Patent application title:

Human mater proteins

Publication number:

-

Publication date:
Application number:

10/216,645

Filed date:

2002-08-12

âś… Patent granted

Patent number:

US 7,125,684 B2

Grant date:

2006-10-24

PCT filing:

-

PCT publication:

-

Examiner:

Gabriele Bugaisky

Adjusted expiration:

2023-09-15

Abstract:

Two human MATER proteins as well as their use for fertility disorders, therapy and diagnosis are described.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12Q1/42 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving hydrolase involving phosphatase

C12N9/14 IPC

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Hydrolases (3)

Description

The invention relates to Mater and its use as a pharmaceutical agent for influencing apoptotic processes that play a basic role in birth control.

For birth control, the “standard pill” is the most frequently used means of choice as a female contraceptive agent. Its regular intake results in ovulation inhibition in women. The principle of this method is that by taking the pill, suppression of the endogenic steroid hormone production in the ovary and thus ovulation inhibition result. A drawback is that a natural cycle thus is no longer present in women. Moreover, in connection with taking the pill in patients who are potentially at risk, side effects such as, for example, tightness of the chest, weight increase, etc., can occur.

Numerous studies confirm that fertility decreases in women as they grow older. This can be attributed to, i.a., a deteriorating quality of ovocytes, an elevated abortion rate, and increased exposure to infectious germs (e.g., chlamydia or gonococci). Since, in industrial countries, however, the age of women who are pregnant for the first time is always moving further back, it is necessary to find possibilities for improving fertility. This is true for women and also for men. For couples with fertility disorders, techniques of assisted reproduction are now available (in vitro fertilization (IVF); gamete intrafallopian transfer (GIFT), intrauterine insemination). These methods are invasive, however, and are connected in most cases with a prior follicle maturation stimulation in women by proteohormones (follicle-stimulating hormone/FSH). This can result in unpleasant side effects such as headaches or pains in the abdomen, but also in the worst case in the so-called ovarian hyperstimulation syndrome.

There therefore exists the urgent need to provide new substances and agents for birth control, i.e., both to promote fertility and to inhibit fertility.

In mice, it was shown that female mice without an OP (ooplasm-specific protein)-1 gene are infertile (Tong and Nelson, 1999, Endocrinology 140, 3720–3726 and Tong et al., Nature Genetics, 2000, 26, 267–267), while the fertility of male animals remains unchanged. It was possible to show that the infertility is the result of a blocking of the development of the fertilized ovocyte after the two-cell stage. The cycle of the mouse is normal; animals ovulate spontaneously after stimulation with gonadotropin. Fertilized cells of these transgenic animals remain, however, in the two-cell stage without further development or degenerate about 3 days after fertilization. The OP-1 is also referred to as MATER (maternal-antigen-that-embryos-require).

In a mouse model of the autoimmune oophoritis, antibodies against mouse-MATER protein could be detected. This model has many similarities to the human clinical picture of “autoimmune-premature ovarian-failure,” so that the possibility exists that a putative human MATER protein plays an important role in the regulation of fertility similar to the mouse-MATER. It is not known to date, however, whether a human homolog to the mouse-MATER protein exists.

In this invention, it was possible to show that human MATER is strongly expressed in the uterus. In this case, the expression in the inner layer of the uterus, the endometrium, shows a clear regulation based on the female cycle. The expression of Mater is significantly reduced in the so-called implantation window of the cycle (about 8 days after the increase of luteinizing hormone LH, which triggers ovulation) in comparison to the phase directly after the ovulation (see FIG. 4). By means of quantitative determinations, the mRNAs from the human endometrium of three different clinical study groups were compared with one another. The result of this study indicated that the mRNA of MATER in comparison to the control group (before opening the implantation window) is greatly reduced in group LH +8 (time of the open implantation window) in healthy women. In group LH +8/EMT (endometriosis patients), an increased amount of MATER-mRNA could be detected in 2 out of 3 patients. A cause of infertility, as it is observed in the case of endometriosis patients, can be based on the elevated MATER expression, since in the implantation window, thus at the time of the fertile phase, the MATER expression in the endometrium of fertile women is reduced.

A human MATER protein therefore represents a suitable target substance to identify new agents for birth control.

This invention represents a nucleic acid that already comprises

  • a. the nucleotide sequence that is shown in Seq ID NO 1 or Seq ID NO 3,
  • b. a nucleotide sequence that corresponds to a sequence from a, in the scope of the degeneration of the genetic code, or
  • c. a nucleotide sequence that hybridizes with the sequences from a, or b, under stringent conditions with the function of a human MATER protein.

The term “hybridization under stringent conditions” according to this invention is defined by Sambrook et al. (Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989). A stringent hybridization exists, for example, if after washing for 1 hour with 1×SSC and 0.1% SDS at 50° C., preferably at 55° C., especially preferably at 62° C. and most preferably at 68° C., especially for 1 hour in 0.2×SSC and 0.1% SDS at 55° C., preferably at 62° C. and most preferably at 68° C., a hybridization signal is still observed. The nucleic acids that hybridize under these conditions with the nucleic acid that is shown in Seq. ID NO 1 and/or 3 or a nucleotide sequence that corresponds to this sequence within the scope of the degeneration of the genetic code are also the subject matter of this invention.

Nucleic acids can produce single- or double-strand DNA, e.g., cDNA, or RNA, e.g., mRNA, cRNA, or pre-mRNA.

The nucleic acids that are shown in Seq ID NO 1 and Seq ID NO 3 code for a human MATER protein. They represent splice variants of the same gene. In the sequence that is shown in Seq ID NO 3, exon 4 is missing.

Preferred is the nucleic acid that comprises a protein-coding section of the nucleic acid sequence that is shown in Seq ID NO 1 or Seq ID NO 3. A protein-coding section of the sequence that is shown in Seq ID NO 1 is in the nucleotide range of 1 to 3489, and the sequence that is shown in Seq ID NO 3 is in the nucleotide range of 1 to 3432.

A subject of the invention is also a nucleic acid that codes for a polypeptide with the amino acid sequence that is shown in Seq ID NO 2 or Seq ID NO 4.

The nucleic acid according to the invention can be obtained from mammals, e.g., human cells, or from a cDNA library or a genomic library, which is obtained from, e.g., human cells. It can be isolated according to known techniques with use of short sections of the nucleic acid sequences that are shown in Seq ID NO 1 or Seq ID NO 3 as hybridization probes or amplification primers.

In addition, the invention relates to polypeptides that are coded by a nucleic acid according to the invention. These polypeptides have the function of a human MATER protein. The function of the MATER protein is that of an NTPase, which is connected with apoptosis. Malfunctions in the MATER protein result in an arrest of the development of the fertilized ovocytes that are found in the two-cell stage. The cells undergo apoptosis, and further development is no longer possible.

In addition, a subject of the invention is a polypeptide that comprises the amino acid sequence that is shown in Seq ID NO 2 or Seq ID NO 4.

The polypeptide according to the invention can be a recombinant polypeptide, a natural, isolated polypeptide or a synthetic polypeptide.

The polypeptide according to the invention contains various domains: a Dapin (Domain in apoptosis and interferon response) domain, a NACHT (NAIP, CIIA, HET- and TP-1) domain, and a DUF (Domain of unknown function) domain. These domains are linked with apoptosis (Staub, E. et al., TIBS, 2001, 26 (2), 83–85, Koonin, E. V., Aravind, L., TIBS, 2000, 25 (5), 223–224). This suggests that members of the NACHT family contain NTPases that have anti-apoptotic action. The Dapin domains, which are responsible for the formation of homodimers or heterodimers, were previously described in the case of proteins that are involved in apoptosis or inflammatory processes. MATER has an antiapoptotic action, while in the case of errors or malfunctions of the MATER protein, the cells go into apoptosis and a further development of the two-cell stage is no longer possible. In addition, MATER 14 contains so-called “leucin-rich repeats” (LRR, Kajava, A. V., 1998, J. Mol. Biol. 227, 519–527), which are responsible for the protein-protein interactions. Although the homology between the human sequence and the mouse sequence is only 52%, mouse-Mater polypeptide and human Mater polypeptide show a high sequence homology in the areas of all domains with the exception of the Dapin domain (see FIGS. 1 and 2).

The mRNA of the polypeptide according to the invention according to claim Seq ID NO 2 or Seq ID NO 4 is transcribed primarily in the ovaries, in the testes and in the placentas.

The polypeptide according to the invention or partial areas thereof (peptides) can be used for the production of antibodies. For the production of polyclonal antibodies, the polypeptides or peptides can be bonded to, e.g., KLH (Keyhole Limpet Hemocyanin), and animals, e.g., rabbits, can be sprayed. They can also be used for the production of monoclonal antibodies. For antibody production, a polypeptide or peptide according to the invention or a mixture of several peptides according to the invention can be used. In this case, the production of the antibodies is carried out according to standard processes, as they are described in, e.g., Kohler, G. and Milstein, C., Nature 1975, 256, 495–497 and Nelson, P. N. et al., Mol. Pathol. 2000, 53, 111–117.

Subjects of the invention are also the antibodies that are directed against a polypeptide according to the invention.

The antibodies according to the invention can be used for the detection of the polypeptides according to the invention. This can be carried out by, e.g., immunohistochemistry. The antibodies according to the invention can also be used in other immune tests, such as, e.g., an ELISA (enzyme linked immunosorbent assay) or in a radioimmuno test. Thus, the concentration of polypeptides according to the invention can be detected in tissue or cell extracts.

The detection of the expression of the polypeptide according to the invention can also be carried out via the detection of mRNA in the cells. The subject of the invention is therefore also the use of a probe with nucleic acid sequences that are complementary to the nucleic acid sequences that code for the peptides according to the invention for the production of a reagent for the detection of the presence of mRNA in cells according to the invention. A probe is a short strand of DNA with at least 14 nucleotides. The probes according to the invention can be used in, e.g., a Northern Blot analysis. This method is described in, e.g., Sambrook, J. et al., 1989, Cold Spring Harbor Laboratory Press. Other methods for detecting RNA are in-situ hybridization, RNAse protection assay or PCR.

In addition, the invention relates to antisense molecules that are directed against the nucleic acid sequence according to the invention and can suppress the expression of the MATER protein. Such molecules can be used specifically for contraception.

In addition, subjects of the invention are vectors that contain at least one copy of the nucleic acid according to the invention. Vectors can be prokaryotic or eukaryotic vectors. Examples of vectors are pPRO (Clontech), pBAD (Invitrogen), pSG5 (Stratagene), pC1 (Promega), pIRES (Clontech), pBAC (Clontech), pMET (Invitrogen), and pBlueBac (Invitrogen). The nucleic acids according to the invention can be inserted into these vectors with the methods that are known to one skilled in the art. In connection with expression signals, such as, e.g., promoters and enhancers, the nucleic acids according to the invention are preferably found in the vector.

The invention also relates to cells that are transfixed with a nucleic acid sequence according to the invention or with a vector according to the invention. As cells, e.g., E. coli, yeast, Pichia, Sf9, COS, CV-1 or BHK can be used. These cells can be used both for the production of the polypeptide according to the invention or for test systems.

In the USA, 1% of women suffer from “autoimmune premature ovarian failure,” a disease whose clinical syndrome is characterized by the formation of amenorrhea (less than 40 years), by infertility and by menopausal symptoms, caused by hypoestrogenemia and hypergonadotropinemia (Nelson and Tong, Endocrinology, 1999, 140, 3720–3726). In an analogous mouse model of the autoimmune-oophoritis, it was possible to show that one of the causes of this disease is the formation of antibodies against the mouse-Mater protein. A subject of the invention is therefore the use of the polypeptides according to the invention or the nucleic acids that code for this as a target substance for the production of an agent for treating fertility disorders, whose cause lies in a malfunction of the MATER protein.

In particular, the invention includes the use of

a. A nucleic acid according to the invention,

b. A polypeptide according to the invention, or

c. A cell according to the invention

for identifying effectors of a polypeptide according to the invention. Effectors are substances that have an inhibitory or activating effect on the polypeptide according to the invention and that are able to influence the MATER function of the polypeptides according to the invention.

For the specific contraception, it may be advantageous to maintain the embryos in the two-cell stage to prevent further development. By administering antibodies that are directed against the polypeptide according to the invention, the endogenic function of MATER can be impaired and/or eliminated. The invention therefore also relates to the use of antibodies that are directed against a polypeptide according to the invention.

In addition, the invention relates to a test system for identifying effectors of a polypeptide according to the invention, whereby a polypeptide according to the invention can be incubated as a complete or partial sequence thereof with a modulator and, for example, the interaction of MATER with proteins or partial sequences of other proteins can be measured (protein interaction assay). The protein-protein interactions are to be measured in the mammalian two-hybrid assay system (stratagenes), in which the interaction between MATER and other proteins or partial sequences thereof is determined via the activation of the expression of a reporter gene.

In addition, the invention relates to a test system for identifying effectors of a polypeptide according to the invention, whereby a polypeptide according to the invention can be incubated as a complete or partial sequence thereof with a modulator, and, for example, the amount of hydrolyzed nucleotide can be measured. As a partial sequence, e.g., the area that comprises the “leucine-rich repeats” and the NACHT domains or shorter strands thereof can be used. The activity of the effectors can be measured, e.g., by labeled NTP being used and the cleavage in NDP and Pi being measured (NTPase assay).

In addition to the hydrolysis of NTP, a binding test can also be performed to identify substances that prevent the binding of NTP to MATER.

This binding test can also be performed with a cell according to the invention that contains the polypeptide according to the invention. In addition to the binding of the substances to be tested on MATER, an intracellular effect can also be measured.

The effectors of the polypeptide according to the invention can be used to treat diseases that are based on malfunctions in the MATER protein. Examples of this are ovarian dysfunction, “autoimmune premature ovarian failure,” inflammatory diseases and diseases of the immune system. In addition, these effectors can be used to treat female infertility.

The effectors of the polypeptide according to the invention can also be used for contraception in women. If they block the NTPase activity of Mater, the fertilized ovocyte undergoes apoptosis, and further development is no longer possible.

In addition, the invention relates to a test system for identifying effectors of a polypeptide according to the invention, whereby a polypeptide according to the invention can be incubated as a complete or partial sequence thereof with a modulator, and for example, apoptosis induction in the cells can be measured. As a partial sequence, e.g., the area that comprises the “leucin-rich repeats” and the NACHT domains or shorter strands thereof can be used. The activity of the effectors can be measured, e.g., by their influence on the apoptosis induction in cells that were incubated with Mater or a fragment of Mater (cell-death assay).

It was found that the polypeptide according to the invention produces an antigen that is absolutely necessary for the development of the embryo over the two-cell stage. The antigen could be administered directly to women who suffer from fertility disorders. Another possibility was the use of antigen in vitro to an oocyte culture. A further possibility was the addition of the antigen to the fertilizing medium or to the medium for the culture of the embryo. The thus prepared oocytes are then used for in-vitro fertilization. A treatment with antibodies against the polypeptide according to the invention or segments therefore could be used by women for birth control.

In addition, the invention relates to a process for the preparation of a pharmaceutical agent, whereby

    • a. Substances are brought into contact with a test system according to the invention,
    • b. The action of the substances on the test system in comparison to controls is measured,
    • c. A substance that in step b. shows a modulation of the activity of the polypeptides according to the invention is identified,
    • d. And the substance that is identified in step c. is mixed with the formulation substances that are commonly used in pharmaceutics.

The activity of the polypeptide according to the invention is defined as the NTPase activity of the polypeptide or its property to induce apoptosis. A substance that is identified by a process according to the invention can optionally be optimized relative to metabolic stability, activity in a test system according to the invention and/or bio-availability. To this end, methods that are common in chemistry can be used.

The preferred preparations consist in a form of dispensing that is suitable for oral, enteral or parenteral administration. Such forms for dispensing are, for example, tablets, film tablets, coated tablets, pills, capsules, powder or depot forms as well as suppositories. Corresponding tablets can be obtained, for example, by mixing active ingredient with known adjuvants, for example inert diluents such as dextrose, sugar, sorbitol, mannitol, polyvinyl pyrrolidone, explosives such as corn starch or alginic acid, binders such as starch or gelatin, lubricants such as carboxypolymethylene, carboxymethyl cellulose, cellulose acetate phthalate or polyvinyl acetate. The tablets can also consist of several layers.

The invention also relates to a process for determining the autoimmune antibodies against the MATER protein. Autoimmunity is a well-described mechanism for “premature ovarian failure,” a disease in which the ovaries of women are attacked by their own immune systems; an inflammation of the ovaries is the result in most cases. For the diagnosis of fertility disorders, bodily samples (tissue or liquids) in women can be studied. The content of autoimmune antibodies can be determined by means of an immune test, such as, e.g., an ELISA (enzyme linked immunosorbent assay) test or in a radioimmuno test. The presence of autoimmune antibodies in tissue or cell extracts thus can be detected and allows conclusions on the state of health of the ovary.

It has also been found that the ovocyte quality depends on the Mater expression. The Mater expression in ovocytes therefore can also be used as a diagnostic marker for determining the ovocyte quality.

In addition, the invention relates to a process for the diagnosis of diseases, whose causes include mutations of the MATER protein. For this purpose, DNA chips can be used. The invention therefore relates in addition to a DNA chip, in which at least one oligonucleotide is immobilized, which corresponds to the complete cDNA sequence or a partial sequence or a complementary sequence to the one described in Seq ID 1. The invention thus also relates to the use of a DNA chip according to the invention for diagnosis of fertility disorders in, i.a., the ovary and endometrium.

DNA chips, also known as DNA microarrays, are miniaturized vehicles, in most cases made of glass or silicon, on whose surfaces DNA molecules of known sequence are immobilized in an ordered grid in high density. The surface-bonded DNA molecules are hybridized with complementary, optionally labeled nucleic acids. The labeling can be a fluorescence dye.

In the case of oligonucleotide chips, the oligonucleotides, which can be bonded to a DNA chip according to the invention, represent partial sequences of the gene products (mRNA or cDNA that is derived therefrom). One or more oligonucleotides per gene can be bonded to the DNA chip. Preferred are 25 nucleotide-long oligonucleotides. The latter are preferably selected from the respective 3′-untranslated end of the gene. Methods for production and use of DNA chips are described in, e.g., U.S. Pat. Nos. 5,578,832; 5,556,752 and 5,510,270.

In the case of cDNA chips, the complete gene products (cDNAs) or subfragments (200–500 bp long) are bonded to the chip. The method is described in, e.g., Eckmann, L. et al., J. Biol Chem., 2000, 275 (19), 14084–14094.

First, the suitable DNA sequences are determined according to Seq ID NO 1 or Seq ID NO 3. Sequences that can hybridize with the selected gene transcripts are suitable. The oligonucleotides are then produced on the chip by a chemical process that is based on the photolithographic process. For this purpose, photolithographic masks that were produced by suitable computer algorithms are used.

The labeled RNA is incubated with the chip in a hybridization furnace. Then, the chip is analyzed in a scanner that determines the hybridization profile. It can thus be determined whether changes to the transcript have occurred (e.g., mutations, truncations). It also makes possible the quantification of the transcript and thus the MATER protein and sheds light on, e.g., a mutation in the promoter.

It has been found that during the implantation window (LH +8), Mater is expressed to a smaller extent than in the prereceptive phase (LH +4). By determining the MATER expression, the optimal time for the implantation of oocytes, which were fertilized in vitro, can accordingly be determined. Moreover, the determination of the Mater expression can be used as a diagnostic marker for determining the implantation window in the endometrium.

DESCRIPTION OF THE FIGURES

FIG. 1 shows a multiple sequence alignment of the MATER proteins of mice (SEQ ID NO: 5) and humans (SEQ ID NO: 2).

FIG. 2 indicates the localization of the various domains within the human MATER protein. The “from” and “to” columns relate to the amino acid numbering according to Seq ID 2.

FIG. 3a shows the mRNA expression pattern of the human MATER protein in various tissues, demonstrated by the PCR. As an internal control, primers for cyclooxygenase (COX) were used. After the PCR amplification, the products were separated on an agarose gel and colored with ethidium bromide.

FIG. 3b shows the gene expression of RNA from MATER in various tissues, demonstrated by the real-time quantitative PCR method. It is readily evident that MATER is strongly expressed in the placenta and the endometrium. In the ovary, MATER is only weakly expressed. Here, these are ovaries from menopausal patients. In these ovaries, only very few ovocytes are present, and these ovocytes in addition are of lower quality, so that Mater is expressed only slightly.

FIG. 4 shows the gene expression of the RNA from MATER in the endometrium, demonstrated by the real-time quantitative PCR method. A greatly reduced regulation of the human MATER gene in the group (LH +8) in comparison to the group LH +4 is clear. Specific “primers” for the MATER were used. Group LH +4: before the opening of the implantation window; group LH +8: time of the open implantation window in healthy women; group LH +8 EMT: time of the open implantation window in women who have the disease endometriosis; LH: luteinizing hormone; 4 or 8: period in days.

Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. The following preferred specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

In the foregoing and in the following examples, all temperatures are set forth uncorrected in degrees Celsius and, all parts and percentages are by weight, unless otherwise indicated.

EXAMPLES

The molecular-biological methods that are used in the Examples, such as, e.g., polymerase chain reaction (PCR), production of cDNA, cloning of DNA, and sequencing of DNA, were performed as described in known textbooks, such as, for example, in Molecular Cloning, A Laboratory Manual (Sambrook, J. et al., 1989, Cold Spring Harbor Laboratory Press).

Example 1

Cloning, Expression and Purification of the Human Mater Protein

For the expression of the two splice variants of the Mater protein, the coding area was amplified by means of the polymerase chain reaction (for reaction conditions, see Example 2) (primer for the N-terminal area 5′ ATGGAAGGAGACAAATCGCTC 3′ (SEQ ID NO: 6); primer for the C-terminal area: 5′ TAGTTGGCATTCTTTTGATG 3′) (SEQ ID NO: 7), and inserted in the baculovirus expression vector pBlueBac4.5/V5-His-TOPO (Invitrogen) or the eukaryotic expression vector pcDNA3.1/V5/His-TOPO (Invitrogen). To simplify detection and purification, a fusion with an His-tag was carried out. After co-transfection of insect cells with the Bac-N-Blue DNA, recombinant viruses that were identified by a PCR process were produced. A phage stock was then applied and used in larger amounts for additional transfections and production of Mater. The purification of the His-tagged proteins was carried out via a nickel affinity column.

Example 2

Studies Regarding the Expression of mRNA of the Human Mater Protein

a) To study the expression of mRNA, a PCR was carried out as follows:

As templates, cDNA from the following tissues was used: bone, vas deferens, prostate, testis, placenta, breast, ovary, adrenal gland, skin, kidney and lung. The reaction batch contains: 2 μl of cDNA; 20 μm of primer (antisense primer: 5′ cacatgaacatccttctccc 3′ (SEQ ID NO: 8); sense primer: 5′ cacagtcctccagtatcagc 3′ (SEQ ID NO: 9)), 10 mmol of NTP; 1.5 mmol of MgCl2 and 0.5 U of Taq gold (Perkin Elmer). The PCR conditions are 94° C. for 10 minutes, then 40 cycles at 94° C. for 1 minute; 58° C. for 1 minute; 72° C. for 1.5 minutes. Then, an aliquot was applied to a 1% agarose gel in 1 X TAE-running buffer. Under these conditions, an expression of the mRNA could be found in the following tissues: testis, placenta and ovary (see FIG. 3a).

b) Determination of the MATER-RNA amounts in endometrial samples by real-time quantitative RT-PCR analysis:

The endometrium was removed from patients who belong to the three groups LH +4, LH +8, and LH +8/endometriosis and shock-frozen in liquid nitrogen. Total-RNA was isolated from the tissues pulverized by “mortars” under liquid nitrogen by means of TRIZOL (Invitrogen). Starting from 5 μg of total-RNA, first DNase I-digestion (Invitrogen) and then a first-strand-synthesis were performed by using the SUPER-SCRIPT First-Strand Synthesis System for RT-PCR (Invitrogen). For the amplification of the transcripts for relative quantification, 0.125 μl of first-strand-DNA was used. With use of human Mater-specific primer pairs (forward primer: 5′ CCT CCC AAG TTG AGG GAT CTT-3′ (SEQ ID NO: 10) and reverse primer: 5′ TAG CCC TGG TGT GCA GCA C-3′ (SEQ ID NO: 11), the amplification was performed under the following PCR conditions: 10 minutes, 95° C.; 15 seconds, 95° C., 1 minute; 60° C. (40 cycles). As internal controls, primers were used for human cyclophilin (huCYC) Part Number 4310857 (PE Biosystems) in the PCR. The measurement of the fluorescence as a yardstick for the increase of amplification products was carried out online by means of an ABI Prism 7700 Sequence Detector (PE Biosystems). The purity of the amplification products was examined by plotting melt curves (see FIGS. 3b and 4).

Example 3

Test System for Finding Substances that Influence the NTPase Activity

A standard NTPase assay was performed as follows: Incubation for 30 minutes at 30° C. 5–30 pMol of the purified Mater protein or a fragment that encompasses the NTPase domain was incubated in a reaction buffer [20 mmol of tris/HCl pH 7.5; 3 mmol of MgCl2; 1 mmol of 2-mercaptoethanol; 10% glycerol; 0.01% triton X-100; 0.1 mg/ml of BSA; 11 μM[γ-32P]NTP (0.5 μCi)] (final volume 25 μl). The reaction was stopped by adding 0.5 ml of activated carbon (2 mg/ml). Then, the batch was centrifuged for 10 minutes at 10,000×g, and 50 μl of the supernatant was counted in the scintillation counter (Cerenkov). Substances that influence the NTPase activity of Mater are added to the reaction buffer.

Example 4

Test System for Finding Substances that Prevent the Nucleotide Bond to Mater

The reaction mixture [20 mmol of Tris/HCl pH 7.5; 3 mmol of MgCl2, 1 mmol of 2-mercaptoethanol; 10% glycerol, 0.01% TRITON X-100, 0.1 mg/ml of BSA and 50 μM of [γ-32-P]ATP (0.5 μCi)] with 30–80 pMol of purified Mater protein or a fragment of the Mater protein, which comprises the ATP binding site, was incubated for 30 minutes at 30° C. The reaction was completed by adding ice-cold NaCl/Pi, and the samples were microfiltered by BA85 nitrocellulose filter. The nitrocellulose was than washed twice with 2 ml of NaCl/Pi, dried, and the bonded [γ-32-P]ATP was counted according to the method of Cerenkov. Substances that influence the binding are added to the reaction mixture.

Example 5

Test System for Finding Substances that Induce Apoptosis (Cell Death Assay)

To find substances that induce apoptosis, the Mater or partial sequences of Mater in a eukaryotic cell, e.g., MCF-7, that was cloned in a eukaryotic expression vector (pCDNA3.1, see Example 1) was transfixed by means of LipfectAMINE (Life Technology, Inc.) according to manufacturer's instructions. 24 hours after the transfection, the cells were set in 0.5% glutaric aldehyde and incubated with 5-bromo-4-chloro-3-indolyl β-D galactopyranosides (X-gal) for 4 hours. The cells were visualized in a phase contrast microscope, and the proportion of apoptotic cells was counted. Substances that influence the apoptosis induction are added to the cell culture medium (10% heat-inactivated fetal calf serum in RPMI 1640).

Sequence Protocol

  • <110> SCHERING AKTIENGESELLSCHAFT
  • <120> Human Mater Protein

The entire disclosures of all applications, patents and publications, cited herein and of corresponding German application No. 101 39 874.3-41, filed Aug. 10, 2001 is incorporated by reference herein.

The preceding examples can be repeated with similar success by substituting the generically or specifically described reactants and/or operating conditions of this invention for those used in the preceding examples.

From the foregoing description, one skilled in the art can easily ascertain the essential characteristics of this invention and, without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.

Claims

The invention claimed is:

1. A method for the identification of an effector of a polypeptide, comprising:

contacting (a) (1) a polypeptide encoded by a nucleotide sequence that hybridizes to the complete complement of SEQ ID NO:1 or 3 under stringent hybridization conditions comprising washing for 1 hour at 68° C. with 1×SSC and 0.1% SDS and which polypeptide possesses nucleoside triphosphatase (NTPase) activity, or (2) a polypeptide fragment of said (1) polypeptide which retains NTPase activity,

with (b) a test effector, and measuring the NTPase activity of said polypeptide.

2. A method of claim 1, where hydrolyzed NTP is detected.

3. A method of claim 1, where intracellular phosphorylation is detected.

4. A method of claim 1, wherein said test effector is a polypeptide.

5. A method of claim 1, wherein said polypeptide is a (1) polypeptide encoded by a sequence that hybridizes to the complete complement of SEQ ID NO:1 or 3 under stringent hybridization conditions comprising washing for 1 hour with 1×SSC and 0.1% SDS at 68° C. and which polypeptide possesses NTPase activity.

6. A method of claim 1, where said polypeptide is (2) a polypeptide fragment said (1) polypeptide which retains NTPase activity.

7. A method of claim 1, wherein said polypeptide is cell-free.

8. A method for the identification of an effector of a polypeptide, comprising:

contacting (a) a polypeptide of SEQ ID NO: 2 or 4, with (b) a test effector, and measuring the NTPase activity of said polypeptide.

9. A method of claim 8, wherein said polypeptide is a polypeptide of SEQ ID NO: 2.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: