Patent application title:

Goodpasture antigen binding protein

Publication number:

-

Publication date:
Application number:

10/270,877

Filed date:

2002-10-11

āœ… Patent granted

Patent number:

US 7,186,527 B2

Grant date:

2007-03-06

PCT filing:

-

PCT publication:

-

Examiner:

Maher M. Haddad | Nora M. Rooney

Adjusted expiration:

2023-11-07

Abstract:

The present invention provides isolated nucleic acid sequences and expression vectors encoding the Goodpasture antigen binding protein (GPBP), substantially purified GPBP, antibodies against GPBP, and methods for detecting GPBP.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07H21/04 IPC

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical

C12N15/09 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor Recombinant DNA-technology

Description

CROSS REFERENCE

This application claims priority to U.S. Provisional Patent Application Ser. No. 60/121,483, filed Feb. 24, 1999, and is a divisional application of U.S. application Ser. No. 09/512,563 , filed Feb. 24, 2000, now U.S. Pat. No. 6,579,969.

STATEMENT OF GOVERNMENT RIGHTS

This work was supported in part by Grants SAL91/0513, SAF94/1051 and SAF97/0065 from the Plan Nacional I+D of the Comisión Interministerial de Ciencia Tecnología (CICYT, Spain), Grant 93/0343 from Fondo de Investigaciones Sanitarias (FISss, Spain) and Grants GV-3166/95, GV-C-VS-21-118-96 from la Direcció General d'Ensenyaments Universitaris i Investigació (Comunitat Valenciana, Spain); therefore the State of Spain may have rights in the invention.

FIELD OF THE INVENTION

The invention relates to the fields of protein kinases, automimmune disease, apoptosis, and cancer.

BACKGROUND OF THE INVENTION

Goodpasture (GP) disease is an autoimmune disorder described only in humans. In GP patients, autoantibodies against the non-collagenous C-terminal domain (NC1) of the type IV collagen α3 chain (ā€œGoodpasture antigenā€) cause a rapidly progressive glomerulonephritis and often lung hemorrhage, the two cardinal clinical manifestations of the GP syndrome (see 1 for review. The reference numbers in this section correspond to reference list of Example 1).

The idea that common pathogenic events exist at least for some autoimmune disorders is suggested by the significant number of patients displaying more than one autoimmune disease, and also by the strong and common linkage that some of these diseases show to specific MHC haplotypes (31, 32). The experimental observation that the autoantigen is the leading moiety in autoimmunity and that a limited number of self-components are autoantigenic (31), suggest that these self-components share biological features with important consequences in self/non-self recognition by the immune system. One possibility is that triggering events, by altering different but specific self-components, would result in abnormal antigen processing. In certain individuals expressing a particular MHC specificity, the abnormal peptides could be recognized by non-tolerized T cells and trigger an immune response (1).

We have previously explored the GP antigen to identify biological features of relevance in autoimmune pathogenesis. Since the NC1 domain is a highly conserved domain among species and between the different type IV collagen α chains (α1–α6) (2), the exclusive involvement of the human α3(IV)NC1 in a natural autoimmune response suggests that this domain has structural and/or biological peculiarities of pathogenic relevance. Consistent with this, the N-terminus of the human antigen is highly divergent, and it contains a unique five-residue motif (KRGDS9) that conforms to a functional phosphorylation site for type A protein kinases (3, 4). Furthermore, the human α3 gene, but not the other related human or homologous genes from other species, is alternatively spliced and generates multiple transcripts also containing the phosphorylatable N-terminal region (5–7). Recent studies indicate that the phosphorylation of the N-terminus of the GP antigen by cAMP-dependent protein kinase is up regulated by the presence of the alternative products (see Example 3 below). Specific serine phosphorylation and pre-mRNA alternative splicing are also associated with the biology of other autoantigens including the acetylcholine receptor and myelin basic protein (MBP) (4). The latter is suspected to be the major antigen in multiple sclerosis (MS), another exclusively human autoimmune disease in which the immune system targets the white matter of the central nervous system. GP disease and MS are human disorders that display a strong association with the same HLA class II haplotype (HLA DRB1*1501)(32, 33). This, along with the recent report of death by GP disease of an MS patient carrying this HLA specificity (34), supports the existence of common pathogenic events in these human disorders.

Thus, specific serine/threonine phosphorylation may be a major biological difference between the human GP antigen, the GP antigens of other species, and the homologous domains from the other human α(IV) chains, and might be important in pathogenesis (1, 4).

Therefore, the identification and isolation of the specific serine/threonine kinase that phosphorylates the N-terminal region of the human GP antigen would be very advantageous for the diagnosis and treatment of GP syndrome, and possibly for other autoimmune disorders.

SUMMARY OF THE INVENTION

The present invention fulfills the need in the art for the identification and isolation of a serine/threonine kinase that specifically binds to and phosphorylates the unique N-terminal region of the human GP antigen. In one aspect, the present invention provides nucleic acid sequences encoding various forms of the Goodpasture antigen binding protein (GPBP), as well as recombinant expression vectors operatively linked to the GPBP-encoding sequences.

In another aspect, the present invention provides host cells that have been transfected with the recombinant expression vectors. In a further aspect, the present invention provides substantially purified GPBP and antibodies that selectively bind to GPBP. In still further aspect, the invention provides methods for detecting the presence of GPBP or nucleic acids encoding GPBP.

In a further aspect, the present invention provides methods for detecting the presence of an autoimmune condition or apoptosis, which comprises detecting an increase in the expression of GPBP in a tissue compared to a control tissue.

In another aspect, the present invention provides methods and pharmaceutical compositions for treating an autoimmune disorder, apoptosis, or a tumor, comprising modifying the expression or activity of GPBP in a patient in need thereof.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1. Nucleotide and derived amino acid sequences of n4′. The denoted structural features are from 5′ to 3′end: the cDNA present in the original clone (HeLa1) (dotted box), which contains the PH homology domain (in black) and the Ser-Xaa-Yaa repeat (in gray); the heptad repeat of the predictable coiled-coil structure (open box) containing the bipartite nuclear localization signal (in gray); and a serine-rich domain (filled gray box). The asterisks denote the positions of in frame stop codons.

FIG. 2. Distribution of GPBP in human tissues (Northern blot) and in eukaryotic species (Southern blot). A random primed 32P-labeled HeLa1 cDNA probe was used to identify homologous messages in a Northern blot of poly(A+)RNA from the indicated human tissues (panel A) or in a Southern blot of genomic DNA from the indicated eukaryotic species (panel B). Northern hybridization was performed under highly stringent conditions to detect perfect matching messages and at low stringency in the Southern to allow the detection of messages with mismatches. No appreciable differences in the quality and amount of each individual poly A+ RNA was observed by denaturing gel electrophoresis or when probing a representative blot from the same lot with human β-actin cDNA. The numbers denote the position and the sizes in kb of the RNA or DNA markers used.

FIG. 3. Experimental determination of the translation start site. In (A), the two cDNAs present in pc-n4′ and pc-FLAG-n4′ plasmids used for transient expression are represented as black lines. The relative position of the corresponding predicted (n4′) or engineered (FLAG-n4′) translation start site is indicated (Met). In (B), the extracts from control (āˆ’), pc-n4′(n4′) or pc-FLAG-n4′ (FLAG-n4′) transfected 293 cells were subjected to SDS-PAGE under reducing conditions in 10% gels. The separated proteins were transferred to a PVDF membrane (Millipore) and blotted with the indicated antibodies. The numbers and bars indicate the molecular mass in kDa and the relative positions of the molecular weight markers, respectively.

FIG. 4. Characterization of rGPBP from yeast and 293 cells. In (A), 1 μg (lane 1) or 100 ng (lanes 2 and 3) of yeast rGPBP were analyzed by reducing SDS-PAGE in a 10% gel. The separated proteins were stained with Coomassie blue (lane 1) or transferred and blotted with anti-FLAG antibodies (lane 2) or Mab14, a monoclonal antibody against GPBP (lane 3). In (B), the cell extracts from GPBP-expressing yeast were analyzed as in A and blotted with anti-FLAG (lane 1), anti-PSer (lane 2), anti-PThr (lane 3) or anti-PTyr (lane 4) monoclonal antibodies respectively. In (C), 200 ng of either yeast rGPBP (lane 1), dephosphorylated yeast rGPBP (lane 2) or 293 cells-derived rGPBP (lane 3) were analyzed as in B with the indicated antibodies. In (D), similar amounts of H332PO4-labeled non-transfected (lanes 1), stable pc-n4′ transfected (lanes 2) or transient pc-FLAG-n4′ expressing (lanes 3) 293 cells were lysed, precipitated with the indicated antibodies and analyzed by SDS-PAGE and autoradiography. The molecular weight markers are represented with numbers and bars as in FIG. 3. The arrows indicate the position of the rGPBP.

FIG. 5. Recombinant GPBP contains a serine/threonine kinase that specifically phosphorylates the N-terminal region of the human GP antigen. To assess phosphorylation, approximately 200 ng of yeast rGPBP was incubated with [γ]32P-ATP in the absence (A and B) or presence of GP antigen-derived material (C). In (A), the mixture was subjected to reducing SDS-PAGE (10% gel) and autoradiographed. In (B), the mixture was subjected to 32P-phosphoamino acid analysis by two-dimensional thin-layer chromatography. The dotted circles indicate the position of ninhydrin stained phosphoamino acids. In (C), the phosphorylation mixtures of the indicated GP-derived material were analyzed by SDS-PAGE (15% gel) and autoradiography (GPpep1 and GPpep1Ala9) or immunoprecipitated with Mab 17, a monoclonal antibody that specifically recognize GP antigen from human and bovine origin, and analyzed by SDS-PAGE (12.5%) and autoradiography (rGP, GP). The relative positions of rGPBP (A), rGP antigen and the native human and bovine GP antigens (C) are indicated by arrows. The numbers and bars refer to molecular weight markers as in previous Figures.

FIG. 6. In-blot renaturation of the serine/threonine kinase present in rGPBP. Five micrograms of rGPBP from yeast were in-blot renatured. The recombinant material was specifically identified by anti-FLAG antibodies (lane 1) and the in situ 32P-incorporation detected by autoradiography (lane 2). The numbers and bars refer to molecular weight markers as in previous Figures. The arrow indicates the position of the 89 kDa rGPBP polypeptide.

FIG. 7. Immunological localization of GPBP in human tissues. Rabbit serum against the N-terminal region of GPBP (1:50) was used to localize GPBP in human tissues. The tissues shown are kidney (A) glomerulus (B), lung (C), alveolus (D), liver (E), brain (F), testis (G), adrenal gland (H), pancreas (I) and prostate (J). Similar results were obtained using anti-GPBP affinity-purified antibodies or a pool of culture medium from seven different GPBP-specific monoclonal antibodies (anti-GPBP Mabs 3, 4, 5, 6, 8, 10 and 14). Rabbit pre-immune serum did not stain any tissue structure in parallel control studies. Magnification was 40Ɨ except in B and D where it was 100Ɨ.

FIG. 8. GPBPĪ”26 is a splicing variant of GPBP. (A) Total RNA from normal skeletal muscle was retrotranscribed using primer 53c and subsequently subjected to PCR with primers 11m–53c (lane 2) or 15m–62c (lane 4). Control amplifications of a plasmid containing GPBP cDNA using the same pairs of primers are shown in lanes 1 and 3. Numbers on the left and right refer to molecular weight in base pairs. The region missing in the normal muscle transcript was identified and its nucleotide sequence (lower case) and deduced amino acid sequence (upper case) are shown in (B). A clone of genomic DNA comprising the cDNA region of interest was sequenced and its structure is drawn in (C), showing the location and relative sizes of the 78-bp exon spliced out in GPBPĪ”26 (black box), adjacent exons (gray boxes), and introns (lines). The size of both intron and exons is given and the nucleotide sequence of intron-exon boundaries is presented, with consensus for 5′ and 3′ splice sites shown in bold case.

FIG. 9. Differential expression of GPBP and GPBPĪ”26. Fragments representing the 78-bp exon (GPBP) or flanking sequences common to both isoforms (GPBP/GPBPĪ”26) were 32P-labeled and used to hybridize human tissue and tumor cell line Northern blots (CLONTECH). The membranes were first hybridized with GPBP-specific probe, stripped and then reanalyzed with GPBP/GPBPĪ”26 probe. Washing conditions were less stringent for GPBP-specific probe (0.1% SSPE, 37° C. or 55° C.) than for the GPBP/GPBPĪ”26 (0.1% SSPE, 68° C.) to increase GPBP and GPBPĪ”26 signals respectively. No detectable signal was obtained for the GPBP probe when the washing program was at 68° C. (not shown).

FIG. 10. GPBPĪ”26 displays lower phosphorylating activity than GPBP. (A) Recombinantly-expressed, affinity-purified GPBP (rGPBP) (lanes 1) or rGPBPĪ”26 (lanes 2) were subjected to SDS-PAGE under reducing conditions and either Coomasie blue stained (2 μg per lane) or blotted (200 ng per lane) with monoclonal antibodies recognizing the FLAG sequence (α-FLAG) or GPBP/GPBPĪ”26 (Mab14). (B) 200 ng of rGPBP (lanes 1) or rGPBPĪ”26 (lanes 2) were in vitro phosphorylated without substrate to assay auto-phosphorylation (left), or with 5 nmol GPpep1 to measure trans-phosphorylation activity (right). An arrowhead indicates the position of the peptide. (C) 3 μg of rGPBP (lane 1) or rGPBPĪ”26 (lane 2) were in-blot renatured as described under Material and Methods. The numbers and bars indicate the molecular mass in kDa and the relative position of the molecular weight markers, respectively.

FIG. 11. rGPBP and rGPBPĪ”26 form very active high molecular weight aggregates. About 300 μg of rGPBP (A) or rGPBPĪ”26 (B) were subjected to gel filtration HPLC as described under Material and Methods. Vertical arrowheads and numbers respectively indicate the elution profile and molecular mass (kDa) of the molecular weight standards used. Larger aggregates eluted in the void volume (I), and the bulk of the material present in the samples eluted in the fractionation range of the column as a second peak between the 669 and 158 kDa markers (II). Fifteen microliters of the indicated minute fractions were subjected to SDS-PAGE and Coomasie blue staining. Five microliters of the same fractions were in vitro phosphorylated as described in Materials and Methods, and the reaction stopped by boiling in SDS sample buffer. The fractions were loaded onto SDS-PAGE, transferred to PVDF and autoradiographed for 1 or 2 hours using Kodak X-Omat films and blotted using anti-FLAG monoclonal antibodies (Sigma).

FIG. 12. Self-interaction of GPBP and GPBPĪ”26 assessed by a yeast two-hybrid system. (A) Cell transfected for the indicated combinations of plasmids were selected on leucine-tryptophan-deficient medium (-Trp, -Leu), and independent transformants restreaked onto histidine-deficient plates (-Trp, -Leu, -His) in the presence or absence of 1 mM 3-amino-triazole (3-AT), to assess interaction. The picture was taken 3 days after streaking. (B) The bars represent mean values in β-galactosidase arbitrary units of four independent β-galactosidase in-solution assays.

FIG. 13. GPBP is expressed associated with endothelial and glomerular basement membranes. Paraffin embedded sections of human muscle (A) or renal cortex (B, C) were probed with GPBP-specific antibodies (A,B) or with Mab189, a monoclonal antibody specific for the human α3(IV)NC1 (C). Frozen sections of human kidney (D-F) were probed with Mab17, a monoclonal antibody specific for the α3(IV)NC1 domain (D), GPBP-specific antibodies (E), or sera from a GP patient (F). Control sera (chicken pre-immune and human control) did not display tissue-binding in parallel studies (not shown).

FIG. 14. GPBP is expressed in human but not in bovine and murine renal cortex. Cortex from human (A, D), bovine (B, E) or murine (C, F) kidney were paraffin embedded and probed with either GPBP-specific antibodies (A-C) or GPBP/GPBPΔ26-specific antibodies (D-F).

FIG. 15. GPBP is highly expressed in several autoimmune conditions. Skeletal muscle total RNA from a control individual (lane 1) or from a GP patient (lane 2) was subjected to RT-PCR as in FIG. 8, using the oligonucleotides 15m and 62c in the amplification program. Frozen (B-D) or paraffin embedded (E-G) human control skin (B, E) or skin affected by SLE (C, F) or lichen planus (D, G) were probed with GPBP-specific antibodies.

FIG. 16. Phosphorylation of GP alternative splicing products by PKA. In left panel, equimolecular amounts of rGP (lanes 1), rGPĪ”V (lanes 2), rGPĪ”III (lanes 3) or rGPĪ”III/IV/V (lanes 4), equivalent to 500 ng of the GP were phosphorylated at the indicated ATP concentrations. One-fifth of the total phosphorylation reaction mixture was separated by gel electrophoresis and transferred to PVDF, autoradiographed (shown) and the proteins blotted with M3/1, a specific monoclonal antibody recognizing all four species (shown) or using antibodies specific for each individual C-terminal region (not shown). Arrowheads indicate the position of each recombinant protein, from top to bottom, GP, GPĪ”V and, GPĪ”III-GPĪ”III/IV/V which displayed the same mobilities. Right panel: purified α3(IV)NC1 domain or hexamer was phosphorylated with PKA and 0.1 μM ATP in the absence (lanes 1) or in the presence of 10 nmol of peptides representing the C-terminal region of either GPĪ”III (lanes 2) or GPĪ”III/IV/V (lanes 3). Where indicated the phosphorylation mixtures of purified α3(IV)NC1 domain were V8 digested and immunoprecipitated with antibodies specific for the N terminus of the human α3(IV)NC1 domain (3). Bars and numbers indicate the position and sizes (kDa) of the molecular weight markers.

FIG. 17. Sequence alignment of GPΔIII and MBP. The phosphorylation sites for PKA (boxed) and the structural similarity for the sites at Ser 8 and 9 of MBP and GPΔIII respectively are shown (underlined). The identity (vertical bars) and chemical homology (dots) of the corresponding exon II (bent arrow) of both molecular species are indicated. The complete sequence of GPΔIII from the collagenase cleavage site (72-residues) is aligned with the 69-N terminal residues of MBP comprising the exon I and ten residues of the exon II.

FIG. 18. Phosphorylation of recombinant MBP proteins by PKA. About 200 ng of rMBP (lane 1), or Ser to Ala mutants thereof in position 8 (lane 2) or 57 (lane 3), or rMPBĪ”II (lane 4) or Ser to Ala mutants thereof in position 8 (lane 5) or 57 (lane 6), were phosphorylated by PKA and 0.1 μM ATP. The mixtures were subjected to SDS-PAGE, transferred to PVDF and autoradiographed (Phosphorylation) and the individual molecular species blotted with monoclonal antibodies against human MBP obtained from Roche Molecular Biochemicals (Western).

FIG. 19. Phosphorylation of recombinant MBP proteins by GPBP. About 200 ng of rMBP (lane 1), or Ser to Ala mutants thereof in positions 8 (lane 2) or 57 (lane 3), or rMPBΔII (lane 4), or Ser to Ala mutants thereof in positions 8 (lane 5) or 57 (lane 6), were subjected to SDS-PAGE, transferred to PVDF, and the area containing the proteins visualized with Ponceau and stripped out. The immobilized proteins were in situ phosphorylated with rGPBP as described in Materials and Methods, autoradiographed (Phosphorylation) and subsequently blotted as in FIG. 18 (Western).

FIG. 20. Regulation of the GPBP by the C terminal region of GPĪ”III. About 200 ng of rGPBP were in vitro phosphorylated with 150 μM ATP in the absence (lane 1) or in the presence of 5 nmol of GPĪ”III-derived peptide synthesized either using Boc-(lane 2) or Fmoc-(lane 3) chemistry. The reaction mixtures were subjected to SDS-PAGE, transferred to PVDF and autoradiographed to asses autophosphorylation, and subsequently blotted with anti-FLAG monoclonal antibodies (Sigma) to determine the amount of recombinant material present (Western).

DETAILED DESCRIPTION OF THE INVENTION

All references cited are herein incorporated by reference in their entirety.

The abbreviations used herein are: bp, base pair; DTT, dithiothreitol; DMEM, Dulbecco's modified Eagle's medium; EDTA, ethylenediamine tetraacetic acid; EGTA, ethylene glycol-bis(β-aminoethyl ether) N,N,N′,N′-tetraacetic acid; GP, Goodpasture; rGPĪ”III, rGPĪ”III/IV/V and rGPĪ”V, recombinant material representing the alternative forms of the Goodpasture antigen resulting from splicing out exon III, exon III, IV and V or exon V, respectively; GPBP and rGPBP, native and recombinant Goodpasture antigen binding protein; GPBPĪ”26 and rGPBPĪ”26, native and recombinant alternative form of the GPBP; GST, glutathione S-transferase; HLA, human lymphocyte antigens; HPLC, high performance liquid chromatography; Kb, thousand base pairs; kDa, thousand daltons; MBP, rMBP, native and recombinant 21 kDa myelin basic protein; MBPĪ”II and rMBPĪ”II, native and recombinant 18.5 kDa myelin basic protein that results from splicing out exon II; MBPĪ”V and MBPĪ”II/V, myelin basic protein alternative forms resulting from splicing out exon V and exons II and V, respectively; MHC, major histocompatibility complex; NC1, non-collagenous domain; PH, pleckstrin homology; PKA, cAMP-dependent protein kinase; PMSF, phenylmethylsulfonyl fluoride; SDS-PAGE, sodium dodecylsulfate polyacrylamide gel electrophoresis; TBS, tris buffered saline.

Within this application, unless otherwise stated, the techniques utilized may be found in any of several well-known references such as: Molecular Cloning: A Laboratory Manual (Sambrook, et al., 1989, Cold Spring Harbor Laboratory Press), Gene Expression Technology (Methods in Enzymology, Vol. 185, edited by D. Goeddel, 1991. Academic Press, San Diego, Calif.), ā€œGuide to Protein Purificationā€ in Methods in Enzymology (M. P. Deutshcer, ed., (1990) Academic Press, Inc.); PCR Protocols: A Guide to Methods and Applications (Innis, et al. 1990. Academic Press, San Diego, Calif.), Culture of Animal Cells: A Manual of Basic Technique, 2nd Ed. (R. I. Freshney. 1987. Liss, Inc. New York, N.Y.), Gene Transfer and Expression Protocols, pp. 109–128, ed. E. J. Murray, The Humana Press Inc., Clifton, N.J.), and the Ambion 1998 Catalog (Ambion, Austin, Tex.).

As used herein, the term ā€œGPBPā€ refers to Goodpasture binding protein, and includes both monomers and oligomers thereof. Human (SEQ ID NO:2), mouse (SEQ ID NO:4), and bovine GPBP sequences (SEQ ID NO:6) are provided herein.

As used herein, the term ā€œGPBPĪ”26ā€ refers to Goodpasture binding protein deleted for the 26 amino acid sequence shown in SEQ ID NO:14, and includes both monomers and oligomers thereof. Human (SEQ ID NO:8), mouse (SEQ ID NO:10), and bovine GPBP sequences (SEQ ID NO:12) are provided herein.

As used herein the term ā€œGPBPpep1ā€ refers to the 26 amino acid peptide shown in SEQ ID NO:14, and includes both monomers and oligomers thereof.

As used herein, the term ā€œGP antigenā€ refers to the α3 NC1 domain of type IV collagen.

As used herein, ā€œMBPā€ refers to myelin basic protein.

In one aspect, the present invention provides isolated nucleic acids that encode GPBP, GPBPΔ26, and GPBPpep1, and mutants or fragments thereof. In one embodiment, the isolated nucleic acids comprise sequences substantially similar to SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, or SEQ ID NO:25, or fragments thereof.

In another aspect, the present invention provides isolated nucleic acids that encode alternative products of the GP antigen or MBP. In one embodiment, the isolated nucleic acids comprise sequences that encode peptides substantially similar to SEQ ID NO:43 and SEQ ID NO:44.

The phrase ā€œsubstantially similarā€ is used herein in reference to the nucleotide sequence of DNA or RNA, or the amino acid sequence of protein, having one or more conservative or non-conservative variations from the disclosed sequences, including but not limited to deletions, additions, or substitutions, wherein the resulting nucleic acid and/or amino acid sequence is functionally equivalent to the sequences disclosed herein. Functionally equivalent sequences will function in substantially the same manner to produce substantially the same protein disclosed herein. For example, functionally equivalent DNAs encode proteins that are the same as those disclosed herein or that have one or more conservative amino acid variations, such as substitution of a non-polar residue for another non-polar residue or a charged residue for a similarly charged residue. These changes include those recognized by those of skill in the art as substitutions that do not substantially alter the tertiary structure of the protein.

In practice, the term substantially similar means that DNA encoding two proteins hybridize to one another under conditions of moderate to high stringency, and encode proteins that have either the same sequence of amino acids, or have changes in sequence that do not alter their structure or function. As used herein, substantially similar sequences of nucleotides or amino acids share at least about 70% identity, more preferably at least about 80% identity, and most preferably at least about 90% identity. It is recognized, however, that proteins (and DNA or mRNA encoding such proteins) containing less than the above-described level of homology arising as splice variants or that are modified by conservative amino acid substitutions (or substitution of degenerate codons) are contemplated to be within the scope of the present invention.

Stringency of hybridization is used herein to refer to conditions under which nucleic acid hybrids are stable. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (TM) of the hybrids. TM decreases approximately 1–1.5° C. with every 1% decrease in sequence homology. In general, the stability of a hybrid is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Reference to hybridization stringency relates to such washing conditions. Thus, as used herein, moderate stringency refers to conditions that permit hybridization of those nucleic acid sequences that form stable hybrids in 0.1% SSPE at 37° C. or 55° C., while high stringency refers to conditions that permit hybridization of those nucleic acid sequences that form stable hybrids in 0.1% SSPE at 65° C. It is understood that these conditions may be duplicated using a variety of buffers and temperatures and that they are not necessarily precise. Denhardt's solution and SSPE (see, e.g., Sambrook, Fritsch, and Maniatis, in: Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989) are well known to those of skill in the art, as are other suitable hybridization buffers.

The isolated nucleic acid sequence may comprise an RNA, a cDNA, or a genomic clone with one or more introns. The isolated sequence may further comprise additional sequences useful for promoting expression and/or purification of the encoded protein, including but not limited to polyA sequences, modified Kozak sequences, and sequences encoding epitope tags, export signals, and secretory signals, nuclear localization signals, and plasma membrane localization signals.

In another aspect, the present invention provides recombinant expression vectors comprising nucleic acid sequences that express GPBP, GPBPΔ26, or GPBPpep1, and mutants or fragments thereof. In one embodiment, the vectors comprise nucleic acid sequences that are substantially similar to the sequences shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, or SEQ ID NO:25, or fragments thereof.

In another aspect, the present invention provides recombinant expression vectors comprising nucleic acid sequences that express peptides that are substantially similar to the amino acid sequence shown in SEQ ID NO:43, SEQ ID NO:44, or peptide fragments thereof.

ā€œRecombinant expression vectorā€ includes vectors that operatively link a nucleic acid coding region or gene to any promoter capable of effecting expression of the gene product. The promoter sequence used to drive expression of the disclosed nucleic acid sequences in a mammalian system may be constitutive (driven by any of a variety of promoters, including but not limited to, CMV, SV40, RSV, actin, EF) or inducible (driven by any of a number of inducible promoters including, but not limited to, tetracycline, ecdysone, steroid-responsive). The construction of expression vectors for use in transfecting prokaryotic cells is also well known in the art, and thus can be accomplished via standard techniques. (See, for example, Sambrook, Fritsch, and Maniatis, in: Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989; Gene Transfer and Expression Protocols, pp. 109–128, ed. E. J. Murray, The Humana Press Inc., Clifton, N.J.), and the Ambion 1998 Catalog (Ambion, Austin, Tex.)

The expression vector must be replicable in the host organisms either as an episome or by integration into host chromosomal DNA. In a preferred embodiment, the expression vector comprises a plasmid. However, the invention is intended to include other expression vectors that serve equivalent functions, such as viral vectors.

In a further aspect, the present invention provides host cells that have been transfected with the recombinant expression vectors disclosed herein, wherein the host cells can be either prokaryotic or eukaryotic. The cells can be transiently or stably transfected. Such transfection of expression vectors into prokaryotic and eukaryotic cells can be accomplished via any technique known in the art, including but not limited to standard bacterial transformations, calcium phosphate co-precipitation, electroporation, or liposome mediated-, DEAE dextran mediated-, polycationic mediated-, or viral mediated transfection. (See, for example, Molecular Cloning: A Laboratory Manual (Sambrook, et al., 1989, Cold Spring Harbor Laboratory Press; Culture of Animal Cells: A Manual of Basic Technique, 2nd Ed. (R. I. Freshney. 1987. Liss, Inc. New York, N.Y.),

In a still further aspect, the present invention provides substantially purified GPBP, GPBPΔ26, and GPBPpep1, and mutants or fragments thereof. In one embodiment, the amino acid sequence of the substantially purified protein is substantially similar to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or peptide fragments thereof.

In another aspect, the present invention provides substantially purified alternative products of the GP antigen and MBP. In one embodiment, the amino acid sequence of the substantially purified polypeptide is substantially similar to SEQ ID NO:43, SEQ ID NO:44, or peptide fragments thereof.

As used herein, the term ā€œsubstantially purifiedā€ means that the protein has been separated from its in vivo cellular environments. Thus, the protein can either be purified from natural sources, or recombinant protein can be purified from the transfected host cells disclosed above. In a preferred embodiment, the proteins are produced by the transfected cells disclosed above, and purified using standard techniques. (See for example, Molecular Cloning: A Laboratory Manual (Sambrook, et al., 1989, Cold Spring Harbor Laboratory Press.)) The protein can thus be purified from prokaryotic or eukaryotic sources. In various further preferred embodiments, the protein is purified from bacterial, yeast, or mammalian cells.

The protein may comprise additional sequences useful for promoting purification of the protein, such as epitope tags and transport signals. Examples of such epitope tags include, but are not limited to FLAG (Sigma Chemical, St. Louis, Mo.), myc (9E10) (Invitrogen, Carlsbad, Calif.), 6-His (Invitrogen; Novagen, Madison, Wis.), and HA (Boehringer Manheim Biochemicals). Examples of such transport signals include, but are not limited to, export signals, secretory signals, nuclear localization signals, and plasma membrane localization signals.

In another aspect, the present invention provides antibodies that selectively bind to GPBP, GPBPΔ26, or GPBPpep1. In one aspect, the antibodies selectively bind to a protein comprising a sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, or peptide fragments thereof. Such antibodies can be produced by immunization of a host animal with either the complete GPBP, or with antigenic peptides thereof. The antibodies can be either polyclonal or monoclonal.

In another aspect, the present invention provides antibodies that selectively bind to a polypeptide comprising an amino acid sequence substantially similar to a sequence selected from the group consisting of SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:54, or antigenic fragments thereof. The antibodies can be either polyclonal or monoclonal.

Antibodies can be made by well-known methods, such as described in Harlow and Lane, Antibodies; A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (1988). In one example, preimmune serum is collected prior to the first immunization. Substantially purified proteins of the invention, or antigenic fragments thereof, together with an appropriate adjuvant, is injected into an animal in an amount and at intervals sufficient to elicit an immune response. Animals are bled at regular intervals, preferably weekly, to determine antibody titer. The animals may or may not receive booster injections following the initial immunization. At about 7 days after each booster immunization, or about weekly after a single immunization, the animals are bled, the serum collected, and aliquots are stored at about āˆ’20° C. Polyclonal antibodies against the proteins and peptides of the invention can then be purified directly by passing serum collected from the animal through a column to which non-antigen-related proteins prepared from the same expression system without GPBP-related proteins bound.

Monoclonal antibodies can be produced by obtaining spleen cells from the animal. (See Kohler and Milstein, Nature 256, 495–497 (1975)). In one example, monoclonal antibodies (mAb) of interest are prepared by immunizing inbred mice with the proteins or peptides of the invention, or an antigenic fragment thereof. The mice are immunized by the IP or SC route in an amount and at intervals sufficient to elicit an immune response. The mice receive an initial immunization on day 0 and are rested for about 3 to about 30 weeks. Immunized mice are given one or more booster immunizations of by the intravenous (IV) route. Lymphocytes, from antibody positive mice are obtained by removing spleens from immunized mice by standard procedures known in the art. Hybridoma cells are produced by mixing the splenic lymphocytes with an appropriate fusion partner under conditions which will allow the formation of stable hybridomas. The antibody producing cells and fusion partner cells are fused in polyethylene glycol at concentrations from about 30% to about 50%. Fused hybridoma cells are selected by growth in hypoxanthine, thymidine and aminopterin supplemented Dulbecco's Modified Eagles Medium (DMEM) by procedures known in the art. Supernatant fluids are collected from growth positive wells and are screened for antibody production by an immunoassay such as solid phase immunoradioassay. Hybridoma cells from antibody positive wells are cloned by a technique such as the soft agar technique of MacPherson, Soft Agar Techniques, in Tissue Culture Methods and Applications, Kruse and Paterson, Eds., Academic Press, 1973.

To generate such an antibody response, the proteins of the present invention are typically formulated with a pharmaceutically acceptable carrier for parenteral administration. Such acceptable adjuvants include, but are not limited to, Freund's complete, Freund's incomplete, alum-precipitate, water in oil emulsion containing Corynebacterium parvum and tRNA. The formulation of such compositions, including the concentration of the polypeptide and the selection of the vehicle and other components, is within the skill of the art.

The term antibody as used herein is intended to include antibody fragments thereof which are selectively reactive with the proteins and peptides of the invention, or fragments thereof. Antibodies can be fragmented using conventional techniques, and the fragments screened for utility in the same manner as described above for whole antibodies. For example, F(ab′)2 fragments can be generated by treating antibody with pepsin. The resulting F(ab′)2 fragment can be treated to reduce disulfide bridges to produce Fab′ fragments.

In a further aspect, the invention provides methods for detecting the presence of the proteins or peptides of the invention in a protein sample, comprising providing a protein sample to be screened, contacting the protein sample to be screened with an antibody against the proteins or peptides of the invention, and detecting the formation of antibody-antigen complexes. The antibody can be either polyclonal or monoclonal as described above, although monoclonal antibodies are preferred. As used herein, the term ā€œprotein sampleā€ refers to any sample that may contain the proteins or peptides of the invention, and fragments thereof, including but not limited to tissues and portions thereof, tissue sections, intact cells, cell extracts, purified or partially purified protein samples, bodily fluids, nucleic acid expression libraries. Accordingly, this aspect of the present invention may be used to test for the presence of GPBP, GPBPĪ”26, GPBPpep1, or alternative products of the GP antigen in these various protein samples by standard techniques including, but not limited to, immunolocalization, immunofluorescence analysis, Western blot analysis, ELISAs, and nucleic acid expression library screening, (See for example, Sambrook et al, 1989.) In one embodiment, the techniques may determine only the presence or absence of the protein or peptide of interest. Alternatively, the techniques may be quantitative, and provide information about the relative amount of the protein or peptide of interest in the sample. For quantitative purposes, ELISAs are preferred.

Detection of immunocomplex formation between the proteins or peptides of the invention, or fragments thereof, and their antibodies or fragments thereof, can be accomplished by standard detection techniques. For example, detection of immunocomplexes can be accomplished by using labeled antibodies or secondary antibodies. Such methods, including the choice of label are known to those ordinarily skilled in the art. (Harlow and Lane, Supra). Alternatively, the polyclonal or monoclonal antibodies can be coupled to a detectable substance. The term ā€œcoupledā€ is used to mean that the detectable substance is physically linked to the antibody. Suitable detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase. Examples of suitable prosthetic-group complexes include streptavidin/biotin and avidin/biotin. Examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin. An example of a luminescent material includes luminol. Examples of suitable radioactive material include 125I, 131I, 35S or 3H.

Such methods of detection are useful for a variety of purposes, including but not limited to detecting an autoimmune condition, identifying cells targeted for or undergoing apoptosis, immunolocalization of the proteins of interest in a tissue sample, Western blot analysis, and screening of expression libraries to find related proteins.

In yet another aspect, the invention provides methods for detecting the presence in a sample of nucleic acid sequences encoding the GPBP, GPBPΔ26, GPBPpep1, or alternative products of the GP antigen comprising providing a nucleic acid sample to be screened, contacting the sample with a nucleic acid probe derived from the isolated nucleic acid sequences of the invention, or fragments thereof, and detecting complex formation.

As used herein, the term ā€œsampleā€ refers to any sample that may contain GPBP-related nucleic acid, including but not limited to tissues and portions thereof, tissue sections, intact cells, cell extracts, purified or partially purified nucleic acid samples, DNA libraries, and bodily fluids. Accordingly, this aspect of the present invention may be used to test for the presence of GPBP mRNA or DNA in these various samples by standard techniques including, but not limited to, in situ hybridization, Northern blotting, Southern blotting, DNA library screening, polymerase chain reaction (PCR) or reverse transcription-PCR (RT-PCR). (See for example, Sambrook et al, 1989.) In one embodiment, the techniques may determine only the presence or absence of the nucleic acid of interest. Alternatively, the techniques may be quantitative, and provide information about the relative amount of the nucleic acid of interest in the sample. For quantitative purposes, quantitative PCR and RT-PCR are preferred. Thus, in one example, RNA is isolated from a sample, and contacted with an oligonucleotide derived from the nucleic acid sequence of interest, together with reverse transcriptase under suitable buffer and temperature conditions to produce cDNAs from the GPBP-related RNA. The cDNA is then subjected to PCR using primer pairs derived from the nucleic acid sequence of interest. In a preferred embodiment, the primers are designed to detect the presence of the RNA expression product of SEQ ID NO:5, and the amount of GPBP gene expression in the sample is compared to the level in a control sample.

For detecting the nucleic acid sequence of interest, standard labeling techniques can be used to label the probe, the nucleic acid of interest, or the complex between the probe and the nucleic acid of interest, including, but not limited to radio-, enzyme-, chemiluminescent-, or avidin or biotin-labeling techniques, all of which are well known in the art. (See, for example, Molecular Cloning: A Laboratory Manual (Sambrook, et al., 1989, Cold Spring Harbor Laboratory Press), Gene Expression Technology (Methods in Enzymology, Vol. 185, edited by D. Goeddel, 1991. Academic Press, San Diego, Calif.); PCR Protocols: A Guide to Methods and Applications (Innis, et al. 1990. Academic Press, San Diego, Calif.)).

Such methods of nucleic acid detection are useful for a variety of purposes, including but not limited to diagnosing an autoimmune condition, identifying cells targeted for or undergoing apoptosis, in situ hybridization, Northern and Southern blot analysis, and DNA library screening.

As demonstrated in the following examples, GPBP shows preferential expression in tissue structures that are commonly targeted in naturally-occurring automimmune responses, and is highly expressed in several autoimmune conditions, including but not limited to Goodpasture Syndrome (GP), systemic lupus erythematosus (SLE), and lichen planus. Furthermore, following a similar experimental approach to that described below, recombinant proteins representing autoantigens in GP disease (α3 Type IV collagen), SLE (P1 ribosomal phosphoprotein and Sm-D1 small nuclear ribonucleoproteins) and dermatomyositis (hystididyl-tRNA synthetase) were shown to be in vitro substrates of GPBP.

Thus, in a preferred embodiment, detection of GPBP expression is used to detect an autoimmune condition. A sample that is being tested is compared to a control sample for the expression of GPBP, wherein an increased level of GPBP expression indicates the presence of an autoimmune condition. In this embodiment, it is preferable to use antibodies that selectively bind to GPBPpep1, which is present in GPBP but not in GPBPΔ26.

Furthermore, as shown in the accompanying examples, GPBP is down-regulated in tumor cell lines, and the data suggest that GPBP/GPBPΔ26 are likely to be involved in cell signaling pathways that induce apoptosis, which may be up-regulated during autoimmune pathogenesis and down-regulated during cell transformation to prevent autoimmune attack to transformed cells during tumor growth. Thus, the detection methods disclosed herein can be used to detect cells that are targeted for, or are undergoing apoptosis.

In another aspect, the present invention provides a method for treating an autoimmune disorder, a tumor, or for preventing cell apoptosis comprising modification of the expression or activity of GPBP, GPBPĪ”26, or a protein comprising a polypeptide substantially similarly to GPBPpep1 in a patient in need thereof. Modifying the expression or activity of GPBP, GPBPĪ”26, or a protein comprising a polypeptide substantially similarly to GPBPpep1 can be accomplished by using specific inducers or inhibitors of GPBP expression or activity, GPBP antibodies, gene or protein therapy using GP or myelin basic protein alternative products, cell therapy using host cells expressing GP or myelin basic protein alternative products, antisense therapy, or other techniques known in the art. In a preferred embodiment, the method further comprises administering a substantially purified alternative product of the GP antigen or MBP to modify the expression or activity of GPBP, GPBPĪ”26, or a protein comprising a polypeptide substantially similarly to GPBPpep1. As used herein, ā€œmodification of expression or activityā€ refers to modifying expression or activity of either the RNA or protein product.

In a further aspect, the present invention provides pharmaceutical compositions, comprising an amount effective of substantially purified alternative products of the GP antigen or MBP to modify the expression or activity of GPBP RNA or protein, and a pharmaceutically acceptable carrier.

For administration, the active agent is ordinarily combined with one or more adjuvants appropriate for the indicated route of administration. The compounds may be mixed with lactose, sucrose, starch powder, cellulose esters of alkanoic acids, stearic acid, talc, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulphuric acids, acacia, gelatin, sodium alginate, polyvinylpyrrolidine, and/or polyvinyl alcohol, and tableted or encapsulated for conventional administration. Alternatively, the compounds of this invention may be dissolved in saline, water, polyethylene glycol, propylene glycol, carboxymethyl cellulose colloidal solutions, ethanol, corn oil, peanut oil, cottonseed oil, sesame oil, tragacanth gum, and/or various buffers. Other adjuvants and modes of administration are well known in the pharmaceutical art. The carrier or diluent may include time delay material, such as glyceryl monostearate or glyceryl distearate alone or with a wax, or other materials well known in the art.

The present invention may be better understood with reference to the accompanying examples that are intended for purposes of illustration only and should not be construed to limit the scope of the invention, as defined by the claims appended hereto.

EXAMPLE 1

Characterization of GPBP

Here we report the cloning and characterization of a novel type of serine/threonine kinase that specifically binds to and phosphorylates the unique N-terminal region of the human GP antigen.

Materials and Methods

Synthetic polymers-Peptides. GPpep1, KGKRGDSGSPATWTTRGFVFT (SEQ ID NO:26), representing residues 3–23 of the human GP antigen and GPpep1Ala9, KGKRGDAGSPATWTTRGFVFT (SEQ ID NO:27), a mutant Ser9 to Ala9 thereof, were synthesized by MedProbe and CHIRON. FLAG peptide, was from Sigma.

Oligonucleotides. The following as well as several other GPBP-specific oligonucleotides were synthesized by Genosys and GIBCO BRL:

  • ON-GPBP-54m: TCGAATTCACCATGGCCCCACTAGCCGACTACAAGGACGACGATG ACAAG (SEQ ID NO:28).
  • ON-GPBP-55c: CCGAGCCCGACGAGTTCCAGCTCTGATTATCCGACATCTTGTCATCG TCG (SEQ ID NO:29).
  • ON-HNC-B-N-14m: CGGGATCCGCTAGCTAAGCCAGGCAAGGATGG (SEQ ID NO:30).
  • ON-HNC-B-N-16c: CGGGATCCATGCATAAATAGCAGTTCTGCTGT (SEQ ID NO:31).

Isolation and characterization of cDNA clones encoding human GPBP—Several human Ī»-gt11 cDNA expression libraries (eye, fetal and adult lung, kidney and HeLa S3, from CLONTECH) were probed for cDNAs encoding proteins interacting with GPpep1. Nitrocellulose filters (Millipore) prepared following standard immunoscreening procedures were blocked and incubated with 1–10 nmoles per ml of GPpep1 at 37° C. Specifically bound GPpep1 was detected using M3/1A monoclonal antibodies (7). A single clone was identified in the HeLa-derived library (HeLa1). Specificity of fusion protein binding was confirmed by similar binding to recombinant eukaryotic human GP antigen. The EcoRI cDNA insert of HeLa1 (0.5-kb) was used to further screen the same library and to isolate overlapping cDNAs. The largest cDNA (2.4-kb) containing the entire cDNA of HeLa1 (n4′) was fully sequenced.

Northern and Southern blots—Pre-made Northern and Southern blots (CLONTECH) were probed with HeLa1 cDNA following manufacturer instructions.

Plasmid construction, expression and purification of recombinant proteins—GPBP-derived material. The original Ī»-gt11 HeLa1 clone was expressed as a lysogen in E. Coli Y1089 (8). The corresponding β-galactosidase-derived fusion protein containing the N-terminal 150 residues of GPBP was purified from the cell lysate using an APTG-agarose column (Boehringer). The EcoRI 2.4-kb fragment of n4′ was subcloned in Bluescribe M13+ vector (Stratagene) (BS-n4′), amplified and used for subsequent cloning. A DNA fragment containing (from 5′ to 3′), an EcoRI restriction site, a standard Kozak consensus for translation initiation, a region coding for a tag peptide sequence (FLAG, DYKDDDDK (SEQ ID NO:32)), and the sequence coding for the first eleven residues of GPBP including the predicted Meti and a Ban II restriction site, was obtained by hybridizing ON-GPBP-54m and ON-GPBP-55c, and extending with modified T7 DNA polymerase (Amersham). The resulting DNA product was digested with EcoRI and BanII, and ligated with the BanII/EcoRI cDNA fragment of BS-n4′ in the EcoRI site of pHIL-D2 (Invitrogen) to produce pHIL-FLAG-n4′. This plasmid was used to obtain Muts transformants of the GS115 strain of Pichia pastoris and to express FLAG-tagged recombinant GPBP (rGPBP) either by conventional liquid culture or by fermentation procedures (Pichia Expression Kit, Invitrogen). The cell lysates were loaded onto an anti-FLAG M2 column (Sigma), the unbound material washed out with Tris buffered saline (TBS, 50 mM Tris-HCl, pH 7.4, 150 mM NaCl) or salt-supplemented TBS (up to 2M NaCl), and the recombinant material eluted with FLAG peptide. For expression in cultured human kidney-derived 293 cells (ATCC 1573-CRL), the 2.4- or 2.0-kb EcoRI cDNA insert of either BS-n4′ or pHIL-FLAG-n4′ was subcloned in pcDNA3 (Invitrogen) to produce pc-n4′ and pc-FLAG-n4′0 respectively. When used for transient expression, 18 hours after transfection the cells were lysed with 3.5–4 μl/cm2 of chilled lysis buffer (1% Nonidet P-40 or Triton-X100, 5 mM EDTA and 1 mM PMSF in TBS) with or without 0.1% SDS, depending on whether the lysate was to be used for SDS-PAGE or FLAG-purification, respectively. For FLAG purification, the lysate of four to six 175 cm2 culture dishes was diluted up to 50 ml with lysis buffer and purified as above. For stable expression, the cells were similarly transfected with pc-n4′ and selected for three weeks with 800 μg/ml of G418. For bacterial recombinant expression, the 2.0-kb EcoRI cDNA fragment of pHIL-FLAG-n4′ was cloned in-frame downstream of the glutathione S-transferase (GST)-encoding cDNA of pGEX-5x-1 (Pharmacia). The resulting construct was used to express GST-GPBP fusion protein in DH5α cells (9).

GP antigen-derived material. Human recombinant GP antigen (rGP) was produced in 293 cells using the pRc/CMV-BM40 expression vector containing the α3-specific cDNA between ON-HNC-B-N-14m and ON-HNC-B-N-16c. The expression vector is a pRc/CMV (Invitrogen)-derived vector provided by Billy G. Hudson (Kansas University Medical Center) that contains cDNA encoding an initiation Met, a BM40 signal peptide followed by a tag peptide sequence (FLAG), and a polylinker cloning site. To obtain α3-specific cDNA, a polymerase chain reaction was performed using the oligonucleotides above and a plasmid containing the previously reported α3(IV) cDNA sequence (3) as template (clone C2). For stable expression of rGP, 293 cells were transfected with the resulting construct (fα3VLC) and selected with 400 μg/ml of G418. The harvested rGP was purified using an anti-FLAG M2 column.

All the constructs were verified by restriction mapping and nucleotide sequencing.

Cell culture and DNA transfection—Human 293 cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum. Transfections were performed using the calcium phosphate precipitation method of the Profection Mammalian Transfection Systems (Promega). Stably transfected cells were selected by their resistance to G418. Foci of surviving cells were isolated, cloned and amplified.

Antibody production—Polyclonal antibodies against the N-terminal region of GPBP. Cells expressing HeLa1 Ī»-gt11 as a lysogen were lysed by sonication in the presence of Laemmli sample buffer and subjected to electrophoresis in a 7.5% acrylamide preparative gel. The gel was stained with Coomassie blue and the band containing the fusion protein of interest excised and used for rabbit immunization (10). The anti-serum was tested for reactivity using APTG-affinity purified antigen. To obtain affinity-purified antibodies, the anti-serum was diluted 1:5 with TBS and loaded onto a Sepharose 4B column containing covalently bound affinity purified antigen. The bound material was eluted and, unless otherwise indicated, used in the immunochemical studies.

Monoclonal antibodies against GPBP. Monoclonal antibodies were produced essentially as previously reported (7) using GST-GPBP. The supernatants of individual clones were analyzed for antibodies against rGPBP.

In vitro phosphorylation assays—About 200 ng of rGPBP were incubated overnight at 30° C. in 25 mM β-glycerolphosphate (pH 7.0), 0.5 mM EDTA, 0.5 mM EGTA, 8 mM MgCl2, 5 mM MnCl2, 1 mM DTT and 0.132 μM γ-32P-ATP, in the presence or absence of 0.5–1 μg of protein substrates or 10 nmoles of synthetic peptides, in a total volume of 50 μl.

In vivo phosphorylation assays—Individual wells of a 24-well dish were seeded with normal or with stably pc-n4′ transfected 293 cells. When the cells were grown to the desired density, a number of wells of the normal 293 cells were transfected with pc-FLAG-n4′. After 12 hours, the culture medium was removed, 20 μCi/well of H332PO4 in 100 μl of phosphate-free DMEM added, and incubation continued for 4 hours. The cells were lysed with 300 μl/well of TBS containing 1% Triton X-100, 2 mM EDTA, 1 mM PMSF, 50 mM NaF and 0.2 mM vanadate, and extracted with specific antibodies and Protein A-Sepharose. When anti-GPBP serum was used, the lysate was pre-cleared using pre-immune serum and Protein A-Sepharose.

In vitro dephosphorylation of rGPBP—About 1 μg of rGPBP was dephosphorylated in 100 μl of 10 mM Tris-acetate (pH 7.5), 10 mM magnesium acetate and 50 mM potassium acetate with 0.85 U of calf intestine alkaline phosphatase (Pharmacia) for 30 min at 30° C.

Renaturation assays—In-blot renaturation assays were performed using 1–5 μg of rGPBP as previously described (11).

Nucleotide sequence analysis—cDNA sequence analyses were performed by the dideoxy chain termination method using [α]35S-dATP, modified T7 DNA polymerase (Amersham) and universal or GPBP-specific primers (8–10).

32P-Phosphoamino acid analysis—Immunopurified rGPBP or HPLC gel-filtration fractions thereof containing the material of interest were phosphorylated, hydrolyzed and analyzed in one dimensional (4) or two dimensional thin layer chromatography (12). When performing two dimensional analysis, the buffer for the first dimension was formic acid:acetic acid:water (1:3.1:35.9) (pH 1.9) and the buffer for the second dimension was acetic acid:pyridine:water (2:0.2:37.8) (pH 3.5). Amino acids were revealed with ninhydrin, and 32P-phosphoamino acids by autoradiography.

Physical methods and immunochemical techniques—SDS-PAGE and Western-blotting were performed as in (4). Immunohistochemistry studies were done on human multi-tissue control slides (Biomeda, Biogenex) using the ABC peroxidase method (13).

Computer analysis—Homology searches were carried out against the GenBank and SwissProt databases with the BLAST 2.0 (14) at the NCBI server, and against the TIGR Human Gene Index database for expressed sequence tags, using the Institute for Genomic Research server. The search for functional patterns and profiles was performed against the PROSITE database using the ProfileScan program at the Swiss Institute of Bioinformatics (15). Prediction of coiled-coil structures was done at the Swiss Institute for Experimental Cancer Research using the program Coils (16) with both 21 and 28 residue windows.

Results

Molecular cloning of GPBP—To search for proteins specifically interacting with the divergent N-terminal region of the human GP antigen, a 21-residue peptide (GPpep1; SEQ ID NO:26)), encompassing this region and flanking sequences, and specific monoclonal antibodies against it were combined to screen several human cDNA expression libraries. More than 5Ɨ106 phages were screened to identify a single HeLa-derived recombinant encoding a fusion protein specifically interacting with GPpep1 without disturbing antibody binding.

Using the cDNA insert of the original clone (HeLa1), we isolated a 2.4-kb cDNA (n4′) that contains 408-bp of 5′-untranslated sequence, an open reading frame (ORF) of 1872-bp encoding 624 residues, and 109-bp of 3′-untranslated sequence (FIG. 1) (SEQ ID NO:1–2). Other structural features are of interest. First, the predicted polypeptide (hereinafter referred to as GPBP) has a large number of phosphorylatable (17.9%) and acidic (16%) residues unequally distributed along the sequence. Serine, which is the most abundant residue (9.3%), shows preference for two short regions of the protein, where it comprises nearly 40% of the amino acids, compared to an average of less than 7% throughout the rest of the polypeptide chain. It is also noteworthy that the more N-terminal, serine-rich region consists mainly of a Ser-Xaa-Yaa repeat. Acidic residues are preferentially located at the N-terminal three-quarters of the polypeptide, with nearly 18% of the residues being acidic. These residues represent only 9% in the most C-terminal quarter of the polypeptide, resulting in a polypeptide chain with two electrically opposite domains. At the N-terminus, the polypeptide contains a pleckstrin homology (PH) domain, which has been implicated in the recruitment of many signaling proteins to the cell membrane where they exert their biological activities (17). Finally, a bipartite nuclear targeting sequence (18) exists as an integral part of a heptad repeat region that meets all the structural requirements to form a coiled-coil (16).

Protein data bank searches revealed homologies almost exclusively within the approximately 100 residues at the N-terminal region harboring the PH domain. The PH domain of the oxysterol-binding protein is the most similar, with an overall identity of 33.5% and a similarity of 65.2% with GPBP. In addition, the Caenorhabditis elegans cosmid F25H2 (accession number Q93569) contains a hypothetical ORF that displays an overall identity of 26.5% and a similarity of 61% throughout the entire protein sequence, indicating that similar proteins are present in lower invertebrates. Several human expressed sequence tags (accession numbers AA287878, AA287561, AA307431, AA331618, AA040134, AA158618, AA040087, AA122226, AA158617, AA121104, AA412432, AA412433, AA282679 and N27578) possess a high degree of nucleotide identity (above 98%) with the corresponding stretches of the GPBP cDNA, suggesting that they represent human GPBP. Interestingly, the AA287878 EST shows a gap of 67 nucleotides within the sequence corresponding to the GPBP 5′-untranslated region, suggesting that the GPBP pre-mRNA is alternatively spliced in human tissues (not shown).

The distribution and expression of the GPBP gene in human tissues was first assessed by Northern blot analysis (FIG. 2, panel A). The gene is expressed as two major mRNAs species between 4.4-kb and 7.5-kb in length and other minor species of shorter lengths. The structural relationship between these multiple mRNA species is not known and their relative expression varies between tissues. The highest expression level is seen in striated muscle (skeletal and heart), while lung and liver show the lowest expression levels.

Southern blot studies analysis of genomic DNA from different species indicated that homologous genes exist throughout phylogeny (FIG. 2, panel B). Consistent with the human origin of the probe, the hybridization intensities decreased in a progressive fashion as the origin of the genomic DNA moves away from humans in evolution.

Experimental determination of the translation start site—To experimentally confirm the predicted ORF, eukaryotic expression vectors containing either the 2.4-kb of cDNA of n4′, or only the predicted ORF tagged with a FLAG sequence (FIG. 3A), were used for transient expression assays in 293 cells. The corresponding extracts were analyzed by immunoblot using GPBP- or FLAG-specific antibodies. The GPBP-specific antibodies bind to a similar major polypeptide in both transfected cells, but only the polypeptide produced by the engineered construct expressed the FLAG sequence (FIG. 3B). This located the translation start site of the n4′ cDNA at the predicted Met and confirmed the proposed primary structure. Furthermore, the recombinant polypeptides displayed a molecular mass higher than expected (80 versus 71 kDa) suggesting that GPBP undergoes post-translational modifications.

Expression and characterization of yeast rGPBP—Yeast expression and FLAG-based affinity-purification were combined to produce rGPBP (FIG. 4A). A major polypeptide of ˜89 kDa, along with multiple related products displaying lower Mr, were obtained. The recombinant material was recognized by both anti-FLAG and GPBP-specific antibodies, guaranteeing the fidelity of the expression system. Again, however, the Mr displayed by the major product was notably higher than predicted and even higher than the Mr of the 293 cell-derived recombinant material, supporting the idea that GPBP undergoes important and differential post-translational modifications. Since phosphorylatable residues are abundant in the polypeptide chain, we investigated the existence of phosphoamino acids in the recombinant materials. By using monoclonal or polyclonal (not shown) antibodies against phosphoserine (Pser), phosphothreonine (PThr) and phosphotyrosine (PTyr), we identified the presence of all three phosphoresidues either in yeast rGPBP (FIG. 4B) or in 293 cell-derived material (not shown). The specificity of the antibodies was further assessed by partially inhibiting their binding by the addition of 5–10 mM of the corresponding phosphoamino acid (not shown). This suggests that the phosphoresidue content varies depending upon the cell expression system, and that the Mr differences are mainly due to phosphorylation. Dephosphorylated yeast-derived material consistently displayed similar Mr to the material derived from 293 cells, and phosphoamino acid content correlates with SDS-PAGE mobilities (FIG. 4C). As an in vivo measurement, the phosphorylation of rGPBP in the 293 cells was assessed (FIG. 4D). Control cells (lanes 1) and cells expressing rGPBP in a stable (lanes 2) or transient (lanes 3) mode were cultured in the presence of H332PO4. Immunoprecipitated recombinant material contained 32P, indicating that phosphorylation of GPBP occurred in vivo and therefore is likely to be a physiological process.

The rGPBP is a serine/threonine kinase that phosphorylates the N-terminal region of the human GP antigen—Although GPBP does not contain the conserved structural regions required to define the classic catalytic domain for a protein kinase, the recent identification and characterization of novel non-conventional protein kinases (19–27) encouraged the investigation of its phosphorylating activity. Addition of [γ32P]ATP to rGPBP (either from yeast or 293 cells (not shown)) in the presence of Mn2+ and Mg2+ resulted in the incorporation of 32P as PSer and PThr in the major and related products recognized by both anti-FLAG and specific antibodies (FIGS. 5A and B), indicating that the affinity-purified material contains a Ser/Thr protein kinase. To further characterize this activity, GPpep1, GPpep1Ala9 (a GPpep1 mutant with Ser9 replaced by Ala), native and recombinant human GP antigens, and native bovine GP antigen were assayed (FIG. 5C). Affinity-purified rGPBP phosphorylates all human-derived material to a different extent. However, in similar conditions, no appreciable 32P-incorporation was observed in the bovine-derived substrate. The lower 32P incorporation displayed by GPpep1Ala9 when compared with GPpep1, and the lack of phosphorylation of the bovine antigen, indicates that the kinase present in rGPBP discriminates between human and bovine antigens, and that Ser9 is a target for the kinase.

Although the purification system provides high quality material, the presence of contaminants with a protein kinase activity could not be ruled out. The existence of contaminants was also suggested by the presence of a FLAG-containing 40 kDa polypeptide, which displayed no reactivity with specific antibodies nor incorporation of 32P in the phosphorylation assays (FIGS. 4A and 5A). To precisely identify the polypeptide harboring the protein kinase activity, we performed in vitro kinase renaturation assays after SDS-PAGE and Western-blotted (FIG. 6). We successfully combined the use of specific antibodies (lane 1) and autoradiographic detection of in situ 32P-incorporation (lane 2), and identified the 89 kDa rGPBP material as the primary polypeptide harboring the Ser/Thr kinase activity. The lack of 32P-incorporation in the rGPBP-derived products, as well as in the 40 kDa contaminant, further supports the specificity of the renaturation assays and locates the kinase activity to the 89 kDa polypeptide. Recently, it has been shown that traces of protein kinases intimately associated with a polypeptide can be released from the blot membrane, bind to, and phosphorylate the polypeptide during the labeling step (28). To assess this possibility in our system, we performed renaturation studies using a small piece of membrane containing the 89 kDa polypeptide, either alone or together with membrane pieces representing the different regions of the blot lane. We observed similar 32P-incorporation at the 89 kDa polypeptide regardless of the co-incubated pieces (not shown), indicating that if there are co-purified protein kinases in our sample they are not phosphorylating the 89 kDa polypeptide in the renaturation assays unless they co-migrate. Co-migration does not appear to be a concern, however, since rGPBP deletion mutants (GPBPΔ26 and R3; see below) displaying different mobilities also have kinase activities and could be similarly in-blot renatured (not shown).

Immunohistochemical localization of the novel kinase—To investigate GPBP expression in human tissues we performed immunohistochemical studies using specific polyclonal (FIG. 7) or monoclonal antibodies (not shown). Although GPBP is widely expressed in human tissues, it shows tissue and cell-specificity. In kidney, the major expression is found at the tubule epithelial cells and the glomerular mesangial cells and podocytes. At the lung alveolus, the antibodies display a linear pattern suggestive of a basement membrane localization, along with staining of pneumocytes. Liver shows low expression in the parenchyma, but high expression in biliary ducts. Expression in the central nervous system is observed in the white matter, but not in the neurons of the brain. In testis, a high expression in the spermatogonium contrasts with the lack of expression in Sertoli cells. The adrenal gland shows a higher level of expression in cortical cells versus the medullar. In the pancreas, GPBP is preferentially expressed in Langerhans islets versus the exocrine moiety. In prostate, GPBP is expressed in the epithelial cells but not in the stroma (FIG. 7). Other locations with high expression of GPBP are striated muscle, epithelial cells of intestinal tract, and Purkinje cells of the cerebellum (not shown). In general, in tissues where GPBP is highly expressed the staining pattern is mainly diffuse cytosolic. However in certain locations there is, in addition, an important staining reinforcement at the nucleus (spermatogonium), at the plasma membrane (pneumocyte, hepatocyte, prostate epithelial cells, white matter) or at the extracellular matrix (alveolus) (FIG. 7).

Discussion

Our data show that GPBP is a novel, non-conventional serine/threonine kinase. We also present evidence that GPBP discriminates between human and bovine GP antigens, and targets the phosphorylatable region of human GP antigen in vitro. Several lines of evidence indicate that the 89 kDa polypeptide is the only kinase in the affinity purified rGPBP. First, we found no differences in auto- or trans-phosphorylation among rGPBP samples purified in the presence of 150 mM, 0.5 M, 1 M or 2 M salt (not shown), suggesting that rGPBP does not carry intimately bound kinases. Second, there is no FLAG-containing, yeast-derived kinase in our samples, since material purified using GPBP-specific antibodies shows no differences in phosphorylation (not shown). Third, a deletion mutant (GPBPΔ26; see below) displays reduced auto- and trans-phosphorylation activities (not shown), demonstrating that the 89 kD polypeptide is the only portion of the rGPBP with the ability to carry out phosphate transfer.

Although GPBP is not homologous to other non-conventional kinases, they share some structural features including an N-terminal α-helix coiled-coil (26, 27), serine-rich motifs (24), high phosphoamino acids content (27), bipartite nuclear localization signal (27), and the absence of a typical nucleotide or ATP binding motif (24, 27).

Immunohistochemistry studies show that GPBP is a cytosolic polypeptide also found in the nucleus, associated with the plasma membrane and likely at the extracellular matrix associated with the basement membrane, indicating that it contains the structural requirements to reach all these destinations. The nuclear localization signal and the PH domain confer to it the potential to reach the nucleus and the cell membrane, respectively (17, 29, 30). Although GPBP does not contain the structural requirements to be exported, the 5′-end untranslated region of its mRNA includes an upstream ORF of 130 residues with an in-frame stop codon at the beginning (FIG. 1). A mRNA editing process inserting a single base pair (U) would generate an operative in-frame start site and an ORF of 754-residues containing an export signal immediately downstream of the edited Met (not shown). Polyclonal antibodies against a synthetic peptide representing part of this hypothetical extra-sequence (PRSARCQARRRRGGRTSS (SEQ ID NO:33)) display a linear vascular reactivity in human tissues suggestive of an extracellular basement membrane localization (data not shown).

Alternatively, a splicing phenomenon could generate transcripts with additional unidentified exon(s) that would provide the structural requirements for exportation. The multiple cellular localization, the high content in PTyr, and the lack of tyrosine kinase activity in vitro, suggest that GPBP is itself the target of specific tyrosine kinase(s) and therefore likely involved in specific signaling cascade(s).

As discussed above, specific serine phosphorylation, as well as pre-mRNA alternative splicing, are associated with the biology of several autoantigens, including the GP antigen, acetylcholine receptor and myelin basic protein (MBP) (4). The latter is suspected to be the major antigen in multiple sclerosis (MS), another exclusively human autoimmune disease in which the immune system targets the white matter of the central nervous system. GP disease and MS are human disorders that display a strong association with the same HLA class II haplotype (HLA DRB1*1501)(32, 33). This, along with the recent report of death by GP disease of a MS patient carrying this HLA specificity (34), supports the existence of common pathogenic events in these human disorders.

Phosphorylation of specific serines has been shown to change intracellular proteolysis (35–40). Conceivably, alterations in protein phosphorylation can affect processing and peptide presentation, and thus mediate autoimmunity. GP antigen-derived peptide presentation by the HLA-DR15 depends more on processing than on preferences of relatively indiscriminate DR15 molecules (41), suggesting that if processing is influenced by abnormal phosphorylation, the resulting peptides would likely be presented by this IHLA. Our more recent data indicate that in both the GP and MBP systems, the production of alternative splicing products serves to regulate the phosphorylation of specific and structurally homologous PKA sites, suggesting that this or a closely related kinase is the in vivo phosphorylating enzyme. Alterations in the degree of antigen phosphorylation, caused either by an imbalance in alternative products, or by the action of an intruding kinase that deregulates phosphorylation of the same motifs, could lead to an autoimmune response in predisposed individuals. rGPBP phosphorylates the human GP antigen at a major PKA phosphorylation site in an apparently unregulated fashion, since the presence of specific alternative products of the GP antigen did not affect phosphorylation of the primary antigen by GPBP (not shown).

Although GPBP is ubiquitously expressed, in certain organs and tissues it shows a preference for cells and tissue structures that are target of common autoimmune responses: the Langerhans cells (type I diabetes); the white matter of the central nervous system (multiple sclerosis); the biliary ducts (primary biliary cirrhosis); the cortical cells of the adrenal gland (Addison disease); striated muscle cells (myasthenia gravis); spermatogonium (male infertility); Purkinje cells of the cerebellum (paraneoplasic cerebellar degeneration syndrome); and intestinal epithelial cells (pernicious anemia, autoimmune gastritis and enteritis). All the above observations point to this novel kinase as an attractive candidate to be considered when envisioning a model for human autoimmune disease.

REFERENCES FOR THE BACKGROUND AND EXAMPLE 1

  • 1 Saus, J. (1998) Goodpasture's Syndrome. Encyclopedia of Immunology, 2nd Ed., Delves, P. J., and Roitt, I. M. Eds., Academic Press Limited, London, UK
  • 2 Leinonen, A., Mariyama, M., Mochizuki, T., Tryggvason, K., and Reeders, S. T. (1994) J. Biol. Chem. 269, 26172–26177
  • 3 Quinones, S., Bernal, D., GarcĆ­a-Sogo, M., Elena, S. F., and Saus, J. (1992) J. Biol. Chem. 267, 19780–19784
  • 4 Revert, F., PenadĆ©s J. R., Plana, M., Bernal, D., Johansson, C., Itarte, E., Cervera, J., Wieslander, J., Quinones, S., and Saus, J. (1995) J. Biol. Chem. 270, 13254–13261
  • 5 Bernal, D., Quinones, S., and Saus, J. (1993) J. Biol. Chem. 268,12090–12094
  • 6 Feng, L., Xia, Y., and Wilson, C. B. (1994) J. Biol. Chem. 269, 2342–2348
  • 7 PenadĆ©s, J. R., Bernal, D., Revert, F., Johansson, C., Fresquet, V. J., Cervera, J., Wieslander, J., Quinones, S., and Saus, J. (1995) Eur. J. Biochem. 229, 754–760
  • 8 Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  • 9 Coligan, J. E., Dunn, B. N., Ploegh, H. L., Speicher, D. W., and Winfield, P. T. (1995–97) Current Protocols in Protein Science, John Wiley & Sons Eds., New York, N.Y.
  • 10 Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Deidman, J. G., Smith, J. A., and Struhl, K. (1994–98) Current Protocols in Molecular Biology, John Wiley & Sons Eds., New York, N.Y.
  • 11 Ferrel, J. E., and Martin, G. S. (1991) Methods in Enzymology 200, 430–435
  • 12 Boyle, W. J., van der Geer, P., and Hunter, T. (1991) Methods in Enzymology 201, 110–149
  • 13 Hsu, S. M., Raine, L., and Fanger, H. (1981) J. Histochem. Cytochem. 29, 577–580
  • 14 Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Nucleic Acids Res. 25, 3389–3402
  • 15 Bairoch, A., Bucher, P., and Hofmann, K. (1997) Nucleic Acids Res. 25, 217–221
  • 16 Lupas, A. (1996) Trends Biochem. Sci. 21, 375–382
  • 17 Lemmon, M. A., Falasca, M., Ferguson, K. M., and Schlessinger, J. (1997) Trends Cell Biol. 7, 237–242
  • 18 Boulikas, T. (1993) Crit. Rev. Eukaryot. Gene Expr. 3, 193–227
  • 19 Csermely, P., and Kahn, C. R. (1991) J. Biol. Chem. 266,4943–4950
  • 20 Maru, Y., and Witte, O. N.(1991) Cell 67, 459–468
  • 21 Beeler, J. F., LaRochelle, W. J., Chedid, M., Tronick, S. R., and Aaronson, S. A. (1994) Mol. Cell. Biol. 14, 982–988
  • 22 Csermely, P., Miyata, Y., Schnaider, T., and Yahara, I. (1995) J. Biol. Chem. 270, 6381-6388
  • 23 Dikstein, R., Ruppert, S., and Tjian, R. (1996) Cell 84, 781–790
  • 24 Eichinger, L., Bomblies, L., Vandekerckhove, J., Schleicher, M., and Gettermans, J. (1996) EMBO J. 15, 5547–5556
  • 25 CĆ“tĆ©, G. P., Luo, X., Murphy, M. B., and Egelhoff, T. T.(1997) J. Biol. Chem. 272, 6846-6849
  • 26 Ryazanov, A. G., Ward, M. D., Mendola, C. E., Pavur, K. S., Dorovkov, M. V., Wiedmann, M., Erdjument-Bromage, H., Tempst, P., Parmer, T. G., Prostko, C. R., Germino, F. J., and Hait, W. N. (1997) Proc. Natl. Acad. Sci. USA 94,4884–4889
  • 27 Fraser, R. A., Heard, D. J., Adam, S., Lavigne, A. C., Le Douarin, B., Tora, L., Losson, R., Rochette-Egly, C., and Chambon, P. (1998) J. Biol. Chem. 273, 16199–16204
  • 28 Langelier, Y., Champoux, L., Hamel, M., Guilbault, C., Lamarche, N., Gaudreau, P., and Massie, B.(1998) J. Biol. Chem. 273, 1435–1443
  • 29 Lemmon, M. A., and Ferguson, K. M. (1998) Curr. Top. Microbiol. Immunol. 228, 39–74
  • 30 Rebecchi, M. J., and Scarlata, S. (1998) Annu. Rev. Biophys. Biomol. Struct. 27, 503–528
  • 31 Roitt, I. (1994) Autoimmune diseases in Essential Immunology, 383–439, 8th Ed., Blackwell Scientific, Oxford, UK
  • 32 Erlich, H., and Apple, R. (1998) MHC disease associations. Encyclopedia of Immunology, 2nd Ed., Delves, P. J., and Roitt, I. M. Eds., Academic Press Limited, London, UK
  • 33 Phelps, R. G., Turner, A. N., and Rees, A. J.(1996) J. Biol. Chem. 271, 18549–18553
  • 34 Henderson, R. D., Saltissi, D., and Pender, M. P.(1998) Acta Neurol. Scand. 98, 134–135
  • 35 Litersky, J. M., and Johnson, G. V. W. (1992) J. Biol. Chem. 267, 1563–1568.
  • 36 Brown, K., Gerstberger, S., Carlson, L., Franzoso, G., and Siebenlist, U. (1995) Science 267, 1485–1488
  • 37 Chen, Z. J., Parent, L., and Maniatis, T. (1996) Cell 84, 853–862
  • 38 Aberle, H., Bauer, A., Stappert, J., Kispert, A., and Kemler, R. (1997) EMBO J. 16, 3797-3804
  • 39 Regnier, C. H., Song, H. Y., Gao, X., Goeddel, D. V., Cao, Z., and Rothe, M. (1997) Cell 90, 373–383
  • 40 Vlach, J., Hennecke, S., and Amati, B. (1997) EMBO J. 16, 5334–5344
  • 41 Phelps, R. G., Jones, V. L., Coughlan, M., Turner, A. N., and Rees, A. J. (1998) J. Biol. Chem. 273, 11440–11447

EXAMPLE 2

GPBP Alternative Splicing

Here we report the existence of two isoforms of GPBP that are generated by alternative splicing of a 78-base pair (bp) long exon that encodes a 26-residue serine-rich motif. Both isoforms, GPBP and GPBPΔ26, exist as high molecular aggregates that result from polypeptide self-aggregation. The presence of the 26-residue peptide in the polypeptide chain results in a molecular species that self-interacts more efficiently and forms aggregates with higher specific activity. Finally, we present evidences supporting the observation that GPBP is implicated in human autoimmune pathogenesis.

Material and Methods.

Synthetic Polymers:

Peptides. GPpep1, KGKRGDSGSPATWTTRGFVFT (SEQ ID NO:26), is described in Example 1. GPBPpep1, PYSRSSSMSSIDLVSASDDVHRFSSQ (SEQ ID NO:14), representing residues 371–396 of GPBP was synthesized by Genosys.

Oligonucleotides. The following oligonucleotides were synthesized by Life Technologies, Inc., 5′ to 3′: ON-GPBP-11m, G CGG GAC TCA GCG GCC GGA TTT TCT (SEQ ID NO:34); ON-GPBP-15m, AC AGC TGG CAG AAG AGA C (SEQ ID NO:35); ON-GPBP-20c, C ATG GGT AGC TTT TAA AG (SEQ ID NO; 36); ON-GPBP-22m, TA GAA GAA CAG TCA CAG AGT GAA AAG G (SEQ ID NO;37); ON-GPBP-53c, GAATTC GAA CAA AAT AGG CTT TC (SEQ ID NO:38); ON-GPBP-56m, CCC TAT AGT CGC TCT TC (SEQ ID NO:39); ON-GPBP-57c, CTG GGA GCT GAA TCT GT (SEQ ID NO:40); ON-GPBP-62c, GTG GTT CTG CAC CAT CTC TTC AAC (SEQ ID NO:41); ON-GPBP-Ī”26, CA CAT AGA TTT GTC CAA AAG GTT GAA GAG ATG GTG CAG AAC (SEQ ID NO:42).
Reverse transcriptase and polymerase chain rection (RT-PCR). Total RNA was prepared from different control and GP tissues as described in (15). Five micrograms of total RNA was retrotranscribed using Ready-To-Go You-Prime First-Strand beads (Amersham Pharmacia Biotech) and 40 pmol of ON-GPBP-53c. The corresponding cDNA was subjected to PCR using the pairs of primers ON-GPBP-11m/ON-GPBP-53c or ON-GPBP-15m/ON-GPBP-62c. The identity of the products obtained with 15m-62c was further confirmed by Alu I restriction. To specifically amplify GPBP transcripts, PCR was performed using primers ON-GPBP-15m/ON-GPBP-57c.
Northern hybridization studies. Pre-made human multiple-tissue and tumor cell-line Northern Blots (CLONTECH) were probed with a cDNA containing the 78-bp exon present only in GPBP or with a cDNA representing both isoforms. The corresponding cDNAs were obtained by PCR using the pair of primers ON-GPBP-56m and ON-GPBP-57c using GPBP as a template, or with primers ON-GPBP-22m and ON-GPBP-20c, using GPBPΔ26 as a template. The resulting products were random-labeled and hybridized following the manufacturers' instructions.
Plasmid construction, expression and purification of recombinant proteins. The plasmid pHIL-FLAG-n4′, used for recombinant expression of FLAG-tagged GPBP in Pichia pastoris has been described elsewhere (4). The sequence coding for the 78-bp exon was deleted by site-directed mutagenesis using ON-GPBP-Ī”26 to generate the plasmid pHIL-FLAG-n4′Δ26. Expression and affinity-purification of recombinant GPBP and GPBPĪ”26 was done as in (4).
Gel-filtration HPLC. Samples of 250 μl were injected into a gel filtration PE-TSK-G4000SW HPLC column equilibrated with 50 mM Tris-HCl pH 7.5, 150 mM NaCl. The material was eluted from the column at 0.5 ml/min, monitored at 220 nm and minute fractions collected.
In vitro phosphorylation assays. The auto-, trans-phosphorylation and in-blot renaturation studies were performed as in Example 1.
Antibodies and immunochemical techniques. Polyclonal antibodies were raised by in chicken against a synthetic peptide (GPBPpep1) representing the sequence coded by the 78-bp exon (Genosys). Egg yolks were diluted 1:10 in water, the pH adjusted to 5.0. After 6 hours at 4° C., the solution was clarified by centrifugation (25 min at 10000Ɨg at 4° C.) and the antibodies precipitated by adding 20% (w/v) of sodium sulfate at 20.000Ɨg, 20′. The pellets were dissolved in PBS (1 ml per yolk) and used for immunohistochemical studies. The production of antibodies against GPBP/GPBPĪ”26 or against α3(IV)NC1 domain are discussed above (see also 4, 13).
Sedimentation velocity. Determination of sedimentation velocities were performed in an Optima XL-A analytical ultracentrifuge (Beckman Instruments Inc.), equipped with a VIS-UV scanner, using a Ti60 rotor and double sector cells of Epon-charcoal of 12 mm optical path-length. Samples of ca. 400 μl were centrifuged at 30,000 rpm at 20° C. and radial scans at 220 nm were taken every 5 min. The sedimentation coefficients were obtained from the rate of movement of the solute boundary using the program XLAVEL (supplied by Beckman).
Sedimentation equilibrium. Sedimentation equilibrium experiments were done as described above for velocity experiments with samples of 70 μl, and centrifuged at 8,000 rpm. The experimental concentration gradients at equilibrium were analyzed using the program EQASSOC (Beckman) to determine the corresponding weight average molecular mass. A partial specific volumes of 0.711 cm3/g for GPBP and 0.729 cm3/g for GPBPĪ”26 were calculated from the corresponding amino acid compositions.
Physical methods and immunochemical techniques. SDS-PAGE and Western blotting were performed under reducing conditions as previously described (3). Immunohistochemistry studies were done on formalin fixed paraffin embedded tissues using the ABC peroxidase method (4) or on frozen human biopsies fixed with cold acetone using standard procedures for indirect immunofluorescence.
Two hybrid studies. Self-interaction studies were carried out in Saccharomyces cerevisiae (HF7c) using pGBT9 and pGAD424 (CLONTECH) to generate GAL4 binding and activation domain-fusion proteins, respectively. Interaction was assessed following the manufacture's recommendations. β-galactosidase activity was assayed with X-GAL (0.75 mg/ml) for in situ and with ortho-nitrophenyl β-D galactopyranoside (0.64 mg/ml) for the in-solution determinations.
Results

Identification of two spliced GPBP variants. To characterize the GPBP species in normal human tissues, we coupled reverse transcription to a polymerase chain reaction (RT-PCR) on total RNA from different tissues, using specific oligonucleotides that flank the full open reading frame of GPBP. A single cDNA fragment displaying lower size than expected was obtained from skeletal muscle-derived RNA (FIG. 8A), and from kidney, lung, skin, or adrenal gland-derived RNA (not shown). By combining nested PCR re-amplifications and endonuclease restriction mapping, we determined that all the RT-PCR products corresponded to the same molecular species (not shown). We fully sequenced the 2.2-Kb of cDNA from human muscle and found it identical to HeLa-derived material except for the absence of 78-nucleotides (positions 1519–1596), which encode a 26-residues motif (amino acids 371–396) (FIG. 8B). We therefore named this more common isoform of GPBP as GPBPĪ”26.

To investigate whether the 78-bp represent an exon skipped transcript during pre-mRNA processing, we used this cDNA fragment to probe a human-derived genomic library and we isolated a ˜14-Kb clone. By combining Southern blot hybridization and PCR, the genomic clone was characterized and a contiguous DNA fragment of 12482-bp was fully sequenced (SEQ ID 25). The sequence contained (from 5′ to 3′), 767-bp of intron sequence, a 93-bp exon, an 818-bp intron, the 78-bp exon sequence of interest, a 9650-bp intron, a 96-bp exon and a 980-bp intron sequence (FIG. 8C). The exon-intron boundaries determined by comparing the corresponding DNA and cDNA sequences meet the canonical consensus for 5′ and 3′ splice sites (FIG. 8C) (5), thus confirming the exon nature of the 78-bp sequence. The GPBP gene was localized to chromosome 5q13 by fluorescence in situ hybridization (FISH) using the genomic clone as a probe (not shown).

The relative expression of GPBP in human-derived specimens was assessed by Northern blot analysis, using either the 78-bp exon or a 260-bp cDNA representing the flanking sequence of 78-bp (103-bp 5′ and 157-bp 3′) present in both GPBP and GPBPĪ”26 (FIG. 9). The 78-bp containing the molecular species of interest were preferably expressed in striated muscle (both skeletal and heart) and brain, and poorly expressed in placenta, lung and liver. In contrast to GPBPĪ”26, the GPBP was expressed at very low levels in kidney, pancreas and cancer cell lines.

All the above indicates that GPBP is expressed at low levels in normal human tissues, and that the initial lack of detection by RT-PCR of GPBP can be attributed to a preferential amplification of the more abundant GPBPΔ26. Indeed, the cDNA of GPBP could be amplified from human tissues (skeletal muscle, lung, kidney, skin and adrenal gland) when the specific RT-PCR amplifications were done using 78-bp exon-specific oligonucleotides (not shown). This also suggests that GPBPΔ26 mRNA is the major transcript detected in Northern blot studies when using the cDNA probe representing both GPBP and GPBPΔ26.

Recombinant expression and functional characterization of GPBPΔ26. To investigate whether the absence of the 26-residue serine-rich motif would affect the biochemical properties of GPBP, we expressed and purified both isoforms (rGPBP and rGPBPΔ26), and assessed their auto- and trans-phosphorylation activities (FIG. 10). As reported above for rGPBP (see also 4), rGPBPΔ26 is purified as a single major polypeptide and several related minor products (FIG. 10A). However, the number and relative amounts of the derived products vary compared to rGPBP, and they display Mr on SDS-PAGE that cannot be attributed simply to the 26-residue deletion. This suggests that the 26-residue motif has important structural and functional consequences that could account for the reduced in-solution auto- and trans-phosphorylation activities displayed by rGPBPΔ26 (FIG. 10B). Interestingly, the differences in specific activity shown in the in-solution assays were not evident when autophosphorylation was assessed in-blot after SDS-PAGE and renaturation, suggesting that the 26-residue motif likely has important functional consequences at the quaternary structure level. Renaturation studies further showed that phosphate transfer activities reside in the major polypeptides representing the proposed open reading frames, and are not detectable in derived minor products.

rGPBP and rGPBP-26 exist as very active high molecular weight aggregates. Gel filtration analysis of affinity-purified rGPBP or rGPBPĪ”26 yielded two chromatographic peaks (I and II), both displaying higher MW than expected for the individual molecular species, as determined by SDS-PAGE studies (89 kDa and 84 kDa, respectively ) (FIG. 11). The bulk of the recombinant material eluted as a single peak between the 158 kDa and the 669 kDa molecular weight markers (peak II), while limited amounts of rGPBP and only traces of rGPBPĪ”26 eluted in peak I (>1000 kDa). Aliquots of fractions representing each chromatographic profile were subjected to SDS-PAGE and stained, or incubated in the presence of 32P[γ] ATP, and analyzed by immunoblot and autoradiography. Along with the major primary polypeptide, every chromatographic peak contained multiple derived products of higher or lower sizes indicating that the primary polypeptide associates to form high molecular weight aggregates that are stabilized by covalent and non-covalent bonds (not shown). The kinase activity also exhibited two peaks coinciding with the chromatographic profiles. However, peak I showed a much higher specific activity than peak II, indicating that these high molecular weight aggregates contained a much more active form of the kinase. Equal volumes of rGPBP fractions number 13 and 20 exhibited comparable phosphorylating activity, even though the protein content is approximately 20 times lower in fraction 13, as estimated by Western blot and Coomasie blue staining (FIG. 11A). The specific activities of rGPBP and rGPBPĪ”26 at peak II are also different, and are consistent with the studies shown for the whole material, thus supporting the hypothesis that the presence of the 26-rediue serine-rich motif renders a more active kinase. These results also suggest that both rGPBP and rGPBPĪ”26 exist as oligomers under native conditions, and that both high molecular weight aggregate formation and specific activity are greatly dependent on the presence of the 26-residue serine-rich motif. Analytical centrifugation analysis of rGPBP revealed that peak I contained large aggregates (over 107 Da). Peak II of rGPBP contained a homogenous population of 220±10 kDa aggregates, likely representing trimers with a sedimentation coefficient of 11S. Peak II of rGPBPĪ”26 however consisted of a more heterogenous population that likely contains several oligomeric species. The main population (ca. 80%) displayed a weight average molecular mass of 310±10 kDa and a coefficient of sedimentation of 14S.

GPBP and GPBPĪ”26 self-interact in a yeast two-hybrid system. To assess the physiological relevance of the self-aggregation, and to determine the role of the 26-residue motif, we performed comparative studies using a two-hybrid interaction system in yeast. In this type of study, the polypeptides whose interaction is under study are expressed as a part of a fusion protein containing either the activation or the binding domains of the transcriptional factor GAL4. An effective interaction between the two fusion proteins through the polypeptide under study would result in the reconstitution of the transcriptional activator and the subsequent expression of the two reporter genes, Lac Z and His3, allowing colony color detection and growth in a His-defective medium, respectively. We estimated the intensity of interactions by the growth-rate in histidine-defective medium, in the presence of different concentrations of a competitive inhibitor of the His3 gene product (3-AT), and a quantitative colorimetric liquid β-galactosidase assay. A representative experiment is presented in FIG. 12. When assaying GPBPĪ”26 for self-interaction, a significant induction of the reporter genes was observed, while no expression was detectable when each fusion protein was expressed alone or with control fusion proteins. The insertion of the 26-residue motif in the polypeptide to obtain GPBP resulted in a notable increase in polypeptide interaction. All of the above data indicate that GPBPĪ”26 self-associates in vivo, and that the insertion of the 26-residues into the polypeptide chain yields a more interactive molecular species.

GPBP is highly expressed in human but not in bovine and murine glomerulus and alveolus. We have shown that GPBP/GPBPĪ”26 is preferentially expressed in human cells and tissues that are commonly targeted in naturally occurring autoimmune responses. To specifically investigate the expression of GPBP, we raised polyclonal antibodies against a synthetic peptide representing the 26-residue motif characteristic of this kinase isoform, and used it for immunohistochemical studies on frozen or formalin fixed paraffin embedded human tissues (FIG. 13). In general, these antibodies showed more specificity than the antibodies recognizing both isoforms for the tissue structures that are target of autoimmune responses such as the biliary ducts, the Langerhans islets or the white matter of the central nervous system (not shown). Nevertheless, the most remarkable finding was the presence of linear deposits of GPBP-selective antibodies around the small vessels in every tissue studied (A), suggesting that GPBP is associated with endothelial basement membranes. Consequently, at the glomerulus, the anti-GPBP antibodies displayed a vascular pattern closely resembling the glomerular basement membrane staining yielded either by monoclonal antibodies specifically recognizing the α3(IV)NC1 (compare 13B with 13C and 13D), or by circulating GP autoantibodies (compare 13E and 13F). These observations further supported the initial observation that GPBP is expressed in tissue structures targeted in natural autoimmune responses, suggesting that the expression of GPBP is a risk factor and makes the host tissue vulnerable to an autoimmune attack.

To further assess this hypothesis, we investigated the presence of GPBP and GPBPĪ”26 in the glomerulus of two mammals that naturally do not undergo GP disease compared to human (FIG. 14). GPBP-specific antibodies failed to stain the glomerulus of both bovine or murine specimens (compare 14A with 14B and 14C) while antibodies recognizing the N-terminal sequence common to both GPBP and GPBPĪ”26 stained these structures in all three species, although with different distributions and intensities (14D–14F). In bovine renal cortex, GPBPĪ”26 was expressed at a lower rate than in human, but showed similar tissue distribution. In murine samples, however, GPBPĪ”26 displayed a tissue distribution closely resembling that of GPBP in human glomerulus. Similar results were obtained when studying the alveolus in the three different species (not shown). To rule out that the differences in antibody detection was due to primary structure differences rather than to a differential expression, we determined the corresponding primary structures in these two species by cDNA sequencing. Bovine and mouse GPBP (SEQ ID NOS:3–6 and 9–12) displayed an overall identity with human material of 97.9% and 96.6% respectively. Furthermore, the mouse 26-residue motif was identical to human while bovine diverged only in one residue. Finally, and similarly to human, we successfully amplified GPBP cDNA from mouse or bovine kidney total RNA using oligonucleotides specific for the corresponding 78-bp exons, indicating that GPBP is expressed at very low levels not detectable by immunochemical techniques.

GPBP is highly expressed in several autoimmune conditions. We analyzed several tissues from different GP patients by specific RT-PCR to assess GPBP/GPBPΔ26 mRNA levels. As in control kidneys, the major expressed isoform in GP kidneys was GPBPΔ26. However, in the muscle of one of the patients, GPBP was preferentially expressed, whereas GPBPΔ26 was the only isoform detected in control muscle samples (FIG. 15A). Since we did not have kidney samples from this particular patient, we could not assess GPBP/GPBPΔ26 expression in the corresponding target organ. For similar reasons, we could not assess GPBP/GPBPΔ26 levels in the muscle of the patients in which kidneys were studied. Muscle cells express high levels of GPBP/GPBPΔ26 (see Northern blot in FIG. 9), and they comprise the bulk of the tissue. In contrast, the expression of GPBP/GPBPΔ26 in the kidney was much less, and the glomerulus was virtually the only kidney structure expressing the GPBP isoform (see FIG. 13). The glomerulus is a relatively less abundant structure in kidney than the myocyte is in muscle, and the glomerulus is the structure targeted by immune attack in GP pathogenesis. These factors, together with the preferential amplification of the more abundant and shorter messages when performing RT-PCR studies, could account for the lack of detection of GPBP in both normal and GP kidneys, thus precluding the assessment of GPBP expression at the glomerulus during pathogenesis. Nevertheless, the increased levels of GPBP in a GP patient suggest that GPBP/GPBPΔ26 expression is altered during GP pathogenesis, and that augmented GPBP expression has a pathogenic significance in GP disease.

To investigate the expression of GPBP and GPBPΔ26 in autoimnune pathogenesis, we studied cutaneous autoimmune processes and compared them with control samples representing normal skin or non-autoimmune dermatitis (FIG. 15). Control samples displayed a limited expression of GPBP in the most peripheral keratinocytes (15B, 15E), while keratinocytes expanding from stratum basale to corneum expressed abundant GPBP in skin affected by systemic lupus erythematosus (SLE) (15C, 15F) or lichen planus (15D, 15G). GPBP was preferentially expressed in cell surface structures that closely resembled the blebs previously described in cultured keratinocytes upon UV irradiation and apoptosis induction (6). In contrast, antibodies recognizing both GPBP and GPBPΔ26 yielded a diffuse cytosolic pattern through the whole epidermis in both autoimmune affected or control samples (not shown). These data indicate that in both control and autoimmune-affected keratinocytes, GPBPΔ26 was expressed at the cytosol and that the expression did not significantly vary during cell differentiation. In contrast, mature keratinocytes were virtually the only GPBP expressing cells. However, bleb formation and expression of GPBP was observed in the early stages of differentiation in epidermis affected by autoimmune responses (15C, 15D, 15F, 15G). This further supports previous observations indicating that aberrant apoptosis at the basal keratinocytes is involved in the pathogenesis of autoimmune processes affecting skin (7), and suggests that apoptosis and GPBP expression are linked in this human cell system.

Discussion

Alternative pre-mRNA splicing is a fundamental mechanism for differential gene expression that has been reported to regulate the tissue distribution, intracellular localization, and function of different protein kinases (8–11). In this regard, and closely resembling GPBP, B-Raf exists as multiple spliced variants, in which the presence of specific exons renders more interactive, efficient and oncogenic kinases (12).

Although it is evident that rGPBPĪ”26 still bears the uncharacterized catalytic domain of this novel kinase, both auto- and trans-phosphorylating activities are greatly reduced when compared to rGPBP. Gel filtration and two hybrid experiments provide some insights into the mechanisms that underlie such a reduced phosphate transfer activity. About 1–2% of rGPBP is organized in very high molecular weight aggregates that display about one third of the phosphorylating activity of rGPBP, indicating that high molecular aggregation renders more efficient quaternary structures. Recombinant GPBPĪ”26, with virtually no peak I material, consistently displayed a reduced kinase activity. However, aggregation does not seem to be the only mechanism by which the 26-residues increases specific activity, since the rGPBPĪ”26 material present in peak II also shows a reduced phosphorylating activity when compared to homologous fractions of rGPBP. One possibility is that rGPBP-derived aggregates display higher specific activities because of quaternary structure strengthening caused by the insertion of the 26-residue motif. The oligomers are kept together mainly by very strong non-covalent bonds, since the bulk of the material appears as a single polypeptide in non-reducing SDS-PAGE, and the presence of either 8 M urea or 6 M guanidine had little effect on chromatographic gel filtration profiles (not shown). How the 26-residue motif renders a more strengthened and active structure remains to be clarified. Conformational changes induced by the presence of an exon encoded motif that alter the activation status of the kinase have been proposed for the linker domain of the Src protein (24) and exons 8b and 10 of B-Raf (12). Alternatively, the 26-residue motif may provide the structural requirements such as residues whose phosphorylation may be necessary for full activation of GPBP.

We have reported (13) that the primary structure of the GP antigen (α3(IV)NC1) is the target of a complex folding process yielding multiple conformers. Isolated conformers are non-minimum energy structures specifically activated by phosphorylation for supramolecular aggregation and likely quaternary structure formation. In GP patients, the α3(IV)NC1 shows conformational alterations and a reduced ability to mediate the disulfide stabilization of the collagen IV network. The GP antibodies, in turn, demonstrate stronger affinity towards the patient α3(IV)NC1 conformers, indicating that conformationally altered material caused the autoimmune response. Therefore, it seems that in GP disease an early alteration in the conforming process of the α3(IV)NC1 could generate altered conformers for which the immune system is not tolerant, thus mediating the autoimmune response.

Other evidence (Raya et al., unpublished results) indicates that phosphorylation is the signal that drives the folding of the αc3(IV)NC1 into non-minimum energy ends. In this scenario, three features of the human α3(IV)NC1 system are of special pathogenic relevance when compared to the corresponding antigen systems from species that, like bovine or murine, do not undergo spontaneous GP disease. First, the N-terminus of the human α3(IV)NC1 contains a motif that is phosphorylatable by PKA and also by GPBP (see above, and also 2–4). Second, the human gene generates multiples alternative products by alternative exon splicing (14,15). Exon skipping generates alternative products with divergent C-terminal ends that up-regulate the in vitro PKA phosphorylation of the primary α3(IV)NC1 product (See below Example 3). Third, the human GPBP is expressed associated with glomerular and alveolar basement membranes, the two main targets in GP disease. The phosphorylation-dependent conforming process is also a feature of non-pathogenic NC1 domains (13), suggesting that the phosphorylatable N-terminus, the alternative splicing diversification, and the expression of GPBP at the glomerular and alveolar basement membranes, are all exclusively human features that place the conformation process of α3(IV)NC1 in a vulnerable condition. The four independent GP kidneys studied expressed higher levels of GP antigen alternative products (15; Bernal and Saus, unpublished results), and an augmented expression of GPBP were found in a GP patient (see above). Both increased levels of alternative GP antigen products and GPBP are expected to have consequences in the phosphorylation-dependent conformational process of the α3(IV)NC1, and therefore with pathogenic potential.

GPBP is highly expressed in skin targeted by natural autoimmune responses. In the epidermis, GPBP is associated with cell surface blebs characteristic of the apoptosis-mediated differentiation process that keratinocytes undergo during maturation from basale to corneum strata (22, 23). Keratinocytes from SLE patients show a remarkably heightened sensitivity to UV-induced apoptosis (6, 18, 20), and augmented and premature apoptosis of keratinocytes has been reported to exist in SLE and dermatomyositis (7). Consistently, we found apoptotic bodies expanding from basal to peripheral strata of the epidermis in several skin autoimmune conditions including discoid lupus (not shown), SLE and lichen planus. Autoantigens, and modified versions thereof are clustered in the cell surface blebs of apoptotic keratinocytes (6,18,20). Apoptotic surface blebs present autoantigens (21), and likely release modified versions to the circulation (16–20). It has been suggested that the release of modified autoantigens from apoptotic bodies could be the immunizing event that mediates systemic autoimmune responses mediating SLE and scleroderma (18,19).

Our evidence indicates that both GPBP and GPBPĪ”26 are able to act in vitro as protein kinases, with GPBP being a more active isoform than GPBPĪ”26. Furthermore, recombinant material representing GPBP or GPBPĪ”26 purified from yeast or from human 293 cells contained an associated proteolytic activity that specifically degrades the α3(IV)NC1 domain (unpublished results). The proteolytic activity operates on α3(IV)NC1 produced in an eukaryotic expression system, but not on recombinant material produced in bacteria (unpublished results), indicating that α3(IV)NC1 processing has some conformational or post-translational requirements not present in prokaryotic recombinant material. Finally, it has been reported that several autoantigens undergo phosphorylation and degradation in apoptotic keratinocytes (20). While not being limited to an exact mechanism, we propose, in light of all of the above data, that the machinery assembling GPBP at the apoptotic blebs likely performs a complex modification of the autoantigens that includes phosphorylation, conformational changes and degradation. Accordingly, recombinant protein representing autoantigens in SLE (P1 ribosomal phosphoprotein and Sm-D1 small nuclear ribonucleoproteins) and in dermatomyositis (hystidil-tRNA synthetase) were in vitro substrates of GPBP (unpublished results).

The down-regulation in cancer cell lines of GPBP, suggest that the cell machinery harboring GPBP/GPBPΔ26 is likely involved in signaling pathways inducing programmed cell death. The corresponding apoptotic pathway could be up regulated during autoimmune pathogenesis to cause an altered antigen presentation in individuals carrying specific MHC haplotypes; and down regulated during cell transformation to prevent autoimmune attack to the transformed cells during tumor growth.

REFERENCES FOR EXAMPLE 2

  • 1. Saus, J. (1998) in Goodpasture's Syndrome: Encyclopedia of Immunology 2nd edn. Vol. 2, eds. Delves, P. J., & Roitt, I. M., (Academic Press Ltd., London),pp. 1005–1011.
  • 2. Quinones, S., Bernal, D., GarcĆ­a-Sogo, M., Elena S. F., & Saus, J. (1992) J. Biol. Chem. 267, 19780–19784.
  • 3. Revert, F., PenadĆ©s, J. R., Plana, M., Bernal, D., Johansson, C., Itarte, E., Cervera, J., Wieslander, J., Quinones, S., & Saus, J.(1995) J. Biol. Chem. 270, 13254–13261.
  • 4. Raya, A., Revert, F., Navarro, S., & Saus, J. (1999) J. Biol. Chem. 274, 12642–12649.
  • 5. Green, M. R. (1986) Ann. Rev. Genet. 20, 671–708.
  • 6. Casciola-Rosen, L. A., Anhalt, G. & Rosen, A. (1994) J. Exp. Med. 179:1317–1330.
  • 7. Pablos, J. L:, Santiago, B., Galindo, M., Carreira, P. E., Ballestin, C.& Gomez-Reino, J. J. (1999) J. Pathol. 188: 63–68.
  • 8. Srinivasan, M., Edman, C. F., & Schulman, H. (1994) J. Cell. Biol. 126, 839–852.
  • 9. Naito, Y., Watanabe, Y., Yokokura, H., Sugita, R., Nishio, M., & Hidaka, H. (1997) J. Biol. Chem. 272, 32704–32708.
  • 10. Bayer, K.-U., Lƶhler, J., & Harbers, K. (1996) Mol. Cell. Biol. 16, 29–36.
  • 11. Madaule, P., Eda, M., Watanabe, N, Fujisawa, K., Matsuoka, T., Bito, H., Ishizaki, T., & Narumiya, S. (1998) Nature 394, 491–494.
  • 12. Papin, C., Denouel-Galy, A., Laugier, D., Calothy, G., & EychĆ©ne, A. (1998) J. Biol. Chem. 273, 24939–24947.
  • 13. U.S. Provisional Patent Application, Serial No. to be assigned, filed Feb. 11, 2000 (Case number 98,723-C)
  • 14. PenadĆ©s, J. R., Bernal, D., Revert, F., Johansson, C., Fresquet, V. J., Cervera, J., Wieslander, J., Quinones, S. & Saus, J. (1995) Eur. J. Biochem. 229, 754–760.
  • 15. Bernal, D., Quinones, S., & Saus, J. (1993) J. Biol. Chem., 268, 12090–12094.
  • 16. Casciola-Rosen, L. A., Anhalt, G. J. & Rosen, A. (1995) J. Exp. Med. 182: 1625–1634.
  • 17. Casiano, C. A., Martin, S. J., Green, D. R., & Tan, E. M. (1996) J. Exp. Med. 184: 765–770.
  • 18. Casciola-Rosen, L., & Rosen, A. (1997) Lupus 6: 175–180.
  • 19. BolĆ­var, J., Guelman, S., Iglesias, C., OrtĆ­z, M., & Valdivia, M. (1998) J. Biol. Chem. 273: 17122–17127.
  • 20. Utz, P. J., & Anderson, P. (1998) Arthritis Rheum. 41: 1152–1160.
  • 21. Golan, T. D., Elkon, K. B., Ghavari, A. E., & Krueger, J. G. (1992) J. Clin. Invest. 90: 1067–1076.
  • 22. Polalowska, R. R., Piacentini, M., Bartlett, R., Goldsmith, L. A., & Haake, A. R. (1994) Dev. Dinam. 199: 176–188.
  • 23. Maruoka, Y., Harada, H., Mitsuyasu et al. (1997) Biochem. Biophys. Res. Commun. 238: 886–890.
  • 24. Xu, W., Harrison, S. C., & Eck, M. J. (1997) Nature 385, 595–602.

EXAMPLE 3

Regulation of Human Autoantigen Phosphorylation by Exon Splicing

Introduction

In GP disease, the immune system attack is mediated by autoantibodies against the non-collagenous C-terminal domain (NC1) of the α3 chain of collagen IV (the GP antigen) (1). The N-terminus of the human α3(IV)NC1 contains a highly divergent and hydrophilic region with a unique structural motif, KRGDS9, that harbors a cell adhesion signal as an integral part of a functional phosphorylation site for type A protein kinases (2,3). Furthermore, the gene region encoding the human GP antigen characteristically generates multiple mRNAs by alternative exon splicing (4,5). The alternative products diverge in the C-terminal ends and all but one share the N-terminal KRGDS9 (4,5).

Multiple sclerosis (MS) is an exclusive human neurological disease characterized by the presence of inflamatory demyelization plaques at the central nervous system. (6). Several evidences indicate that this disease is caused by an autoimmune attack mediated by cytotoxic T cells towards specific components of the white matter including the myelin basic protein (MBP) (7, 8). In humans, the MBP gene generates four products (MBP, MBPΔII, MBPΔV and MBPΔII/V) that result from alternative exon splicing during pre-mRNA processing (9). Among these, MBPΔII is the more abundant form in the mature central nervous system, while MBP form containing all the exons is virtually absent (9).

Several biological similarities exist between the autoimme responses mediating GP disease and MS, namely: 1) both are human exclusive diseases and typically initiate after a viral flu-like disease; 2) a strong linkage exists to the same haplotype of the HLA-DR region of the class II MHC; 3) several products are generated by alternative splicing; and 4) the death of a MS patient by GP disease has recently been reported (10).

Materials and Methods

  • Synthetic polymers: GPĪ”III derived peptide, QRAHGQDLDALFVKVLRSP (SEQ ID NO:43) and GPĪ”III/IV/V derived peptide, QRAHGQDLESLFHQL (SEQ ID NO:44) were synthesized using either Boc-(MedProbe) or Fmoc-(Chiron, Lipotec) chemistry.
    Plasmid Construction and Recombinant Expression.

GP derived material: The constructs representing the different GP-spliced forms were obtained by subcloning the cDNAs used elsewhere to express the corresponding recombinant proteins (5) into the BamHI site of a modified pET15b vector, in which the extraneous vector-derived amino-terminal sequence except for the initiation Met was eliminated. The extra sequence was removed by cutting the vector with NcoI and Bam HI, filling-in of the free ends with Klenow, and re-ligation. This resulted in the reformation of both restriction sites and placed the BamHI site immediately downstream of the codon for the amino-terminal Met.

The recombinant proteins representing GP or GPĪ”V (SEQ ID NO:46) were purified by precipitation (5). Bacterial pellets containing the recombinant proteins representing GPĪ”III (SEQ ID NO:48) or GPĪ”III/IV/V (SEQ ID NO:50) were dissolved by 8 M urea in 40 mM Tris-HCl pH 6.8 and sonication. After centrifugation at 40,000Ɨg the supernatants were passed through a 0.22 μm filter and applied to resource Q column for FPLC. The effluent was acidified to pH 6 with HCl and applied to a resource S column previously equilibrated with 40 mM MES pH 6 for a second FPLC purification. The material in the resulting effluent was used for in vitro phosphorylation.

MBP-derived material: cDNA representing human MBPΔII (SEQ ID NO:51) was obtained by RT-PCR using total RNA from central nervous system. The cDNA representing human MBP was a generous gift from C. Campagnoni (UCLA). Both fragments were cloned into a modified version of pHIL-D2 (Invitrogen) containing a 6xHis-coding sequence at the C-terminus to generate pHIL-MBPΔII-His and pHIL-MBP-His, respectively. These plasmids were used for recombinant expression in Pichia pastoris as described in (12). Recombinant proteins were purified using immobilized metal affinity chromatography (TALON resin, CLONTECH) under denaturant conditions (8M urea) and eluted with 300 mM imidazole following manufacturers' instructions. The affinity-purified material was then renatured by dilution into 80 volumes of 50 mM Tris-HCl pH 8.0, 10 mM CHAPS, 400 mM NaCl, 2 mM DTT, and concentrated 50 times by ultrafiltration through a YM10-type membrane (AMICON). The Ser to Ala mutants were produced by site-directed mutagenesis over native sequence-containing constructs using transformer mutagenesis kit from CLONTECH and the resulting proteins were similarly produced.

Phosphorylation studies. Phosphorylation studies were essentially done as described above (see also 3 and 12). In some experiments, the substrates were in-blot renatured and then, phosphorylated for 30 min at room temperature by overlaying 100 μl of phosphorylation buffer containing 0.5 μg of rGPBP. Digestion with V8 endopeptidase and immunoprecipitation were performed as described in (3).

Antibody production. Synthetic peptides representing the C-terminal divergent ends of GPΔIII or GPΔIII/IV/V comprised in SEQ ID NO:43 or SEQ ID NO:44 respectively were conjugated to a cytochrome C, BSA or ovoalbumine using a glutaraldehyde coupling standard procedure. The resulting protein conjugates were used for mouse immmunization to obtain polyclonal antibodies specific for GPΔIII and monoclonal antibodies specific for GPΔIII/IV/V (Mab153). To obtain monoclonal antibodies specific for GPΔV (Mab5A) mouse were immunized using recombinant bacterial protein representing the corresponding alternative form comprising the SEQ ID NO:50. The production of monoclonal (M3/1, P1/2) or polyclonal (anti-GPpep1) antibodies against SEQ ID NO: 26 which represents the N-terminal region of the GP alternative forms have been previously described (3,5).

Boc-based peptide synthesis.

Assembling. The peptide was assembled by stepwise solid phase synthesis using a Boc-Benzyl strategy. The starting resin used was Boc-Pro-PAM resin (0.56 meq/g, batch R4108). The deprotection/coupling procedure used was: TFA (ixlmin) TFA (1Ɨ3 min) DCM (flow flash) Isopropylalcohol (1Ɨ30 sec) DMF (3Ɨ1 min) COUPLING/DMF (1Ɨ10 min) DMF (1Ɨ1 min) COUPLING/DMF (1Ɨ10 min) DMF (2Ɨ1 min) DCM (1Ɨ1 min). For each step 10 ml per gram of peptide-resin were used. The coupling of all amino acids (fivefold excess) was performed in DMF in the presence of BOP, Hobt and DIEA. For the synthesis the following side-chain protecting groups were used: benzyl for serine; 2 chlorobenzyloxycarbonyl for lysine; cyclohexyl for aspartic and glutamic acid; tosyl for histidine and arginine.

Cleavage. The peptide was cleaved from the resin and fully deprotected by a treatment with liquid Hydrogen Fluoride (HF): Ten milliliters of HF per gram of peptide resin were added and the mixture kept at 0° C. for 45 min in the presence of p-cresol as scavengers. After evaporation of the HF, the crude reaction mixture is washed with ether, dissolved in TFA, precipitated with ether and dried.

Purification. Stationary phase: Silica C18, 15 μm, 120 A; Mobile phase: solvent A: water 0.1% TFA and solvent B: acetonitrile/A, 60/40 (v/v); Gradient: linear from 20 to 60% B in 30 min; Flow rate: 40 ml/min; and detection was U.V (210 nm). Fractions with a purity higher than 80% were pooled and lyophilized. Control of purity and identity was performed by analytical HPLC and ES/MS. The final product had 88% purity and an experimental molecular weight of 2192.9.

Fmoc-based peptide synthesis.

Assembling. The peptides were synthesized by stepwise linear solid phase on Pro-clorotrityl-resin (0.685 meq/g) with standard Fmoc/tBu chemistry. The deprotection/coupling procedure used was: Fmoc aa (0.66 g) HOBt (0.26 g) DIPCDI (0.28 ml) for 40 min following a control by Kaiser test. If the test was positive the time was extended until change to negative. Then DMF (31 min), piperidine/DMF 20% (11 min) piperidine/DMF 20% (15 min) and DMF (41 min). Side chain protectors were: Pmc (pentamethylcromane sulfonyl) for arginine, Bcc (tert-butoxycarbonyl) for lysine, tBu (tert-butyl) for aspartic acid and for serine and Trl (trityl) for histidine.

Cleavage. The peptide was cleaved and fully deprotected by treatment cleavage with TFA/water 90/10. Ten milliliters of TFA solution per gram of resin were added. Water acts as scavenger. After two hours, resin was filtered and the resulting solution was precipitated five times with cold diethylether. The final precipitated was dried.

Purification. Stationary phase: Kromasil C18 10 μm; Mobile phase: solvent A: water 0.1% TFA and solvent B: acetonitrile 0.1% TFA; Isocratic: 28% B; Flow rate: 55 ml/min; Detection: 220 nm. Fractions with the higher purity were pooled and lyophilized, and a second HPLC purification round performed. Control of purity and identity was performed by analytical HPLC and ES/MS. The final product had 97% purity and an experimental molecular weight of 2190.9.

Results

Regulation of the phosphorylation of the human GP antigen by alternative splicing. We produced bacterial recombinant proteins representing the primary antigen (GP) or the individual alternative products GPĪ”V (SEQ ID NO:46), GPĪ”III (SEQ ID NO:48) and GPĪ”III/IV/V (SEQ ID NO:50), and we tested their ability to be phosphorylated by PKA (FIG. 16, left panel). Using standard ATP concentrations (150 μM), all four recombinant antigens were phosphorylated but to very different extents. The alternative forms incorporated 32P more efficiently than the primary GP antigen, suggesting that they are better substrates. Because these antigens are expected to be in the extracellular compartment, we also assayed their phosphorylatability with more physiological ATP concentrations (0.1–0.5 μM). Under these conditions, the differences in 32P incorporation between the primary and alternative products were more evident, indicating that at low ATP concentrations the primary GP antigen was a very poor substrate for the kinase. Among the three PKA phosphorylation sites present in the GP antigen, the N-terminal Ser9 and Ser26 are the major ones, and are common to all the alternative products assayed (3,5). Accordingly, the differences observed in phosphorylation for the full polypeptides also existed among the individual N-terminal regions, as determined after specific V8 digestion and immunoprecipitation (not shown). This strongly suggests that differences in phosphorylation might be due to the presence of different C-terminal sequences in the alternative products. Since GPĪ”III and GPĪ”III/IV/V displayed significantly higher 32P incorporation rates than GPĪ”V, and they have shorter divergent C-terminal regions (5), we used synthetic peptides individually representing these C-terminal sequences (SEQ ID NO: 43, SEQ ID NO:44) to further examine their regulatory roles in the in vitro phosphorylation of the native antigen. Collagen IV is a trimeric molecule comprised of three interwoven α chains. In basement membranes, two collagen IV molecules assemble through their NC1 domains to yield a hexameric NC1 structure that can be solubilized by bacterial collagenase digestion (1). Dissociation of the hexamer structure releases the GP antigen in monomeric and disulfide-related dimeric forms (1). For the following set of experiments, we carried out phosphorylations in the presence of low, extracellular-like ATP concentrations using both monomeric or hexameric native GP antigen (FIG. 16, right panel ). The presence of each specific peptide but not control peptides (not shown) induced the phosphorylation of a single polypeptide displaying an apparent MW of 22 kDa. By specific V8 digestion and immunoprecipitation, the corresponding polypeptide has been identified as the 22 kDa conformer of the α3(IV)NC1, previously characterized and identified as the best substrate for the PKA (11).

Regulation of the phosphorylation of the MBP by alternative splicing. The MBP contains at its N terminal region two PKA phosphorylation sites (Ser8, Ser57) that are structurally similar to the N terminus site (Ser9) present in GP antigen products (FIG. 17). The Ser8 site present in all the MBP proteins is located in a similar position than the Ser9 in the GP-derived polypeptides. In addition, in the MBP and GPΔIII Ser8 and Ser9 respectively are at a similar distance in the primary structures of a highly homologous motif present in the corresponding exon II (bend arrow in FIG. 17). The GPΔIII-derived motif coincides with the C terminal divergent region that up-regulates PKA phosphorylation of Ser9 in the GP antigen system (FIG. 16). The regulatory-like sequence in MBP is located at exon II and its presence in the final products depends on an alternative exon splicing mechanism. Therefore, the MBP motif identified by structural comparison to GPΔIII may be also regulating PKA phosphorylation of Ser8. We produced recombinant proteins representing MBP and MBPΔII (SEQ ID NO:54) and the corresponding Ser to Ala mutants to knock-out each of the two PKA phosphorylation sites (Ser8 and Ser57) present in exon I. Subsequently, we assessed its in vitro phosphorylation by PKA (FIG. 18). MBPΔII was a better substrate than MBP, and Ser8 was the major phosphorylation site, indicating that, similarly to GP antigenic system, alternative exon splicing regulates the PKA phosphorylation of specific sites located at the N-terminal region common to all the MBP-derived alternative forms.

In similar experiments assessing GPBP phosphorylation of the recombinant MBP proteins, GPBP preferentially phosphorylated MBP, while little phosphorylation of MBPΔII was observed (FIG. 19). Furthermore, recombinant Ser to Ala mutants displayed no significant reduction in 32P incorporation, indicating that GPBP phosphorylates MBP/MBPΔII in an opposite way than PKA, and that these two kinases do not share major phosphorylation sites in MBP proteins.

From all these data we concluded that in the MBP system, alternative splicing regulates the phosphorylation of specific serines by either PKA or GPBP.

Synthetic peptides representing the C terminal region of GPΔIII influence GPBP phosphorylation. To assess the effect of the C terminal region of GPΔIII on GPBP activity, peptides representing this region were synthesized using two different chemistries (Boc or Fmoc), and separately added to a phosphorylation mixture containing GPBP (FIG. 20). Boc-based synthetic peptides positively influenced GPBP autophosphorylation while Fmoc-based inhibited GPBP autophosphorylation, suggesting that the regulatory sequences derived from the alternative products in either GP and MBP antigenic systems can influence the kinase activity of GPBP.

Discussion

We have shown that the α3(IV)NC1 domain undergoes a complex structural diversification by two different mechanism: 1) alternative splicing (4,5) and 2) conformational isomerization of the primary product (11). Both mechanisms generate products that are distinguished by PKA, indicating that PKA phosphorylation is a critical event in the biology of the α3(IV)NC1 domain. Phosphorylation guides at least in part the folding, but also the supramolecular assembly of the α3(IV)NC1 domain in the collagen IV network (11 and Raya et al. unpublished results). Altered conformers of the α3(IV)NC1 lead the autoimmune response mediating GP disease (11), suggesting that an alteration in antigen phosphorylation could be the primary event in the onset of the disease. Accordingly, we have found increased expression levels of GPĪ”III in several GP kidneys (4 and Bernal and Saus, unpublished results), and an increased expression of GPBP has been detected in another Goodpasture patient (FIG. 15). Both increased expression of alternative GP antigen products and of GPBP are expected to have consequences in the phosphorylation steady state of α3(IV)NC1, and therefore in the corresponding conformational process. The discrimination among the different structural products by PKA strongly suggests that this kinase, or another structurally similar kinase, is involved in the physiological antigen conforming process, and that antigen phosphorylation by GPBP has a pathogenic significance. In pathogenesis, GPBP could be an intruding kinase, interfering in the phosphorylation-dependent conforming process. Accordingly, GPBP is expressed in tissue structures that are targeted by natural autoimmune responses, and an increased expression of GPBP is associated with several autoimmune conditions (See examples 1 and 2 above).

An alternative splicing mechanism also regulates the PKA phosphorylation of specific serines in the MBP antigenic system. MBP is also a substrate for GPBP suggesting that GPBP may play a pathogenic role in multiple sclerosis, and other autoimmune responses.

All of the above data identify GPBP as a potential target for therapeutics in autoimmune disease. In FIG. 20, we show that synthetic peptides representing the C terminal region of GPΔIII (SEQ ID NO:43) modulate the action of GPBP in vitro, and therefore we identified this and related sequences as peptide-based compounds to modulate the activity of GPBP in vivo. The induction of GP antigen phosphorylation by PKA was achieved when using Boc-based peptides, but not when using similar Fmoc-based peptides. Furthermore, Boc- but not Fmoc-based peptides were in vitro substrates of PKA (not shown), indicating that important structural differences exist between both products. Since both products displayed no significant differences in mass spectrometry, one possibility is that the different deprotection procedure used may be responsible for conformational differences in the secondary structure that may be critical for biological activity. Accordingly, Boc-based peptide loses its ability to induce PKA upon long storage at low temperatures.

REFERENCES FOR EXAMPLE 3

  • 1. Saus, J. (1998) in Goodpasture's Syndrome: Encyclopedia of Immunology 2nd edn. Vol. 2, eds. Delves, P. J., & Roitt, I. M., (Academic Press Ltd., London),pp. 1005–1011.
  • 2. Quinones, S., Bernal, D., GarcĆ­a-Sogo, M., Elena S. F., & Saus, J. (1992) J. Biol. Chem. 267, 19780–19784.
  • 3. Revert, F., PenadĆ©s, J. R., Plana, M., Bernal, D., Johansson, C., Itarte, E., Cervera, J., Wieslander, J., Quinones, S., & Saus, J.(1995) J. Biol. Chem. 270, 13254–13261.
  • 4. Bernal, D., Quinones, S., & Saus, J. (1993) J. Biol. Chem., 268, 12090–12094.
  • 5. PenadĆ©s, J. R., Bernal, D., Revert, F., Johansson, C., Fresquet, V. J., Cervera, J., Wieslander, J., Quinones, S. & Saus, J. (1995) Eur. J. Biochem. 229, 754–760.
  • 6. Raus, J. C M, en Multiple Sclerosis : Encyclopedia of Immunology 2nd edn. Vol. 3 (eds. Delves, P. J., & Roitt, I. M.) 1786–1789 (Academic Press Ltd., London, 1998).
  • 7. Pette, M., Fujita, K., Wilkinson, D., Altmann, D. M., Trowsdale, J., Giegerich, G., Hinkkanen, A., Epplen, J. T., Kappos, L., and Wekerle, H. (1994) Proc. Natl. Acad. Sci. USA 87, 7968-7972
  • 8. Tschida, T., Parker, K. C., Turner, R. V., McFarland, H. F., Coligan, J. E., and Biddison, W. E.(1994) Proc. Natl. Acad. Sci. USA 91, 10859–10863.
  • 9. Campagnoni, A. T. (1988) J. Neurochem. 51, 1–14.
  • 10. Henderson, R. D., Saltissi, D., and Pender, M. P. (1998) Acta Neurol. Scand. 98, 134–135.
  • 11. U.S. Provisional Patent Application, Serial No. to be assigned, filed Feb. 11, 2000 (Case number 98, 723-C).
  • 12. Raya, A., Revert, F., Navarro, S., and Saus, J. (1999). J. Biol. Chem. 274,12642–12649.

The present invention is not limited by the aforementioned particular preferred embodiments. It will occur to those ordinarily skilled in the art that various modifications may be made to the disclosed preferred embodiments without diverting from the concept of the invention. All such modifications are intended to be within the scope of the present invention.

Claims

I claim:

1. An isolated nucleic acid comprising a nucleic acid sequence that encodes the protein selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:8, or consisting of a nucleic acid sequence that encodes a polypeptide according to SEQ ID NO:14.

2. The isolated nucleic acid of claim 1, wherein the nucleic acid sequence encodes the protein of SEQ ID NO:2.

3. The isolated nucleic acid of claim 1, wherein the nucleic acid sequence encodes the protein of SEQ ID NO:8.

4. The isolated nucleic acid of claim 1, consisting of a nucleic acid sequence that encodes the polypeptide of SEQ ID NO:14.

5. The isolated nucleic acid of claim 1, wherein the nucleic acid sequence is selected from the group consisting of SEQ ID NO:1, SEQ ID NO:7, and SEQ ID NO:13.

6. The isolated nucleic acid of claim 1, wherein the nucleic acid sequence consists of SEQ ID NO:1.

7. The isolated nucleic acid of claim 1, wherein the nucleic acid sequence consists of SEQ ID NO:7.

8. The isolated nucleic acid of claim 1, wherein the nucleic acid sequence consists of SEQ ID NO:13.

9. A recombinant expression vector comprising the isolated nucleic acid of claim 1.

10. A recombinant expression vector comprising the isolated nucleic acid of claim 2.

11. A recombinant expression vector comprising the isolated nucleic acid of claim 3.

12. A recombinant expression vector comprising the isolated nucleic acid of claim 4.

13. A recombinant expression vector comprising the isolated nucleic acid of claim 5.

14. A recombinant expression vector comprising the isolated nucleic acid of claim 6.

15. A recombinant expression vector comprising the isolated nucleic acid of claim 7.

16. A recombinant expression vector comprising the isolated nucleic acid of claim 8.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: