are shown in FIGS. 8, 11, 12, 13, and 14, respectively. Where applicable, conserved residues or motifs important for the function are highlighted in black and additional features are indicated.
The PKSE family is a family of polyketide synthases that are involved in formation of enediyne warhead structures. FIG. 7 summarizes schematically the domain organization of a typical PKSE, showing the position and relative size of the putative domains based on Markov modeling of PKS domains: ketosynthase (KS), acyltransferase (AT), acyl carrier protein (ACP), ketoreductase (KR), dehydratase (DH), and 4′-phosphopantetheinyl transferase (PPTE) activities. Using the calicheamicin PKSE as an example, the full-length PKSE protein is 1919 amino acids in length As indicated in FIG. 8 for the calicheamicin PKSE, the KS domain spans positions 3 to 467 of the PKSE; the AT domain spans positions 482 to 905 of the PKSE, the ACP domain spans positions 939 to 1009 of the PKSE; a small domain of unknown function of approximately 130 amino acids (spanning positions 1025 to 1144 of the PKSE) is present between the ACP and the KR domains; the KR domain spans positions 1153 to 1414 of the PKSE; the DH domain spans positions 1421 to 1563 of the PKSE; a C-terminal 4′-phosphopantetheinyl transferase (PPTE) domain spans positions 1708 to 1914 of the PKSE; a small domain of about 110 amino acids (spanning positions 1591 to 1701 of the PKSE) is present between the DH and the PPTE domains.
The PKSE contains a conserved unusual ACP domain (FIG. 9A). This ACP domain contains several conserved residues that are also present in the well-characterized ACP of the actinorhodin type II PKS (PDBid:1AF8 in FIG. 9B). The most important conserved resudue is the serine residue to which a 4′-phosphopantetheine prosthetic group is covalently attached (corresponding to Ser-42 of 1AF8). In addition to Ser-42, several surface-exposed charged residues are conserved, namely Glu-20, Asp-37, and Glu-84 (highlighted in the alignment of FIG. 9A and highlighted and labeled in the three dimensional structure shown in FIG. 9B). Several buried uncharged or non-polar residues that may be important in stabilizing the overall fold of the ACP domain are also conserved, namely Leu-14, Val-15, Gly-57, Pro-71, Ala-83, and Ala-85 (highlighted in the alignment and three dimensional structure shown in FIG. 9). Interestingly, the conserved serine (Ser-42) is almost always immediately preceeded by another serine in the ACP domains of PKSEs. As shown in FIG. 8, nine of the ten PKSE members contain this double serine arrangement, the only exception being that from the 132H locus in which the first of the serine is replaced by a threonine. Therefore, PKSEs contain ACP domains with two potential hydroxyl-containing residues in close proximity to one another. These ACPs may carry two 4′-phosphopantetheine prosthetic groups. The positioning of the KR and DH domains after the ACP is unusual among PKSs, but is described in one of the three PKS-like components of the eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) biosynthetic machinery (Metz et al. (2001) Science Vol. 293 pp. 290-293). The unusual domain organization shared by the PKSE genes of the invention and the PKS-like synthetase involved in synthesis of polyunsaturated fatty acids suggests that enediyne warhead formation involves intermediates similar to those generated during assembly of polyunsaturated fatty acids.
The presence of an unusual ACP domain in the PKSE, and the absence of any obvious 4′-phosphopantetheinyl transferase or holo-ACP synthase (involved in phosphopantetheinyl transfer onto the conserved serine of the ACP) common to enediyne biosynthetic loci led us to search for the presence of a 4′-phosphopantetheinyl transferase. We examined the conserved domains of the PKSE whose functions were unaccounted for as well as the UNBL, UNBV, and UNBU polypeptides in more detail and determined that the PPTE domain was a 4′-phosphopantetheinyl transferase.
The C-terminal domains of the PKSEs from the biosynthetic loci of three known enediynes, namely neocarzinostatin (NEOC, aa 1620-1977), calicheamicin (CALI, aa 1562-1919) and macromomycin (MACR, aa 1582-1936), were analyzed for their folding using secondary structure predictions and salvation potential information (Kelley et al. (2000) J. Mol. Biol. Vol. 299 pp. 499-520). Comparison searches using a database of known 3-D structures of proteins revealed similarities between the C-terminal domains of the PKSEs and Sfp, the 4′-phosphopantetheinyl transferase from the Bacillus subtilis surfactin biosynthetic locus (Reuter et al. (1999) EMBO Vol. 18 pp. 6823-6831). The alignment shown in FIG. 10A indicates the predicted secondary structures of all three C-terminal PKSE domains (PPTE domains) along with the X-ray crystallography-determined secondary structure of Sfp (PDB id: 1QR0). Alpha-helices are indicated by rectangles and β-sheets by arrows.
An overall conservation of secondary structure over the entire length of the proteins is evident. All major structural constituents of Sfp, namely α-helices α1-α5 and β-sheets β2-β4 and β8 are also present in PPTE domains. Similar to Sfp, the PPTE domains are predicted to have an intramolecular 2-fold pseudosymmetry.
The loop formed between α5 and β7 in Sfp is not present in the PPTE domains. It is believed that this region of Sfp is in part responsible for ACP recognition and contributes to the broad substrate specificity observed for this enzyme. The size of this loop appears to vary among phosphopantetheinyl transferases, as the EntD enzyme, which exhibits a greater ACP substrate specificity than Sfp, has a region between α5 and β7 structures shorter than that of Sfp but longer than that found in the PPTE domains. The short α5/β7 loop region found in the PPTE domains may reflect the need for a specific interaction with the rather unusual ACP domain found in the PKSE enzymes. Residues conserved in all phosphopantetheinyl transferases and shown in Sfp to make contacts with the CoA substrate and Mg++ cofactor are also conserved in the PPTE domains (highlighted in FIG. 10A).
Referring to FIG. 10B, Sfp residues Lys-28 and Lys-31 make salt bridges with the 3′-phosphate of CoA and are not found in the PPTE domains; however, a similar interaction could be provided by the corresponding conserved residue Arg-26. Sfp Thr-44 makes a hydrogen bond and His-90 a salt bridge with the 3′-phosphate of CoA; similar hydrogen bonding potential is provided by the conserved serine found at the corresponding position 44 of the PPTE domains, while the histidine 90 residue is absolutely conserved in all three PPTE domains.
Sfp amino acid residues 73-76 hold in place the adenine base of CoA. The main chain carbonyl of Tyr-73 forms a hydrogen bond with the adenine amino group and residues Gly-74, Lys-75 and Pro-76 hold firmly in place the adenine ring. In the PPTE domains, a conserved aspartic acid that may form a salt bridge with the adenine amino group is substituted for Tyr-73 and a conserved arginine residue is substituted for Lys-75. The remaining two residues, Gly-74 and Pro-76, are also found in the PPTE domains.
Sfp residues Ser-89 and His-90 interact via hydrogen bonding and salt bridging with the α-phosphate of the CoA substrate. Similarly, Lys-155 in helix α5 interacts with the CoA α-phosphate. The His-90 and Lys-155 residues are highly conserved in the PPTE domains whereas Ser-89 is found only in the neocarzinostatin PPTE domain.
Sfp residues Asp-107, Glu-109 in the β4 sheet and Glu-151 in the α5 helix participate in the complexation of a metal ion (presumably Mg++) together with the α and β phosphates of the CoA pyrophosphate and a water molecule. All three residues are also conserved in PPTE domains. Importantly, Asp-107 was altered by mutagenesis in Sfp and shown to be critical for catalytic activity but not for CoA binding of the protein suggesting the Mg++ ion is important for catalysis (Quadri et al., 1998, Biochemistry, Vol. 37, 1585-1595).
In the Sfp protein, residue Glu-127 salt-bridges the amino group of Lys-150. In the PPTE domains, a Glu/Asp residue is found at the corresponding position 127, whereas Lys-150 is not conserved Since Glu-127 is highly conserved in the PPTE domains, it is conceivable that the role of Lys-150 is served by other basic residues in the vicinity, namely the conserved arginine at the corresponding position 145. Residue Trp-147, conserved in all phosphopantetheinyl transferases and shown to be critical for catalytic activity, is also present in all three PPTE domains (Quadri et al., 1998, Biochemistry, Vol. 37, 1585-1595).
The presence of a phosphopantetheinyl domain (PPTE) in the C-terminal part of the PKSE enediyne warhead PKS is reminiscent of the 4′-phosphopantetheinyl domain found in the yeast fatty acid synthase (FAS) complex, where it resides in the C-terminal region of the FAS α subunit. FAS is capable of auto-pantetheinylation resulting in a post-translational autoactivation of this enzyme (Fichtlscherer et al., 2000, Eur. J. Biochem., Vol. 267, 2666-2671). In a similar manner, the PKSE warhead PKSs are likely to be capable of auto-pantetheinylation and activation of their ACP domains before proceeding to the iterative synthesis of the polyunsaturated polyketide intermediate forming the enediyne core.
The ACP and KR domains of the PKSEs are separated by approximately 130 amino acids. The presence of a considerable number of invariable residues within this stretch of amino acids suggests that the putative domain formed by these 130 amino acids has a functional role. The putative domain may serve a structural role, for example as a protein-protein interaction domain or it may form a cleft adjacent to the ACP that acts as a “chain length factor” for the growing polyketide chain. A search of NCBI's Conserved Domain Database with Reverse Position Specific BLAST revealed several short stretches of homology to proteins that bind substrates such as ATP, AMP, NAD(P), as well as folates and double stranded RNA (adenosine deaminase). Thus, the putative domain may adopt a structure accommodating an adenosine or adenosine-like structure and serve as a cofactor-binding site. Alternatively, the domain might interact with the adenosine moiety of coenzyme A (CoA). As such, the physical proximity of the CoA to the ACP domain may facilitate the phosphopantetheinylation of the ACP. Yet another possibility is that a molecule of CoA is noncovalently-bound to the putative domain downstream of the ACP via its adenosine moiety and its phosphopantetheinyl tail protrudes out from the enzyme, as would the phosphopantetheinyl tail on the holo-ACP. Alternatively, the PPTE domain can carry a molecule of noncovalently-bound CoA. Thus, it is expected that KS carries out several iterations of condensation reactions involving the transfer of an acetyl group from an acetyl-ACP-thioester to a growing acyl-CoA chain that is non-covalently bound to the enzyme. The proposed scenario explains the presence of the TEBC, an acyl-CoA thioesterase rather than a “conventional” PKS-type thioesterase: the full-length polyketide chain generated by the PKSE is not tethered to the holo-ACP, but rather to a non-covalently bound CoA and the TEBC hydrolyzes the thioester bond of a polyketide-CoA to release the full-length polyketide and CoA. A CoA-activated thioester may render the polyketide more accessible to auxiliary enzymes involved in cyclization and acetylenation prior to or concomitant to hydrolytic release by TEBC.
FIG. 11 is a Clustal amino acid alignment showing the relationship between the TEBC family of proteins and the enzyme 4-hydroxybenzoyl-CoA thioesterase (1BVQ) of Pseudomonas sp. Strain CBS-3 for which the crystal structure has been previously determined (Benning et al. (1998) J. Biol. Chem. Vol. 273 pp. 33572-33579). The black bars highlight the three regions of conservation believed to play important roles in the catalysis for 4-hydroxybenzoyl-CoA thioesterase. Homology between the TEBC family of proteins and 1BVQ is concentrated in these three highlighted regions.
FIG. 12 is a Clustal amino acid alignment of the UNBL family of proteins. The UNBL family of proteins represents a novel group of conserved proteins that are unique to enediyne biosynthetic loci. The UNBL proteins are rich in basic residues and contain several conserved or invariant histidine residues. Besides the PKSE and TEBC proteins, the UNBL proteins are the only other proteins predicted by the PSORT program (Nakai et al. (1999) Trends Biochem. Sci. Vol. 24 pp. 34-36) to be cytosolic that are encoded by the enediyne warhead gene cassette and thus represent the best candidates for the acetylenase activity that is required to introduce triple bonds into the warhead structure.
FIG. 13 is a Clustal amino acid alignment of the UNBV family of proteins. PSORT analysis of the UNBV family of proteins predicts that they are secreted proteins. The approximate position of the putative cleavable N-terminal signal sequence is indicated above the alignment. The UNBV proteins display considerable amino acid conservation but do not have any known homologue. Thus, the UNBV family of proteins represents a novel group of conserved proteins of unknown function that are unique to enediyne biosynthetic loci.
FIG. 14 is a Clustal amino acid alignment of the UNBU family of proteins. PSORT analysis of the UNBU family of proteins predicts that they are integral membrane proteins with seven or eight putative membrane-spanning alpha helices (indicated by dashes in FIG. 14). The UNBU proteins display considerable amino acid conservation but do not have any known homologue. The UNBU family of proteins represents a novel group of conserved proteins that are unique to enediyne biosynthetic loci.
UNBU is likely involved in transport of the enediynes across the cell membrane. UNBU may also contribute, in part, to the biochemistry involved in the completion of the warhead. In the case of chromoprotein enediynes, the apoprotein carries its own cleavable N-terminal signal sequence and is probably exported independently of the chromoprotein by the general protein secretion machinery. Formation of the bioactive warhead, export, and binding of the chromophore and protein component must occur in and around the cell membrane to minimize damage to the producer and to maximize the stability of the natural product. UNBV is predicted to be an extracellular protein. UNBV may finalize or stabilize the warhead structure. UNBV may act in close association with the extracellularly exposed portion(s) of UNBU.
To date, we have sequenced over ten enediyne biosynthetic loci that contain the 5-gene cassette made up of PKSE, TEBC, UNBL, UNBV, and UNBU genes. In all cases, the PKSE and TEBC genes are adjacent to one another and the TEBC gene is always downstream of the PKSE gene. Moreover, these two genes are usually, if not always, translationally coupled. These observations suggest that the expression of the PKSE and TEBC genes is tightly coordinated and that their gene products, i.e, polypeptides, act together. Likewise, the UNBV and UNBU genes are always adjacent to one another and the UNBU gene is always downstream of the UNBV gene. Moreover, these two genes are usually, if not always, translationally coupled. These observations suggest that the expression of the UNBV and UNBU genes is tightly coordinated and that their gene products, i.e., polypeptides, act together.
Without intending to be limited to any particular biosynthetic scheme or mechanism of action, the genes and proteins of the present invention can explain formation of enediyne warheads in both chromoprotein enediynes and non-chromoprotein enediynes.
The PKSE is proposed to generate a highly conjugated polyunsaturated hepta/octaketide intermediate in a manner analogous to the action of polyunsaturated fatty acid synthases (PUFAs). The polyunsaturated fatty acyl intermediate is then modified by tailoring enzymes involving one or more of UNBL, UNBU and UNBV to introduce the acetylene bonds and form the ring structure(s). The conserved auxiliary proteins UNBL, UNBU and UNBV are expected to be involved in modulating iterations performed by the PKSE, or in subsequent transformations to produce the enediyne core in a manner analogous to action of lovastatin monaketide synthase, a fungal iterative type I polyketide synthase that is able to perform different oxidative/reductive chemistry at each iteration with the aid of at least one auxiliary protein (Kennedy et al., 1999, Science Vol. 284 pp. 1368-1372).
The acetate enrichment pattern of the enediyne moiety of esperamicin and dynemicin suggest that both are derived from an intact heptaketide/octaketide. There has been suggestion that esperamicin and dynemicin may share a common precursor (Lam et. al., J. Am. Chem. Soc. 1993, Vol. 115 pp. 12340). However, in the case of neocarzinostatin, representative of other chromoprotein enediynes, incorporation studies investigating carbon-carbon connectivities revealing that the final enediyne core contains uncoupled acetate atoms (Hensens et al., 1989 JACS, Vol. 111, pp. 3295-3299), and other studies regarding polyacetylene biosynthesis (Hensens et. al., supra), suggest that the chromoprotein enediyne precursors are distinct from those of the non-chromoprotein enediynes. Thus, prior art studies regarding formation of the enediyne core teach away from the present invention that genes and proteins common to both chromoprotein enediynes and non-chromoprotein enediynes are responsible for formation of the warhead in both classes of enediynes.
We propose that skeletal rearrangements may account for the distinct chromoprotein/nonchromoprotein enediyne labeling patterns. For instance, thermal electrocyclic rearrangement of an intermediate cyclobutene to a 1,3 diene could result in an isotopic labeling pattern consistent with that which has been reported.
Accordingly, the warhead precursor in the formation of neocarzinostatin could be a heptaketide, similar to that proposed for the other classes of enediynes. Since calicheamicin and esperimicin do not contain any uncoupled acetates, the common unsaturated polyketidic precursor must rearrange differently from the chromoprotein class. However, the proposed biosynthetic scheme is consistent with one aspect of the present invention, namely that warhead formation in all enediynes involves common genes, proteins and common precursors.
Escherichia coli was used as a general host for routine subcloning. Streptomyces lividans TK24 was used as a heterologous expression host. The plasmid pECO1202 was derived from plasmid pANT1202 (Desanti, C. L. 2000. The molecular biology of the Streptomyces snp Locus, 262 pp., Ph.D dissertation, Ohio State Univ., Columbus, Ohio) by deleting the Kpnl site in the multi-cloning site (MCS). pECO1202RBS contains a DNA sequence encoding a putative ribosome-binding site (AGGAG) introduced just upstream of the Clal site located in the MCS of pECO1202.
E. coli strains carrying plasmids were grown in Luria-Bertani (LB) medium and were selected with appropriate antibiotics. S. lividans TK24 strains were grown on R2YE medium. (Kieser, T. et al., Practical Streptomyces Genetics, The John Innes Foundation, Norwich, United Kingdom, 2000).
Preparation of S. lividans TK24 protoplasts was carried out using the standard protocols. (Kieser et al., supra). Polyethylene glycol-induced protoplast transformation was carried out with 1 μg DNA per transformation. After protoplast regeneration on R5 agar medium for 16 h at 30° C., transformants were selected by overlaying each R5 plate with 50 μg/ml apramycin solutions. Transformants were grown in 50 ml flasks containing R2YE medium plus apramycin for seven days.
SDS-PAGE and Western-blotting were carried out by standard procedures (Sambrook, J. et al. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). Penta-His antibody was obtained from Qiagen. Western blots were performed using the ECL detection kit from Amersham Pharmacia biotech using the manufacturer's suggested protocols. One milliliter of seven-day S. lividans culture was centrifuged and mycelium resuspended in cold extraction buffer (0.1M Tris-HCl, pH 7.6, 10 mM MgCl2 and 1 mM PMSF). The mycelium was sonicated 4×20 sec on ice with 1 min intervals to release soluble protein. After 10 min centrifugation at 20,000 g, the supernatant and pellet fractions were diluted with sample buffer and subjected to SDS-PAGE and Western-blotting analysis.
DNA manipulations used in construction of expression plamsids were carried out using standard methods (Sambrook, J. et al., supra). The plasmid pECO1202 was used as the parent plasmid. Cosmid 061CR, carrying the calicheamicin biosynthetic gene locus was digested with Mfel, and the restriction fragments were made blunt ended by treatment with the Klenow fragment of DNA polymerase I. Upon additional digestion with Bg/II after phenol extraction and ethanol precipitation, the resulting 11.5 kb blunt-ended, Bg/II fragment was gel purified and cloned into pECO1202 (previously digested with EcoRI, made blunt ended by treatment with Klenow fragment of polymerase I, then digested with BamHI), to yield pECO1202-CALI-1, as shown in FIG. 15.
PCR was carried out on a PTC-100 programmable thermal controller (MJ research) with Pfu polymerase and buffer from Stratagene. A typical PCR mixture consisted of 10 ng of template DNA, 20 μM dNTPs, 5% dimethyl sulfoxide, 2 U of Pfu polymerase, 1 μM primers, and 1× buffer in a final volume of 50 μl. The PCR temperature program was the following: initial denaturation at 94° C. for 2 min, 30 cycles of 45 sec at 94° C., 1 min at 55° C., and 2 min at 72° C., followed by an additional 7 min at 72° C. A PCR product amplified by primer 1402, 5′-GAGTTGTATCGATGAGCAGGATCGCCGTCGTCGGC-3′ [containing Cla I site (italic) and the start codon of PKSE gene (bold)], and primer 1420, 5′GTAGCCGGCCGCCTCCGGCC (corresponding to the nucleotide sequence 940 to 959 bp of PKSE), was digested with ClaI and NheI and gel purified. This fragment was then cloned into ClaI, NheI digested pECO1202-CALI-1 to yield pECO1202-CALI-5 (FIG. 16).
PCR products were amplified by primer 1421, 5′-GACCTGCCGTACACCGTCTCC-3′ (corresponding to the nucleotide sequence 5367 to 5387 bp of PKSE), and primer 1403, 5′-CCCAAGCTTCAGTGGTGGTGGTGGTGGTGCCCCTGCCCCACCGTGGCCGAC-3′[containing a His Tag (underlined), HindIII site (italic) and stop codon of TEBC (bold)], or primer 1500, 5′-CCCAAGCTTCACCCCTGCCCCACCGTGGCCGAC-3′(containing HindIII site (italic) and stop codon (bold) of TEBC). These PCR products were digested with HindIII and PstI, gel purified, and then cloned into HindIII, PstI digested pECO1205 to yield pECO1202-CALI-2 (with HisTag) and pECO1202-CALI-3 (without HisTag), respectively (FIG. 16).
The ClaI and HindIII fragments from pECO1202-CALI-2 and pECO1202-CALI-3 were cloned into pECO1202RBS to yield pECO1202-CALI-6 (with HisTag) and pECO1202-CALI-7 (without HisTag), respectively, as shown in FIG. 16.
Six transformants of S. lividans TK24 harboring pECO1202-CALI-2 were analyzed for expression of the His-tagged TEBC protein. Referring to FIG. 17, lane M provides molecular weight markers; lanes 1 to 6 represent crude extracts of independent transformants of S. lividans TK24 harboring pECO1202-CALI-2; lane 7 represents a crude extract of S. lividans TK24 harboring pECO1202-CALI-4; and lane 8 represents a crude extract of S. lividans TK24 harboring pECO1202 (control). TEBC protein expression was detected in four pECO1202-CALI-2 transformants by Western blotting using an antibody that recognizes the His-tag (lanes 2, 3, 5, 6). TEBC protein expression was also observed in the transformant of S. lividans TK24 harboring pECO1202-CALI-4 (lane 7).
As shown in FIG. 12, the TEBC protein was expressed as a soluble protein in S. lividans although the pellet fraction also contains TEBC protein, perhaps reflecting insoluble protein or incomplete lysis of S. lividans by the sonication procedure used. FIG. 12 provides an analysis of His-tagged TEBC protein derived from recombinant S. lividans TK24 by immunoblotting. The soluble and insoluble protein fractions of S. lividans transformants were separated by 12% SDS-polyacrylamide gel electrophoresis, blotted to PVDF membrane, and detected detection with the Penta-His antibody. Referring to FIG. 12, lane M provides molecular weight markers; lane 1 to 6 represent soluble (S) and pellet (P) protein fractions of independent transformants of S. lividans TK24 harboring pECO1202-CALI-2; lane C represents protein fractions of S. lividans TK24 harboring pECO1202 (control).
To confirm that the PKSE is critical to the biosynthesis of enediynes, the PKSE gene of the calicheamicin producer, M. echinospora, was disrupted by introduction of an apramycin selectable marker as follows. M. echinospora was grown with a 1:100 fresh inoculum in 50 mL MS medium (Kieser et al., supra) supplemented with 5% PEG 8000 and 5 mM MgCl2 for 24-36 h and 6 h prior to harvest, 0.5% glycine was added. The digest of the cell wall was accomplished via published procedures with the exception that 5 mg mL−1 lysozyme and 2000 U mutanolysin were used. Under these conditions, protoplast formation was complete within 30-60 min after which the mixture was filtered twice through cotton wool. Transformation was accomplished via typical methodology (Kieser et al., supra) with a 1:1 mixture of T-buffer and PEG 2000 containing up to 10 μg of alkaline denatured DNA per transformation. The protoplasts were then plated on R2YE plates supplemented with 10 mg L−1 CoCl2 and submitted to antibiotic pressure (70 μg mL−1 apramycin) after 3-4 days. To date, all attempts to use methods other than protoplast chemical transformation (e.g. phage transduction, conjugation and electroporation) have failed to introduce DNA into M. echinospora. Low transformation efficiencies were observed in all calicheamicin-producing Micromonospora strains tested, including those developed from strain improvement efforts. In comparison to other actinomycetes, M. echinospora protoplast regeneration was found to be slow (˜4 weeks). Moreover, integration into the locus requires homologous fragments exceeding 3 kb in size as constructs containing PKSE fragments (or other calicheamicin gene fragments) smaller than 3 kb all failed to integrate into the chromosome (data not shown).
Nine independent apramycin-resistant PKSE disruption clones were obtained. All nine isolates mapped consistently with the expected PKSE gene disruption both by PCR fragment amplification and by Southern hybridization (data not shown). All nine PKSE disruption mutants and two parental controls were subsequently tested in parallel for calicheamicin production. Extracts from these strains were prepared as follows. Fresh M. echinospora cells grown in R2YE were inoculated 1:100 in 10 mL medium E (Kieser et al., supra) in stoppered 25 ml glass tubes containing a 4 cm stainless coil spring for better aeration and incubated on an orbital shaker with 230 rpm at 28° C. for one to three weeks. A 600 μl aliquot was removed at various time points, extracted with an equal volume of EtOAc and centrifuged at 10000×g for 5 min in a benchtop centrifuge. The supernatant was concentrated to dryness, the pellet redissolved in 200 μl acetonitrile, centrifuged again and the supernatant removed, concentrated to dryness and the residual material finally dissolved in 10 μl acetonitrile. One μl of this solution was utilized for the bioassays and the remaining 8 μl aliquot was utilized for analysis by HPLC (Ultrasphere-ODS chromatography, 5 μm, 4.6 mm×250 mm, 55:45 CH3CN-0.2 NH4OAc, pH 6.0, 1.0 mL min−1, 280 nm detection). A typical M. echinospora fermentation contains a mixture of calicheamicins that are resolved by HPLC-γ1I (retention time—7 min, ˜60%), δ1I (retention time—5.7 min, ˜30%), and α3I (retention time—3.8 min, ˜10%)—and all of these calicheamicin components contribute to bioassay activities. The best production was found to occur during late log or early stationary phase growth. The estimate of calicheamicin production by parental M. echinospora is 0.78-0.85 mg mL−1. Extracts were analyzed by i) the biological induction assay, a modified prophage induction assay used in the original discovery of the calicheamicins (Greenstein et al. (1986) Antimicrob. Agents Chemotherap. Vol. 29, 861); ii) the molecular break light assay, a DNA-cleavage assay based upon intramolecular fluorescence quenching optimized for DNA-cleavage by enediynes (in which fM calicheamicin concentrations are detectable) (Biggins et al. (2000) Proc. Natl. Acad. Sci. USA Vol. 97, 13537); and iii) high-performance liquid chromatography (HPLC) (described above). As expected, all three methods revealed that the parental M. echinospora fermentations produced 0.5-0.8 mg L−1. In contrast, the PKSE gene disruption mutant strains were both devoid of any calicheamicin, known calicheamicin derivatives and/or enediyne activity by all three methods of detection. The elimination of calicheamicin production brought about by disruption of the PKSE gene indicates that it provides an essential activity for biosynthesis of calicheamicin. Based on the presence of the PKSE in all enediyne biosynthetic loci sequenced to date and on their overall conservation, it is expected that PKSEs fulfill the same, essential function in the biosynthesis of all enediyne structures.
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
It is further to be understood that all sizes and all molecular weight or mass values are approximate, and are provided for description.
Some open reading frames listed herein initiate with non-standard initiation codons (e.g. GTG—Valine or TTG—Leucine) rather than the standard initiation codon ATG, namely SEQ ID NOS: 2, 8, 16, 28, 30, 32, 38, 40, 42, 48, 54, 56, 70, 74, 76, 78, 80, 82, 84, 86, 88, 92, 98, 100. All ORFs are listed with M, V or L amino acids at the amino-terminal position to indicate the specificity of the first codon of the ORF. It is expected, however, that in all cases the biosynthesized protein will contain a methionine residue, and more specifically a formylmethionine residue, at the amino terminal position, in keeping with the widely accepted principle that protein synthesis in bacteria initiates with methionine (formylmethionine) even when the encoding gene specifies a non-standard initiation codon (e.g. Stryer, Biochemistry 3rd edition, 1998, W. H. Freeman and Co., New York, pp. 752-754).
Patents, patent publications, procedures and publications cited throughout this application are incorporated herein in their entirety for all purposes.
1. A method of discovering an enediyne biosynthetic locus comprising the step of detecting, within a sample of microbial sequence information, the presence of at least one member of a protein family selected from the group consisting of PKSE, TEBC, UNBL, UNBV and UNBU.
2. The method of claim 1 wherein the step of detecting, within the sample of microbial sequence information, the presence of the at least one member of the protein family selected from the group consisting of PKSE, TEBC, UNBL, UNBV and UNBU comprises detecting a polypeptide sequence within the sample of microbial sequence information corresponding to the at least one member of the protein family.
3. The method of claim 1 wherein the step of detecting, within the sample of microbial sequence information, the presence of the at least one member of the protein family selected from the group consisting of PKSE, TEBC, UNBL, UNBV and UNBU comprises detecting a nucleic acid sequence encoding a polypeptide within the sample of microbial sequence information corresponding to the at least one member of the protein family.
4. The method of claim 1 wherein the sample of microbial sequence information is microbial sequence information sequence information stored on computer readable medium.
5. The method of claim 1 wherein the step of detecting, within the sample of microbial sequence information, the presence of the at least one member of the protein family selected from the group consisting of PKSE, TEBC, UNBL, UNBV and UNBU is computer-assisted.
6. The method of claim 1 wherein the protein family detected is PKSE.
7. The method of claim 1 wherein the protein family detected is TEBC.
8. The method of claim 1 wherein the protein family detected is UNBL.
9. The method of claim 1 wherein the protein family detected is UNBV.
10. The method of claim 1 wherein the protein family detected is UNBU.
11. The method of claim 1 wherein the step of detecting, within the sample of microbial sequence information, the presence of the at least one member of the protein family selected from the group consisting of PKSE, TEBC, UNBL, UNBV and UNBU comprises detecting the presence of at least one member from two protein families selected from the group consisting of PKSE, TEBC, UNBL, UNBV and UNBU.
12. The method of claim 1 wherein the step of detecting, within the sample of microbial sequence information, the presence of the at least one member of the protein family selected from the group consisting of PKSE, TEBC, UNBL, UNBV and UNBU comprises detecting the presence of at least one member from three protein families selected from the group consisting of PKSE, TEBC, UNBL, UNBV and UNBU.
13. The method of claim 1 wherein the step of detecting, within the sample of microbial sequence information, the presence of the at least one member of the protein family selected from the group consisting of PKSE, TEBC, UNBL, UNBV and UNBU comprises detecting the presence of at least one member from four protein families selected from the group consisting of PKSE, TEBC, UNBL, UNBV and UNBU.
14. The method of claim 1 wherein the step of detecting, within the sample of microbial sequence information, the presence of the at least one member of the protein family selected from the group consisting of PKSE, TEBC, UNBL, UNBV and UNBU comprises detecting the presence of a member of each of the protein families selected from the group consisting of PKSE, TEBC, UNBL, UNBV and UNBU.