-
2006-05-23
10/286,186
2002-11-01
US 7,049,134 B2
2006-05-23
-
-
David Guzo | Michael D. Burkhart
2023-10-18
A rolling circle DNA replicon which replicates in a host eukaryotic cell is disclosed which has a truncated replication cycle. The rolling circle DNA replicon comprises the following elements present on the same DNA molecule. It contains a Rep gene open reading frame from a virus belonging to the viral taxonomic families Geminiviridae, Circoviridae or genus Nanovirus. The Rep gene open reading frame is placed under transcriptional control of a promoter, which is placed 5′ of the gene. Any sequences that are required to be present in cis on the rolling circle DNA replicon in order that the Rep protein might promote replication of the rolling circle DNA replicon are included. An expression cassette for expression of an ancillary protein that is capable of creating a cellular environment permissive for replication of the rolling circle DNA replicon in the host cell of interest is also included. At least one expression cassette with an RNA polymerase II promoter, a multiple cloning site, and transcription termination and polyadenylation signals suitable for transcription of RNA molecules not normally intrinsic to a geminiviral, circoviral or nanoviral genome is also included.
Get notified when new applications in this technology area are published.
C12N15/79 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression Vectors or expression systems specially adapted for eukaryotic hosts
C12N15/82 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
C12N15/85 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
C12N7/00 IPC
Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
A61K31/713 IPC
Medicinal preparations containing organic active ingredients; Carbohydrates; Sugars; Derivatives thereof; Compounds having three or more nucleosides or nucleotides Double-stranded nucleic acids or oligonucleotides
This is a continuation of Ser. No. 09/505,477 filed on Feb. 16, 2000, now abandoned.
This invention relates to the field of single stranded circular DNA (ssDNA) viruses that infect eukaryotic hosts. In particular this invention relates to viral vectors having utility in gene expression in a eukaryotic host. Among the viruses in this field are the Geminiviruses, Nanoviruses, and Circoviruses.
The single stranded circular DNA (ssDNA) viruses that infect eukaryotic hosts belong to several different virus taxonomic families (Van Regenmortel et al., 1999; Pringle, 1999). Circoviruses, Circinoviruses (Mushahwar et al., 1999), Gyroviruses and Parvoviruses infect vertebrates; some Parvoviruses (subfamily Densovirinae) also infect invertebrate hosts while Geminiviruses and viruses in the genus Nanovirus infect plants. There is recent evidence that the viruses currently classified as Circoviruses evolved from Nanoviruses and have switched from a plant to a vertebrate host (Gibbs and Weiller, 1999).
Geminiviruses, Nanoviruses, and Circoviruses are all small circular ssDNA viruses that appear to be fairly closely related, in that they use the same basic rolling-circle mechanism of replication (RCR) and employ very similar life cycle strategies. Recently published data indicate that some plant RCR viruses—dicot-infecting begomoviruses and at least one Nanovirus genomic component even co-exist in some plant infections, with the geminiviral component of the infection presumably providing movement and propagation functions for the Nanovirus element, which functions as a sort of autonomously replicating satellite virus (Mansoor et al., 1999; Saunders and Stanley, 1999). The genomes of all of the plant RCR viruses, and related vertebrate-infecting Circoviruses are small, single-stranded and circular. The Geminiviruses have mono- or bi-partite genomes, with each genomic component between 2.5 and 3.0-kb. The Nanoviruses have multipartite genomes, generally with at least six, and up to ten, circular subgenomic ssDNAs, each of about 1.0-kb (Katul et al., 1998; Boevink et al., 1995; Burns et al., 1995). The Circoviruses PCV and BFDV have circular ssDNA genomes between 1.75- and 2.0-kb that encode at least two proteins. It is hypothesized that the PCV and BFDV genomes evolved after a recombination event between at least two Nanovirus subgenomic component and a vertebrate RNA-infecting virus which contributed a small portion of the new virus's replication associated protein.
The life cycle of the plant RCR viruses and Circoviruses consists of the following stages, (reviewed by Palmer and Rybicki, 1998; Hanley-Bowdoin et al., 1999):
The plant RCR viruses and their relatives the Circoviruses all encode a replication-associated protein (Rep) that is absolutely required for replication of the virus genomic components (Mankertz et al., 1998; Elmer et al., 1988; Hafner et al., 1997). All other proteins are dispensable for replication, and may be involved in such functions as: movement from cell-to-cell; encapsidation of the virus genome; shuttling of the virus genome between the nucleus and the cytoplasm of infected cells; transcriptional activation or repression of genes in the host or viral genome. The Rep proteins of these RCR viruses bear some distant relationship to replication initiator proteins of some ssDNA plasmids, as well as of members of the Microviridae, such as coliphage phiX174 (Ilyina and Koonin, 1992), and has led to speculation that the plant RCR viruses and Circoviruses evolved from prokaryotic ssDNA replicons. The Rep proteins of all of these replicons is a sequence specific DNA binding protein with site specific cleavage and joining activity. In all cases, Rep, probably in association with host enzymes and possibly other viral proteins (Castellano et al., 1999) binds RF DNA at specific sequences and nicks the plus strand at a specific point. In the plant RCR viruses and Circoviruses this specific point occurs within a conserved nonanucleotide sequence that occurs in the loop of a stem-loop structure in the viral intergenic region. The sequence of this nonanucleotide sequence is well conserved between all RCR viruses of plants and Circoviruses: in Geminiviruses the sequence of the nonanucleotide origin of RCR is: TAATATTAC (Palmer and Rybicki, 1998; Hanley-Bowdoin et al., 1999); in Nanoviruses (Refs) and Circoviruses the sequence is TANTATTAC (Meehan et al., 1997; Hamel et al., 1998; Morozov et al., 1998) Thus the consensus sequence for nonanucleotide origin of replication for these viruses is TANTATTAC. The Rep protein-mediated cleavage of this nonanucleotide sequence occurs between positions 7 and 8. The minimum amount of sequences that are required to be present on a DNA molecule so that it can be replicated in a reaction mediated by an RCR virus Rep protein are referred to as the RCR virus's minimal origin of replication (minimal ori). The minimal origin of replication is empirically determined, and virus species-specific; the term “minimal ori” is used interchangeably with “ori”, and “origin of replication”. In general, the minimal ori includes: (1) the viral stem-loop structure with TANTATTAC nonanucleotide sequence present in the loop; (2) generally, at least 90 base pairs 5′ to the start of the stem-loop structure and (3) generally, at least 10, but in many cases up to 100 bases, 3′ of the end of the stem-loop structure. The minimal ori is always contained within the main viral intergenic region. The main viral intergenic region (IR) is a non-coding DNA sequence that contains the stem-loop structure, TANTATTAC sequence, binding sites for the Rep protein, the minimal ori, and promoter sequences for driving transcription of viral genes in both orientations relative to the IR. In Geminiviruses of genus Begomovirus, the minimal ori is contained within the common region, a sequence within the IR that is common to both DNA A and DNA B genetic components since the sequence is required to be in present in cis for replication of both components. Likewise, the minimal ori of Nanoviruses is contained within the viral common region, present on all genome components. In Curtoviruses, the minimal ori is contained within the IR, and Mastreviruses the minimal ori is within the Long IR, but sequences in the Short IR are also required for replication. In Circoviruses the minimal ori is contained within the IR, and constitutes the stem-loop structure, TANTATTAC sequence and sequences flanking the stem-loop structure (Mankertz et al., 1997).
Replication of the plant RCR viruses and Circoviruses is entirely dependent upon a single virally-encoded replication initiator protein (Rep). Rep proteins of these viruses all contain three conserved protein motifs which are also present in replication initiator proteins from prokaryotic RCR replicons (Ilyina and Koonin, 1992; Palmer and Rybicki 1998; Mankertz et al., 1998; Meehan et al., 1997; Bassami et al., 1998; Gibbs and Weiller 1999). The function of motif I (FTLNN (SEQ ID NO:7) in Circoviruses, FTLNY (SEQ ID NO:8) in Nanoviruses and FLTYP (SEQ ID NO:9) in Geminiviruses), is unknown; Motif II (GXXXHLQGF (SEQ ID NO:10) in Circoviruses, GXXHLQGF (SEQ ID NO:11) in Nanoviruses and GXXHLH(A/V)L (SEQ ID NO:12) in Geminiviruses) and is probably involved in metal ion coordination. Motif III [(V/N)(R/K)XYXXK (SEQ ID NO:13) in all three groups] contains a conserved tyrosine residue that participates in phosphodiester bond cleavage and in the covalent linkage of Rep to the 5′ terminus of the nicked nonanucleotide motif at the origin of replication. The Rep proteins of these three groups of viruses also contains a fourth conserved motif, a nucleotide triphosphate-binding domain (GX4GKXXWARX28-29DD) (SEQ ID NO:14) that may indicate that these proteins possess helicase activity.
Apart from their functions in RCR, Rep proteins and ancillary replication-associated “early” gene products also seem to have transcription factor activity, and are capable of controlling viral and perhaps also host gene expression. Geminivirus Rep proteins can interact with both mammalian and plant Retinoblastoma protein (Rb) homologues (Xie et al., 1995; 1996; Grafi et al., 1996; Xie et al., 1996; Ach et al., 1997). Rb belongs to a protein family that controls cell cycle progression by sequestering transcription factors necessary for entry of the cell cycle into S phase. There is also evidence that infection of plants with Geminiviruses such as tomato golden mosaic begomovirus (TGMV) is associated with an increase in the levels of proliferating cell nuclear antigen (PCNA), a DNA polymerase processivity factor required in cellular DNA replication (Nagar et al., 1995). These viruses thus appear to possess the ability to modify the host environment to one that allows viral DNA replication. At present, the exact mechanisms by which these viruses modify the host cell cycle are unclear. This could be achieved exclusively through interaction of viral proteins (such as Rep) with host proteins (such as Rb). It is also possible that transcriptional activation or repression of host genes mediated by the transcription factor activity of viral protein/s may also be involved in resetting the cellular environment to one that is permissive for viral replication.
Of this group of closely related RCR viruses, only Geminiviruses have been exploited as gene vectors in plant cells. Recombinant viral vectors that have a foreign gene inserted in place of a begomovirus coat protein can sometimes infect permissive dicotyledonous plant hosts and move systemically in infected plants (Ward et al., 1988; Hayes et al., 1988; Sudharsha et al., 1998). Vectors that contain part of the begomoviral genome, including at least three open reading frames (AC1 [=Rep],AC2 and AC3) driven by their own promoters, and containing the viral origin of replication, can replicate in transfected dicotyledonous plant cells Palmer et al., (1997). Mastrevirus-derived vectors that contain the two genes (Rep and RepA) necessary for replication of the viral genome and expression of the viral late genes, together with the viral origins of replication, can replicate in cells derived from monocotyledonous cereal plants (Palmer et al., 1997; Palmer et al., 1999).
One aspect of this invention is a rolling circle DNA replicon (RCR replicon) which replicates in a host eukaryotic cell. Another aspect of the invention is a RCR replicon which has a truncated replication cycle. Another aspect of the invention is a RCR replicon which has the following elements, present on the same DNA molecule: A Rep gene open reading frame from a virus belonging to the viral taxonomic families Geminiviridae, Circoviridae or genus Nanovirus, said Rep gene open reading frame is placed under transcriptional control of a promoter, which promoter is placed 5′ of the gene; any sequences that are required to be present in cis on the rolling circle DNA replicon in order that the Rep protein might promote replication of the rolling circle DNA replicon; an expression cassette for expression of an ancillary protein that is capable of creating a cellular environment permissive for replication of the rolling circle DNA replicon in the host cell of interest; and at least one expression cassette with an RNA polymerase II promoter, a multiple cloning site, and transcription termination and polyadenylation signals suitable for transcription of RNA molecules not normally intrinsic to a geminiviral, circoviral or nanoviral genome.
Another aspect of the invention is a RCR replicon, which replicates in a host eukaryotic cell, and which has a promoter that can function in a host eukaryotic cell type of interest.
Another aspect of the invention is a RCR replicon, which replicates in a host eukaryotic cell, and which has a promoter that has some tissue, or cell-type specificity.
Another aspect of the invention is a RCR replicon for a host cell, which has a promoter that is inducible by chemical or other environmental induction.
Another aspect of the invention is a RCR replicon which replicates in a host eukaryotic cell, and which has sequences that are required to be present in cis on the rolling circle DNA replicon in order that the Rep protein might promote replication of the rolling circle DNA replicon are derived from the group consisting of Nanoviruses, Circoviruses, begomoviruses and curtoviruses.
Another aspect of the invention is an RCR replicon which replicates in a host eukaryotic cell, and which has sequences that are required to be present in cis on the rolling circle DNA replicon in order that Rep might promote the replication of the rolling circle DNA replicon. These sequences are:
Another aspect of the invention is an RCR replicon derived from a Mastrevirus which replicates in a host eukaryotic cell, and which has sequences that are required to be present in cis on the rolling circle DNA replicon in order that Rep might promote the replication of the rolling circle DNA replicon. These sequences are:
Another aspect of the invention is a RCR replicon which replicates in a host eukaryotic cell, and which has an expression cassette that a) functions in expression of an ancillary protein and b) which is redundant with the Rep gene expression cassette.
Another aspect of the invention is a RCR replicon which replicates in a host eukaryotic cell, and which has an expression cassette for expression of an ancillary protein and an expression cassette driving the expression of a Rep ORF which expression cassette is from a different virus species from the group of Geminiviruses, Circoviruses and Nanoviruses.
Another aspect of the invention is a method of making a rolling circle DNA replicon which replicates in a host eukaryotic cell, comprising combining:
Another aspect of the invention is a method of making a rolling circle DNA replicon which replicates in a host eukaryotic cell which replicon has a truncated replication cycle, comprising combining:
Another aspect of the invention is a method of discovering the function of a gene or gene segment in a host eukaryotic cell, the method comprising:
FIG. 1 shows a restriction and genetic map of Construct 1. The PCV Rep Promoter,The PCV Rep Gene with restriction sites, the PCV Ori and cloning vector are shown.
FIG. 2 shows a restriction and genetic map of Construct 2 with pCMV, pCV Rep gene, PCV Ori, and SV40 terminator with G418/kanamycin resistance gene.
FIG. 3 shows the restriction map and genetic map of Construct 6 (p TracerSV40 from invitrogen Corp). construct 6 is the backbone of Construct 7. It contains the same GFP-zeocin expression cassette that is present in Construct 7 the NotI—NsiI fragment from Construct 1 was excised and inserted into Construct 6, replacing the SV40 promoter with the PCV fragment to generate Construct 7. The pTrace™-SV40 vector is available from Invitrogen Carlsbad, Calif.
FIG. 4 shows a Southern blot of DNA isolated from cells transfected with PCV-containing constructs and control DNAs. Two and a half micrograms of total DNA from transfected cells was digested with an excess of DpnI restriction enzyme and electrophoresed in a 1.0% TAE agarose gel and stained with ethidium bromide. DNA was transferred to a nylon membrane by capillary transfer. The Southern blot was hybridized with a probe prepared from construct 1, which has homology with all input plasmid DNAs. Lanes 1 to 9 contain DNA isolated from COS-7 cells transfected with the following plasmids: Lane 1 & 2; Construct 1, DNA isolated at day 2 and day 4 post-transfection; Lanes 3&4: Construct 2, day 2 & 4; Lanes 5 & 6; construct 4, day 2 & day 4; Lanes 7 & 8;construct 6, day 2 & 4. Lanes 9 & 11 contain DNA isolated from untransfected cells; lane 10 contained a DNA molecular weight marker. Lanes 12 to 19 contain DNA isolated from CHO-K1 cells transfected with the following plasmids: lanes 12 & 13; Construct 7, day 2 & day 4. lanes 14 & 15: construct 2, day 2 & 4; lanes 16 & 17: construct 4, days 2 & 4 and lanes 18 & 19; construct 6, days 2 & 4. Lane 20 contains DNA isolated from PC V-positive cell line PK-15, used as a positive control for DNA hybridization. The hybridizing bands run at a significantly lower position, due to the virus's small size (1.8-kb) relative to the plasmid DNAs (greater than 4.0-kb).
FIG. 5 shows the DNA sequence of Construct 1: 5285 bp Composition 1216 A; 1277C;1514G;1278T; 0 OTHER Percentage: 23% A; 24% C; 29% G; 24% T; 0% OTHER. Molecular Weight (kDa): ssDNA: 1636.28 dsDNA: 3258.4 (SEQ ID NO: 1).
FIG. 6 shows the DNA sequence of Construct 7 5650 bp; Composition 1372 A; 1333 C;1516 G; 1429 T; 0 OTHER Percentage: 24% A; 24% C; 27% G; 25% T; 0% OTHER. Molecular Weight (kDa): ssDNA: 1747.85 dsDNA: 3483.2 (SEQ ID NO: 2).
In order to facilitate understanding of the invention, certain terms used throughout are herein defined.
“BFDV” means beak and feather disease virus.
“PCV” means porcine Circovirus.
“CHO cells” means Chinese Hamster Ovary cells
“COS-7 cells” means Cercopithecus aethiops (African Green Monkey) kidney cells, transformed with simian virus 40 (SV40).
“D-MEM” means Dulbecco's Modified Eagle Medium.
“DpnI” is a restriction endonuclease which cuts only dam-methylated DNA.
“Buffer EC” means DNA condensation buffer.
“Effectene” is a transfection reagent, sold by Qiagen Valencia, Calif.
“GFP-zeocin” is a fusion gene made by combining the genes for green fluorescent protein and zeocin.
“G418 resistance gene” is a selectable marker gene.
“HUBEC” cell lines means human brain endothelial cell lines.
“Integrated SV40 Large T antigen-expressing gene:” The African Green Monkey Kidney cell line COS-7 contains a chromosomally-integrated SV40 virus that has a gene for the Large T antigen protein which is required for SV40 virus replication. Thus, COS-7 cells contain a chromosomally-integrated SV40 Large T antigen-expressing gene that is sufficient for episomal replication of SV40 on-containing plasmids in this cell line.
“Intergenic sequences:” The non-coding DNA sequences, wherein the viral origin of replication is situated, that are located between open reading frames of RCR viruses.
“Lipofectamine” is a cationic lipid used for transfecting mammalian cells. Life Technologies, Inc supplies Lipofectamine.
“nanonucleotide:” The sequence TANTATTAC, where “N” may be A or C or G or T. This sequence is contained within the loop of the stem-loop structure present in the origin of replication of all RCR viruses in the group of Geminiviruses, Circoviruses and Nanoviruses.
“neomycin/G418 resistance gene:” A gene that confers to the G418 antibiotic resistance.
“NsiI-NotI fragment” is a restriction fragment from Construct 1 that is used to create Construct 7.
“Passive episomal replicon inheritance:” Process where a replicon present in the nucleus of a cell is passively inherited by both daughter cells upon cell division; the replicons are not actively sequestered into each daughter cell since they do not contain a classical centromere structure, but are nevertheless inherited due to their high copy number in the original undivided cell.
“PMVC cell lines” means porcine microvascular cell lines.
“PCV genome” means the porcine Circovirus genome.
“PCV rep” The replication associated protein gene of porcine Circovirus (PCV).
“PCV RCR plasmid” A plasmid that contains the sequences derived from porcine Circovirus which allow the plasmid to replicate by rolling circle replication in a host cell.
“PK-15 cells” Porcine Kidney cell line PK-15 or PK(15). Cell line derived from kidney epithelial cells of Sus scrofa. The PK-15 cell line is persistently infected with Porcine Circovirus, type 1 (PCV).
“pCMVscript” A mammalian cell expression vector obtained from Stratagene, Inc. (La Jolla, Calif).
“pCRblunt-II TOPO vector” PCRblunt-II TOPO vector: a vector useful for cloning of PCR products sold by Invitrogen Corp. (Carlsbad, Calif.).
“PK-15SwaA and PK-15SwaB” are PCR primers used to amplify the PCV genome.
“pTracerSV40” pTracerSV40 a mammalian cell expression vector that contains an expression cassette for expression of a GFP-zeocin resistance gene; obtained from Invitrogen Corporation.
“QIAamp DNA Mini Kit” A DNA extraction kit useful for extraction of total DNA from blood and mammalian cells, sold by Qiagen Inc (Valencia, Calif.)
“Rep” means virally-encoded replication initiator protein.
“Rep gene” means a gene from an RCR virus belonging to the group of viruses from the taxonomic families Geminiviridae or Circoviridae or from the genus Nanovirus, which is essential for viral replication and which possesses a nicking and joining activity specific for the TANTATTAC sequence present in the stem loop sequence in the viral origin of replication and which is able to promote replication of an RCR virus.
“Rep gene ORF” is an open reading frame associated with a Rep gene.
“Rep protein” means replication-associated protein, a plasmid-encoded protein that functions as an activator of replication of that plasmid.
“Replicon” means any DNA sequence or molecule which possesses a replication origin and which is therefore potentially capable of being replicated in a suitable cell.
“RCR replicons” are replicons that reproduce by the rolling circle DNA replication is a mechanism.
“Rolling circle DNA replication” is a mechanism for the replication of DNA wherein one strand of a parent dsDNA molecule is nicked, and DNA synthesis proceeds by elongation of the 3′-OH end (with progressive displacement of the 5′-end), the unbroken circular strand acting as the template. The partly replicated intermediate is thus a double-stranded circular DNA with a single-stranded displaced tail.
“RCR” means rolling-circle mechanism of replication.
“Rolling circle DNA replicon” means a replicon that reproduces by the rolling circle DNA replication mechanism.
“Rolling Circle Replicon Expression Vectors” means a vector that reproduces by means of the rolling circle DNA replication method.
“RCR vector” means Rolling Circle Replicon Expression Vectors.
“RCR virus” means Rolling Circle Replicon Expression virus.
“ssDNA viruses” means single stranded circular DNA virus.
“SV40 promoter” means simian virus 40 early promoter. Simian virus 40 is a virus of the genus Polyomavirus. SV 40 was originally isolated from kidney cells of the rhesus monkey, and is common (in latent form) in such cells.
“VLPs” means virus-like particles.
This invention provides methods for designing and creating rolling circle DNA replicons for eukaryotic cells with elements from RCR viruses from the viral taxonomic families Geminiviridae, Circoviridae, and the genus Nanovirus that is as yet unassigned to a taxonomic family. We disclose methods for manipulating the genomes of these viruses so that the RCR replicons described in this invention employ only part of the replication cycle of the virus or viruses from which they were originally derived. The RCR replicons are introduced into eukaryotic host cells as double stranded DNA molecules, and thus the form in which the replicon initially enters the host is not usual for the parental virus that normally infects new host cells in an encapsidated ssDNA form. The viral “late” genes that are involved in sequestration of ssDNA, movement of viral DNA out of the host cell nucleus and assembly of viral DNA into virions are inactivated or deleted in the RCR replicons of this invention.
These RCR replicons have the following elements, present on the same DNA molecule:
RCR replicons are useful for discovery of the function of genes in eukaryotic hosts. RCR replicons are useful for inducing or enhancing a function or trait in a host eukaryotic cell. RCR replicons are useful for down-regulating a gene in a plant or in mammalian cells and thereby altering or even eliminating the function of that gene.
RCR replicons have several properties that will lead to the development of superior gene expression vector properties. The vector initiates a rapid replication cycle leading to earlier gene expression than standard plasmid vectors. This coupled with its self-amplifying properties will lead to sustained expression for longer periods of time as compared with standard plasmid vectors. These properties, coupled with the amplification of substrates for transcription by host machinery, will lead to greater levels and longer enduring levels of target gene expression as compared to standard plasmid vectors. The amplification of 100–1000 copies of the genome per transfected cell will lead to passive inheritance of the RCR replicon infection into daughter cells. This will lead to the development of homogeneous populations of transfected cells, all containing RCR replicons and expressed sequences, with the need for little or no biochemical selection procedures. This sustained replication in original transfected cells and resulting daughter cells will allow for long term expression experiments and novel application not available to standard plasmid vectors or other virus-based vector systems. Due to the basic aspects of the host replication system that RCR replicons require, the replicons will have virtually unlimited host range with regards to cellular replication cycles. These replicons express very few protein products outside of targeted genes or sequences for overexpression and do not perturb host cell metabolism to the same degree that other virus vectors do. All these properties give RCR replicons superior performance and make way for novel utilities not available to other plasmid or virus expression systems. For examples of several utilities, see reduction to practice section.
1. Alternative Cellular Expression System.
These vectors can be used as an alternative cellular expression vectors and perform superior to plasmid or virus-based vectors based on the following criteria: rapid replication coupled with expression driven by promoter of choice (affecting expression levels or regulation); sustained replication and passive inheritance; unlimited cellular host range; minimal host metabolism perturbation and low levels of viral protein accumulation.
2. Enhanced Immune Response in Naked DNA or Formulated DNA-based Vaccines.
RCR replicons should have sustained replication properties yielding greater levels of substrate for sustained targeted gene expression in transfected cells. The accumulation of targeted immunogen in transfected antigen presenting cells will be greater than standard plasmid vectors. Advantages over virus vectors include: Non-pathogenic, minimal host perturbation, broad cell host range, no transmission of infection to non-primarily transfected cells due to lack of packaging.
3. Mammalian-cell Based Genomics Using RCR Vectors for Gene Function Discovery.
RCR vectors will prove to be excellent gene sequence delivery tools for mammalian genomic approaches. Uses include the expression of homologous or heterologous genes in a library or targeted manner for the detection of gain of function cellular phenotypes and expression of antisense or sense gene fragments for the inhibition of targeted gene expression for assay of loss of function phenotypes.
4. Gene Therapy Applications
The sustained episomal expression in specific tissues or cells transfected by RCR replicon can allow the delivery of therapeutic or complementing (functional gene copy to complement function of a dysfunctional chromosomal copy) gene products to organisms or cells. The coupling of this activity with the ability of porcine or human brain endothelial cells lines to amplify hemopoictic stem cells without differentiation may prove to be a powerful tool to repopulate a body with new cells containing functional gene copies lacking in native organism. The coupling of these technologies will enable gene therapy to really work. For example, RCR replicon could be designed to express the glucocerebrosidase gene and transfect the hemopojetic stem cells of a patient suffering from Gaucher's disease. Once the transfected stem cells are amplified, they can be re-infused into the patient to engraft in the bone marrow. Once there, the cells will produce a range of hemopoietic cells including Kupffer cells that will be in the liver and responsible from cerebroside lipid degradation. The cells derived from stem cells transfected with the RCR vector will inherit the RCR expression replicon and now express glucocerebrosidase in the liver and now degrade the accumulating lipids that the native system is incapable of doing.
Other properties that are important in RCR vectors to succeed in gene therapy applications: sustained replication, passive episomal replicon inheritance, wide cellular and tissue host range.
5. Unique Coupling of RCR Vectors with Tissue Specific Gene Delivery Modalities.
Packaging of RCR replicon DNA in capsid proteins of viruses with specific cellular tropisms (bound by receptors on specific cell or tissue types) for targeted delivery of replicon to tissues in organisms to maximize correct immune response or therapeutic effect. For example, packaging of RCR replicons in papillomavirus virus-like particles (VLPs) would give the replicon a mucosal targeting tropism at the receptor binding step and inherent replication properties of RCR replicons will allow them to amplify and express sequences in mucosal cells. This approach will allow gene delivery for therapeutic end or immunogen delivery for generation of immune response in mucosal tissues (e.g. applications for papilloma, HIV, Herpes virus, Hepatitis B, microbial agents vaccine purposes). Likewise, integration of RCR replicon DNA into adenovirus VLPs would grant pleural tropisms for delivery of genes to advance therapeutic treatment of cystic fibrosis or other diseases. For example, following treatment of patients with DNAse, patients could receive regular treatments with VLPs containing RCR replicons containing therapeutic genes (DNAse gene) or complimenting gene (correct copies of genes causing the disease). In this manner, transient doses of replicons can transfect tissues and deliver therapeutic genes to reverse disease progression. With pleural cell shedding, new transfections with RCR replicons will be necessary to maintain the functional state of pleural tissue.
6. Whole Animal Genomics or Gene Therapy
Due to persistent replication and expression and passive inheritance of replicons in daughter cells, it should be possible to transfect pluri-potent cell lineages with replicons containing targeted genes and expect resulting daughters cells and subsequent differentiated cells (or tissues derived from them) to maintain long term expression of the gene of interest. This would allow one to transfect CD34+, CD38− hemopoietic stem cells with RCR vectors in vitro, incubation cells with PMVC or HUBEC cell lines, capable of initiating stem cell cycling and division without inducing differentiation, and then re-infuse transfected cells (now expressing novel gene product) into adult animals. All derived cells from the transfected stem cells will continue to express this novel gene function. This would allow the activities of genes to be ascertained at the entire organismal level and in the context of a variety of cell types.
Conversely, RCR vectors containing homologous or heterologous genes could be delivered to embryos of animals and the organism developing from the transfected embryo would be at least chimeric for the RCR encoded gene function or possibly homogeneous for its expression. This tool could be applied to determine gene function in the context of developing or adult organisms. Alternatively, this could be the ultimate gene therapy tool for complimenting chromosomal defects in organisms, such that the derived organism would continue to have a chromosomal defect in a gene, but it would be complemented by the persistent, episomal gene copy in the RCR vector.
7. Gene Therapy Through targeted Gene Repair.
It should be possible to perform directed mutagenesis of a DNA sequence encoded by the host chromosomal genome by encouraging homologous recombination or directed point mutation of specific host DNA sequences homologous to DNA sequences carried on the RCR replicon. Virus infection may induce all necessary factors that are involved in DNA recombination. This coupled with the generation of high levels homologous recombination substrates: single-stranded DNA during the replication cycle (thought to be more involved in DNA recombination than double stranded DNA) and high copy number of RCR genome in double-stranded DNA form, would be thought to enhance the recombinational frequencies between host chromosome and episomal replicon. For example, when Geminiviruses, containing mutations in the virus coat protein rendering the virus packaging and movement incompetent, are inoculated on transgenic plant hosts containing wild type coat protein ORF, they recombine with transgene locus to recreate a fully functional viral genome at a very high rate, Frischmuth and Stanley (1998).
The following examples further illustrate the present invention. These examples are intended merely to be illustrative of the present invention and are not to be considered as limiting.
Constructed Several Plasmids:
We constructed several plasmids to test whether RCR plasmids carrying the Rep gene and origin of replication from could replicate in different mammalian cell types.
Cloning of the Genome of PCV
We designed PCR primers to amplify parts of the genome of PCV from the strain present in PK-15 cells (Mehan et al., 1997; Genbank accession number U49186). For amplification of the whole genome of PCV, with one nucleotide mismatch from the published sequence, the following primers were used; nucleotides identical to the published sequence (accession number U49186) are underlined:
PK-15SwaA:
TTTATTTAAATGGAGCCACAGCTGG (SEQ ID NO: 3)
PK-15SwaB: TTTATTTAA-TACCCACACCAATGTCG (SEQ ID NO: 4)
In PK-15SwaB, an A has been deleted at position 9 relative to the homologous sequence in the published PCV sequence.
A 1.8-kb fragment was amplified with these primers (not shown), with total nucleic acid (100 ng) isolated from PK-15 cells used as the template for PCR. The PCR fragment was cloned into the pCRblunt-II TOPO vector, according to the manufacturer's instructions (Invitrogen). A clone containing the correct-sized insert was named construct 1 (FIG. 1).
Construct 1 (deposited to ATCC on Feb. 16, 2000, accession number PTA-1351) thus contained the whole PCV genome cloned into the Invitrogen cloning vector pCRblunt II. This construct contained the PCV rep gene under the transcriptional control of its own promoter, and has the putative coat protein inactivated by insertion of the bacterial cloning vector.
For cloning of the PCV genome and expression of its Rep gene under the control of the cytomegalovirus immediate-early promoter (CMV promoter), the PCV genome was amplified by PCR from total DNA isolated from PK-15 cells, using the following primers; nucleotides identical to the published sequence of PCV are underlined:
PCVwholerepA
ACCATGCCAAGCAAGAAAAGCGGCCC (SEQ ID NO: 5)
PCVwholerepB
TTTTCACTGACGCTGCCGAGGTG (SEQ ID NO: 6)
A PCR product of approximately 1.8-kb was obtained after PCR amplification using these primers (not shown). This product was cloned into the vector pCMVScript according to the instructions supplied by the manufacturer (Stratagene). Construct 2, Shown in FIG. 2, contained the PCV genome cloned into the Stratagene vector, pCMVscript, such that the Rep gene was placed under the control of the cytomegalovirus immediate-early promoter (CMV promoter), with the PCV rep transcription termination and polyadenylation signal and origin of replication sequences upstream. This construct also contained a neomycin/G418 resistance gene with simian virus 40 early promoter (SV40 promoter) and origin of replication sequences, and thus should replicate episomally in COS-7 cells that have an integrated SV40 Large T antigen-expressing gene. The SV40 origin of replication will not, however, be functional in other cell types.
Construct 4 contains the PCV genome amplified with primers PK-l5SwaA and PK-15SwaB and cloned into the pCMVScript vector according to the instructions supplied by the manufacturer (Stratagene). This construct therefore contains the PCV Rep gene under the control of its own promoter in a vector which carries an SV40 origin of replication and a selectable marker gene (G418 resistance). Construct 6 is the Invitrogen pTracerSV40 (FIG. 3), which expresses a GFP-zeocin resistance gene fusion, useful because one can evaluate the success of transfection experiments by visualization of green fluorescent protein expression.
Construct 7 (deposited in ATCC on Feb. 16, 2000, accession number PTA-1352 was derived by deleting the SV40 promoter and origin of replication sequences from pTracer SV40 (FIG. 3). The NsiI-NotI fragment from construct 1 (FIG. 1) was then cloned into the vector. This construct therefore contains the PCV Rep gene under the control of its own promoter, together with the PCV origin of replication sequences, in the context of a vector that contains a selectable and screenable marker gene (GFP-zeocin resistance), but which cannot replicate in COS-7 cells because the SV40 origin of replication sequences have been deleted.
Transfection Experiments with PCV Replicons
The RCR vectors described herein may be introduced into eukaryotic cells by one of many different protocols that are available for direct transfer of DNA into cells, including, but not limited to: electroporation, cationic lipid-mediated transfection, calcium phosphate transfection, Agrobacterium-mediated transfection, microprojectile bombardment, polyethylene glycol-mediated transfection. Several methods that are commonly used for introduction of DNA into mammalian cells are described in detail in “Current Protocols in Molecular Biology” by Ausubel et al. (1994–2000). John Wiley and Sons, Inc.
Constructs 1, 2, 4 and 6 were transfected into Cercopithecus aethiops (African Green Monkey) kidney cells, transformed with SV40 (COS-7 cells), according to the protocol supplied by the manufacturer of the transfection reagent (Lipofectamine, manufactured by Life Technologies, Inc.) of COS 7 cells.
Transfections were done in duplicate, i.e. two plates per construct.
Cells were harvested at 2 and 4 days post-transfection. Cells were scraped from the plates and pelleted by centrifugation in 1.5 ml microcentrifuge tubes. Pellets from the duplicate transfection experiments were pooled. We isolated total nucleic acids from these cells, at two and four days post-transfection using the QIAamp DNA Mini Kit, according to the manufacturer's instructions (Qiagen). Two and a half micrograms of total nucleic acids from each sample was digested with 20 units of DpnI which cuts only dam-methylated DNA, i.e. the input plasmid DNA, at sequence GA*TC, where the A* is methylated (Sambrook et al., 1989). The restricted DNA was run on a 1% TAE agarose gel, stained with ethidium bromide. The DNA was transferred to a nylon membrane (Roche Molecular Biochemicals) by the standard alkaline capillary transfer Southern blot protocol (Sambrook et al., 1989). The RCR replicon DNAs were detected by Southern hybridization with a probe made from Construct 1, nonradioactively labeled with Digoxygenin by the random priming method, according to the protocol supplied by the manufacturer (Roche Molecular Biochemicals).
FIG. 5 shows the results of the Southern Hybridization experiment. The probe DNA contains sequences (the ColE1 origin of replication) in common with all of the input plasmids, and should therefore hybridize with all replicating, and input plasmid DNAs. Digested, low molecular weight Dpn I-digested fragments of the input DNAs may be visible (less than 1.0-kb, indicated in FIG. 4); all replicating DNAs will remain undigested. All plasmids with SV40 ori sequences (constructs 2, 4, and 6) replicated in the COS-7 cells, as expected. Construct 1 (lanes 1 and 2) also appeared to be replicating in the COS-7 cells, indicating that the PCV RCR replicon was functioning, and replicating the linked non-viral DNA sequences. This shows that the PCV-derived RCR replicon can replicate in African Green Monkey kidney cells.
Constructs 2, 4, 6 and 7 were transfected into Chinese Hamster Ovary (CHO) cells. Cells transfected with constructs 6 and 7 exhibited green fluorescence, indicating expression of the GFP fusion protein. Total DNA was isolated from these cells at 2 and 4 days post-transfection. Southern blot analysis showed that constructs 2, 4 and 7, which contain PCV Rep and origin of replication sequences were all replicating in the transfected cells, whereas construct 6, an SV40 replicon, was not replicating. This shows that PCV RCR replicons can replicate, and express genes linked to the replicon, in Chinese Hamster Ovary (CHO) cells.
Constructs 1, 6 and 7 were transfected into COS-7 cells. The transfections were performed according to the methods suggested by the manufacturer of the transfection reagent (Effectene, from Qiagen). We used 1 μg of DNA, 8 μl of enhancer and 25 μl of Effectene per transfection.
Analysis
At one day post-transfection, cells transfected with construct 7 (PCV RCR plasmid) were clearly expressing the GFP-zeocin fusion gene, but cells transfected with construct 6 (with functional SV40 origin of replication sequences) were not. Thus, the PCV replicon expresses linked genes at a higher level, earlier than the cognate SV40 replicon. Constructs 1, 6 and 7 were also transfected into CHO cells, with similar results one day post-transfection.
In another experiment to evaluate GFP gene expression after transfection of CHO-K1 cells, we compared timing and relative intensity of GFP fluorescence after transfection of cells with constructs 6 (non-replicating, with no PCV sequences) and 7 (a PCV-derived construct). Cells were transfected in parallel by two different methods: with Effectene (Qiagen) and with a standard calcium phosphate precipitation protocol.
Effectene Transfection Method
For the effectene transfection method, one microgram of plasmid DNA was mixed with DNA condensation buffer (Buffer EC), to a total volume of 150 μl. Eight microlitres of Enhancer were added, and the DNA solution was mixed by vortexing for one second. The DNA mixture was incubated at room temperature for 5 minutes. Effectene transfection reagent (25 μl) was added to the DNA-enhancer mixture, and mixed by pipetting up and down five times. The samples were incubated at room temperature to allow complex formation.
While complex formation was occurring, the growth medium was gently aspirated from the plates, and the cells were washed once with phosphate buffered saline (PBS). Four milliliters of fresh growth medium was then added to the cells.
One milliliter of growth medium was added to the reaction tube containing the transfection complexes; the solution was then mixed and immediately added drop-wise onto the cells in 60-mm dishes. The dish was gently swirled to ensure uniform distribution of the complexes. The cells with transfection complexes were incubated at 37° C. and 5% CO2 to allow for gene expression.
The expression of GFP in transfected cells was observed at three and seven days post-transfection. The results from observation of cells transfected by the Effectene method are tabulated below (Table 1/LSB #3).
Construct 3: non-replicating plasmid DNA, no GFP gene (DNA control)
Construct 6: non-replicating plasmid DNA, GFP-zeocin fusion gene, should express GFP in transfected cells.
Construct 7: plasmid DNA with PCV replicon and the same GFP-zeocin fusion gene as
construct 6: May be capable of replication.
| Dish # | Construct | Day 3 Observations | Day 7 Observations |
| 1 | 3 | No GFP, cells look | No GFP, cells growing well |
| healthy | |||
| 2 | 6 | 4 to 5% GFP + ve, | Small number of GFP + ve |
| low level expression | cells | ||
| 3 | 7 | 10% GFP + ve, low to | Very many GFP + ve cells, |
| moderate expression | both dim and bright | ||
| 5 | No DNA | No GFP; cells growing | No GFP |
| well | |||
Although the invention has been described with reference to the presently preferred embodiments, it should be understood that various modifications could be made without departing from the spirit of the invention.
1. A rolling circle DNA replicon capable of rolling circle replication in a host eukaryotic cell, comprising the following elements, present on the same DNA molecule:
a) a Rep gene open reading frame from a virus belonging to viral taxonomic families Geminiviridae, Circoviridae or genus Nanovirus, wherein said Rep gene open reading frame is placed under transcriptional control of a promoter, and wherein said promoter is placed 5′ of the gene;
b) sequences that are required to be present in cis on the rolling circle DNA replicon in order that a Rep protein might promote replication of the rolling circle DNA replicon;
c) an expression cassette for expression of an ancillary protein that is capable of creating a cellular environment allowing for replication of the rolling circle DNA replicon in the host eukaryotic cell wherein said ancillary protein is a viral protein; and
d) at least one expression cassette comprising an RNA polymerase II promoter, a multiple cloning site, and transcription termination and polyadenylation signals suitable for transcription of RNA molecules not normally intrinsic to a Geminiviral, Circoviral or Nanoviral genome.
2. The rolling circle DNA replicon according to claim 1, wherein at least one promoter is chosen to be one that can function in a host eukaryotic cell type of interest.
3. The rolling circle DNA replicon according to claim 1, wherein at least one promoter has tissue or cell-type specificity.
4. The rolling circle DNA replicon according to claim 1, wherein at least one promoter is an inducible promoter subject to chemical or other environmental induction.
5. The rolling circle DNA replicon according to claim 1, wherein said sequences that are required to be present in cis on the rolling circle DNA replicon in order that the Rep protein might promote replication of the rolling circle DNA replicon are obtained from the group consisting of Nanoviruses, Circoviruses, begomoviruses and curtoviruses.
6. The rolling circle DNA replicon according to claim 1, wherein said sequences that are required to be present in cis on the rolling circle DNA replicon in order that the Rep protein might promote replication of the rolling circle DNA replicon are:
a) the viral origin of replication that contains the conserved stem-loop structure,
b) TANTATTAC nanonucleotide sequence; and
c) flanking intergenic sequences, wherein said flanking intergenic sequences comprise at least 90 bases 5′ to the start of the conserved stem-loop structure and 10 to 100 bases 3′ of the end of the conserved stem-loop structure.
7. The rolling circle DNA replicon according to claim 1, wherein said sequences that are required to be present in cis on the rolling circle DNA replicon in order that the Rep protein might promote replication of the rolling circle DNA replicon are long intergenic regions and short intergenic regions obtained from a mastrevirus.
8. The rolling circle DNA replicon according to claim 1, wherein a second viral ancillary protein is expressed.
9. A method of making a rolling circle DNA replicon which replicates in a host eukaryotic cell, comprising combining:
a) a Rep gene open reading frame from a virus belonging to the viral taxonomic families Geminiviridae, Circoviridae or genus Nanovirus, said Rep gene open reading frame is placed under transcriptional control of a promoter, wherein said promoter is placed 5′ of the gene;
b) (i) an origin of replication of the same virus of the Rep gene open reading frame, (ii) a TANTATTAC sequence, and (iii) a stem-loop structure flanking sequence present in cis on the rolling circle DNA replicon in order for the Rep protein to promote replication of the rolling circle DNA replicon;
c) an expression cassette for expression of an ancillary protein capable of creating a cellular environment allowing for replication of the rolling circle DNA replicon in the host eukaryotic cell wherein said ancillary protein is a viral protein; and
d) at least one expression cassette with an RNA polymerase II promoter, a multiple cloning site, and transcription termination and polyadenylation signals suitable for transcription of RNA molecules not normally intrinsic to a geminiviral, circoviral or nanoviral genome.
10. The replicon of claim 1, wherein the ancillary protein comprises a replication-associated early gene product of a Geminiviridae, Circoviridae or Nanovirus virus.
11. The replicon of claim 1, wherein the ancillary protein comprises a redundant Rep gene ORF from a virus belonging to a Geminiviridae, Circoviridae or Nanovirus virus.
12. The method of claim 9, wherein the ancillary protein comprises a replication-associated early gene product of a Geminiviridae, Circoviridae or Nanovirus virus.
13. The method of claim 9, wherein the ancillary protein comprises a redundant Rep gene ORF from a virus belonging to a Geminiviridae, Circoviridae or Nanovirus virus.