Patent application title:

Method for immobilizing molecules onto surfaces

Publication number:

-

Publication date:
Application number:

10/194,138

Filed date:

2002-07-12

✅ Patent granted

Patent number:

US 7,687,437 B2

Grant date:

2010-03-30

PCT filing:

-

PCT publication:

-

Examiner:

Amber D. Steele

Adjusted expiration:

2022-07-12

Abstract:

A method for immobilizing amino-group containing molecules onto surfaces and devices having immobilized isocyanate-group containing molecules prepared by the method are disclosed. The method comprises reacting a surface (i.e., glass surface) having free hydroxyl groups with a silyl isocyanate derivatizing agent to provide immobilized reactive moieties, the agent having a formula:
(R1O)(R2O)(R3O)Si—X—NCO
wherein R1, R2 and R3 are independently represents C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, and sulfur and reacting the immobilized reactive moieties with the amino group-containing molecule so as to immobilize said molecule on the surface. Devices having a surface with immobilized molecules such as nucleic acids or proteins are useful for detection of target analytes in a sample.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C40B50/18 IPC

Methods of creating libraries, e.g. combinatorial synthesis; Solid phase synthesis, i.e. wherein one or more library building blocks are bound to a solid support during library creation; Particular methods of cleavage from the solid support using a particular method of attachment to the solid support

G01N33/552 IPC

Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing; Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being inorganic Glass or silica

Description

CROSS-REFERENCE

This application claims the benefit of U.S. Provisional application Nos. 60/305,369, filed Jul. 13, 2001 and 60/363,472, filed Mar. 12, 2002, which are incorporated by reference in its entirety.

FIELD OF THE INVENTION

The present invention relates to a method for immobilizing amino-group containing molecules such as nucleic acids, proteins, carbohydrates onto surfaces that have immobilized isocyanate groups bound thereto. The invention also relates to devices having bound thereto isocyanate groups or molecules including probes or linkers for attaching other molecules or probes.

BACKGROUND OF THE INVENTION

DNA attachment to glass surfaces has become an important tool in the genomics industry for many applications, including gene expression analysis and DNA detection methods. In general, DNA can be attached to glass either through non-covalent, ionic interactions, or through covalent multi-step processes or simple covalent coupling reactions. The reported methods, however, involve labor intensive, expensive and potentially hazardous steps in some methods.

The present invention provides a simple, fast, and inexpensive method to covalently attach synthetic DNA and other molecules directly or in a stepwise manner to a derivatized surface having immobilized isocyanate groups and devices having surfaces prepared by the inventive method. The inventive method can be extended to covalently attach proteins, amino acids, carbohydrates, lipids and other molecules to surfaces, such as a glass surface. Surfaces modified through attachment of nucleic acids, amino acids, proteins, carbohydrates, lipids and other molecules using the present inventive method are useful in diagnostic applications for screening for the presence or absence of target molecules in samples.

SUMMARY OF THE INVENTION

The present invention relates to a method for attaching amino-group containing molecules such as nucleic acids, amino acids, proteins, and carbohydrates or other amino-containing molecules that have been derivatized with one or more amino groups to a surface such as a glass surface that has been reacted with a silyl isocyanate derivatizing agent. For instance, the method can be used to attach a 3′ or 5′ amino-derivatized end of DNA extracted from cells or synthesized by conventional procedures in a direct or indirect manner to a support having a glass surface or other surfaces with free hydroxyl groups. It is known that one cannot couple amino-group containing molecules to a glass surface very easily. One advantage of the inventive method is that it overcomes this problem by first immobilizing isocyanate groups that can react very fast with amines and form stable amide linkages. Moreover, amino group containing DNA molecules can be readily immobilized onto immobilized isocyanates on the surface, even in the presence of aqueous buffer. The resulting isocyanate modified glass surface having amide-linked DNA or other molecules bound thereto are highly stable in enzymatic, acidic and basic conditions.

Accordingly, one embodiment of the invention provides a method for immobilizing an amino-group containing molecule on a surface having free hydroxyl groups. The method comprises the steps of:

(a) reacting the free hydroxyl groups of said surface with a silyl isocyanate derivatizing agent to provide immobilized reactive moieties, the agent having a formula:
(R1O)(R2O)(R3O)Si—X—NCO
wherein R1, R2 and R3 independently represents C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comprising oxygen, nitrogen, and sulfur; and

(b) reacting the immobilized reactive moieties with the amino-group containing molecule so as to immobilize said molecule on the surface.

In another aspect of this embodiment of the invention, the method for immobilizing the molecule further comprises the steps of:

(c) reacting the immobilized molecule on the surface with a chemical agent that reacts with the functional group of the molecule so as to produce second immobilized reactive moieties; and

(d) reacting the second immobilized reactive moieties with a second molecule having a functional group capable of reacting with the second immobilized reactive moieties.

In another embodiment of the invention, the method further comprises the step of:

(c) coupling the molecule immobilized on the surface with a second molecule, wherein the molecule immobilized on the surface and the second molecules have at least one functional group for coupling.

In another embodiment of the invention, a method for immobilizing a probe on a glass surface is provided. The method comprises the steps of:

(a) reacting the glass surface with (3-isocyanatopropyl) triethoxysilane to provide immobilized reactive moieties; and

(b) reacting the immobilized reactive moieties with a molecule having an amine group so as to immobilize said molecule on the glass surface.

In yet another aspect of the invention, the method further comprises the steps of:

(c) reacting the immobilized molecule on the surface with a chemical agent that reacts with the functional group of the molecule so as to produce second immobilized reactive moieties; and

(d) reacting the second immobilized reactive moieties with a second molecule having a functional group capable of reacting with the second immobilized reactive moieties.

In another embodiment of the invention, the present invention provides devices comprising a surface with an immobilized molecule prepared by the inventive method. These and other embodiments of the invention will become apparent in light of the detailed description below.

IN THE DRAWINGS

FIG. 1 provides a schematic diagram of DNA attachment on isocyanate plates (see Example 1).

FIG. 2 is a general illustration that uses gold nanoparticle probes as detection labels for detecting for the presence of a target DNA molecule using capture probes bound to the inventive plates having isocyanate groups attached thereto. The nanoparticle-oligonucleotide conjugate detections probes have oligonucleotides (b) bound thereto for detection of target a′b′ using a glass DNA chip having capture probe oligonucleotides (a). The sequence of the oligonucleotides (b) bound to the nanoparticles are complementary to a portion (b′) of the sequence of target a′b′ while the sequence of the capture oligonucleotides (a) bound to the glass chip are complementary to another portion (a′) of the target a′b′ sequence. See Example 2.

FIG. 3 illustrates M13 synthetic target detection and reproducibility using gold nanoparticle detection probes and capture probes bound to a glass surface prepared in accordance with the invention. See Example 2.

FIG. 4 is essentially the same as FIG. 3 and shows that target detection using plates prepared in accordance with the present invention is reproducible. See Example 2.

FIGS. 5 illustrates MTHFR 208 base pair target (mutant and wild type) SNP detection using gold nanoparticle detection probes and capture probes bound to a glass surface prepared in accordance with the invention. See Example 3.

FIG. 6 is essentially the same as FIG. 5 and shows that target detection using plates prepared in accordance with the present invention is reproducible. See Example 3.

FIG. 7 illustrates the targeting of a nanoparticle probe directly to the capture DNA bound to a glass surface prepared in accordance with the invention. See Example 4.

FIG. 8 illustrates Factor V 99 base pair PCR product target detection using gold nanoparticle detection probes and capture probes bound to a glass surface prepared in accordance with the invention. See Example 5.

FIG. 9 illustrates detection of different target lengths of MTHFR PCR products (208, 119 and 75 base pairs) detection on the same plate using gold nanoparticle detection probes and capture probes bound to a glass surface prepared in accordance with the invention. See Example 6.

FIG. 10 is essentially the same as FIG. 9 and shows that target detection using plates prepared in accordance with the present invention is reproducible. See Example 6.

FIG. 11 illustrates MTHFR 75 base pair detection using gold nanoparticle detection probes and capture probes bound to a glass surface prepared in accordance with the invention. See Example 7.

FIG. 12 is a schematic diagram illustrating the stepwise modification of the glass plate. Amino-group containing sugar molecules in aqueous solution were reacted with the isocyanate linked glass surface to immobilize the sugar molecule onto the plate. Thereafter, a second molecule including a functional group (an amino-group containing DNA capture probe) is coupled to the first molecule immobilized onto the surface in the presence of a coupling agent such as EDC. See Example 8.

FIG. 13 illustrates MTHFR 100mer synthetic sequence detection on carbohydrate modified plate from Example 8.

FIG. 14 illustrates a schematic diagram for the stepwise attachment of a DNA capture probe via amino acid linker to an isocyanate modified glass plate. Amino acid molecules in aqueous solution were reacted with the isocyanate linked glass surface to immobilize the amino acid onto the plate. Thereafter, a second molecule including a functional group (an amino-group containing DNA capture probe) is coupled to the first molecule immobilized onto the surface in the presence of a coupling agent such as EDAC. See Example 9.

FIG. 15 illustrates MTHFR 100mer synthetic sequence detection on amino acid modified plate from Example 9.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides a method for the covalent attachment of molecules such as amino-group containing nucleic acids, amino acids, proteins, carbohydrates, or other molecules derivatized with amino groups to an isocyanate modified surface and devices having a surface with immobilized molecules prepared by the inventive method.

One aspect of the invention relates to the immobilization of a molecule having amino-groups onto surfaces having reactive hydroxyl groups such as siliconized surfaces, germanium surfaces, mica, silicon wafers, wave guides, nylon and silicon dioxide glass surfaces. In practicing this invention, substrates having glass surfaces, e.g., glass slides or beads, are preferred. FIGS. 1, 12 and 14 illustrates the basic reactions involved in the immobilization process using a silyl isocyanate derivatizing agent for derivatizing the glass surface. The silyl isocyanate derivatizing agent has the following formula:
(R1O)(R2O)(R3O)Si—X—NCO
wherein R1, R2 and R3 are independently C1-C6 alkyl; X represents a C1-C20 linear or branched alkyl group optionally substituted with one or more heteroatoms such ascarbon, hydrogen, nitrogen, sulfur, and oxygen. In practicing this invention, (3-isocyanatopropyl) triethoxysilane is preferred as the silyl isocyanate derivatizing agent.

Any type of glass surface may be used as a substrate, including glass slides or beads, provided that it is adequately cleaned prior to derivatization. Washing with acid, followed by successive washings in water and organic solvents has been found to produce adequate results.

The cleaned dried glass surface is reacted (e.g., 1.5 hours at room temperature) with a silyl isocyanate dissolved in a suitable solvent mixture comprised of organic solvent and an acid. Suitable, but non-limiting, examples of solvent include alcohols such as absolute ethanol, methanol, and propanol; toluene; tetrahydrofuran; and dimethyl sulfoxide. Suitable acids include glacial acetic acid, hydrochloric acid and sulfuric acid. The amount of acid in the mixture generally ranges from between about 0.01% (v/v) and about 0.1%(v/v), preferably about 0.01% (v/v). In practicing this invention, absolute ethanol is preferred as organic solvent and glacial acetic acid is preferred as acid at a ratio of ranging between about 1:0.0001 to about 1:0.001, preferably about 100000:1 v/v ethanol/glacial acetic acid. The concentration of the silyl isocyanate generally ranges between about 20 mM and about 200 mM, preferably about 80 mM.

Glass surfaces containing immobilized reactive groups are then washed with a suitable organic solvent to remove unreacted silyl isocyanate. Representative examples of suitable solvents include toluene, acetone, and ethanol. The washed plates are then dried (e.g., at room temperature for 5-10 minutes). The glass surface may be kept dry by storage in a vacuum desiccator prior to use.

Surface-bound isocyanate moieties present on the glass surface react with the amino groups of amino-group containing molecules such as amino-derivatized oligonucleotides to form a stable urea linkage. In the case of immobilized isothiocyanate moities, attachment occurs through covalent thiourea linkages. Generally, the molecules containing amino groups are dissolved in a suitable solvent such as ethanol, dimethyl sulfoxide, dimethyl form amide, tetrahedrofuran in the optional presence of water. In the case where the molecules are not readily soluble or are insoluble in organic solvent, water may be used alone as the solvent or in combination with a water miscible solvent to enhance the molecule solubility. The amount of water in aqueous solvent mixtures generally ranges between about 1%(v/v) and about 10% (v/v), preferably about 5%(v/v) in solution having amino-group containing molecules. While any desired concentration of molecule solution may be used, generally the concentration of the amino-group containing molecules generally ranges between about 1 uM and about 2 mM, preferably between about 5 uM and about 1 mM, and most preferably between about 10 uM and about 1 mM. The solution containing molecules having amino groups may applied to the glass surfaces containing the isocyanate immobilized reactive groups by any suitable means, including spotting or spraying. Reactions may be successfully performed at room temperature and are essentially complete within 30 minutes. After completion, the glass slides were washed with water and ethanol and dried. The unreacted isocyanates present on the glass surface are converted into free amines during water washing and these free amines may be blocked using any suitable capping solution, e.g., 1:1 (v/v) pyridine-acetic anhydride mixture. Generally, the capping reaction is conducted for at least 30 minutes, preferably about one hour, at room temperature. After capping the free amines, the plates having immobilized molecules were washed again with ethanol thoroughly and dried in the desiccator until further use.

After attachment of the molecules containing amino groups to the surface, devices having a glass surface prepared in the manner described above can be used in assays for detection purposes where the amino-group containing molecule is a probe. Suitable, but non-limiting examples of probes include a protein, a peptide, a nucleic acid, an amino acid, a peptide nucleic acid, a linked nucleic acid, a nucleoside triphosphate, a carbohydrate, a lipid, a lipid bound protein, an aptamer, a virus, a cell fragment, or a whole cell. The probe may have one or more amino groups inherently as part of its structure or may be derivatized by any suitable means to include one or more amino-groups. In cases where an amino-containing oligonucleotide was used to prepare a device using the above method, the resulting immobilized oligonucleotides may be used in hybridization reactions with other nucleic acids. It has been found that oligonucleotide probes immobilized in the manner described above retain the ability to specifically recognize and bind target DNAs having complementary nucleotide sequences. Assay conditions may be varied to accomplish specific experimental objectives. For example, hybridization assays may be performed at different stringencies depending upon the extent to which the experimenter wants hybridization to occur to target nucleic acids having mismatched nucleotide sequences.

In another aspect of the invention, the immobilized molecules bound to the glass surface may include a functional group, e.g., a carboxyl moiety. This functional group may be used to couple with a second molecule or probe. Hence, the immobilized molecule may act as a spacer or a linker to bind the second molecule or probe to the glass surface. The second molecule includes a second functional group, e.g, amino group, that allows it to react directly or indirectly with the immobilized molecules. Any suitable coupling agents may be used. For instance, FIGS. 12 and 14 illustrate the coupling immobilization of an amino-containing sugar molecule or amino acid, respectively, with the isocyanate modified surface. The amino acid and sugar molecules includes a carboxylic acid moieties which, in the presence of EDC or EDAC or other suitable coupling reagent, convert to a reactive ester intermediate. This ester intermediate couples with an amino-containing oligonucleotide as the second molecule. In practicing this invention, any desired amino-group containing molecule may be used as a linker or spacer, provided that it has some functionality that allows the molecule to covalent attach to another molecule, alone or in the presence of one or more coupling agents. Any suitable concentration of second molecules may be used in any suitable solvent or solvent mixture as described above. Similarly, any suitable method of applying the solution including the second molecules may be used as described above.

In yet another aspect of the invention, devices having glass surfaces modified by the inventive method are provided. In one embodiment of the invention, the device comprises a substrate with a glass surface having bound thereto one or more types of capture probes for immobilizing target analytes contained in a sample onto said substrate, each capture probe specific for a target analyte. In cases where a plurality of different types of capture probes attached are attached to the glass substrate, the capture probes may be arranged as an array to allow for the detection of multiple types of target analytes.

EXAMPLES

The Examples below illustrate those oligonucleotides having amino groups at the 3′ or 5′ terminal ends can be readily immobilized onto glass surfaces having immobilized reactive isocyanate groups.

The Examples below describe a procedure for the preparation of an isocyanate-linked glass plates (Example 1), attachment of an amino-group containing oligonucleotides onto the isocyanate-linked glass plate (Example 2), and detection of various M-13 phage target molecules nucleic acid sequences using the glass plates having immobilized DNA (capture probes) modified glass plate, and gold nanoparticle-oligonucleotide conjugates as detection probes (Example 2); detection of various MTHFR target nucleic acid sequences using glass plates having immobilized oligonucleotide capture probes and gold nanoparticle conjugates as detection probes; (Examples 3, 6 and 7). Example 4 shows direct hybridization of a gold nanoparticle-oligonucleotide conjugate to a capture oligonucleotide probe immobilized onto the isocyanate plate. Example 5 illustrates detection of Factor V target nucleic acid using glass plates having immobilized oligonucleotide capture probes and gold nanoparticle conjugates as detection probes. Example 8 describes attachment of a amino-group containing carbohydrate linker to an isocyanate plate and subsequent attachment of a nucleic acid molecule to the immobilized linker and the use of the nucleic acid modified plate for detection of a target nucleic acid molecule. Example 9 describes attachment of an amino acid linker to an isocyanate plate and subsequent attachment of a nucleic acid molecule to the linker and the use of the nucleic acid modified plate for detection of a target nucleic acid molecule. Examples 8 and 9 showed coupling of nucleic acid to carbohydrate and amino acid to confirm the presence of the linker on the glass surface.

Example 1

Preparation of Immobilized Isocyanate Plates and DNA Loading

This Example illustrates the general preparation of an isocyanate-linked glass surface and subsequent reaction of an amino-group containing molecule (e.g., a 3′ amino DNA molecule). FIG. 1 illustrates the basic steps in generating the reactive isocyanate groups on a surface having free reactive hydroxyl groups and subsequent coupling of an amino-group containing DNA molecule.

(a) Preparation of isocyanate plates: To 100 ml of absolute ethanol (200 proof ACS/USP grade, pharmco products Inc) contained in a polypropylene plastic container, 2 ml of (3-Isocyanatopropyl) triethoxy silane (Sigma Company, St. Louis, Mo., USA; Product no: 58810) and 10 μl of glacial acetic acid was added and the mixture was stirred for one minute. Immediately thereafter, PIRANHA (3:1 H2SO4: H2O2) cleaned glass slide plates were immersed in the mixture and kept at room temperature for 1.5 h. The glass plates were then washed with ethanol and dried prior to DNA loading.

(b) Preparation of DNA plates: A 12 μM DNA solution was used to cover the dried isocyanate plates and the plates where then kept overnight in a covered box to avoid evaporation of the DNA solution. The amino-containing DNA molecules were prepared as described above. The DNA solution was prepared in 1:9 10 mM Phosphate buffer: DMF mix. The DNA coated plates were then washed with water and ethanol and dried. The unreacted isocyanates that converted into amines during the water washing were treated with a solution of pyridine-acetic anhydride [1:1 ratio, total 100 ml] for 30 minutes at room temperature. In this case where gold nanoparticles were used for detection, amine capping becomes necessary to avoid undesirable chemical reaction between the free amines and the gold surfaces. The plates are then washed with water, then ethanol, and then air dried at room temperature and used for detection.

Example 2

M-13 Target Detection Using Gold Nanoparticles

In this example, capture probes where attached to a glass surface in accordance with the DNA loading procedure in Example 1. Gold nanoparticle-oligonucleotide probes to detect for the target M-13 sequence was prepared using procedures described in PCT/U.S.97/12783, filed Jul. 21, 1997; PCT/US00/17507, filed Jun. 26, 2000; PCT/U.S.01/01190, filed Jan. 12, 2001, which are incorporated by reference in their entirety. FIG. 2 illustrates the use of gold nanoparticle probes having oligonucleotides (b) bound thereto for detection of target a′b′ using a glass DNA chip having capture probe oligonucleotides (a). The sequence of the oligonucleotides (b) bound to the nanoparticles are complementary to a portion (b′) of the sequence of target a′b′ while the sequence of the capture oligonucleotides (a) bound to the glass chip are complementary to another portion (a′) of the target a′b′ sequence. Under hybridization conditions, the nanoparticle probes, the capture probes and the target sequence bind to form a complex. Signal detection of the resulting complex can be enhanced with conventional silver staining.

(a) Preparation of Gold Nanoparticles

Gold colloids (13 nm diameter) were prepared by reduction of HAuCl4 with citrate as described in Frens, 1973, Nature Phys. Sci., 241:20 and Grabar, 1995, Anal. Chem.67:735. Briefly, all glassware was cleaned in aqua regia (3 parts HCl, 1 part HNO3), rinsed with Nanopure H2O, then oven dried prior to use. HAuCl4 and sodium citrate were purchased from Aldrich Chemical Company. Aqueous HAuCl4 (1 mM, 500 mL) was brought to reflux while stirring. Then, 38.8 mM sodium citrate (50 mL) was added quickly. The solution color changed from pale yellow to burgundy, and refluxing was continued for 15 min. After cooling to room temperature, the red solution was filtered through a Micron Separations Inc. 1 micron filter. Au colloids were characterized by UV-vis spectroscopy using a Hewlett Packard 8452A diode array spectrophotometer and by Transmission Electron Microscopy (TEM) using a Hitachi 8100 transmission electron microscope. Gold particles with diameters of 13 nm will produce a visible color change when aggregated with target and probe oligonucleotide sequences in the 10-35 nucleotide range.

(b) Synthesis of Oligonucleotides

An oligonucleotide complementary to a segments of the M-13 DNA sequence were synthesized on a 1 micromole scale using a Milligene Expedite DNA synthesizer in single column mode using phosphoramidite chemistry. Eckstein, F. (ed.) Oligonucleotides and Analogues: A Practical Approach (IRL Press, Oxford, 1991). All solutions were purchased from Milligene (DNA synthesis grade). Average coupling efficiency varied from 98 to 99.8%, and the final dimethoxytrityl (DMT) protecting group was not cleaved from the oligonucleotides to aid in purification.

To facilitate hybridization of the probe sequence with the target, a deoxyadenosine oligonucleotide (da20) was included on the 5′ end in the probe sequence as a spacer. Additional da20 oligomers were generated as “filler oligonucleotides,” comprising a 5′-steroid disulfide unit. These “fillers” further facilitated hybridization with a target by increasing the separation of the recognition oligonucleotide strands anchored on the gold nanoparticles as described below.

To generate 5′-terminal steroid-cyclic disulfide oligonucleotide derivatives (see Letsinger et al., 2000, Bioconjugate Chem. 11:289-291 and PCT/U.S.01/01190 (Nanosphere, Inc.), the disclosure of which is incorporated by reference in its entirety), the final coupling reaction was carried out with a cyclic dithiane linked epiandrosterone phosphoramidite on Applied Biosystems automated synthesizer, a reagent that prepared using 1,2-dithiane-4,5-diol, epiandrosterone and p-toluenesulphonic acid (PTSA) in presence of toluene. The phosphoramidite reagent may be prepared as follows: a solution of epiandrosterone (0.5 g), 1,2-dithiane-4,5-diol (0.28 g), and p-toluenesulfonic acid (15 mg) in toluene (30 mL) was refluxed for 7 h under conditions for removal of water (Dean Stark apparatus); then the toluene was removed under reduced pressure and the reside taken up in ethyl acetate. This solution was washed with water, dried over sodium sulfate, and concentrated to a syrupy reside, which on standing overnight in pentane/ether afforded a steroid-dithioketal compound as a white solid (400 mg); Rf (TLC, silica plate, ether as eluent) 0.5; for comparison, Rf values for epiandrosterone and 1,2-dithiane-4,5-diol obtained under the same conditions are 0.4, and 0.3, respectively. Recrystallization from pentane/ether afforded a white powder, mp 110-112° C.; 1H NMR, δ 3.6 (1H, C3OH), 3.54-3.39 (2H, m 2OCH of the dithiane ring), 3.2-3.0 (4H, m 2CH2S), 2.1-0.7 (29H, m steroid H); mass spectrum (ES+) calcd for C23H36O3S2 (M+H) 425.2179, found 425.2151. Anal. (C23H37O3S2) S: calcd, 15.12; found, 15.26. To prepare the steroid-disulfide ketal phosphoramidite derivative, the steroid-dithioketal (100 mg) was dissolved in THF (3 mL) and cooled in a dry ice alcohol bath. N,N-diisopropylethylamine (80 μL) and β-cyanoethyl chlorodiisopropylphosphoramidite (80 μL) were added successively; then the mixture was warmed to room temperature, stirred for 2 h, mixed with ethyl acetate (100 mL), washed with 5% aq. NaHCO3 and with water, dried over sodium sulfate, and concentrated to dryness. The residue was taken up in the minimum amount of dichloromethane, precipitated at −70° C. by addition of hexane, and dried under vacuum; yield 100 mg; 31P NMR 146.02. The epiandrosterone-disulfide linked oligonucleotides were synthesized on Applied Biosystems automated gene synthesizer without final DMT removal. After completion, epiandrosterone-disulfide linked oligonucleotides were deprotected from the support under aqueous ammonia conditions and purified on HPLC using reverse phase column.

Reverse phase HPLC was performed with a Dionex DX500 system equipped with a Hewlett Packard ODS hypersil column (4.6×200 mm, 5 mm particle size) using 0.03 M Et3NH+ OAc buffer (TEAA), pH 7, with a 1%/min. gradient of 95% CH3CN/5% TEAA. The flow rate was 1 mL/min. with UV detection at 260 nm. Preparative HPLC was used to purify the DMT-protected unmodified oligonucleotides. After collection and evaporation of the buffer, the DMT was cleaved from the oligonucleotides by treatment with 80% acetic acid for 30 min at room temperature. The solution was then evaporated to near dryness, water was added, and the cleaved DMT was extracted from the aqueous oligonucleotide solution using ethyl acetate. The amount of oligonucleotide was determined by absorbance at 260 nm, and final purity assessed by reverse phase HPLC.

3′-amino containing DNA was synthesized by following standard protocol for DNA synthesis on DNA synthesizer. The 3′ amine modified DNA was attached to the solid support through an immobilized succinyl linker. After synthesis, DNA was cleaved from the solid support using aqueous ammonia, resulting in the generation of a DNA molecule containing a free amine at the 3′-end. The crude material was purified on HPLC as described above, using triethyl ammonium (TEA) buffer. 5′ amino modified oligonucleotide was synthesized using standard protocols by incorporating 5′ MMT protected amine modified phospharamidite which is commercially available from GLEN research.

Attachment of amino linked DNA to the isocyanate functionalized glass surface is preferably performed in presence of N,N′-dimethylformamide (DMF). Typically, 12 μM amine modified DNA was loaded on the glass surface and kept in the chamber for 12 h, then the glass plates are washed with water and ethanol and dried in the dessicator. After drying, these plates are ready for testing with DNA samples.

(c) Attachment of Oligonucleotides to Gold Nanoparticles

A colloidal solution of citrate stabilized gold nanoparticles (about 10 nM), prepared as described in part A above, was mixed with sulfur modified-a20-probe oligonucleotide and corresponding sulfur modified-da20 filler oligonucleotide (each to a concentration of 1.7 μM), prepared as described in part B, and allowed to stand for 24 hours at room temperature in 1 ml Eppendorf capped vials. Then, 100 μL of a 0.1 M sodium hydrogen phosphate buffer, pH 7.0, and 100 μL of 1.0 M NaCl were premixed and added to the solution and allowed to stand for an additional 40 hours. The solution was next centrifuged at 14,000 rpm in an Eppendorf Centrifuge 5414 for about 15 minutes to give a very pale pink supernatant containing most of the oligonucleotide (as indicated by the absorbance at 260 nm) along with 7-10% of the colloidal gold (as indicated by the absorbance at 520 nm), and a compact, dark, gelatinous residue at the bottom of the tube. The supernatant was removed, and the residue was resuspended in the desired aqueous buffer. In this Example, the buffer used includes 0.1 M NaCl, 10 mM phosphate, 0.01% sodium azide at pH 7.

The following nanoparticle-oligonucleotide conjugates specific for M-13 phage DNA were prepared in this manner:

    • Probe P1: (a20)m-5′-S′-gold-S′-5′-[a20-cgctcacaatt-3′]n (SEQ ID NO: 1)
    • Probe P2: (a20)m-5′-S′-gold-S′-5′-[a20-tgaaattgttatc-3′]n (SEQ ID NO:2)
      S′ indicates a connecting unit prepared via an epiandrosterone disulfide group; m and n are approximately the same since equal concentrations of the oligonucleotides were used in preparing the nanoparticle-oligonucleotide conjugates.
      (d) M-13 Target Detection:
      For M13 target detection, a stock solution containing target was prepared as follows:
  • 1 μl of 100 nM 51mer synthetic DNA
  • 2 μl of 1:2000 diluted Tween
  • 2 μl of PCR buffer*
  • 2 μl of probe P1 and P2 mix
  • 1 μl 1:10 diluted salmon sperm DNA (Gibco BRL cat. No. 15632-011)
  • 2 μl of 4 M NaCl buffer
  • 10 μl of total mixture
    * PCR buffer for amplification purchased from Applied Biosystems, Cat. No. N808-0249 (AmpliTaq Gold DNA polymerase kit).

A 27mer oligonucleotide having a poly A linker (SEQ ID NO: 3) was prepared with a 3′-terminal amino group as described above. This 27mer was used as capture probe for the target M-13 sequence. The 27mer oligonucleotide was attached to an isocyanate plate using the procedures described in Example 1. The target M-13 sequence to be detected is shown as SEQ ID NO:4.

Capture probe sequence: 5′-cca cac aac ata cga gcc gga agc ata-a10-NH2-3′ [SEQ ID NO:3]

M-13 Target sequence: 5′-tat gct tcc ggc tcg tat gtt gtg tgg aat tgt gag cgg ata aca att tca-3′ [SEQ ID NO:4]

A 1 ul aliquot of the stock solution was spotted on the DNA modified glass plate. A control solution (no DNA target) also prepared in the same fashion and 1 ul aliquot of the control solution was spotted on the same chip. The loaded glass plates were stored in a closed container under humid conditions for 2 h and was then washed with washing buffer (750 mM NaCl, 75 mM sodium citrate, 0.05% Tween at pH 7) and with 0.5 M NaNO3 buffer at 23° C. The spots were then amplified with silver stain for 5 min and washed with nanopure water. The silver stain solutions A and B were purchased from Sigma Company, St. Louis, Mo. (catalog NoS-5020 (solution A) and S-5145 (solution B) and used according to the instructions therein. Both solutions are also available from Sigma Co. as a silver amplication kit. After signal amplification, the glass plates were scanned using a Hewlett Packard scan jet 5300C.

The results are shown in FIGS. 3 and 4. As shown in FIG. 3, no silver stain spots were observed for the controls and three silver stain spots were observed on the glass chip for areas spotted with the M-13 target solution as expected. In FIG. 4, same experiment was repeated to show the reproducibility of the target hybridization using complementary DNA capture probes immobilized onto isocyanate modified plates.

Example 3

Detection of MTHFR Sequence

This Example illustrates the use of oligonucleotides immobilized onto the isocyanate plates and its use for detecting a MTHFR target DNA sequence (SEQ ID NO:5). A capture probe having 3′-amino group and a PEG spacer were prepared as described below and were attached to an isocyanate immobilized glass surface in accordance with the procedure in Example 1.

MTHFR (wild type) PCR product sequence:

(SEQ ID NO:5)
5′ccttgaacaggtggaggccagcctctcctgactgtcatccctattggc
aggttaccccaaaggccaccccgaagcagggagctttgaggctgacctga
agcacttgaaggagaaggtgtctgcgggagccgatttcatcatcacgcag
cttttctttgaggctgacacattcttccgctttgtgaaggcatgcaccga
catgggcatcacttgccccatcgtccccgggatctttcccatccaggtga
ggggcccaggagagcccataagctccctccaccccactctcaccgc-3′

MTHFR (mutant) PCR product sequence:

(SEQ ID NO:6)
5′ccttgaacaggtggaggccagcctctcctgactgtcatccctattggc
aggttaccccaaaggccaccccgaagcagggagctttgaggctgacctga
agcacttgaaggagaaggtgtctgcgggagtcgatttcatcatcacgcag
cttttctttgaggctgacacattcttccgctttgtgaaggcatgcaccga
catgggcatcacttgccccatcgtccccgggatctttcccatccaggtga
ggggcccaggagagcccataagctccctccaccccactctcaccgc-3′

The following nanoparticle-oligonucleotide conjugates specific for MTHFR sequence were prepared as described in Example 2:

    • Probe P3: (a20)m-5′-S′-gold-S′-5′-[a20-cctcaaagaaaagc-3′]n (SEQ ID NO: 7)
    • Probe P4: (a20)mS-gold-S′-[5′a20gcggaagaatgtgtc-3′]n (SEQ ID NO:8)
      S′ indicates a connecting unit prepared via an epiandrosterone disulfide group; m and n are approximately the same since equal concentrations of the oligonucleotides were used in preparing the nanoparticle-oligonucleotide conjugates. The probes were stored in buffer as described in Example 2 prior to use.

A capture probe (3′-NH2-PEG-cct cgg cta aag tag t-5′)(SEQ ID NO:9) was prepared where PEG represents polyethylene glycol linker. The oligonucleotide synthesis was started with an 3′-amino support which is commercially available from Glen Research (Sterling, Va., USA; catalog No. 10-1918-90) on an automated synthesizer (Applied Biosystems, Inc., Foster City, Calif., USA; ; model Expedite). PEG linkers were incorporated from 3′ end as a spacer (between the surface and oligonucleotide) into the oligonucleotide synthesis. Commercially available peg phosphoramidite was used for the automated synthesis and available from Glen Research. After incorporating peg linkers into the oligonucleotide synthesis, DNA synthesis was extended from 3′ end. After completion oligonucletides were deprotected from the solid support and purified as described in Example 2.

Experimental Procedure: To each well, mixture of 30 ml of the hybridization buffer (150 ul of SSC (3M NaCl, 0.3 M sodium citrate at pH 7), 90 ul of water, 60 ul of 0.5% Tween 20 detergent), 10 ml of colloid mix (probe P3 5 ml+ probe P4 5 ml), 10 ul of 208 base pair PCR amplified product (5-10 nM in PCR buffer (PCR buffer for amplification purchased from Applied Biosystems, Cat. No. N808-0249 (AmpliTaq Gold DNA polymerase kit) was added. After heating for 3 minutes, aliquots were cooled to room temperature and loaded on the plate and kept in the humidified chamber for 40 min at 40° C. After 40 minutes, the hybridization plates were washed with washing buffer (750 mM NaCl, 75 mM sodium citrate, 0.05% Tween at pH 7) and with 0.5M NaNO3 buffer at 40° C. and amplified with silver A and B from Sigma. Same experiment was conducted on two different plates and the results, after silver amplification, are shown in FIG. 5 and FIG. 6. On both the plates, wild type and mutant targets were used to show SNIP differentiation.

Example 4

Positive Control Hybridization

In this Example, a nanoparticle-oligonucleotide probe was targeted directly to the capture strand (SEQ ID NO:10) bound to the glass plate using the isocyanate plates described in Example 1. Hence, the oligonucleotides bound to the nanoparticles has a sequence (SEQ ID NO:11) that is complementary to a portion of the capture oligonucleotides immobilized on the glass surface.

Capture strand sequence:

  • 3′-ACT GGA CTG GAC TGG-5′ (SEQ ID NO:10)

The following nanoparticle-oligonucleotide conjugate probe specific for capture oligonucleotide were prepared as described in Example 2:

    • Probe P9: (a20)m-5′-S′-gold-S′-5′-[a20-tgacctgacctgacc-3′]n (SEQ ID NO: 11)
      S′ indicates a connecting unit prepared via an epiandrosterone disulfide group; m and n are approximately the same since equal concentrations of the oligonucleotides were used in preparing the nanoparticle-oligonucleotide conjugates.
      Procedure: A hybridization buffer was prepared and included 150 ul of SSC (3M NaCl, 0.3 M sodium citrate at pH 7), 90 ul of water, 60 ul of 0.5% Tween 20 detergent. To each well in the capture probe immobilized plate prepared as described in Example 2, a mixture of 25 ul of hybridization buffer, 25 ul of water, 5 ul of 10 nM gold colloid probe P9 was added and hybridized at 52° C. for 45 minutes. After washing thoroughly with washing buffer (750 mM NaCl, 75 mM sodium citrate, 0.05% Tween at pH 7) and with 0.5M NaNO3 buffer at 23° C., plates were amplified with Sigma silver solution A and B. After signal amplification, the glass plates were scanned using a Hewlett Packard scan jet 5300C. From this experiment (see FIG. 7), it was concluded that gold nanoparticles probes hybridized directly to the capture strands under the hybridization conditions.

Example 5

Detection of Factor V Target Sequence

In this Example, a Factor V sequence sandwich hybridization assay was performed using a Factor V 99 base pair PCR amplified product of defined sequence (SEQ ID NO:12). In addition, a DNA capture probe (SEQ ID NO:13) including a PEG (polyethylene glycol) linker was prepared using the procedure described in Examples 2 and 3. This capture probe was immobilized onto isocyanate-linked plates and free amines were subsequently capped as described in Example 1.

Factor V 99base PCR pair product sequence:

(SEQ ID NO:12)
5′gacatcgcctctgggctaataggactacttctaatctgtaagagcaga
tccctggacaggcaaggaatacaggtattttgtccttgaagtaacctttc
ag 3′

Capture strand sequence:

  • 5′-ctg ctc tta cag att aga agt agt cct-PEG-PEG-PEG-NH2-3′ (SEQ ID NO:13)
    The following nanoparticle-oligonucleotide conjugates specific for the synthetic target sequence were prepared in accordance with the procedure outlined in Example 2:
    • Probe 13D: (a20)m-5′-S′-gold-S′-5′-[a20-tattcctcgcc-3′]n (SEQ ID NO: 14)
    • Probe 26D: (a20)m-5′-S′-gold-S′-5′-[a20-attccttgcct-3′]n (SEQ ID NO:15)
      S′ indicates a connecting unit prepared via an epiandrosterone disulfide group; m and n are approximately the same since equal concentrations of the oligonucleotides were used in preparing the nanoparticle-oligonucleotide conjugates. The probes were stored in buffer as described in Example 2 prior to use.
      Experimental Procedure: A hybridization buffer was prepared as follows: 150 ul of SSC (3M NaCl, 0.3 M sodium citrate at pH 7), 90 ul of water, 60 ul of 0.5% Tween 20 detergent. To each well, a mixture of 30 ul of the hybridization buffer, 10 ul of either probes 13D or 26D and 10 ul of PCR product (5-10 nM in PCR buffer (PCR buffer for amplification purchased from Applied Biosystems, Cat. No. N808-0249 (AmpliTaq Gold DNA polymerase kit)) was added. After loading the aliquots, the plates were kept in the humidified chamber for 2 h at room temperature. After 2 h, the hybridization plates washed with washing buffer (750 mM NaCl, 75 mM sodium citrate, 0.05% Tween at pH 7) and with 0.5M NaNO3 buffer at 23° C. and amplified with silver A and B from Sigma. Wells 1 and 6 were used as controls (no DNA target was added) to the hybridization aliquots and water was added in place of target stock solution. After signal amplification, the glass plates were scanned using a Hewlett Packard scan jet 5300C. As expected, wells 1 and 6 did not show any spots and rest of the wells showed the target presence spots (FIG. 8).

Example 6

Detection of MTHFR Target Sequence

This Example is the same as the one described in Example 3 except three different MTHFR target sequences of various sizes were used and were labeled as PCR products 75 (SEQ ID NO:16), 119 (SEQ ID NO:17), 208 (SEQ ID NO:18), and. The purpose of this experiment was to evaluate the effect of different sized targets on hybridization. A 3-amino DNA capture probe (SEQ ID NO:19) having a PEG spacer was prepared as described in Example 3 and was used for immobilization onto isocyanate plates in accordance with Example 1. Nanoparticle-oligonucleotide detection probes 65D (SEQ ID NO:20) and 66D (SEQ ID NO:21) were prepared as described in Example 2.

75 base pair PCR product:

(SEQ ID NO:16)
5′gaggctgacctgaagcacttgaaggagaaggtgtctgcgggagccgat
ttcatcatcacgcagcttttctttgag-3′

119 base pair PCR product:

(SEQ ID NO:17)
5′tattggcaggttaccccaaaggccaccccgaagcagggagctttgagg
ctgacctgaagcacttgaaggagaaggtgtctgcgggagccgatttcatc
atcacgcagcttttctttgag-3′

208 base pair PCR product:

(SEQ ID NO:18)
5′ccttgaacaggtggaggccagcctctcctgactgtcatccctattggc
aggttaccccaaaggccaccccgaagcagggagctttgaggctgacctga
agcacttgaaggagaaggtgtctgcgggagccgatttcatcatcacgcag
cttttctttgaggctgacacattcttccgctttgtgaaggcatgcaccga
catgggcatcacttgccccatcgtccccgggatctttcccatccaggtga
ggggcccaggagagcccataagctccctccaccccactctcaccgc

Capture probe sequence:

  • 3′-NH2-PEG-tcc aca gac gcc ctc ggc ta-5′ (SEQ ID NO:19)

The following nanoparticle-oligonucleotide conjugates specific for the synthetic target sequence were prepared in accordance with the procedure outlined in Example 2:

    • Probe 65D: (a20)m-5′-S′-gold-S′-5′-[a20-gcgtgatgatgaaa-3′]n (SEQ ID NO: 20)
    • Probe 66D: (a20)m-5′-S′-gold-S′-5′-[a20-cctcaaagaaaag-3′]n (SEQ ID NO:21)
      where S′ indicates a connecting unit prepared via an epiandrosterone disulfide group; m and n are approximately the same since equal concentrations of the oligonucleotides were used in preparing the nanoparticle-oligonucleotide conjugates.
      Experimental Procedure: A hybridization buffer was prepared and included the following components: 150 ul of SSC (3M NaCl, 0.3 M sodium citrate at pH 7), 90 ul of water, 60 ul of 0.5% Tween 20 detergent. To each well, mixture of 30 ul of the hybridization buffer, 10 ul of probe mix (65D 5 ul, 66D 5 ul), 10 ul of PCR product (5-10 nM in PCR buffer (PCR buffer for amplification purchased from Applied Biosystems, Cat. No. N808-0249 (AmpliTaq Gold DNA polymerase kit)) was added. The 50 ul Aliquots were loaded on the plates and the plates where then kept in the humidified chamber for 40 minutes at 40° C. After the 40 minute hybridization reaction was completed, the plates were washed with washing buffer (750 mM NaCl, 75 mM sodium citrate, 0.05% Tween at pH 7) and with 0.5M NaNO3 buffer at 35° C. and amplified with silver A and B from Sigma. The same experiment was conducted on two glass plates with different thicknesses to see if there are any differences in spot morphology. After signal amplification, the glass plates were scanned using a Hewlett Packard scan jet 5300C. In FIG. 9, the plate thickness was 1.2 mm while in FIG. 10, the plate thickness was 1.0 mm The Figures show that detection of different target lengths is possible. Moreover, no conclusive difference in spot morphology was seen

Example 7

Detection of MTHFR Wild-Type and Mutant Sequences

This Example illustrates detection of MTHFR wild-type and mutant sequences. Two PCR amplified wild type (SEQ ID NO:22) and mutant MTHFR (SEQ ID NO:23) sequences were synthesized and used as target sequences for this Example. The 3′ amino DNA capture probe sequence (SEQ ID NO:24) including a PEG spacer was prepared as described in Example 3. The capture probe was immobilized onto isocyanate glass plates as described in Example 1. Two gold nanoparticle-oligonucleotide conjugate detection probes 13D′ (SEQ ID NO:25) and 14D′ (SEQ ID NO:26) were prepared as described in Example 2.

75 base pair (Wild-Type) product target sequence:

(SEQ ID NO:22)
5′gaggctgacctgaagcacttgaaggagaaggtgtctgcgggagccgat
ttcatcatcacgcagcttttctttgag-3′

75 (mutant) base pair (mutant) product target sequence:

(SEQ ID NO:23)
5′gaggctgacctgaagcacttgaaggagaaggtgtctgcgggagtcgat
ttcatcatcacgcagcttttctttgag-3′

Capture probe sequence:

  • 5′-ccc gca gac acc ttc tcc ttc-PEG-NH2-3′ (SEQ ID NO:24)
    The following nanoparticle-oligonucleotide conjugates specific for the synthetic target sequence were prepared in accordance with the procedure outlined in Example 2:
  • Probe 13D′: (a20)m-5′-S′-gold-S′-5′-[a20-tgatgaaatcgact-3′]n (SEQ ID NO:25)
  • Probe 14D′: (a20)m-5′-S′-gold-S′-5′-[a20-atgaaatcggct-3′]n (SEQ ID NO:26)
    S′ indicates a connecting unit prepared via an epiandrosterone disulfide; m and n are approximately the same since equal concentrations of the oligonucleotides were used in preparing the nanoparticle-oligonucleotide conjugates. The probes were stored in buffer as described in Example 2 prior to use.
    Experimental Procedure: A hybridization buffer was prepared and included the following components: 150 ul of SSC (3M NaCl, 0.3 M sodium citrate at pH 7), 90 ul of water, 60 ul of 0.5% Tween 20 detergent. To each well, a mixture of 30 ul of the hybridization buffer, 10 ul of probe 13D′ or 14D′, and 10 ul of PCR target product (5-10 nM in PCR buffer (PCR buffer for amplification purchased from Applied Biosystems, Cat. No. N808-0249 (AmpliTaq Gold DNA polymerase kit) was added. Aliquots were loaded on the plate and the plate was kept in the humidified chamber for 2 h at room temperature. After completion of the 2 h hybridization reaction, the plates were washed with washing buffer (750 mM NaCl, 75 mM sodium citrate, 0.05% Tween at pH 7) and with 0.5 M NaNO3 buffer at 35° C. and amplified with silver A and B from Sigma. After amplification, the glass slide was scanned under Hewlett Packard scan jet 5300C (FIG. 11). As expected, the controls did not show up as spots on the slide. Both wild type and mutant targets were showed up as dark spots since plates were washed at lower stringency that is 35° C.
    Wells were loaded on the plate in the following order:
  • Well 1---14D′ probe with 75mer mutant target
  • Well 2---13D′ probe without any target (control)
  • Well 3---13D′ probe with 75mer wild type target
  • Well 4---13D′ probe with 75mer mutant type target
  • Well 5---13D′ probe with 75mer mutant type target
  • Well 6---14D′ probe without any target (control)
  • Well 7---13D′ probe with 75mer wild type target
  • Well 8---14D′ probe with 75mer mutant type target

Example 8

2-Deoxy Glucosaminic Acid (Carbohydrate) Addition to Isocyanate Plate and Coupling with Capture DNA and Target Detection

This Example describes attachment of a carbohydrate linker to an isocyanate plate and attachment of a nucleic acid molecule to the linker and the use of the nucleic acid modified plate for detection of a target nucleic acid molecule. FIG. 12 is a schematic diagram illustrating the stepwise modification of the glass plate. As shown in FIG. 12, amino-group containing sugar molecules contained in an water/organic solvent mixture solution were reacted with the isocyanate linked glass surface to immobilize the sugar molecule onto the plate. Thereafter, a second molecule including a functional group (an amino-group containing DNA capture probe) is coupled to the first molecule immobilized onto the surface in the presence of a coupling agent such as EDC.

(a) Glass Slide Fictionalization and Attachment of Capture Strand to Modified Glass Surface:

Pre-cleaned glass slides were functionalized with silyl-isocyanate as described in Example 1. The highly reactive isocyanate sites were treated with 2′-deoxy glucosaminic acid (4 gm in 100 ml of water) in aqueous solution for one hour at room temperature. Thereafter, the immobilized plates were washed with water and ethanol successively and dried. The carboxylic acid moiety of the carbohydrate molecule was coupled with 3′-amino DNA capture probe (SEQ ID NO:28) using standard carbodiimide coupling conditions. The capture probe having a free 3′ amine was synthesized on Expedite (PE Bio systems) DNA synthesizer in accordance with Example 2. After synthesis, aqueous ammonia was used to release the DNA from the solid support, resulting in the generation of DNA strand containing a free amine group at the 3′-end. The crude DNA strand obtained was purified on C 18 column (Agilent), reverse phase HPLC as described in Example 2.

Attachment of the 3′-NH2 modified DNA to the carbohydrate linked glass surface was accomplished by adding 1-ethyl-3-(-3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (sulfo-NHS) to a 20 μM solution of the capture probe in activation buffer, 100 mM 2-N-morpholinoethanesulfonic acid (MES) at pH 6. The solution was incubated at room temperature for 15 minutes and then 10 ul aliquots were spotted on the glass surface. Only a portion of the glass plate was functionalized with capture oligonucleotides. These areas were subsequently spotted with the target DNA solution.

(b) Detection of Target Nucleic Acids:

A synthetic target sequence (SEQ ID NO:27) as well as capture probe oligonucleotides (SEQ ID NO:28) and gold nanoparticle-oligonucleotide detection probes having sequences complementary to the synthetic target sequences were prepared as described in Example 2.

Target sequence:

(SEQ ID NO:27)
5′aagcacttgaaggagaaggtgtctgcgggagccgatttcatcatcacg
cagcttttctttgaggctgacacattcttccgctttgtgaaggcatgcac
cg 3′

Capture probe sequence:

  • 3′-NH2-tcc aca gacgcc ctc ggc t-5 (SEQ ID NO:28)

The following nanoparticle-oligonucleotide conjugates specific for the synthetic target sequence were prepared in accordance with the procedure outlined in Example 2:

  • Probe P5: (a20)m-5′-S′-gold-S′-5′-[a20-cctcaaagaaaagc-3′]n (SEQ ID NO:29)
  • Probe P6: (a20)m-5′-S′-gold-S′5′-[a20-aaagcggaagaatgtgtc-3′]n (SEQ ID NO :30)
    S′ indicates a connecting unit prepared via an epiandrosterone disulfide group; m and n are approximately the same since equal concentrations of the oligonucleotides were used in preparing the nanoparticle-oligonucleotide conjugates. Stock solutions of nanoparticle probes P5 and P6 were prepared as described in Example 2.

Oligonucleotide capture probe immobilized glass plates were prepared via 2′-deoxy glucosaminic acid linker as described above.

A stock target solution was prepared as follows:

Protocol:

  • 2 μl of the target. sequence
  • 2 μl of the 1:10 diluted salmon sperm DNA (Gibco BRL cat. No. 15632-011)
  • 2 μl of 0.05% Tween 20.
  • 2 μl of the Hybridization buffer
  • 2 μl of the probes P5 and P6
  • 10 μl Total
    (b) Hybridization: Hybridization buffer (0.75 M NaCl, 7.5 mM MgCl2, 7.5 mM NaPO4, pH 7, 0.005% SDS), 2 μl of salmon DNA (1:10 diluted from neat commercial sample), 2 μl of 0.05% Tween 20, 1 ul of DNA target (1 μM in 10 mM phosphate buffer, pH 7) and 2 nM gold nanoparticle probes were mixed in an eppendorf tube. The mixture was incubated for 10 minutes and spotted 1 μl on the glass chip area that was exactly modified with DNA capture probe. The glass chip was kept in humidified chamber for 1 h at room temperature. After hybridization, the plate was washed with washing buffer (750 mM NaCl, 75 mM sodium citrate, 0.05% Tween at pH 7) and with 0.5M NaNO3 buffer at 23° C., and air dried.
    (c) Silver staining detection: After hybridization and for detection purposes, equal amounts of silver solution A and B (SIGMA) were mixed and applied on the glass surface such that the surface was fully covered with silver solution. After 5 minutes, the glass chip was washed with water. The silver stain procedure was repeated to improve the intensity of the silver spots. After signal amplification, the glass plates were scanned using a Hewlett Packard scan jet 5300C. FIG. 13 demonstrates the detection of MTHFR synthetic target sequence clearly. Four controls and four target spots were maintained on the glass chip.

Example 9

Glycine (Amino Acid) Addition to Isocyanate Plates and Coupling with Capture DNA and Target Detection

This Example describes attachment of a carbohydrate linker to an isocyanate plate and subsequent attachment of a nucleic acid molecule to the linker and the use of the nucleic acid modified plate for detection of a target nucleic acid molecule. FIG. 14 illustrates a schematic diagram for the stepwise attachment of a DNA capture probe via amino acid linker to an isocyanate modified glass plate. As shown in FIG. 14, amino acid molecules in aqueous solution were reacted with the isocyanate linked glass surface to immobilize the amino acid onto the plate. Thereafter, a second molecule including a functional group (an amino-group containing DNA capture probe) is coupled to the first molecule immobilized onto the surface in the presence of a coupling agent such as EDAC.

(a) Glass Slide Functionalization and Attachment of Capture Strand to Modified Glass Surface:

Pre-cleaned glass slides were functionalized with silyl-isocyanate as described in Example 1. The highly reactive isocyanate sites were treated with glycine (1 gm in 100 ml of water) in aqueous solution for one hour at room temperature. Thereafter, the plates were washed with water and ethanol successively and dried. The carboxylic acid site of the amino acid part was coupled with 3′-NH2-tcc aca gacgcc ctc ggc t-5′ DNA capture probe (SEQ ID NO: 14) using standard carbodiimide coupling conditions. The capture oligomer was synthesized on Expedite (PE Bio systems) DNA synthesizer in accordance with Example 2. After synthesis, aqueous ammonia was used to release the DNA from the solid support, resulting in the generation of DNA strand containing a free amine group at the 3′-end. The crude DNA strand obtained was purified on C 18 column (Agilent), reverse phase HPLC as discussed in Example 2.

The same methodology used to prepare the carbohydrate linked plates in Example 4 was used here also to detect the same target DNA. In addition, the same capture probes and gold nanoparticle probes described in Example 4 were used to detect the target DNA. All conditions were the same as described in Example 4 except a different linker (amino acid instead of carbohydrate) was used here. After signal amplification, the glass plates were scanned using a Hewlett Packard scan jet 5300C. The results are shown in FIG. 15. FIG. 15 shows that no silver spots were observed for the three controls. A silver spot was observed for the one target as expected.

In conclusion, it has been demonstrated that detection of different target DNA sequences are possible using capture probes immobilized onto the isocyanate modified glass plates. While DNA modified gold nanoparticle probes were used for detection, any suitable detection labels besides gold nanoparticles may be used such as chromophores, radiolabels, fluorescent labels, and Raman labels. Using this inventive method, amino group linked oligonucleotides, carbohydrates, amino acids; peptides and amino group linked small molecules can immobilize on glass surface in a simple way for detection. In the same fashion, hydroxyl group containing molecules may also be reacted on the isocyanate modified surface and detected with different reporter molecules, however, the reaction rate is slow relative to amino group containing molecules.

REFERENCES

  • 1. Nucleic Acids research, vol 22, 5456-5465 (1994).
    • Direct fluorescence analysis of genetic polymorphism by hybridization with oligonucleotide arrays on glass supports.
  • 2. Nucleic Acids research, vol 24, 3040-3047 (1996).
    • Fabrication of patterned DNA surfaces.
  • 3. Nucleic Acids research, vol 24,3031-3039(1996).
    • Covalent attachment of synthetic DNA to self-assembled monolayer films.
  • 4. Nucleic Acids research, vol 27, 1970-1977 (1999).
    • Versatile derivatisation of solid support media for covalent bonding on DNA-microchips.
  • 5. Angew .Chem. Int. Ed, 38, No.9, 1297(1999)
    • Covalent surface functionalization and self-organization of silica nanoparticles.
  • 6. Analytical biochemistry 280, 143-150 (2000).
    • Comparison between different strategies of covalent attachment of DNA to glass surfaces to build DNA microarrays.
  • 7. Nucleic Acids research, vol 29, 955-959 (2001).
    • Immobilization of oligodeoxyribonucleotides with multiple anchors to microchips.

Claims

What is claimed:

1. A method for immobilizing a probe on a glass surface comprising the steps of:

(a) reacting the glass surface with a solution at room temperature to provide immobilized reactive moieties, the solution comprising (3-isocyanatopropyl) triethoxysilane, an organic solvent, and an acid; and

(b) reacting the immobilized reactive moieties with an amino-group containing molecule so as to immobilize said molecule on the glass surface, wherein the amino-group containing molecule further comprises one or more functional groups;

(c) reacting the immobilized amino-group containing molecule on the surface with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) that reacts with a functional group of the immobilized amino-group containing molecule so as to produce second immobilized reactive moieties; and

(d) reacting the second immobilized reactive moieties with a second molecule having a functional group capable of reacting with the second immobilized reactive moieties.

2. The method of claim 1 wherein the second molecule is a probe.

3. The method of claim 2, wherein the probe is selected from the group consisting of a protein, a peptide, a nucleic acid, a peptide nucleic acid, a linked nucleic acid, an amino acid, a nucleoside triphosphate, a carbohydrate, a lipid, a lipid bound protein, an aptamer, a virus, a cell fragment, and a whole cell.

4. The method of claim 2, wherein the probe has been derivatized to contain one or more amino and/or hydroxyl groups.

5. The method of claim 4, wherein the probe has been derivatized to contain one or more amino groups.

6. The method according to claim 1 wherein the (3-isocyanatopropyl) triethoxysilane is present in solution at a concentration ranging between about 20 mM and about 200 mM.

7. The method of claim 1 wherein the amino-group containing molecule immobilized on the surface has at least one carboxyl group.

8. The method of claim 7 wherein the second molecule has at least one amino group.

9. The method of claim 7 wherein the second immobilized reactive moieties are the reaction products of the carboxyl group with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC).

10. The method according to claim 1, wherein the amount of acid in the solution is between about 0.01 % (v/v) to about 0.1 % (v/v).

11. A method for immobilizing an amino-group containing molecule on a surface having free hydroxyl groups comprising the steps of:

(a) reacting said surface with a solution at room temperature to provide immobilized reactive moieties, the solution comprising a silyl isocyanate derivatizing agent, an organic solvent, and an acid, the silyl isocyanate agent having a formula:


(R1O)(R2O)(R3O)Si—X—NCO

wherein R1R2 and R3 independently represents C1-C6 alkyl, phenyl, or aryl substituted with one or more groups selected from the group consisting of C1-C6 alkyl and C1-C6 alkoxy; X represents linear or branched C1-C20 alkyl or aryl substituted with one or more groups selected from the group consisting of C1C6 alkyl and C1-C6 alkoxy, optionally substituted with one or more heteroatoms comrrising oxygen, nitrogen, and sulfur;

(b) reacting the immobilized reactive moieties with the amino-group containing molecule so as to immobilize the amino-group containing molecule on the surface, wherein the amino-group containing molecule further includes one or more functional groups and comprises a carboxyl group;

(c) reacting the immobilized amino-group containing molecule on the surface with a chemical agent that reacts with a functional group of the amino-group containing molecule so as to produce second immobilized reactive moieties; and

(d) reacting the second immobilized reactive moieties with a second molecule having a functional group capable of reacting with the second immobilized reactive moieties.

12. The method of claim 11, wherein the chemical agent is 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC), and the second immobilized reactive moieties are the reaction products of the carboxyl group with EDC.

13. The method of claim 12, wherein the second molecule contains or has been derivatized to contain one or more amino groups.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: