Patent application title:

GABAreceptor polypeptides and screening methods

Publication number:

-

Publication date:
Application number:

10/235,463

Filed date:

2002-09-04

✅ Patent granted

Patent number:

US 7,507,543 B2

Grant date:

2009-03-24

PCT filing:

-

PCT publication:

-

Examiner:

Daniel E. Kolker

Adjusted expiration:

2025-05-10

Abstract:

The present invention relates to a nucleic acid molecule encoding a human or canine GABAB receptor, or a conservative variant thereof.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

G01N33/53 IPC

Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing Immunoassay; Biospecific binding assay; Materials therefor

Description

CROSS REFERENCE TO RELATED APPLICATION

This application is a continuation-in-part of U.S. Ser. No. 09/242,608, filed Feb. 19, 1999, which claims priority to PCT/SE98/01947 filed Oct. 27, 1998, and Swedish application Nos. 9703914-2, filed Oct. 27, 1997; 9800864-2, filed Mar. 16, 1998; and 9802575-2, filed Jul. 17, 1998.

FIELD OF THE INVENTION

The invention relates to nucleic acid molecules encoding GABAB receptors, and to methods for screening for compounds that are inhibitors of transient lower esophageal sphincter relaxations (TLESR).

BACKGROUND OF THE INVENTION

GABAB Receptors

GABA (4-aminobutanoic acid) is an endogenous neurotransmitter in the central and peripheral nervous systems. Receptors for GABA have traditionally been divided into GABAA and GABAB receptor subtypes. GABAB receptors (for a review see Kerr, D. I. B. and Ong, J. (1995) Pharmac. Ther. vol. 67, pp.187-246) belong to the superfamily of G-protein coupled receptors. GABAB receptor agonists are useful in the treatment of central nervous system (CNS) disorders, such as for inducing muscle relaxation in spinal spasticity, cardiovascular disorders, asthma, and gut motility disorders such as irritable bowel syndrome; and as prokinetic and anti-tussive agents. GABAB receptor agonists have also been disclosed as useful in the treatment of emesis (WO 96/11680).

The cloning of the rat GABAB receptors GABABR1a (SEQ ID NOs: 44 and 45) and GABABR1b (SEQ ID NOs: 46 and 47) was disclosed by Kaupmann et al. ((1997) Nature, vol. 386, 239-246). The mature rat GABABR1b differs from GABABR1a in that the N-terminal 147 residues are replaced by 18 different residues. It is thought that the rat GABABR1a and GABABR1b receptor variants are derived from the same gene by alternative splicing. Cloning of the human GABABR1b receptor was disclosed in WO97/46675.

Reflux

In some humans, the lower esophageal sphincter (LES) is prone to relaxing more frequently than in other humans. As a consequence, fluid from the stomach can pass into the esophagus because the mechanical barrier is temporarily lost at such times, an event hereinafter referred to as “reflux.”

Gastro-esophageal reflux disease (GERD) is the most prevalent upper gastrointestinal tract disease. Conventional therapies have sought to reduce gastric acid secretion, or reduce esophageal acid exposure by enhancing esophageal clearance, lower esophageal sphincter tone, and gastric emptying. The major mechanism behind reflux has been considered to depend on a hypotonic lower esophageal sphincter. However, recent research (e.g., Holloway & Dent (1990) Gastroenterol. Clin. N. Amer. 19, 517-535) has shown that most reflux episodes occur during transient lower esophageal sphincter relaxations (TLESR), i.e., relaxations not triggered by swallowing. It has also been shown that gastric acid secretion usually is normal in patients with GERD.

SUMMARY OF THE INVENTION

The present invention provides nucleic acid molecules encoding human and canine GABAB receptors. These nucleic acid molecules make it possible to screen for compounds that are agonists or antagonists of GABAB receptors, e.g., to identify compounds which are inhibitors of TLESR.

Consequently, the invention provides an isolated nucleic acid molecule encoding a human or canine GABAB receptor, or a conservative variant thereof. An “isolated nucleic acid” is a nucleic acid the structure of which is not identical to that of any naturally occurring nucleic acid or to that of any fragment of a naturally occurring genomic nucleic acid spanning more than three separate genes. The term therefor covers, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule but is not flanked by both of the coding sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein. Specifically excluded from this definition are nucleic acids present in mixtures of (i) DNA molecules, (ii) transfected cells, and (iii) cell clones: e.g., as these occur in a DNA library such as a cDNA or genomic DNA library.

In various embodiments, the nucleic acid molecule encodes a human GABAB receptor 1a (SEQ ID NOs: 48 and 49), 1b (SEQ ID NOs: 50 and 51), 1c (SEQ ID NOs: 54 and 55) or 1d (SEQ ID NOs: 56 and 57); or a canine GABAB receptor 1a (SEQ ID NOs: 52 and 53) or 1c (SEQ ID NOs: 58 and 59). Accordingly, the invention includes the following nucleic acid molecules:

(1) a nucleic acid molecule that includes a nucleotide sequence set forth as SEQ ID NO: 48, 50, 52, 54, 56, or 58, or a degenerate variant thereof;

(2) an RNA molecule that includes a nucleotide sequence set forth as SEQ ID NO: 48, 50, 52, 54, 56, or 58, or a degenerate variant thereof, wherein T is replaced by U;

(3) a nucleic acid molecule that includes a nucleotide sequence that is capable of hybridizing under stringent conditions (e.g., is complementary) to a nucleotide sequence of (1) or (2), or to the complement of (1) or (2); and

(4) nucleic acid fragments that are at least 15 base pairs in length and which hybridize under stringent conditions to genomic DNA encoding the human or canine GABAB polypeptides described herein, or to the complement of such genomic DNA.

The invention also includes isolated nucleic acid molecules corresponding to genomic sequences encoding human GABAB receptors (SEQ ID NOs: 60 and 61), as well as nucleic acid molecules (set forth as SEQ ID NO: 70, 72, 74, 76, 78, 80, 82, and 84) encoding additional isoforms of the human GABAB receptor, which isoforms are generated by alternative splicing.

The nucleic acid molecules of the invention are not limited strictly to molecules including the sequences set forth as SEQ ID NOs: 48, 50, 52, 54, 56 or 58. Rather, the invention encompasses nucleic acid molecules carrying modifications such as substitutions, small deletions, insertions, or inversions, which nevertheless encode proteins having substantially the biochemical activity of the GABAB receptors according to the invention, and/or which can serve as hybridization probes for identifying a nucleic acid with one of the disclosed sequences. Included in the invention are nucleic acid molecules, the nucleotide sequence of which is at least 95% identical (e.g., at least 96%, 97%, 98%, or 99% identical) to the nucleotide sequence shown as SEQ ID NO: 48, 50, 52, 54, 56, or 58 in the Sequence Listing.

The determination of percent identity or homology between two sequences is accomplished using the algorithm of Karlin and Altschul (1990) Proc. Nat'l Acad. Sci. USA 87: 2264-2268, modified as in Karlin and Altschul (1993) Proc. Nat'l Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al. (1990) J. Mol. Biol. 215:403-410. BLAST nucleotide searches are performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches are performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to the protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST is utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25: 3389- 3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) are used. See the internet at ncbi.nlm.nih.gov.

The term “stringent hybridization conditions” is known in the art from standard protocols (e.g., Current Protocols in Molecular Biology, editors F. Ausubel et al., John Wiley and Sons, Inc. 1994) and is to be understood as conditions as stringent as those defined by the following: hybridization to filter-bound DNA in 0.5 M NaHPO4 (pH 7.2), 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at +65° C., and washing in 0.1×SSC/0.1% SDS at +68° C.

Also included in the invention is a nucleic acid molecule that has a nucleotide sequence which is a degenerate variant of a nucleic acid disclosed herein, e.g., SEQ ID NOs: 48, 50, 52, 54, 56, and 58. A sequential grouping of three nucleotides, a “codon,” encodes one amino acid. Since there are 64 possible codons, but only 20 natural amino acids, most amino acids are encoded by more than one codon. This natural “degeneracy” or “redundancy” of the genetic code is well known in the art. It will thus be appreciated that the nucleic acid sequences shown in the Sequence Listing provide only an example within a large but definite group of nucleic acid sequences that will encode the polypeptides as described above.

The invention also includes an isolated polypeptide encoded by a nucleic acid of the invention. An “isolated” polypeptide is a polypeptide that is substantially free from the proteins and other naturally occurring organic molecules with which it is naturally associated. Purity can be measured by any art-known method, e.g., column chromatography, polyacrylamide gel electrophoresis, or HPLC. An isolated polypeptide may be obtained, for example, by extraction from a natural source (e.g., a human cell); by expression of a recombinant nucleic acid encoding the polypeptide; or by chemical synthesis of the polypeptide. In the context of a polypeptide obtained by extraction from a natural source, “substantially free” means that the polypeptide constitutes at least 60% (e.g., at least 75%, 90%, or 99%) of the dry weight of the preparation. A protein that is chemically synthesized, or produced from a source different from the source from which the protein naturally originates, is by definition substantially free from its naturally associated components. Thus, an isolated polypeptide includes recombinant polypeptides synthesized, for example, in vivo, e.g., in the milk of transgenic animals, or in vitro, e.g., in a mammalian cell line, in E. coli or another single-celled microorganism, or in insect cells.

In various embodiments, the polypeptide of the invention has an amino acid sequence as set forth in SEQ ID NO: 49, 51, 53, 55, 57, 59, 71, 73, 75, 77, 79, 81, 83, and 85. However, polypeptides of the present invention are not to limited to those having an amino acid sequence identical to one of SEQ ID NOs: 49, 51, 53, 55, 59, 71, 73, 75, 77, 79, 81, 83, or 85 in the Sequence Listing. Rather, the invention also encompasses conservative variants of the disclosed sequences. “Conservative variants” include substitutions within the following groups: glycine and alanine; valine, alanine, isoleucine, and leucine; aspartic acid and glutamic acid; asparagine, glutamine, serine, and threonine; lysine, arginine, and histidine; and phenylalanine and tyrosine.

Also included in the invention are polypeptides carrying modifications such as substitutions, small deletions, insertions, or inversions, which polypeptides nevertheless have substantially the biological activities of the GABAB receptor. Consequently, included in the invention is a polypeptide, the amino acid sequence of which is at least 95% identical (e.g., at least 96%, 97%, 98%, or 99% identical) to an amino acid sequence set forth as SEQ ID NO: 49, 51, 53, 55, 57 59, 71, 73, 75, 77, 79, 81, 83, or 85 in the Sequence Listing. “Percent identity” is defined in accordance with the algorithm described above.

Also included in the invention are polypeptides of the invention that have been post-translationally modified, e.g., by cleavage of an N-terminal signal sequence, which can be, e.g., 1 to 25 amino acids long.

The invention also includes a vector that contains a nucleic acid molecule of the present invention. The vector can, e.g., be a replicable expression vector that is capable of mediating the expression of a nucleic acid molecule of the invention. A “replicable” vector is able to replicate in a given type of host cell into which it has been introduced. Examples of suitable vectors include virus-based vectors (e.g., bacteriophages, retroviruses, adenoviruses, herpes viruses, polio viruses, and vaccinia viruses), cosmids, plasmids, and other recombination vectors. Nucleic acid molecules can be inserted into vectors by methods well known in the art.

Also included in the invention is a host cell harboring a nucleic acid (e.g., on a vector) of the invention. Without limitation, such a host cell can be a prokaryotic cell, a unicellular eukaryotic cell, or a cell derived from a multicellular organism. For example, the host cell can be a bacterial cell, such as an E. coli cell; a yeast cell, such as Saccharomyces cerevisiae or Pichia pastoris; an insect cell, an amphibian cell (e.g., a frog oocyte), or a mammalian cell. It is preferably not a neuron, e.g., a human, dog, rat or other mammalian neuron. Conventional methods can be employed to introduce the vector into the host cell.

Host cells containing nucleic acids of the invention can be used to produce a GABAB receptor polypeptide of the invention or a conservative variant thereof. Generally, the process includes culturing a host cell as defined above under conditions such that the polypeptide is produced, and recovering the polypeptide.

A further aspect of the invention is a method for determining whether a test compound is an inhibitor of TLESR. The method entails (a) expressing in a cell (preferably a cell that does not naturally express the GABAB receptor, such as a fibroblast or other non-neural cell) a nucleic acid molecule that includes a nucleotide sequence of the invention, thereby producing a cell having on its surface a GABAB receptor or a conservative variant thereof; (b) contacting the GABAB receptor or conservative variant with a test compound; and (c) detecting binding of the test compound to the GABAB receptor or conservative variant, wherein binding of the test compound to the GABAB receptor or conservative variant indicates that the test compound is an inhibitor of TLESR. This activity can be further validated by other in vitro or in vivo tests: e.g., by administration of the test compound to an animal model for this condition. It should be understood that this aspect of the invention is not limited to use of human and canine GABAB receptors, but rather encompasses the use of any GABAB receptor for screening for compounds which are inhibitors of TLESRs.

Nucleic acid molecules encoding human or canine GABAB receptors also can be used in a related method for screening for compounds that are agonists or antagonists. Generally, in this method, binding is detected by detecting activation, or inhibition of activation, of the GABAB receptor or a conservative variant thereof, wherein activation indicates that the test compound is an agonist of the GABAB receptor, and inhibition of activation indicates that the test compound is an antagonist of the GABAB receptor.

The screening methods according to the invention can e.g., comprise the steps (a) transforming a cultured cell with a nucleic acid molecule encoding a GABAB receptor, so that a GABAB receptor is expressed on the surface of the cell; (b) contacting a test compound with the cell; and (c) determining whether the test compound binds to, and/or activates, the GABAB receptor.

GABAB receptor-expressing cells, transgenic animals, or cells and tissues derived therefrom can be used to screen substance libraries (i.e., libraries of test compounds) for antagonist or agonist activity. For this purpose, GABAB receptor expression may be directed to cells and tissues containing, either naturally or artificially, the necessary components allowing correct receptor transport and processing as well as coupling to second messenger pathways. Screening may be performed as ligand binding assays or functional assays. For screening, cells and tissues can be prepared in various ways, each uniquely suited to its purpose. Ligand binding assays can be performed in vivo or in vitro using, e.g., radiolabelled GABA. Functional assays (e.g., Ca++-responses, cAMP-responses, and effects on K+ channels) can be performed in living cells, broken cells, isolated cell membranes, tissues, or living animals. To facilitate measurement of physiological GABAB receptor mediated responses, GABAB receptors may be co-expressed with promiscuous G-proteins, e.g., GÎą16 or Gqi5, increasing G-protein coupling. Another way to increase G-protein coupling is to fuse the GABAB receptor to appropriate G-proteins using standard molecular techniques. To further improve readouts in Ca++-response assays, GABAB receptors can be co-expressed with aequorin, a photoprotein cloned from the luminescent jellyfish Aequorea victoria.

The invention also provides a pharmaceutical composition that includes a GABAB receptor (e.g., a soluble receptor), or a conservative variant thereof, and at least one of (a) a pharmaceutically acceptable carrier and (b) a pharmaceutically acceptable diluent.

The pharmaceutical composition can be used in methods of treating conditions involving GABA-dysfunction, e.g., epilepsy, psychiatric disorders such as depression and anxiety, cognitive dysfunction, gastroesophageal reflux disease, emesis, irritable bowel syndrome, dyspepsia, spasticity, arthritis, allergies, autoimmune diseases, neoplastic diseases, pain, and infectious diseases. Typically, the GABAB receptor is a soluble form of the GABAB receptor, such as the human GABAB receptor 1c or 1d or a conservative variant thereof.

A soluble form of the receptor can be a form that lacks some or all of the membrane-spanning domains of the wild-type receptor protein, but retains the ligand-binding portion or portions of the receptor. The membrane-spanning domains are readily identified by their predominance of non-polar amino acid residues, and/or by comparison with related receptors (e.g., other G-protein receptors).

Soluble forms of the GABAB receptor can be produced by culturing a host cell containing a vector that includes a nucleic acid encoding the soluble GABAB receptor under conditions such that the GABAB receptor polypeptide is produced. The polypeptide then is recovered, and a pharmaceutical composition containing the polypeptide is administered to a mammal (e.g., a human or dog) in need thereof.

In a related aspect, the invention provides a method for diagnosing a mammal as having a condition involving altered levels of GABAB receptors in body fluid (e.g., serum or cerebrospinal fluid). Such conditions include epilepsy, psychiatric disorders, cognitive dysfunction, gastroesophageal reflux disease, emesis, irritable bowel syndrome, dyspepsia, spasticity, arthritis, allergies, auto immune diseases, neoplastic diseases, pain, and infectious diseases. Diagnosis involves measuring the level of GABAB receptor in a body fluid of a mammal (e.g., a human), wherein an increase or decrease in the level of GABAB receptor, relative to the level found in a normal mammal, indicates that the mammal has a condition involving altered levels of GABAB receptors in body fluid.

Throughout this description, the terms “standard protocols” and “standard procedures,” when used in the context of molecular cloning techniques, are to be understood as protocols and procedures found in an ordinary laboratory manual such as Current Protocols in Molecular Biology, editors F. Ausubel et al., John Wiley and Sons, Inc. 1994, or Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A laboratory manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a map of the human GABAB receptor gene. The exon/intron organization is shown. Exons are indicated as solid boxes numbered 1-23. The part of intron 5 that is retained together with exon 6 giving rise to GABAB receptor 1b is indicated as an open box.

FIG. 2 is a Western blot illustrating expression of the human GABAB receptor 1b isoform in transfected C127 cells. A polyclonal anti-human GABAB receptor antibody was used. Lane 1: Untransfected C127 whole cell lysate. Lanes 2-7: Whole cell lysates of six independent clones transfected with cDNA encoding the human GABAB receptor 1b isoform. The clones analyzed in lanes 4 to 7 express a GABAB receptor of the expected molecular weight (arrow)

FIG. 3 is a Western blot illustrating expression of the human GABAB receptor 1d isoform in transfected C127 cells. A polyclonal anti-human GABAB receptor antibody was used. Lanes 1-3: Concentrated culture media from three independent C127 clones transfected with a cDNA expression construct encoding the human GABAB receptor 1d isoform. Lanes 4-6: Whole cell lysates corresponding to the clones analyzed in lanes 1-3. The figure shows that the human GABAB receptor 1d cDNA encodes a secreted isoform. The arrow indicates the bands corresponding to the 1d isoform.

FIG. 4 is a Western blot illustrating expression of the human GABAB receptor 1d isoform in E. coli. A polyclonal anti-human GABAB receptor antibody was used. Lane 1: Lysate from an uninduced E. coli culture transformed with an pET-based expression construct encoding the human GABAB receptor 1d cDNA. Lane 2: Lysate from an IPTG-induced E. coli culture transformed with an expression construct encoding the human GABAB receptor 1d cDNA. Lane 3: Lysate from an IPTG-induced E. coli culture transformed with an expression construct encoding an unrelated protein. Lane 4: An aliquot of the BSA-conjugated peptide used for immunization was loaded on the gel as a positive antibody control.

DETAILED DESCRIPTION

EXAMPLE 1A

Cloning and Sequencing of cDNA Encoding Human GABAB Receptor 1a and 1b

Messenger RNA from human hippocampus was obtained from Clontech (Palo Alto, Calif., USA) (catalog #6578-1). First-strand cDNA synthesis reactions were performed using the First-strand™ cDNA Synthesis kit from Amersham Pharmacia Biotech (Uppsala, Sweden). The pd(N)6 primer was used to prime the first-strand synthesis. The generated cDNA molecules were used as templates in the PCR reactions described below.

Specific PCR primers were designed (as shown in Table 1) based on the sequences of the rat GABAB receptor 1a and 1b cDNA (Kaupmann et al., 1997, EMBL accession numbers Y10369 (SEQ ID NO: 44) and Y10370 (SEQ ID NO: 46)). Various cDNA fragments encoding parts of the human GABAB receptors were amplified directly by PCR using the designed primers with the generated cDNA molecules as templates. All PCR experiments were carried out using Perkin Elmer Taq DNA polymerase with Gene Amp™ (Roche Molecular Systems Inc., NJ, USA) with the following PCR program: +95° C. for 1 minute, +50° C. for 30 seconds, +72° C. for 3 minutes, repeated 44 times, and then +72° C. for 7 minutes. The following combinations of primers gave PCR products with the expected sizes: primers 838 and 842, 838 and 795, 797 and 865, 864 and 865, and 864 and 863, which correspond to the 5′-end of the GABAB receptor 1a cDNA. The combinations of 932 and 831, 932 and 796, and 794 and 831 produced PCR products that correspond to the 3′-ends of both GABAB receptor 1a and 1b cDNA. The primer combination 839 and 918 produced a PCR product corresponding to the 5′-end of the GABAB receptor 1b cDNA.

TABLE 1
Primers used for RT-PCR on rnRNA from human hippocampus
Nr. Species Seqences 5′–3′ SEQ ID NO
794 Rat GTTTCTTCTCGGATCCAGCTGTGCCTG 1
795 Rat CAGGCACAGCTGGATCCGAGAAGAAACT 2
796 Rat CGGTCGACTCACTTGTAAAGCAAATGTACTCGACTCCC 3
797 Rat ATGCGCGCCGGCAGCCAACATGCTGCTGCTGCTGCTGGTGC 4
831 Rat CGGTCGACTCACTTGTAAAGCAAATGTACTCGACTCCCATCACAGC 5
838 Rat ATGCGCGCCGGCAGCCAACATGCTGCTGCTGCTGCTGGTGCCTCTCTTCC 6
842 Rat CAGGCACAGCTGGATCCGAGAAGAAACTCTGTCGGAAAGT 7
863 Rat GGTCATCCAGCGTTGAGGTGAAGAC 8
864 Rat GAAGGTTGCCAGATTATACATCCGC 9
865 Rat CCACGATGATTCGAGCATCTTGACG 10
866 Rat GCCTCTCACTCCCCTCATCTCC 11
932 Human GAGTGAAGGAGGCTGGAATTG 12

The PCR products were subcloned into the pGEM-T vector from Promega (Madison, USA). The inserts were subjected to nucleotide sequence analysis, and the complete nucleotide sequences for all subclones were determined using a Thermo Sequences™ dye terminator cycle sequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala, Sweden). Specific oligonucleotides complementary to the vector pGEM-T, or primers complementary to the cDNA encoding the GABAB receptor, were used as primers for the sequencing reactions.

Additional PCR primers were designed based on the obtained sequences encoding fragments of the human GABAB receptor, additional DNA fragments encoding parts of the human GABAB receptors were amplified by PCR, and the PCR products were subcloned and sequenced as described above.

EXAMPLE 1B

Cloning and Sequencing of the 3′-ends of the cDNA Encoding Human GABAB Receptors 1a and 1b

Messenger RNA from human hippocampus was obtained from Clontech (Palo Alto, Calif., USA) (catalogue #6578-1). First strand cDNA synthesis reactions were performed using the First-strand™ cDNA Synthesis kit from Amersham Pharmacia Biotech (Uppsala, Sweden). The Not-I-d(T)18 primer was used to prime the first-strand synthesis. The generated cDNA molecules were used as templates in the PCR reactions described below.

Specific PCR primers were designed (as shown in Table 2) based on the sequences of the human GABAB receptor 1a and 1b cDNA obtained in Example 1A and the EST sequence set forth in EMBL accession number Y11044.

By homology searches in the EMBL database using the GABAB receptor cDNA sequences obtained in Example 1A as the query sequences, the EST sequence set forth in EMBL accession number Y11044 has been found to be homologous to the 3′-end of the GABAB receptor cDNA.

TABLE 2
Primers used in PCR to amplify 3′ ends
of human GABAB receptor cDNA
Nr. Species Sequence 5′–3′ SEQ ID NO
938 Human GACGCTTATCGAGCAGCTTC 13
972 Human AGCCCAGAACTCACAGGGGGACAT 14
973 Human GCTTCAAGCCAGGTACGAACTAA 15

Various cDNA fragments encoding parts of the human GABAB receptors were amplified directly by PCR using the designed primers with the generated cDNA molecules as templates. All PCR experiments were carried out using Perkin Elmer Taq DNA polymerase with Gene Amp™ (Roche Molecular Systems Inc., NJ, USA) with the following PCR program: +95° C. for 1 minute, +50° C. for 30 seconds, +72° C. for 3 minutes, repeated 44 times, and then +72° C. for 7 minutes. The following combinations of primers gave PCR products with the expected sizes: 938 and 972, and 938 and 973, corresponding to the 3′-end of both GABAB receptor 1a and 1b cDNA.

The PCR products were subcloned into the pGEM-T™ vector from Promega (Madison, USA). The inserts were subjected to nucleotide sequence analysis, and the complete nucleotide sequences for all subclones were determined using a Thermo Sequenase™ dye terminator cycle sequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala, Sweden). Specific oligonucleotides complementary to the vector pGEM-T™, or primers complementary to the cDNA encoding the GABAB receptor, were used as primers for the sequencing reactions.

EXAMPLE 1C

Cloning and Sequencing of the 5′-end of the cDNA Encoding Human GABAB Receptor 1b

Messenger RNA from human hippocampus was obtained from Clontech (Palo Alto, Calif., USA) (catalogue #6578-1). A Marathon™ cDNA amplification kit (Clontech) was used for performing 5′/3′-RACE (Rapid Amplification of cDNA Ends). Adaptor-ligated double stranded cDNA molecules were amplified according to standard methods, as described by the manufacturer. A pd(N)6 primer from the First-strand™ cDNA Synthesis kit from Amersham Pharmacia Biotech (Uppsala, Sweden) was used to produce the adaptor-ligated cDNA.

A specific PCR primer was designed (Table 3) based on the sequences of the human GABAB receptor 1b cDNA obtained in Example 1A.

TABLE 3
Primers used in PCR to amplify the 5′-ends
of human GABAB receptor cDNA
SEQ ID
Nr. Source Sequence 5′–3′ NO
958 Human TGGCCCTCCACCGCCTCAGTCATCTCA 16
AP1 Marathon kit CCATCCTAATACGACTCACTATAGGGC 17

cDNA fragments encoding part of the human GABAB receptors were amplified directly by PCR using the designed primers with the generated adaptor-ligated cDNA molecules as templates. PCR was carried out using the Expand Long Template™ PCR System (Boehringer Mannheim GmbH, Germany) with the following PCR program: +94° C. for 1 minute, +94° C. for 30 seconds, +60° C. for 30 seconds, and +68° C. for 4 minutes, repeated 24 times. The primer combination AP1 and 958 produced a PCR product that corresponded to the 5′-end of the GABAB receptor 1b cDNA, including 190 base pairs upstream of the initiation codon.

The PCR products were subcloned into the pGEM-T™ vector from Promega (Madison, USA). The inserts were subjected to nucleotide sequence analysis, and the complete nucleotide sequences for all subclones were determined using a Thermo Sequenase™ dye terminator cycle sequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala, Sweden). Specific oligonucleotides complementary to the vector pGEM-T™, or primers complementary to the cDNA encoding the GABAB receptor, were used as primers for the sequencing reactions.

EXAMPLE 1D

Cloning and Sequencing of the 51′-end of the cDNA Encoding Human GABAB Receptor 1a

Messenger RNA from human hippocampus was obtained from Clontech (Palo Alto, USA) (catalogue #6578-1). A Marathon™ cDNA amplification Kit (Clontech) was used to obtain adaptor-ligated double stranded cDNA molecules according to conventional methods as described by the manufacturer. The pd(N)6 primer from the First-strand™ cDNA Synthesis kit from Amersham Pharmacia Biotech (Uppsala, Sweden) was used to obtain the adaptor-ligated cDNA.

Specific PCR primers were designed (as shown in Table 4) based on the sequences of the human GABAB receptor 1a cDNA obtained in Example 1 and the rat GABAB receptor 1a cDNA disclosed in WO 97/46675.

TABLE 4
Primers used to amplify the 5′-ends of the
human GABAB receptor 1a cDNA
Nr. Species Sequence 5′–3′ SEQ ID NO
1033 Human CTCAATCTCATAGTCCACTGG 18
1087 Rat CCTTGAGGCCCGGGGAGAG 19

A cDNA fragment encoding part of the human GABAB 1a receptor was amplified directly by PCR using the designed primers with the generated adaptor-ligated cDNA molecules as templates. PCR was performed using Perkin Elmer Taq DNA polymerase with Gene Amp™ (Roche Molecular Systems Inc., NJ, USA) with the following PCR program: +94° C. for 1 minute, +50° C. for 30 seconds, +72° C. for 3 minutes, +94° C. for 1 minute, +60° C. for 30 seconds, and +72° C. for 4 minutes, repeated 34 times, and then +72° C. for 7 minutes.

The primer combination 1087 and 1033 produced a PCR product corresponding to the 5′-end of the GABAB receptor 1a cDNA, including 26 base pairs upstream of the initiation codon.

The PCR products were subcloned into the pGEM-T™ vector from Promega (Madison, USA). The inserts were subjected to nucleotide sequence analysis, and the complete nucleotide sequences for all subclones were determined using a Thermo Sequenase™ dye terminator cycle sequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala, Sweden). Specific oligonucleotides complementary to the vector pGEM-T™ were used as primers for the sequencing reactions.

Complete cDNA sequences encoding the human GABAB receptor 1a (SEQ ID NO: 48) and the human GABAB receptor 1b (SEQ ID NO: 50) were obtained by aligning the sequences of the different fragments cloned and sequenced in Examples 1A, 1B, 1C, and 1D.

EXAMPLE 2A

Cloning and Sequencing of cDNA Encoding Canine GABAB Receptor 1a

A QuickPrep Micro mRNA Purification™ kit (Amersham Pharmacia Biotech, Uppsala, Sweden) was used to isolate mRNA from canine neural tissue according to conventional methods, as described by the manufacturer. First-strand cDNA synthesis reactions were performed using the First-strand™ cDNA Synthesis kit from Amersham Pharmacia Biotech (Uppsala, Sweden). The Not-I-d(T)18 bifunctional or pd(N)6 primer was used to prime the first-strand synthesis. The generated cDNA molecules were used as templates in the PCR reactions described below.

Specific PCR primers (as shown in Table 5) were designed based on the sequences of the rat GABAB receptor 1a and 1b cDNA (Kaupmann et al., 1997, EMBL accession numbers Y10369 (SEQ ID NO: 44) and Y10370 (SEQ ID NO: 46)). Various cDNA fragments encoding parts of the canine GABAB receptor were amplified directly by PCR using the designed primers with the generated cDNA molecules as templates. All PCR experiments were carried out using the Perkin Elmer Taq DNA polymerase with Gene Amp™ (Roche Molecular Systems Inc., NJ, USA) with the following PCR program: +95° C. for 1 minute, +50° C. for 30 seconds, and +72° C. for 3 minutes, repeated 44 times, and then +72° C. for 7 minutes. The following primer combinations produced PCR products with the expected sizes: 842 and 838, 838 and 795, and 838 and 865, which correspond to the 5′-part of the canine GABAB receptor cDNA. Primer pairs 848 and 844, 848 and 831, 848 and 841, and 840 and 841 produced PCR products which correspond to the 3′-part of the canine GABAB receptor cDNA.

TABLE 5
Primers used for RT-PCR on mRNA from canine cortex
Nr. Species Sequence 5′–3′ SEQ ID NO
795 Rat CAGGCACAGCTGGATCCGAGAAGAAACT 20
831 Rat CGGTCGACTCACTTGTAAAGCAAATGTACTCGACTCCCATCACAGC 21
838 Rat ATGCGCGCCGGCAGCCAACATGCTGCTGCTGCTGCTGGTGCCTCTCTTCC 22
840 Rat CGTCAAGATGCTCGAATCATCG 23
841 Rat CAGGGGGCTCAGAGGGTCCC 24
842 Rat CAGGCACAGCTGGATCCGAGAAGAAACTCTGTCGGAAAGT 25
844 Rat CGGTCGACTCACTTGTAAAGCAAATGTACTCGACTCCCATCACAGCTAAG 26
848 Rat ACTTTCCGACAGAGTTTCTTCTCGGATCCAGCTGTGCCTG 27
865 Rat CCACGATGATTCGAGCATCTTGACG 28

The PCR products were subcloned into the pGEM-T™ vector from Promega (Madison, USA). The inserts were subjected to nucleotide sequence analysis, and the complete nucleotide sequences for all subclones were determined using a Thermo Sequenase™ dye terminator cycle sequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala, Sweden). Specific oligonucleotides complementary to the vector pGEM-T™, or primers complementary to the cDNA encoding the GABAB receptor, were used as primers for the sequencing reactions.

EXAMPLE 2B

Cloning and Sequencing of the 3′- and 5′-ends of the cDNA Encoding Canine GABAB Receptor 1a

A QuickPrep™ Micro mRNA Purification kit (Amersham Pharmacia Biotech, Uppsala, Sweden) was used to isolate mRNA from canine nerve tissue according to conventional methods, as described by the manufacturer. A Marathon™ cDNA amplification Kit (Clontech, Palo Alto, Calif., USA) was used for performing both 5′- and 3′-RACE. Two adaptor-ligated double stranded cDNA libraries were amplified according to conventional methods, as described by the manufacturer. A random primer (pd(N)6) was used when amplifying the adaptor-ligated cDNA for the 5′-RACE, and the Marathon™ cDNA Synthesis primer (52-mer) was used when amplifying the adaptor ligated cDNA for the 3′-RACE.

Specific PCR primers were designed (as shown in Table 6) based on the sequence of canine GABAB receptor 1a cDNA obtained in Example 2A.

TABLE 6
Primers used in PCR to amplify the 5′- and 3′-ends
of canine GABAB receptor 1a cDNA
SEQ
ID
Nr. Species Sequence 5′–3′ NO
 936 canine CTACCGCGCAATGAACTCCTCGTC 29
1076 canine CGAGGTGGCGTTGGGGGTCTGTGC 30
 AP1 Marathon kit CCATCCTAATACGACTCACTATAGGGC 31
 AP2 Marathon kit ACTCACTATAGGGCTCGAGCGGC 32

Various cDNA fragments encoding parts of the canine GABAB receptor were amplified by PCR from the adaptor-ligated cDNA using the designed primers. A number of different PCR programs were tested to find conditions under which PCR products corresponding to GABAB receptor DNA were obtained. The 5′-PCR experiments were carried out using the Expand Long Template™ PCR System (Boehringer Mannheim GmbH, Germany) with the following PCR program: +94° C. for 30 seconds, +72° C. for 3 minutes, repeated 4 times; +94° C. for 30 seconds, +70° C. for 3 minutes, repeated 4 times; and +94° C. for 30 seconds, +68° C. for 3 minutes, repeated 24 times. The primer combination AP2 and 1076 produced a PCR product that corresponded to the 5′-end of the GABAB receptor cDNA, including 114 base pairs upstream the initiation codon.

The 3′-PCR experiments were carried out using the Expand Long Template™ PCR System (Boehringer Mannheim GmbH, Germany) with the following PCR program: +94° C. for 1 minute; +94° C. for 30 seconds, +60° C. for 30 seconds, and +68° C. for 4 minutes, repeated 29 times. The primer combination AP1 and 936 produced a PCR fragment that corresponded to the 3′-end of the GABAB receptor cDNA, including the poly(A) tail.

The PCR products were subcloned into the pGEM-T vector from Promega (Madison, USA). The inserts were subjected to nucleotide sequence analysis, and the complete nucleotide sequences for all subclones were determined using a Thermo Sequenase™ dye terminator cycle sequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala, Sweden). Specific oligonucleotides complementary to the vector pGEM-T or primers complementary to GABAB receptor DNA were used as primers for sequencing reactions.

A complete cDNA sequence encoding the canine GABAB receptor 1a (SEQ ID NO: 52) was obtained by aligning the sequences of the various fragments obtained in Example 2A and Example 2B.

EXAMPLE 3A

Cloning of cDNA Encoding Human GABAB Receptor 1c and 1d from Jurkat Cells

A guanidine isothiocyanate/CsCl purification method was used to isolate total RNA from Jurkat cells. The first-strand cDNA synthesis was performed using a First-strand™ cDNA Synthesis kit from Amersham Pharmacia Biotech (Uppsala, Sweden). The pd(N)6 primer was used to prime the first strand synthesis. The generated cDNA molecules were used as templates in the PCR reaction described below.

Specific PCR primers (as shown in Table 7) were designed based on the sequences of human GABAB receptor 1a and 1b cDNAs (Example 1), rat GABAB receptor (Kaupmann et al. 1997) and the EST sequence set forth in EMBL accession number Y11044.

TABLE 7
Primers used in RT-PCR on mRNA from Jurkat cells
Nr. Species Sequence 5′–3′ SEQ ID NO
938 human GACGCTTATCGAGCAGCTTC 33
972 human AGCCCAGAACTCACAGGGGGACAT 34
973 human GCTTCAAGCCAGGTACGAACTAA 35
893 rat GGAGCACCCCCAAGCCCCACTG 36
937 human CTGGTTCCTCCCAATGTG 37
1005 rat CCTCTCACTCCCCTCATCTC 38
1030 human AAGCCAACCTTCCCTGCTTCTC 39

Various cDNA fragments encoding parts of the GABAB receptor were amplified directly by PCR using human- and rat-specific primers. All PCR experiments were carried out using Perkin Elmer Taq DNA polymerase with Gene Amp™ (Roche Molecular Systems Inc., NJ, USA) with the following PCR program: +95° C. for 1 minute; +54° C. for 1 minute, and +72° C. for 3 minutes, repeated 44 times; and then +72° C. for 7 minutes.

The PCR products were subcloned into the pGEM-T™ vector from Promega (Madison, USA). The inserts were subjected to nucleotide sequence analysis, and the complete nucleotide sequences for all subclones were determined using a Thermo Sequenase™ dye terminator cycle sequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala, Sweden). Specific oligonucleotides complementary to the vector pGEM-T™ or primers complementary to GABAB receptor DNA were used as primers for the sequencing reactions.

The following primer combination produced PCR products corresponding to the 3′-end of the GABAB receptor cDNA: primer pairs 938 and 972; and 938 and 973. Unexpectedly, both of these fragments lacked 149 base pairs, resulting in a frame shift and the insertion of a new termination codon. The following primer combination produced a PCR product corresponding to the 5′-part of the GABAB receptor 1a cDNA: 893 and 937. The primer pairs 1005 and 937, and 1030 and 937 produced PCR products corresponding to the 5′-part of the GABAB receptor 1b cDNA. These PCR fragments lacked the same 149 base pairs that resulted in a frame shift and the insertion of a new termination codon.

These results show that Jurkat cells contain mRNA encoding two new forms of the human GABAB receptor. These new forms are designated GABAB receptor 1c (SEQ ID NO: 54 and 55) (with the mRNA including the same 5′-part as the GABAB receptor 1a) and GABAB receptor 1d (SEQ ID NO: 56 and 57) (with the mRNA including the same 5′-part as the GABAB receptor 1b). These two forms of the GABAB receptor do not contain any of the transmembrane region of the receptor and are therefore expected to be soluble forms of the receptor.

EXAMPLE 3B

Analysis of cDNA Encoding Human GABAB Receptors from Hippocampus

Messenger RNA from human hippocampus was obtained from Clontech (Palo Alto, USA) (catalogue #6578-1). First strand cDNA synthesis reactions were performed using the First-strand™ cDNA Synthesis kit from Amersham Pharmacia Biotech (Uppsala, Sweden). The pd(N)6 primer was used to prime the first-strand synthesis. The generated cDNA molecules were used as templates in the PCR reactions described below.

Specific PCR primers were designed (as shown in Table 8) based on the sequences of the cDNAs encoding human GABAB receptors 1a and 1b.

TABLE 8
Primers used for RT-PCR on mRNA
from human hippocampus
Nr. Species Sequence 5′–3′ SEQ ID NO
937 Human CTGGTTCCTCCCAATGTG 40
938 Human GACGCTTATCGAGCAGCTTC 41

cDNA fragments encoding parts of the human GABAB receptors were amplified directly by PCR using the designed primers with the generated cDNA molecules as templates. All PCR experiments were carried out using Perkin Elmer Taq DNA polymerase with Gene Amp™ (Roche Molecular Systems Inc., NJ, USA) with the following PCR program: +94° C. for 1 minute, +50° C. for 30 seconds, +72° C. for 3 minutes; +94° C. for 1 minute, +54° C. for 30 seconds, and +72° C. for 3 minutes, repeated 44 times; and then +72° C. for 7 minutes. The primer combination of 938 and 937 produced PCR products that corresponded to the expected size of the GABAB receptor 1a and 1b cDNAs, and to a fragment of a smaller size.

The PCR products were subcloned into the pGEM-T vector from Promega (Madison, USA). The inserts were subjected to nucleotide sequence analysis, and the complete nucleotide sequences for all subclones were determined using a Thermo Sequenase™ dye terminator cycle sequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala, Sweden). Specific oligonucleotides complementary to the vector pGEM-T™ or primers complementary to the cDNA encoding the GABAB receptor were used as primers for the sequencing reactions.

The larger PCR fragment was found to correspond to the 3′-part of the GABAB receptor 1a and 1b cDNA, and the smaller fragment which lacked 149 base pairs was found to correspond to the 3′-part of the GABAB receptors 1c and 1d cDNA identified in Example 3A.

EXAMPLE 4

Cloning and Sequencing of cDNA Encoding Canine GABAB Receptor 1b

A cDNA encoding the canine GABAB receptor 1b can be isolated in a manner similar to that described in Example 2 for receptor 1a. PCR primers specifically designed to be complementary to the 5′-end of the cDNA encoding the rat and human GABAB receptor 1b, together with PCR primers complementary to the 3′-end of the cDNA encoding the canine GABAB receptor 1a, and mRNA prepared from a suitable canine tissue, can be used.

EXAMPLE 5

Cloning of cDNA Encoding Canine GABAB Receptor 1c

Total RNA from canine liver was prepared using RNeasy™ Total RNA Purification Protocols (Qiagen GmbH, Germany). The first-strand cDNA synthesis was performed using a First-strand™ cDNA Synthesis kit from (Amersham Pharmacia Biotech, Uppsala, Sweden). The pd(N)6 primer was used to prime the first-strand synthesis. The generated cDNA molecules were used as templates in the PCR reaction described below.

Specific PCR primers (as shown in Table 9) were designed based on the sequence of canine GABAB receptor 1a cDNA.

TABLE 9
Primers used in RT-PCR
Nr. Species Sequence 5′–3′ SEQ ID NO
936 canine CTACCGCGCAATGAACTCCTCGTC 42
954 canine CCTTCTTCTCCTCCTTCTTAGTGA 43

cDNA fragments encoding part of the canine GABAB receptor were amplified directly by PCR using canine specific primers. All PCR reactions were carried out using Perkin Elmer Taq DNA polymerase with Gene Amp™ (Roche Molecular Systems Inc., NJ, USA) with the following PCR program: +95° C. for 1 minute, +54° C. for 30 seconds, and +72° C. for 3 minutes, repeated 44 times, and then +72° C. for 7 minutes. The primer combination produced PCR products having a size corresponding to the GABAB receptor 1a cDNA and a fragment of a smaller size, indicating the presence of GABAB receptor 1c cDNA.

The PCR products were subcloned into the pGEM-T™ vector from Promega (Madison, Wis.; USA). The inserts were subjected to nucleotide sequence analysis, and the complete nucleotide sequences for all subclones were determined using a Thermo Sequenase™ dye terminator cycle sequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala, Sweden). Specific oligonucleotides complementary to the vector pGEM-T™ were used as primers for the sequencing reactions.

The smaller fragment was shown to have a deletion of 149 base pairs. This deletion caused a frame shift and insertion of a new termination codon, verifying the existence of a canine GABAB receptor 1c.

A complete cDNA sequence encoding the canine GABAB receptor 1c (SEQ ID NO: 58) was obtained by aligning the sequences of the fragments obtained in Example 2A, Example 2B and Example 5.

EXAMPLE 6

Cloning, Sequencing, and Organization of Human GABAB Receptor Genomic Fragments

To determine the structural organization and sequence of the human GABAB receptor gene, human genomic DNA libraries and human genomic DNA were screened and analyzed. Human genomic libraries were obtained from Clontech (Palo Alto, Calif., USA). The libraries were constructed from female leukocyte DNA (catalog # HL1111J) cloned into a λEMBL-3 vector. The average size of the inserts was 16 kb, and the number of independent clones was 1.7×106. Human genomic DNA was obtained from Clontech (catalog #6550-1). In order to isolate recombinant phage containing exon and intron sequences of the human GABAB receptor gene, 48 individual bacterial plates, each having a diameter of 150 mm and approximately 4×104 individual plaques, were screened. Conventional methods and solutions were used, as described in The Library Protocol Handbook: General Procedures for the Hybridization of Lambda Phage Libraries w/DNA Probes (Clontech) with modifications as described below.

The experiment was carried out essentially as follows, and the following numbers are given on a per plate basis. A sample of the phage library, diluted in 0.1 ml sterile lambda diluent, was prepared to obtain an estimated titer of 40,000 pfu (plaque forming units). A 0.6 ml culture of the E. coli host strain K802 (obtained from Clontech) in LB-medium was infected with 40,000 pfu recombinant phage for 15 minutes at +37° C. The culture then was mixed with 7 ml top agarose (6.5 g of agarose added per liter of LB) and poured onto LB plates. The plates were incubated at +37° C. for approximately 7 hours. The plates were then chilled at +4° C.

Plaque hybridization experiments were carried out as follows. Membrane filters (Colony/Plaque Screen (DuPont, Wilmington, Del., USA)) were placed on top of the plates for 3 minutes. For denaturation of DNA, the filters were removed and floated in 0.5 M NaOH on plastic wrap for 2 minutes, with the plaque side up. This step was repeated to ensure efficient denaturation. Following neutralization, the membrane filters were placed in 1M Tris-HCl, pH 7.5, twice for 2 minutes, and allowed to dry.

Probes for screening of the membrane filters by DNA hybridization were obtained as follows. A GABAB receptor cDNA clone was digested with SacII to release a 479 bp fragment (base pairs 573-1051 of the cDNA encoding human GABAB receptor 1a, SEQ ID NO: 48). This 479 bp fragment was separated from the remaining GABAB receptor cDNA by electrophoresis on an agarose gel. A segment of the gel containing the 479 bp fragment was excised and transferred to a polypropylene microcentrifuge tube. Water was then added to the microcentrifuge tube at a ratio of 3 ml per gram of gel. The microcentrifuge tube then was placed in a boiling water bath for 7 minutes to melt the agarose gel and denature the DNA.

DNA (25 ng) contained within the melted agarose was labeled with 32P using a Megaprime™ DNA labeling system (Amersham Pharmacia Biotech, Uppsala, Sweden) according to the supplier's instructions. Unincorporated 32P-labeled nucleotides were removed from the DNA sample with a MicroSpin™ G-50 Column (Amersham Pharmacia Biotech, Uppsala, Sweden). Additional probes were prepared by PCR amplification of various regions of the GABAB receptor cDNA (base pairs 68-486 and 2368-2863 of the cDNA encoding human GABAB receptor 1a, SEQ ID NO: 48). These probes also were labeled with 32P and purified as described above.

The DNA hybridization reaction was performed under stringent conditions according to the method described below. The filter membranes were prehybridized at +65° C. for at least 1 hour in a solution of 1% SDS, 1M NaCl, and 10% dextran sulfate using a hybridization oven (Hybaid Ltd, Ashford, UK). Following prehybridization, a solution containing denatured herring sperm DNA at a final concentration of 100 μg/ml and the 32P-labeled DNA probe at a concentration <10 ng/ml (for optimal signal to background ratio) was added to the prehybridization solution, and the membrane filters were incubated at +65° C. for 10-20 hours. Following the removal of the hybridization solution, the membrane filters were washed in a solution of 2×SSC (0.3 M NaCl, 0.03 M Na-citrate), 1% SDS twice for 5 minutes at room temperature. The membrane filters then were washed twice more in the same solution, incubating at +60° C. for 30 minutes each wash. The filters then were washed twice at room temperature in 0.1×SSC. Finally, the membrane filters were placed on a sheet of filter paper with the DNA face up, and allowed to dry. The dried membrane filters were then exposed to X-ray films and autoradiographed.

Of the approximately 2×106 individual plaques analyzed, four hybridizing plaques were detected and isolated. These four isolates were designated #GR1, #GR12, #GR13 and #GR41, respectively. After several rescreening experiments, the recombinant phage DNA was purified using a Qiagen Lambda Midi™ Kit (Qiagen GmbH, Germany). The purified DNA was digested with SalI, and the fragments representing the inserts were isolated by agarose electrophoresis.

The approximate sizes of the inserts were: for isolate #GR1, 12 kb; for isolate #GR12, 12 kb; for isolate #GR13, 16 kb; and for isolate #GR41, 19 kb. These fragments were cloned into SalI digested linearized pUC19, resulting in the plasmids pAM362 (isolate #GR1), pAM363 (isolate #GR12), pAM364 (isolate #GR13), and pAM365 (isolate #GR41). The inserts from the four plaques that hybridized to GABAB receptor cDNA probes were analyzed by PCR, restriction mapping, and hybridization to 32P-labeled DNA fragments representing various regions of the GABAB receptor gene.

The cloned fragments in the plasmids pAM362, pAM363, pAM364, and pAM365 were characterized by restriction enzyme mapping, using EcoRI, HindIII, PstI, and BamHI. The approximate positions of the exons, and the approximate sizes of the introns, were analyzed and determined by PCR-based exon-exon linking and agarose gel electrophoresis.

To facilitate nucleotide sequence analysis, seven restriction sub-fragments derived from pAM364, two restriction fragments derived from pAM362, and one restriction sub-fragment derived from pAM365 were isolated and cloned into pUC19, resulting in the plasmids pAM366-pAM375. To this end, PCR primers located within the pUC19 sequence either upstream or downstream of the cloning site were combined with a PCR primer having a defined orientation and specific for the GABAB receptors derived subcloned fragment.

The inserts in the 10 plasmids pAM366-pAM375 were subjected to nucleotide sequence analysis. The nucleotide sequences for all subclones were determined using a Thermo Sequenase™ dye terminator cycle sequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala, Sweden). Specific oligonucleotides complementary to pUC19 or primers complementary to the GABAB receptor cDNA were used as primers for the sequencing reactions.

The genomic fragments cloned in the plasmids pAM362-pAM365 contain the complete transcribed part of the human GABAB receptor gene and extend more than 3 kb upstream of the first exon and more than 2 kb downstream of the last exon. The fragment cloned in the plasmid pAM362 contains exons 7-11; pAM363 contains exons 12-22; pAM364 contains exons 1-11; and pAM365 contains exons 12-23 of the GABAB receptor gene (FIG. 1). The sequences of exons 1-11 and introns 1-10 are set forth in SEQ ID NO: 60, and the sequences of exons 12-23 and introns 12-22 are set forth in SEQ ID NO: 61.

The human GABAB receptor gene consists of 23 exons and 22 introns (FIG. 1). The exons range in size from 21 bp to 1486 bp. As indicated in Table 10, the exon/intron boundaries are in accordance with the AG/GT rule and conform well to the consensus sequence suggested by Mount et al. 1982.

TABLE 10
Exon-Intron boundaries of the GABAB receptor gene,
sequences at exon-intron junctions.
5′ splice donor . . . 3′ splice acceptor
Exon 1–Exon 2 CGAG GTAAGAG (nt 3441-3451 of SEQ ID NO:60) . . . CCGCCTCTCACTTAG
ATGT (nt 3894-3912 of SEQ ID NO:60)
Exon 2–Exon 3 GAAG GTGCATC (nt 3990-4000 of SEQ ID NO:60) . . . CGACTCACCCCTTAG
GTTG (nt 4680-4698 of SEQ ID NO:60)
Exon 3–Exon 4 TGTG GTGAGTA (nt 4895-4905 of SEQ ID NO:60) . . . CCWATCTCTCCACAG
TCCG (nt 5638-5656 of SEQ ID NO:60)
Exon 4–Exon 5 CAGG GTGAGGG (nt 5835-5845 of SEQ ID NO:60) . . . CTTTCCTGCTGCCAG
TGAA (nt 7170-7188 of SEQ ID NO:60)
Exon 5–Exon 6 TCAG GTGAGAT (nt 7202-7212 of SEQ ID NO:60) . . . CGCACCCCTCCTCAG
AACG (nt 8631-8649 of SEQ ID NO:60)
Exon 6–Exon 7 CAAG GTAGCCC (nt 8803-8813 of SEQ ID NO:60) . . . CCTCTTGTCTTTCAG
TGTG (nt 12257-12275 of SEQ ID NO:60)
Exon 7–Exon 8 TGTG GTAAGCA (nt 12403-12413 of SEQ ID NO:60) . . . CTCCCTGCCCCACAG
CTTT (nt 12806-12824 of SEQ ID NO:60)
Exon 8–Exon 9 TTCG GTGAGCA (nt 12988-12998 of SEQ ID NO:60) . . . TTATTCCCACCCAAG
ACTC (nt 14075-14093 of SEQ ID NO:60)
 Exon 9–Exon 10 GAAG GTCAGAT (nt 14188-14198 of SEQ ID NO:60) . . . CTTTCTCTGTKGTAG
CGCC (nt 14463-14481 of SEQ ID NO:60)
Exon 10–Exon 11 TGAG GTGGART (nt 14540-14550 of SEQ ID NO:60) . . . CTCCTCTGTATTCAG
GTGT (nt 14988-15006 of SEQ ID NO:60)
Exon 11–Exon 12 CATG GTGAGAG (nt 15191-15201 of SEQ ID NO:60) . . . TTTTTTCCTCCCAAG
ACAT (nt 1910-1928 of SEQ ID NO:61)
Exon 12–Exon 13 CTCT GTGAGTT (nt 2164-2174 of SEQ ID NO:61) . . . TGTTCCTTCCCTCAG
GGCC (nt 2781-2799 of SEQ ID NO:61)
Exon 13–Exon 14 CAGG CTTAGTA (nt 2856-2866 of SEQ ID NO:61) . . . TTGTCGTCTGCCCAG
GTGG (nt 4394-4412 of SEQ ID NO:61)
Exon 14–Exon 15 ATTG GTGAGTG (nt 4483-4493 of SEQ ID NO:61) . . . CCCTGTGCCATGCAG
GAGG (nt 6016-6034 of SEQ ID NO:61)
Exon 15–Exon 16 TCCG GTXAGTT (nt 6178-6188 of SEQ ID NO:61) . . . CCACCTCTGCCCTAG
TTAT (nt 6664-6682 of SEQ ID NO:61)
Exon 16–Exon 17 CCAG GTCAGGA (nt 6808-6818 of SEQ ID NO:61) . . . TCTCTTCCTTTCTAG
GCCC (nt 8180-8198 of SEQ ID NO:61)
Exon 17–Exon 18 GAAG GTGAGCT (nt 8308-8318 of SEQ ID NO:61) . . . CACATATTTATCCAG
ACTC (nt 8394-8412 of SEQ ID NO:61)
Exon 18–Exon 19 TGAG GTACCAC (nt 8513-8523 of SEQ ID NO:61) . . . TYGTTTCTGCCCTAG
ACAT (nt 8914-8932 of SEQ ID NO:61)
Exon 19–Exon 20 CTTG GTGTGTG (nt 9019-9029 of SEQ ID NO:61) . . . CTCCTGCCATCCTAG
GCAT (nt 9702-9720 of SEQ ID NO:61)
Exon 20–Exon 21 GGCA GTGAGCA (nt 9841-9851 of SEQ ID NO:61) . . . TGTCTTTCCCTCTAG
GTCC (nt 10410-10428 of SEQ ID NO:61)
Exon 21–Exon 22 CAAG GTAAGGA (nt 10550-10560 of SEQ ID NO:61) . . . AACATTTGCCCCCAG
ATGC (nt 10761-10779 of SEQ ID NO:61)
Exon 22–Exon 23 TGAG GTGCGGG (nt 10916-10926 of SEQ ID NO:61) . . . TGCTTCTTCCTCCAG
AAAG (nt 11686-11704 of SEQ ID NO:61)

A comparison of the sequences of the different forms of the human GABAB receptor cDNA (SEQ ID NO: 48, 50, 54, and 56) with the sequence of the human GABAB gene (SEQ ID NO: 60 and 61) reveals that various mRNAs encoding human GABAB receptors are formed by alternative splicing. The translational start site of the GABAB receptor 1a is in exon 2 and the translational stop signal is in exon 23. The mRNA encoding GABAB receptor 1b is formed by alternative splicing such that part of intron 5 is retained together with exon 6, and the translational start of the GABAB receptor 1b is derived from the intron sequence. The mRNA encoding GABAB receptor 1c is formed by alternative splicing such that exon 15 is removed along with introns 14 and 15, and a frame shift and a translational stop signal are generated in the sequence corresponding to exon 16. The mRNA encoding GABAB receptor 1d is formed when the translational start of the GABAB receptor 1b is generated together with the translational stop of the GABAB receptor 1c.

The GABAB receptor 1a isoform is formed by splicing exon 5 to a cryptic splice site in the middle of exon 6. Transcription of the GABAB receptor 1b isoform mRNA is most likely initiated from regulatory elements in intron 5. The ATG that initiates translation of GABAB receptor 1b mRNA is located in the 5′-end of exon 6.

Additional mRNA variants encoding variants of the human GABAB receptor can be derived by alternative splicing such that one or more of the exons, or parts of exons, are excised in the processing of the pre-mRNA. Subsequent translation of these mRNAs gives rise to variants of the human GABAB receptor having potentially different biological and/or pharmacological activities.

EXAMPLE 7

Analysis of cDNA Encoding Human GABAB Receptors from Human Brain

Messenger RNA from human fetal brain (catalog #6525-1) and adult human brain (catalog #6516-1) were obtained from Clontech (Palo Alto, Calif., USA). First strand cDNA synthesis reactions were performed using a First Strand™ cDNA Synthesis kit from Amersham Pharmacia Biotech (Uppsala, Sweden). The pd(N)6 primer was used to prime the first-strand synthesis. The generated cDNA molecules were used as templates in the PCR reactions described below.

Specific PCR primers were designed (as shown in Table 11) based on the sequences of the rat GABAB receptor 1a and 1b cDNA and human GABAB receptor 1a and 1b cDNA. Various cDNA fragments encoding parts of the human GABAB receptors were amplified directly by PCR using the designed primers with the generated cDNA molecules as templates. PCR experiments with primers 838, 863, 864, and 865 were carried out using Perkin Elmer Taq DNA polymerase with Gene Amp™ (Roche Molecular System Inc., NJ, USA) with the following PCR program: +95° C. for 1 minute, +50° C. for 30 seconds, and +72° C. for 3 minutes, repeated 44 times, and then +72° C. for 7 minutes. PCR experiments with primers 937 and 1015 were carried out using the Expand Long Template™ PCR System (Boehringer Mannheim GmbH, Germany) with the following PCR program: +94° C. for 2 minutes, +94° C. for 10 seconds, +55° C. for 30 seconds, and +68° C. for 3 minutes, repeated 35 times, and then +68° C. for 7 minutes. The primer combinations 838 and 863, 864 and 863, 864 and 865, and 937 and 1015 produced the expected PCR products.

TABLE 11
Primers used for RT-PCR on mRNA from human fetal brain
SEQ ID
Nr. Species Sequence 5′–3′ NO
838 Rat ATGCGCGCCGGCAGCCAACATGCTGCTGCTGCTGCTGGTGCCTCTCTTCC 62
863 Rat GGTCATCCAGCGTTGAGGTGAAGAC 63
864 Rat GAAGGTTGCCAGATTATACATCCGC 64
865 Rat CCACGATGATTCGAGCATCTTGACG 65
937 Human CTGGTTCCTCCCAATGTG 66
1015 Human CCAGTGGACTATGAGATTGAG 67

The PCR products were subcloned into the pGEM-T™ vector from Promega (Madison, Wis., USA), and the inserts were subjected to nucleotide sequence analysis. The complete nucleotide sequences for all subclones were determined using a Thermo Sequenase™ dye terminator cycle sequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala, Sweden). Specific oligonucleotides complementary to the vector pGEM-T™ or primers complementary to the cDNA encoding the GABAB receptor were used as primers for the sequencing reactions.

A number of analyzed clones isolated from fetal brain lacked 186 base pairs corresponding to exon 4. Such alternative splicing resulted in a cDNA (SEQ ID NO: 70) encoding a protein (SEQ ID NO: 71) containing 899 amino acids, and designated GABAB receptor 1e.

Other clones from fetal brain lacked 368 base pairs, corresponding to exons 4, 5, and 6, and resulting in a cDNA (SEQ ID NO: 72) having a frame shift and a translational stop codon generated in the sequence corresponding to exon 7. This cDNA encoded a protein (SEQ ID NO: 73) that included only 97 amino acids, which was designated GABAB receptor 1f.

One clone lacked 207 base pairs, corresponding to exons 4 and 5, and resulting in a cDNA (SEQ ID NO: 74) encoding a protein (SEQ ID NO: 75) containing 892 amino acids and designated GABAB receptor 1g.

Another clone had two deletions: the first deleted 186 base pairs corresponding to exon 4, and the second deleted 39 base pairs corresponding to part of exon 6. The resulting cDNA (SEQ ID NO: 76) encoded a protein (SEQ ID NO: 77) containing 886 amino acids, designated GABAB receptor 1h.

Another clone from adult human brain had a deletion of 1194 base pairs corresponding to base pairs 319-1512 of the cDNA encoding human GABAB receptor 1a. This deletion corresponds to part of exon 4, exons 5-11, and part of exon 12. This cDNA (SEQ ID NO: 78) encodes a protein (SEQ ID NO: 79) containing 563 amino acids, designated GABAB receptor 1i.

One clone isolated from fetal brain lacked 284 base pairs corresponding to part of exon 3 and all of exon 4, generating a frame shift and a translational stop codon in the sequence corresponding to exon 5. This cDNA (SEQ ID NO: 80) encodes a protein (SEQ ID NO: 81) containing only 105 amino acids, designated GABAB receptor 1j.

EXAMPLE 8

Analysis of cDNA Encoding Human GABAB Receptors from Jurkat Cells

A guanidine isothiocyanate/CsCl method was used to isolate total RNA from Jurkat cells. First strand cDNA synthesis reactions were performed using the First Strand™ cDNA Synthesis kit from Amersham Pharmacia Biotech (Uppsala, Sweden). The pd(N)6 primer was used to prime the first-strand synthesis. The generated cDNA molecules were used as templates in the PCR reactions described below.

Specific PCR primers were designed (as shown in Table 12) based on the sequences of the human GABAB receptor 1a and 1b cDNA.

TABLE 12
Primers used for RT-PCR on mRNA from Jurkat cells
Nr. Species Sequence 5′–3′ SEQ ID NO
937 Human CTGGTTCCTCCCAATGTG 68
1015 Human CCAGTGGACTATGAGATTGAG 69

cDNA fragments encoding parts of the human GABAB receptors were amplified directly by PCR using the designed primers with the generated cDNA molecules as templates. PCR was carried out using the Expand Long Template™ PCR System (Boehringer Mannheim GmbH, Germany) with the following PCR program: +94° C. for 2 minutes; +94° C. for 10 seconds, +55° C. for 30 seconds, and +68° C. for 3 minutes, repeated 35 times; and then +68° C. for 7 minutes. The primer combination 937 and 1015 produced a PCR product.

The PCR products were subcloned into the pGEM-T vector from Promega (Madison, Wis., USA), and the inserts were subjected to nucleotide sequence analysis. The complete nucleotide sequences for all subclones were determined using a Thermo Sequenase™ dye terminator cycle sequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala, Sweden). Specific oligonucleotides complementary to the vector pGEM-T or primers complementary to the cDNA encoding the GABAB receptor were used as primers for the sequencing reactions.

Two clones had two deletions: the first deleted 368 base pairs corresponding to exons 4, 5, and 6; the second deleted 151 base pairs corresponding to exon 15, with a frame shift and a translational stop codon generated in the sequence corresponding to exon 7. This cDNA (SEQ ID NO: 82) encodes a protein (SEQ ID NO: 83) containing only 98 amino acids, which is designated GABAB receptor 1k, and which is identical to the GABAB receptor 1f described above.

Two other clones also had two deletions: the first a deletion of 246 base pairs corresponding to part of exon 4, exon 5, and exon 6; the second deletion lacked 149 base pairs corresponding to exon 15, generating a frame shift and a translational stop codon in the sequence corresponding to exon 16. This cDNA (SEQ ID NO: 84) encodes a protein (SEQ ID NO: 5) containing 496 amino acids, which is designated GABAB receptor 1l.

Additional variants of cDNAs encoding the human GABAB receptors can be identified in a similar manner using PCR primers based on the sequences of the cDNAs and genomic fragments encoding the human GABAB receptors disclosed herein.

The biological activity of these variants of the human GABAB receptor can be evaluated by transfection of suitable host cells with expression vectors containing the corresponding cDNA sequences, and measuring binding of labeled ligands activation of the receptor, or modulation of receptor function.

EXAMPLE 9

Generation of Antibodies

Antibodies were raised in rabbits against four different BSA-conjugated 20 amino acid-long synthetic peptides corresponding to selected regions of the human and canine GABAB receptor extracellular domains. Two polyclonal antibodies were directed against a sequence common to GABAB receptors 1a and b (ab1 and ab2), one against a GABAB receptor 1a-specific region (a1), and one against a GABAB receptor 1b-specific sequence (b1). To allow BSA-conjugation, a cysteine residue was added to the amino terminus in all peptides except a1, which contains an endogenous cysteine. The peptide sequences are as follows:

Peptide a1: (amino acids 18-37 of SEQ ID NO: 49) NH2-Gly Gly Ala Gln Thr Pro Asn Ala Thr Ser Glu Gly Cys Gln Ile Ile His Pro Pro Trp-COOH

Peptide ab1: (amino acids 197-216 of SEQ ID NO: 49, with N-terminally added Cys) NH2-Cys Glu Asp Val Asn Ser Arg Arg Asp Ile Leu Pro Asp Tyr Glu Leu Lys Leu Ile His His-COOH

Peptide ab2: (amino acids 271-290 of SEQ ID NO: 49, with N-terminally added Cys) NH2-Cys Ser Pro Ala Leu Ser Asn Arg Gln Arg Phe Pro Thr Phe Phe Arg Thr His Pro Ser Ala-COOH

Peptide b1: (amino acids 30-47 of SEQ ID NO: 57, with N-terminally added Cys) NH2-Cys Ser His Ser Pro His Leu Pro Arg Pro His Ser Arg Val Pro Pro His Pro Ser-COOH

The antibodies were purified from rabbit serum by affinity chromatography using the corresponding immobilized peptide. The antibodies subsequently were used to detect expression of recombinant GABAB receptor isoforms on Western blots.

EXAMPLE 10

Heterologous Expression of GABAB Receptor Isoforms in Mammalian Cells

A HindIII/SalI cDNA fragment encoding the human GABAB receptor 1b isoform was cloned into a BPV (bovine papilloma virus)-based expression vector containing the mMT-1 (murine metallothionein) promoter. Using a calcium phosphate transfection method, murine C127 cells were co-transfected with the GABAB receptor expression construct and an expression plasmid containing a G418 resistance marker gene. G418 resistant clones were evaluated by Western blot analysis for expression of the approximately 100 kDa GABAB receptor 1b isoform (FIG. 2). The human GABAB receptor 1b isoform also was expressed in human HEK-293 cells using a pCI-neo expression vector and Lipofectamine™ (Life Technologies, Inc., Rockville, Md., USA) for transfection. The identity of the heterologously expressed receptor was verified in HEK-293 cells by Western blot analysis and radioligand binding experiments.

A cDNA fragment encoding the human GABAB receptor 1d isoform was cloned into a BPV-based expression vector containing the mMT-1 promoter. Using a calcium phosphate transfection method, murine C127 cells were co-transfected with the GABAB receptor expression construct and an expression plasmid containing a G418 resistance marker gene. G418 resistant clones, and concentrated medium from such clones, were evaluated for GABAB receptor 1d isoform expression by Western blot analysis (FIG. 3). This experiment revealed that the human GABAB receptor 1d is a secreted isoform.

EXAMPLE 11

Heterologous Expression of GABAB Receptor Isoforms in E. Coli

A cDNA fragment encoding the human GABAB receptor 1d isoform was cloned into a modified pET (Pharmacia Amersham, Uppsala, Sweden) vector downstream of a STII (heat stable enterotoxin II of E. coli) signal peptide. The cDNA insert was followed by a thrombin cleavage site and a hexahistidine tag. The expression construct was subsequently used to transform the BL21 (DE3) E. coli strain BL21 (DE3). Western blot analysis of IPTG-induced bacteria revealed expression of a human GABAB receptor 1d isoform of the expected size (FIG. 4).

In addition, the human GABAB receptor 1d isoform was successfully expressed in E. coli strain AD494 (DE3) without fusion to a bacterial signal peptide.

EXAMPLE 12

Method for the Screening of Substances which are GABAB Receptor Antagonists or Agonists

GABAB receptor expressing cells, and transgenic animals or cells and tissues derived therefrom, are used to screen substance libraries for antagonist or agonist activities. Screening can be performed as ligand binding assays or functional assays. For screening, cells and tissues are prepared in various ways, each uniquely suited to its purpose. Ligand binding assays are performed in vivo or in vitro. Functional assays exemplified by, but not limited to, Ca++-responses, cAMP-responses and effects on Cl− and K+ channels, are performed in living cells, broken cells, or isolated cell membranes, as well as in tissues and in living animals.

Claims

What is claimed is:

1. An isolated GABAB receptor polypeptide comprising a sequence at least 99% identical to SEQ ID NO:49.

2. An isolated polypeptide comprising the sequence of SEQ ID NO:49.

3. An isolated polypeptide comprising the sequence of SEQ ID NO:49 minus an N-terminal sequence of SEQ ID NO:49, wherein the N-terminal sequence is 1-25 amino acids long.

4. An isolated polypeptide the amino acid sequence of which consists of SEQ ID NO:49.

5. An isolated polypeptide consisting of the sequence of SEQ ID NO:49 minus an N-terminal sequence of SEQ ID NO:49, wherein the N-terminal sequence is 1-25 amino acids long.

6. A screening method comprising

(a) contacting the polypeptide of claim 1 with a test compound; and

(b) detecting binding of the test compound to the polypeptide.

7. The method of claim 6, further comprising

(c) selecting a test compound that binds to the polypeptide; and

(d) testing the compound for its ability to inhibit transient lower esophageal sphincter relaxations (TLESR).

8. The method of claim 6, wherein the polypeptide is expressed on a cell that contains a recombinant DNA encoding the polypeptide.

9. A screening method comprising

(a) contacting the polypeptide of claim 2 with a test compound; and

(b) detecting binding of the test compound to the polypeptide.

10. The method of claim 9, further comprising

(c) selecting a test compound that binds to the polypeptide; and

(d) testing the compound for its ability to inhibit transient lower esophageal sphincter relaxations (TLESR).

11. The method of claim 9, wherein the polypeptide is expressed on a cell that contains a recombinant DNA encoding the polypeptide.

12. A screening method comprising

(a) contacting the polypeptide of claim 3 with a test compound; and

(b) detecting binding of the test compound to the polypeptide.

13. The method of claim 12, further comprising

(c) selecting a test compound that binds to the polypeptide; and

(d) testing the compound for its ability to inhibit transient lower esophageal sphincter relaxations (TLESR).

14. The method of claim 12, wherein the polypeptide is expressed on a cell that contains a recombinant DNA encoding the polypeptide.

15. A screening method comprising

(a) contacting the polypeptide of claim 4 with a test compound; and

(b) detecting binding of the test compound to the polypeptide.

16. The method of claim 15, further comprising

(c) selecting a test compound that binds to the polypeptide; and

(d) testing the compound for its ability to inhibit transient lower esophageal sphincter relaxations (TLESR).

17. The method of claim 15, wherein the polypeptide is expressed on a cell that contains a recombinant DNA encoding the polypeptide.

18. A screening method comprising

(a) contacting the polypeptide of claim 5 with a test compound; and

(b) detecting binding of the test compound to the polypeptide.

19. The method of claim 18, further comprising

(c) selecting a test compound that binds to the polypeptide; and

(d) testing the compound for its ability to inhibit transient lower esophageal sphincter relaxations (TLESR).

20. The method of claim 18, wherein the polypeptide is expressed on a cell that contains a recombinant DNA encoding the polypeptide.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: