Patent application title:

Nuclear protein

Publication number:

-

Publication date:
Application number:

10/309,175

Filed date:

2002-12-04

✅ Patent granted

Patent number:

US 7,151,162 B2

Grant date:

2006-12-19

PCT filing:

-

PCT publication:

-

Examiner:

Nita Minnifield | Padma Baskar

Adjusted expiration:

2022-12-04

Abstract:

An isolated Shoca polypeptide comprising:

    • (i) the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4; or
    • (ii) a variant thereof which is capable of interacting with a polypeptide of the wnt signalling pathway; or
    • (iii) a fragment of (i) or (ii) which is capable of interacting with a polypeptide of the wnt signalling pathway, a polypeptide encoding said polypeptide, a method for identifying a modulator of the wnt signalling pathway utilising said polypeptide or polynucleotide and methods of diagnosing and treating cancer.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07K1/00 IPC

General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length

C07K14/47 IPC

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

C07H21/04 IPC

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical

C12P21/02 IPC

Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione

C12N5/06 IPC

Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor Animal cells or tissues; Human cells or tissues

Description

This application claims the benefit of provisional Appln. No. 60/336,176, filed Dec. 6, 2001; the entire content of which is hereby incorporated by reference in this application.

FIELD OF THE INVENTION

The present invention relates to a novel signalling protein associated with healthy, neoplastic and oncogenic tissues. The invention also relates to screening methods for identifying modulators of activity and/or expression of the signalling protein and to associated methods of diagnosis, prognosis and therapy of cancer.

BACKGROUND TO THE INVENTION

Human cancer results from the accumulation of independent genetic alterations which effect the transcriptional programs normally responsible for controlling cell growth and survival. Cancers within a single clinical category may exhibit seemingly disparate genetic defects that are, however, part of a common signal transduction pathway. The discovery of the wnt signalling pathway (summarised in FIG. 1) and the structure/function analysis of its distinct molecular components has provided an outstanding example for the identification of common denominators in oncogenesis (Polakis (2000) Genes & Development 14:1837–1851; Peifer and Polakis (2000) Science 287: 1606–1609).

Wnt signalling is initiated by members of the family of secreted wnt glycoproteins which bind to one or several of their specific cell surface receptors, designated frizzled. This family of seven-path-transmembrane receptors activate the dishevelled protein upon binding of their respective ligand. Associated with axin, dishevelled prevents glycogen synthase kinase-3β from phosphorylating critical substrates such as β-catenin. Other substrates include the negative regulators axin itself and APC. Unphosphorylated β-catenin escapes degradation via the ubiquitin pathway and translocates to the nucleus where it associates with transcription factors such as T-cell factor (TCF) and leucocyte enhancer factor (LEF). In mammals, the number of identified target genes transcriptionally regulated by way of wnt signalling is still limited but includes c-myc, cyclin D1, c-jun, matrix metalloproteinases and CD44.

There have been numerous reports on transcipional overexpression, and sometimes underexpression, of wnt genes in human cancers but mRNA expression levels are merely correlative. More compelling evidence for the involvement of wnt-mediated signals in neoplastic transformation stems from mutational analysis of regulatory genes operational in wnt signal transduction. For example, certain mutations in β-catenin render this protein refractory to inhibition by APC and thus prevent its degradation. In consequence, constituitive activation of β-catenin/TCF regulated gene transcription occurs. Similarly, mutational changes in APC and axin can disrupt the normal regulation of β-catenin and have been associated with various forms of tumours. Thus, characterizing wnt molecules, their signal transduction pathway and their biological effects will further aid the interpretation of direct and epigenetic evidence implicating wnts in oncogenesis including the generation of colorectal carcinoma, familial adenomatous polyposis, sporadic desmoid (i.e. aggressive fibromatosis), gastric cancer, hepatoblastoma, Wilm's tumor, melanoma, pancreatic tumors, anaplastic thyroid tumors, medulloblastoma, endometrial ovarian cancer, prostate cancer, and acute lymphoblastic leukemia.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a schematic picture of the Wnt signaling pathway. The abreviations used are:

sFRP: sluable Frizzled Receptor Protein

Fz: Frizzled

Dvl: Dishevelled

JNK: Jun-kinase pathway

PI3-K: Phosphatidylinositide 3 OH Kinase

Akt: Protein Kinase B

GSK-3β: Glycogen Synthase Kinase 3β

TCF: T Cell Factor

FIG. 2 is a comparison of the N-terminal amino acid sequences of mouse, human and zebra fish Shoca proteins.

FIG. 3 is a comparison of the SH2 domain of mouse and human Shoca-1 and Shoca-2.

FIG. 4 is an alignment of the amino acid sequences of mouse and human Shoca-1.

FIG. 5 shows a structure prediction of Shoca-1, revealing a coiled-coiled domain and a C-terminally located SH2 domain.

FIG. 6 shows Shoca-1 (FIG. 6A) and Shoca-2 (FIG. 6B) expression profiles in adult C57B6 mouse tissues analysed using a TaqMan assay.

FIG. 7 shows the results of a luciferase reporter gene assay demonstrating that Shoca-1 modulates the transcriptional activation of β-catenin-LEF/TCF regulated activation. Expression of wild-type mouse Shoca-1 suppresses the spontaneous activity of a reporter gene while a mutant (R-K) disabling the SH2 domain fails to exert a suppressive effect depending on the cellular context.

BRIEF DESCRIPTION OF THE SEQUENCES

SEQ ID NO: 1 shows the nucleotide and amino acid sequences of murine Shoca-1.

SEQ ID NO: 2 shows the amino acid sequence of murine Shoca-1.

SEQ ID NO: 3 shows the nucleotide and amino acid sequences of human Shoca-1.

SEQ ID NO: 4 shows the amino acid sequence of human Shoca-1.

SEQ ID NO: 5 shows the nucleotide and amino acid sequences of murine Shoca-2.

SEQ ID NO: 6 shows the amino acid sequence of murine Shoca-2.

SEQ ID NO: 7 shows the nucleotide and amino acid sequences of human Shoca-2.

SEQ ID NO: 8 shows the amino acid sequence of human Shoca-2.

SEQ ID NO: 9 shows the N-terminal amino acid sequence of human Shoca-1.

SEQ ID NO: 10 shows the N-terminal amino acid sequence of murine Shoca-1.

SEQ ID NO: 11 shows the N-terminal amino acid sequence of human Shoca-2.

SEQ ID NO: 12 shows the N-terminal amino acid sequence of murine Shoca-2.

SEQ ID NO: 13 shows the N-terminal amino acid sequence of zebra fish homologue A.

SEQ ID NO: 14 shows the N-terminal amino acid sequence of zebra fish homologue B.

SEQ ID NO: 15 shows the amino acid sequence of the SH2 domain of human Shoca-1.

SEQ ID NO: 16 shows the amino acid sequence of the SH2 domain of murine Shoca-1.

SEQ ID NO: 17 shows the amino acid sequence of the SH2 domain of human Shoca-2.

SEQ ID NO: 18 shows the amino acid sequence of the SH2 domain of murine Shoca-2.

SEQ ID NO: 19 shows the amino acid sequence of peptide Shoca #0 used to generate Shoca antibodies.

SEQ ID NO: 20 shows the amino acid sequence of peptide Shoca #1 used to generate anti-Shoca antibodies.

SEQ ID NO: 21 shows the amino acid sequence of peptide Shoca #2 used to generate anti-Shoca antibodies.

SEQ ID NO: 22 shows the amino acid sequence of peptide Shoca #3 used to generate anti-Shoca antibodies.

SEQ ID NO: 23 shows the amino acid sequence of peptide Shoca #4 used to generate anti-Shoca antibodies.

SEQ ID NO: 24 shows the amino acid sequence of peptide Shoca #5 used to generate anti-Shoca antibodies.

SUMMARY OF THE INVENTION

The present inventors have identified in mouse and human tissue a novel gene whose product is directly involved in wnt-mediated signalling. The gene (SEQ ID NO: 1 and SEQ ID NO: 3) encodes an SH2-domain containing adaptor protein of 52 kDa (as demonstrated by Western blotting) and has thus been designated Shoca-1. Subsequently, a second mouse Shoca-like gene (Shoca-2) has been identified by use of EST analysis in the public domain (SEQ ID NO: 5). A human Shoca-2 homologue has also been identified on the basis of sequence homology (SEQ ID NO: 7).

The inventors have carried out an extensive molecular analysis of Shoca, characterised its function ex vivo and have shown that its expression in normal tissues is absent or low and that its expression is correlated with oncogenic changes in various tissues. The expression pattern of Shoca-1 and the functional effects of Shoca-mediated modulation of Wnt signals suggest a central role for this family of molecules in the process of cell fate determination. In analogy to other molecules affecting Wnt signal transduction, impairment of regular Shoca function may affect the cellular homeostasis in different tissues leading from physiological cell growth and differentiation to aberrant cell survival and function. In this context, detection of a functional aberration of Shoca has a diagnostic significance in the prediction of disease progression, therapeutic response and prognosis. Moreover, novel interacting molecules that modulate Shoca function will provide unique tools to interfere with uncontrolled cell differentiation and proliferation. The inventors have thus shown that Shoca may be important in regulating normal physiology and homeostasis of cells and that Shoca may be useful for diagnosis, risk assessment and therapy of human malignancies.

Accordingly, the present invention provides:

    • an isolated Shoca polypeptide comprising:
      • (i) the amino acid sequence of SEQ ID NO; 2 or SEQ ID NO: 4; or
      • (ii) a variant thereof which is capable of interacting with a polypeptide of the wnt signalling pathway; or
      • (iii) a fragment of (i) or (ii) which is capable of interacting with a polypeptide of the wnt signalling pathway;
    • a polynucleotide encoding a polypeptide according to the invention;
    • a polynucleotide encoding a Shoca polypeptide capable of interacting with a polypeptide of the wnt signalling pathway, which polynucleotide comprises:
      • (i) the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3 and/or a sequence complementary thereto;
      • (ii) a sequence which hybridizes under stringent conditions to a sequence defined in (i);
      • (iii) a sequence that is degenerate as a result of the genetic code to a sequence as defined in (i) or (ii); or
      • (iv) a sequence having at least 85% identity to a sequence as defined in (i), (ii) or (iii);
    • an expression vector comprising a polynucleotide according to the invention;
    • a host cell comprising a vector according to the invention;
    • an antibody specific for a polypeptide according to the invention;
    • a method of identifying an agent capable of modulating the wnt signalling pathway, which method comprises:
      • (i) providing a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 4, or a variant thereof, or a fragment of either thereof which variant or fragment is capable of interacting with a polypeptide of the wnt signalling pathway or a polynucleotide encoding said polypeptide; and a test agent;
      • (ii) contacting the polypeptide or polynucleotide and the test agent; and
      • (iii) determining whether the test agent has any effect on the expression of said polypeptide or on a function or property of said polypeptide thereby determining whether the test agent is capable of modulating Shoca activity;
    • an agent capable of modulating Shoca activity identified by a method according to the invention for use in a method of treatment of the human or animal body by therapy or in a method of diagnosis carried out on the human or animal body;
    • use of an agent identified by a method according to the invention in the manufacture of a diagnostic agent or a medicament for use in the diagnosis or treatment of cancer;
    • a method of diagnosing cancer which method comprises determining the level of Shoca expression in a tissue sample from a subject;
    • a method of predicting the progression of a tumour which method comprises determining the level of Shoca expression in a tissue sample from a subject;
    • use of an anticancer agent in the manufacture of a medicament for treating cancer in an individual wherein the individual has been diagnosed as having cancer using a method according to the invention; and
    • a method of treating cancer, which method comprises:
      • (i) identifying an agent capable of modulating Shoca activity; and
      • (ii) administering a therapeutically effective amount of said agent to a human or animal subject in need to thereof.

DETAILED DESCRIPTION OF THE INVENTION

Proteins

The present invention relates to a novel protein of the wnt signaling pathway, referred to herein as Shoca, functional variants thereof and functional fragments of Shoca or of variants of Shoca. Sequence information for murine Shoca-1 is provided in SEQ ID NO: 1 (nucleotide and amino acid) and in SEQ ID NO: 2, sequence information for human Shoca-1 is provided in SEQ ID NO: 3 (nucleotide and amino acid) and in SEQ ID NO: 4, sequence information for murine Shoca-2 is provided in SEQ ID NO: 5 (nucleotide and amino acid) and in SEQ ID NO: 6 and sequence information for human Shoca-2 is provided in SEQ ID NO: 7 (nucleotide and amino acid) and in SEQ ID NO: 8. A polypeptide of the invention thus consists essentially of the amino acid sequence of SEQ ID NO: 2, 4, 6 or 8 or of a variant of any one of these sequences, or of a fragment of any one of these sequences or variants.

Polypeptides of the invention may be in a substantially isolated form. It will be understood that the polypeptide may be mixed with carriers or diluents which will not interfere with the intended purpose of the polypeptide and still be regarded as substantially isolated. A polypeptide of the invention may also be in a substantially purified form, in which case it will generally comprise the polypeptide in a preparation in which more than 50%, e.g. more than 80%, 90%, 95% or 99%, by weight of the polypeptide in the preparation is a polypeptide of the invention. Routine methods can be employed to purify and/or synthesise the proteins according to the invention. Such methods are well understood by persons skilled in the art, and include techniques such as those disclosed in Sambrook et al, Molecular Cloning: a Laboratory Manual, 2nd Edition, CSH Laboratory Press, 1989, the disclosure of which is included herein in its entirety by way of reference.

The term “variant” refers to a polypeptide which shares at least one property or function with Shoca-1. A “fragment” of the invention also possesses at least one function or property of Shoca-1. Shoca-1 is a signalling protein of the wnt signaling pathway. Shoca-1 may also be a signalling protein of any other pathway regulating cell survival, proliferation or differentiation. Preferably a variant polypeptide is one which is capable of interacting with a molecule of the wnt signalling pathway, preferably a nuclear molecule. Preferably, a variant polypeptide is capable of interacting with LEF, TCF and/or β-catenin. A variant may interact with an endogenous Shoca protein. Preferably the variant polypeptide is capable of modulating β-catenin-LEF/TCF regulated transcription. Preferably modulation of β-catenin-LEF/TCF transcription by a polypeptide of the invention is tissue specific, for example with repression occurring in thymic epithelial cells and stimulation occurring in fibroblasts.

A variant polypeptide of the invention may typically be identified by monitoring for a function of Shoca such as binding to LEF and/or TCF and/or β-catenin, modulating expression of a reporter gene under the control of LEF/TCF responsive control sequences.

The SH2 domain of Shoca-1 is essential for the repression of LEF/TCF mediated transcription in thymic epithelial cells. It is, therefore, preferred that a variant or fragment of Shoca comprises a functional SH2 domain. Other preferred fragments and variants and variants may comprise other functional domains of Shoca-1, such as a coiled-coil domain or a phosphorylation site.

Shoca is almost exclusively expressed in the nucleus. Preferred fragments and variants may contain a nuclear localisation sequence. Mutants of Shoca-1 missing the first N-terminal 50 amino acids fail to translocate from the cytoplasm to the nucleus, suggesting that a motif within this sequence contains a nuclear localisation sequence. It is, therefore, preferred that a variant or fragment of the invention comprises an N-terminal domain including a nuclear localisation sequence. More preferably, the variant or fragment contains the sequence from position 56 to position 63 of SEQ ID NO: 4.

In another aspect of the invention, a variant is one which does not show the same activity as Shoca but is one which inhibits a basic function of Shoca, i.e. has dominant-negative activity. For example, a variant polypeptide is one which inhibits modulation of LEF/TCF mediated transcription by Shoca.

The identity between the different Shoca proteins at the amino acid level are as follows: Human Shoca-1 is 91% identical to mouse Shoca-1; human Shoca-2 is 72% identical to mouse Shoca-2; human Shoca-1 is 40% identical to human Shoca-2; mouse Shoca-1 is 40% identical to mouse Shoca-2.

Typically, polypeptides with more than about 40% identity preferably at least 70%, at least 80% or at least 90% and particularly preferably at least 91% at least 95% at least 97% or at least 99% identity, with the amino acid sequence of SEQ ID NO: 2 or 4, are considered as variants of the proteins. Such variants may include allelic variants and the deletion, modification or addition of single amino acids or groups of amino acids within the protein sequence, as long as the peptide retains at least one function or property of Shoca. Preferably a variant of SEQ I NO: 2 or 4 will have the same domain structure as Shoca-1, i.e. a coiled-coil domain and/or a C-terminal SH2 domain.

Amino acid substitutions may be made, for example from 1, 2 or 3 to 10, 20 or 30 substitutions. The modified polypeptide generally retains activity as a wnt signaling molecule. Conservative substitutions may be made, for example according to the following Table. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other.

ALIPHATIC Non-polar G A P
I L V
Polar-uncharged C S T M
N Q
Polar-charged D E
K R
AROMATIC H F W Y

Variant polypeptides within the scope of the invention may be generated by any suitable method, for example by gene shuffling (molecular breeding) techniques.

Shorter polypeptide sequences are within the scope of the invention. For example, a peptide fragment of at least 20 amino acids or up to 50, 60, 70, 80, 100, 150 or 200 amino acids in length is considered to fall within the scope of the invention as long as it demonstrates a basic biological functionality of Shoca. In particular, but not exclusively, this aspect of the invention encompasses the situation when the protein is a fragment of the complete protein sequence and may represent a LEF/TCF-binding region. Such fragments can be used to construct chimeric molecules. Such fragments of Shoca or a variant thereof can also be used to raise anti-Shoca antibodies.

WO 01/54733 identifies (amongst many others) an amino acid sequence of 235 amino acids in length corresponding to residue 220 through to 454 of the amino acid sequence of SEQ ID NO: 7. No function is attributed to this peptide in WO 01/54733. This peptide is not a preferred fragment in accordance with the present invention. WO 01/53455 identifies, amongst many others, SEQ ID NO: 931, the sequence of which, beginning at the fourth residue, corresponds to residues 266 through to 454 of the amino acid sequence of SEQ ID NO: 7. No specific function is attributed to this peptide in WO 01/53455. This peptide is not a preferred fragment in accordance with the present invention.

Polypeptides of the invention may be chemically modified, e.g. post-translationally modified. For example, they may be glycosylated or comprise modified amino acid residues. They may also be modified by the addition of histidine residues to assist their purification or by the addition of a nuclear localisation sequence to promote translocation to the nucleus. Such modified polypeptides fall within the scope of the term “polypeptide” of the invention.

Polynucleotides

The invention also includes nucleotide sequences that encode for Shoca or a variant or fragment thereof as well as nucleotide sequences which are complementary thereto. The nucleotide sequence may be RNA or DNA including genomic DNA, synthetic DNA or cDNA. Preferably the nucleotide sequence is a DNA sequence and most preferably, a cDNA sequence. Nucleotide sequence information for murine and human Shoca-1 is provided in SEQ ID NOs: 1 and 3 respectively and nucleotide sequence information for murine and human Shoca-2 is provided in SEQ ID NOs: 5 and 7 respectively. Such nucleotides can be isolated from cells or synthesised according to methods well known in the art, as described by way of example in Sambrook et al, 1989.

Typically a polynucleotide of the invention comprises a contiguous sequence of nucleotides which is capable of hybridizing under selective conditions to the coding sequence or the complement of the coding sequence of SEQ ID NO: 1. Such sequences include the sequences shown in SEQ ID NOs: 3, 5 and 7.

A polynucleotide of the invention can hybridize to the coding sequence or the complement of the coding sequence of SEQ ID NO: 1 at a level significantly above background. Background hybridization may occur, for example, because of other cDNAs present in a cDNA library. The signal level generated by the interaction between a polynucleotide of the invention and the coding sequence or complement of the coding sequence of SEQ ID NO: 1 is typically at least 10 fold, preferably at least 100 fold, as intense as interactions between other polynucleotides and the coding sequence of SEQ ID NO: 1. The intensity of interaction may be measured, for example, by radiolabelling the probe, e.g. with 32P. Selective hybridisation may typically be achieved using conditions of medium to high stringency. However, such hybridisation may be carried out under any suitable conditions known in the art (see Sambrook et al, 1989. For example, if high stringency is required suitable conditions include from 0.1 to 0.2×SSC at 60° C. up to 65° C. If lower stringency is required suitable conditions include 2×SSC at 60° C.

The coding sequence of SEQ ID NO: 1, 3, 5 or 7 may be modified by nucleotide substitutions, for example from 1, 2 or 3 to 10, 25, 50 or 100 substitutions. The polynucleotide of SEQ ID NO: 1, 3, 5 or 7 may alternatively or additionally be modified by one or more insertions and/or deletions and/or by an extension at either or both ends. A polynucleotide may include one or more introns, for example may comprise genomic DNA. The modified polynucleotide generally encodes a polypeptide which has Shoca activity. Alternatively, a polynucleotide encodes a ligand-binding portion of a polypeptide or a polypeptide which modulates Shoca activity. Degenerate substitutions may be made and/or substitutions may be made which would result in a conservative amino acid substitution when the modified sequence is translated, for example as shown in the Table above.

The identity between the different Shoca proteins at the DNA level are as follows: Human Shoca-1 is 80% identical to mouse Shoca-1; human Shoca-2 is 75% identical to mouse Shoca-2, human Shoca-1 is 57% identical to human Shoca-2; and mouse Shoca-1 is 59% identical to mouse Shoca-2.

A nucleotide sequence which is capable of selectively hybridizing to the complement of the DNA coding sequence of SEQ ID NO: 1 or 3 will generally have at least 50%, at least 57%, at least 60%, at least 70%, at least 80%, at least 88%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the coding sequence of SEQ ID NO: 1 over a region of at least 20, preferably at least 30, for instance at least 40, at least 60, more preferably at least 100 contiguous nucleotides or most preferably over the full length of SEQ ID NO: 1. Preferably the nucleotide sequence encodes a polypeptide which has the same domain structure as Shoca-1, i.e. a coiled-coil domain and/or a C-terminal SH2 domain.

For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology (for example used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p 387–395). The PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (typically on their default settings), for example as described in Altschul (1993) J. Mol. Evol. 36:290–300; Altschul et al (1990) J. Mol. Biol. 215:403–10.

Software for performing BLAST analyses is publicly available through the National Centre for Biotechnology Information (ncbi.nlm. nih.gov). This algorithm involves first identifying high scoring sequence pair (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al, 1990). These initial neighbourhood word hits act as seeds for initiating searches to find HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89: 10915–10919) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.

The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873–5787 and Altschul and Gish (1996) Methods Enzymol. 266: 460–480. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

Any combination of the above mentioned degrees of sequence identity and minimum sizes may be used to define polynucleotides of the invention, with the more stringent combinations (i.e. higher sequence identity over longer lengths) being preferred. Thus, for example a polynucleotide which has at least 90% sequence identity over 25, preferably over 30 nucleotides forms one aspect of the invention, as does a polynucleotide which has at least 95% sequence identity over 40 nucleotides.

The nucleotides according to the invention have utility in production of the proteins according to the invention, which may take place in vitro, in vivo or ex vivo. The nucleotides may be involved in recombinant protein synthesis or indeed as therapeutic agents in their own right, utilised in gene therapy techniques. Nucleotides complementary to those encoding Shoca, or antisense sequences, may also be used in gene therapy.

The present invention also includes expression vectors that comprise nucleotide sequences encoding the proteins of the invention. Such expression vectors are routinely constructed in the art of molecular biology and may for example involve the use of plasmid DNA and appropriate initiators, promoters, enhancers and other elements, such as for example polyadenylation signals which may be necessary, and which are positioned in the correct orientation, in order to allow for protein expression. Other suitable vectors would be apparent to persons skilled in the art. By way of further example in this regard we refer to Sambrook et al. 1989.

Flanking sequences upstream from the ATG site in the Shoca gene are important for the regulation of Shoca expression. It is preferred that flanking sequences needed for the proper expression of Shoca are included in expression vectors of the invention.

Polynucleotides according to the invention may also be inserted into the vectors described above in an antisense orientation in order to provide for the production of antisense RNA. Antisense RNA or other antisense polynucleotides may also be produced by synthetic means. Such antisense polynucleotides may be used as test compounds in the assays of the invention or may be useful in a method of treatment of the human or animal body by therapy.

Preferably, a polynucleotide of the invention in a vector is operably linked to a control sequence which is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector. The term “operably linked” refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence, such as a promoter, “operably linked” to a coding sequence is positioned in such a way that expression of the coding sequence is achieved under conditions compatible with the regulatory sequence.

The vectors may be for example, plasmid, virus or phage vectors provided with a origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter. The vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene in the case of a bacterial plasmid or a resistance gene for a fungal vector. Vectors may be used in vitro, for example for the production of DNA or RNA or used to transfect or transform a host cell, for example, a mammalian host cell. The vectors may also be adapted to be used in vivo, for example in a method of gene therapy.

Promoters and other expression regulation signals may be selected to be compatible with the host cell for which expression is designed. For example, yeast promoters include S. cerevisiae GAL4 and ADH promoters, S. pombe nmt1 and adh promoter. Mammalian promoters include the metallothionein promoter which can be induced in response to heavy metals such as cadmium. Viral promoters such as the SV40 large T antigen promoter or adenovirus promoters may also be used. An IRES promoter may also be used. All these promoters are readily available in the art.

Mammalian promoters, such as β-actin promoters, may be used. Tissue-specific promoters are especially preferred. Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR), the rous sarcoma virus (RSV) LTR promoter, the SV40 promoter, the human cytomegalovirus (CMV) IE promoter, adenovirus, HSV promoters (such as the HSV IE promoters), or HPV promoters, particularly the HPV upstream regulatory region (URR). Viral promoters are readily available in the art.

The vector may further include sequences flanking the polynucleotide giving rise to polynucleotides which comprise sequences homologous to eukaryotic genomic sequences, preferably mammalian genomic sequences, or viral genomic sequences. This will allow the introduction of the polynucleotides of the invention into the genome of eukaryotic cells or viruses by homologous recombination. In particular, a plasmid vector comprising the expression cassette flanked by viral sequences can be used to prepare a viral vector suitable for delivering the polynucleotides of the invention to a mammalian cell. Other examples of suitable viral vectors include herpes simplex viral vectors and retroviruses, including lentiviruses, adenoviruses, adeno-associated viruses and HPV viruses. Gene transfer techniques using these viruses are known to those skilled in the art. Retrovirus vectors for example may be used to stably integrate the polynucleotide giving rise to the polynucleotide into the host genome. Replication-defective adenovirus vectors by contrast remain episomal and therefore allow transient expression.

The invention also includes cells that have been modified to express a Shoca polypeptide of the invention. Such cells include transient, or preferably stable higher eukaryotic cell lines, such as mammalian cells or insect cells, using for example a baculovirus expression system, lower eukaryotic cells, such as yeast or prokaryotic cells such as bacterial cells. Particular examples of cells which may be modified by insertion of vectors encoding for a polypeptide according to the invention include mammalian thymic epithelial cells, fibroblasts, HEK293T, CHO, HeLa, BHK, 3T3 and COS cells. A polypeptide of the invention may be expressed in cells of a transgenic non-human animal, preferably a mouse. A transgenic non-human animal expressing a polypeptide of the invention is included within the scope of the invention.

Antibodies

According to another aspect, the present invention also relates to antibodies, specific for a polypeptide of the invention. Such antibodies are for example useful in purification, isolation or screening methods involving immunoprecipitation techniques or, indeed, as therapeutic agents in their own right. Antibodies may be raised against specific epitopes of the polypeptides according to the invention.

Preferred antibodies are raised against the amino acid sequences shown in SEQ ID Nos: 19, 20 and 21.

Antibodies may be used to impair Shoca function. An antibody, or other compound, “specifically binds” to a protein when it binds with preferential or high affinity to the protein for which it is specific but does substantially bind not bind or binds with only low affinity to other proteins. A variety of protocols for competitive binding or immunoradiometric assays to determine the specific binding capability of an antibody are well known in the art (see for example Maddox et al, J. Exp. Med. 158, 1211–1226, 1993). Such immunoassays typically involve the formation of complexes between the specific protein and its antibody and the measurement of complex formation.

Antibodies of the invention may be antibodies to human polypeptides or fragments thereof. For the purposes of this invention, the term “antibody”, unless specified to the contrary, includes fragments which bind a polypeptide of the invention. Such fragments include Fv, F(ab′) and F(ab′)2 fragments, as well as single chain antibodies. Furthermore, the antibodies and fragment thereof may be chimeric antibodies, CDR-grafted antibodies or humanised antibodies.

Antibodies may be used in a method for detecting polypeptides of the invention in a biological sample, which method comprises:

  • I providing an antibody of the invention;
  • II incubating a biological sample with said antibody under conditions which allow for the formation of an antibody-antigen complex; and
  • III determining whether antibody-antigen complex comprising said antibody is formed.

A sample may be for example a tissue extract, blood, serum and saliva. Antibodies of the invention may be bound to a solid support and/or packaged into kits in a suitable container along with suitable reagents, controls, instructions, etc. Antibodies may be linked to a revealing label and thus may be suitable for use in methods of in vivo Shoca imaging.

Antibodies of the invention can be produced by any suitable method. Means for preparing and characterising antibodies are well known in the art, see for example Harlow and Lane (1988) “Antibodies: A Laboratory Manual”, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. For example, an antibody may be produced by raising antibody in a host animal against the whole polypeptide or a fragment thereof, for example an antigenic epitope thereof, herein after the “immunogen”.

A method for producing a polyclonal antibody comprises immunising a suitable host animal, for example an experimental animal, with the immunogen and isolating immunoglobulins from the animal's serum. The animal may therefore be inoculated with the immunogen, blood subsequently removed from the animal and the IgG fraction purified.

A method for producing a monoclonal antibody comprises immortalising cells which produce the desired antibody. Hybridoma cells may be produced by fusing spleen cells from an inoculated experimental animal with tumour cells (Kohler and Milstein (1975) Nature 256, 495–497).

An immortalized cell producing the desired antibody may be selected by a conventional procedure. The hybridomas may be grown in culture or injected intraperitoneally for formation of ascites fluid or into the blood stream of an allogenic host or immunocompromised host. Human antibody may be prepared by in vitro immunisation of human lymphocytes, followed by transformation of the lymphocytes with Epstein-Barr virus and in transgenic mice enabling production of human antibodies.

For the production of both monoclonal and polyclonal antibodies, the experimental animal is suitably a goat, rabbit, rat or mouse. If desired, the immunogen may be administered as a conjugate in which the immunogen is coupled, for example via a side chain of one of the amino acid residues, to a suitable carrier. The carrier molecule is typically a physiologically acceptable carrier. The antibody obtained may be isolated and, if desired, purified.

Assays

An important aspect of the present invention is the use of polypeptides according to the invention in screening methods. The screening methods may be used to identify substances that bind to Shoca polypeptides or mRNAs. Screening methods may also be used to identify modulators, which may be inhibitors or activators of Shoca activity, and/or agents which up-regulate or down-regulate Shoca expression. Generally, an agent capable of binding Shoca, modulating Shoca activity and/or modulating Shoca expression will be capable of modulating the wnt signalling pathway.

Any suitable format may be used for the assay. In general terms such screening methods may involve contacting a polypeptide of the invention with a test agent and monitoring for binding of the test agent to the polypeptide or measuring Shoca activity. A polypeptide of the invention may be incubated with a test agent. Modulation of Shoca activity may be determined. In a preferred aspect, the assay is a cell-based assay. Preferably the assay may be carried out in a single well of a microtitre plate. Assay formats which allow high throughput screening are preferred.

Modulator activity can be determined by contacting cells expressing a polypeptide of the invention with an agent under investigation and by monitoring an effect mediated by the polypeptide. The cells expressing the polypeptide may be in vitro or in vivo. The polypeptide of the invention may be naturally or recombinantly expressed. Preferably, the assay is carried out in vitro using cells expressing recombinant polypeptide. Preferably, control experiments are carried out on cells which do not express the polypeptide of the invention to establish whether the observed responses are the result of activation of the polypeptide. Typically the cells will express other molecules of the wnt signalling pathway such as β-catenin, LEF and/or TCF.

A method of identifying an agent capable of modulating the wnt signalling pathway, may consist essentially of:

    • (i) providing a polypeptide of the invention or a polynucleotide of the invention encoding said polypeptide and a test agent;
    • (ii) contacting the polypeptide or polynucleotide and the test agent; and
    • (iii) monitoring any interaction between the polypeptide or polynucleotide and the test agent, thereby determining whether the test agent is capable of modulating the Wnt signalling pathway.

An interaction between the polypeptide or polynucleotide and the test agent may be monitored directly by monitoring binding of the polypeptide or polynucleotide to the test agent. Preferably direct binding of the test agent to the polypeptide or to the mRNA encoding the polypeptide is monitored. For example, a radiolabelled test agent can be incubated with the polypeptide of the invention and binding of the test agent to the polypeptide can be monitored.

Assays may be carried out using cells expressing Shoca, and incubating such cells with the test agent. The results of the assay are compared to the results obtained using the same assay in the absence of the test agent. Cells expressing Shoca constitutively may be provided for use in assays for Shoca function. Alternatively, an interaction between the polypeptide or polynucleotide and the test agent may be monitored indirectly by monitoring activity of a Shoca polypeptide of the invention. An agent capable of modulating the wnt signalling pathway may be an inhibitor of Shoca activity or may be an activator of Shoca activity.

Shoca activity may be determined by monitoring an effect of stimulation or inhibition of Shoca activity on cells, for example by monitoring cell proliferation, differentiation, growth or survival.

Shoca activity may be determined by monitoring phosphorylation of a polypeptide of the invention and determining whether the test agent inhibits or enhances phosphorylation.

Shoca binds directly or indirectly to LEF/TCF transcription factors and/or co-associates with β-catenin in the nucleus. Shoca may repress or activate β-catenin-LEF/TCF mediated transcription in the nucleus depending on the cellular context. For Shoca to exert an effect on such transcription it must be present in the nucleus. Therefore, Shoca activity may be determined by monitoring the intracellular location of a polypeptide of the invention, and in particular translocation to the nucleus.

A method of the invention may be used to identify an agent which inhibits or enhances binding of Shoca to a molecule of the wnt signalling pathway such as β-catenin, LEF and/or TCF. A method of identifying an agent capable of modulating the wnt signalling pathway according to the invention may further comprise providing a molecule of the wnt signalling pathway capable of interacting with Shoca. The polypeptide or polynucleotide and the test agent and the wnt signalling molecule may then be contacted under conditions suitable for the interaction of the polypeptide and the wnt signalling molecule and the effect of the test agent on the interaction of the polypeptide and the wnt signalling molecule may be determined by monitoring the interaction. Preferably the wnt signalling molecule is β-catenin, TCF, LEF or any combination of β-catenin, TCF or/and LEF.

Substances that inhibit the interaction of a Shoca polypeptide of the invention with a wnt signalling molecule such as β-catenin, LEF or TCF may also be identified through a mammalian 2-hybrid assay, yeast 2-hybrid assay, yeast 3-hybrid assay (protein-DNA interaction assay) or other protein interaction assay such as a co-immunoprecipitation or an ELISA based technique.

Agents capable of modulating the wnt signalling pathway may be identified by determining whether a test agent inhibits or enhances modulation of gene transcription by a Shoca polypeptide of the invention. The effect of a test agent on Shoca-mediated repression or activation of gene expression may thus be monitored in a method of the invention. Typically, a reporter gene construct comprising a reporter gene under the transcriptional control of LEF and/or TCF is provided and contacted with a polypeptide of the invention and a test agent under conditions suitable for expression of a reporter gene. Expression of the reporter gene may be monitored and compared to expression in a control experiment without the test agent to determine whether the test agent modulates Shoca activity.

Assays may also be carried out to identify agents which modify Shoca expression, for example substances which up- or down-regulate expression. Generally, in such assays a polynucleotide of the invention is contacted with the test agent. The polynucleotide may be mRNA and the test agent may modulate translation. Preferably the polynucleotide is DNA and the test agent preferably modulates transcription. Such assays may, alternatively, be carried out for example by using antibodies for Shoca to monitor levels of Shoca expression.

Additional control experiments may be carried out.

Suitable test agents which can be tested in the above assays include combinatorial libraries, defined chemical entities and compounds, peptide and peptide mimetics, oligonucleotides and natural product libraries, such as display (e.g. phage display libraries) and antibody products.

Typically, organic molecules will be screened, preferably small organic molecules which have a molecular weight of from 50 to 2500 daltons. Candidate products can be biomolecules including, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.

Test agents may be used in an initial screen of, for example, 10 agents per reaction, and the agents of these batches which show inhibition or activation tested individually. Test agents may be used at a concentration of from 1 nM to 1000 μM, preferably from 1 μM to 100 μM, more preferably from 1 μM to 10 μM. Preferably, Shoca activity in the presence of a test agent is compared to the activity shown in the absence of the test agent. A test agent which acts as an inhibitor may produce a 50% inhibition of Shoca activity. Alternatively a test agent which acts as an activator may enhance Shoca activity by 50%.

The activity of Shoca on β-catenin-LEF/TCF transcriptional activity is tissue-specific. For example, in thymic epihelial cells Shoca acts to repress such transcriptional activity but in fibroblasts Shoca stimulates transcription of gene sequences under the control of LEF/TCF. In one embodiment the present invention provides a method for identifying a cellular component that interacts with Shoca and which is responsible for determining the tissue-specific activity of Shoca. Such a method typically comprises any assay described herein for the identification of a modulator of the wnt signalling pathway in which the test agent is a cellular component. Suitable test agents include for example, a crude cellular extract, a fraction of a cellular extract, proteins purified from a cellular extract or a protein isolated from the cell type or tissue of interest.

Another aspect of the present invention is the use of polynucleotides encoding the Shoca polypeptides of the invention to identify mutations in Shoca genes which may be implicated in human disorders and, in particular, susceptibility to cancer. Identification of such mutations may be used to assist in diagnosis or susceptibility to such disorders and in assessing the physiology of such disorders. Polynucleotides may also be used in hybridisation studies to monitor for up- or down-regulation of Shoca expression. Polynucleotides such as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 or fragments thereof may be used to identify allelic variants, genomic DNA and species variants.

Diagnosis

The present invention provides a method for detecting variation in the expressed products encoded by Shoca genes. This may comprise determining the level of Shoca expressed in cells or determining specific alterations in the expressed product. Sequences of interest for diagnostic purposes include, but are not limited to, the conserved portions as identified by sequence similarity and conservation of intron/exon structure. The diagnosis may be performed in conjunction with kindred studies to determine whether a mutation of interest co-segregates with disease phenotype in a family.

The present inventors have shown that Shoca is expressed in many different cell types and neoplastic tissues. In particular, Shoca is involved in distinct tumour types including breast cancer, colon cancer and cervical cancer. Normal tissue from a broad range of organs was found to be either negative for Shoca or to express low levels of Shoca while expression of Shoca in these tissues was associated with less malignant tumour forms. Further, cancerous progression was shown to coincide with a loss of Shoca expression in many tumours. Accordingly, Shoca is a clinically relevant prognostic marker for tumours, especially breast, colon and cervical tumours. Shoca may also be used as a diagnostic maker for diseases which involve benign tissue changes such as mastopathy, apocrine metaplasia, intraductal hyperplasia, papilloma and carcinoma.

Thus in a further embodiment, the present invention provides a method of diagnosing cancer by determining the level of Shoca expression in a tissue sample from a subject. The invention also provides a method of predicting the progression of a tumour by determining the level of Shoca expression in a tissue sample from a subject. Also provided is a method of diagnosing a disease involving benign tissue changes such as mastopathy, apocrine metaplasia, intraductal hyperplasia, papilloma and carcinoma by determining the level of Shoca expression in a tissue sample from a subject. The level of Shoca expression may be determined by monitoring the level of a polypeptide of the invention or mRNA encoding a polypeptide of the invention. Any suitable tissue sample may be used, for example a biopsy or resection. Preferably the cancer is breast, colon or cervical cancer.

The expression of a Shoca protein or mRNA may be determined using an agent that interacts with Shoca. Suitable agents may be identified using a screening assay of the invention. Preferably, the agent is capable of binding specifically to the Shoca protein. More preferably the agent is an antibody of the invention.

A method of diagnosing cancer, or of predicting the progression of a tumour, or of diagnosing a disease involving benign tissue changes such as mastopathy, apocrine metaplasia, intraductal hyperplasia, papilloma and carcinoma may comprise the steps of:

    • (i) identifying an agent capable of interacting with Shoca;
    • (ii) contacting a sample from a human or animal subject with the agent;
    • (iii) monitoring binding of the agent to the sample; and
    • (iv) determining whether the level of Shoca expression is elevated or reduced in said sample compared to the level of Shoca expression in a sample from a human or animal subject not having cancer or said disease.

Diagnostic procedures may be performed on polynucleotides isolated from an individual or alternatively, may be performed in situ directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary. Appropriate procedures are described in, for example, Nuovo, G. J., 1992, “PCR In Situ Hybridization: Protocols And Applications”, Raven Press, NY. Such analysis techniques include, DNA or RNA blotting analyses, single stranded conformational polymorphism analyses, in situ hybridization assays, and polymerase chain reaction analyses. Such analyses may reveal both quantitative aspects of the expression pattern of Shoca and qualitative aspects of Shoca expression and/or composition.

Alternative diagnostic methods for the detection of Shoca nucleic acid molecules may involve their amplification, e.g. by PCR (the experimental embodiment set forth in U.S. Pat. No. 4,683,202), ligase chain reaction (Barany, 1991, Proc. Natl. Acad. Sci. USA 88:189–193), self sustained sequence replication (Guatelli et al., 1990, Proc. Natl. Acad. Sci. USA 87:1874–1878), transcriptional amplification system (Kwoh et al., 1989, Proc. Natl. Acad. Sci. 15 USA 86:1173–1177), Q-Beta Replicase (Lizardi et al., 1988, Bio/Technology 6:1197) or any other nucleic acid amplification method (for example, Holland et al., 1991, Proc. Natl. Acad. Sci. USA 88:7276–7280), followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.

Particularly suitable diagnostic methods are chip-based DNA technologies such as those described by Hacia et al., 1996, Nature Genetics 14:441–447, Shoemaker et al., 1996, Nature Genetics 14:450–456 and Welford et al., 1998, Nucl. Ac. Res. 26: 3059–3065. Briefly, these techniques involve quantitative methods for analyzing large numbers of nucleic acid sequence targets rapidly and accurately. By tagging with oligonucleotides or using fixed probe arrays, one can employ chip technology to segregate target molecules as high density arrays and screen these molecules on the basis of hybridization.

Following detection, the results seen in a given patient may be compared with a statistically significant reference group of normal patients and patients that have cancer. In this way, it is possible to correlate the amount or kind of Shoca encoded product detected with various cancers or predisposition to various cancers. Generally, only low levels of Shoca expression or no Shoca expression is seen in tissue from individuals not having a tumour so expression in such a tissue may be an indication of a cancerous tumour.

In an individual known to have a tumour, expression of Shoca may typically indicate that the tumour is not very aggressive and no expression of Shoca in the tumour cells may typically indicate that the tumour is malignant.

Therapeutic Treatment

The present invention also provides a method of treating a cancer in an individual, the method comprising:

    • (i) carrying out a method of diagnosis according to the invention on a tissue sample from the individual; and
    • (ii) administering an anti-cancer agent to the individual.

Another aspect of the present invention is the use of the agents that have been identified by screening techniques referred to above in the treatment of disease states which are responsive to regulation of Shoca activity, such as cancers. In particular, such substances may be used in the treatment of colon, breast and cervical cancers. The treatment may be therapeutic or prophylactic.

Accordingly, the present invention provides an agent capable of modulating the wnt signalling pathway identified by a method of the invention for use in a method of treatment by the human or animal body by therapy or in a method of diagnosis carried out on the human or animal body. The use of an agent identified by a method of the invention in the manufacture of a medicament for use in the diagnosis or treatment of cancer is also provided.

A method of treating cancer according to the invention may consist essentially of the steps of:

    • (i) identifying an agent capable of modulating Shoca activity; and
    • (ii) administering a therapeutically effective amount of the agent to a human or animal subject in need thereof.

A human or animal subject in need of treatment may be identified by a method of diagnosis according to the invention.

A therapeutically effective amount of an agent is an amount which when administered to a patient with cancer, improves the condition of a patient. The condition of a patient may be improved if one or more symptom of cancer is allieviated. The agent may, for example, kill tumour cells or inhibit tumour progression.

Agents identified according to the screening methods outlined above may be formulated with standard pharmaceutically acceptable carriers and/or excipients as is routine in the pharmaceutical art. For example, a suitable agent may be dissolved in physiological saline or water for injections. The exact nature of a formulation will depend upon several factors including the particular agent to be administered and the desired route of administration. Suitable types of formulation are fully described in Remington's Pharmaceutical Sciences, Mack Publishing Company, Eastern Pennsylvania, 17th Ed. 1985, the disclosure of which is included herein of its entirety by way of reference.

The agents may be administered by enteral or parenteral routes such as via oral, buccal, anal, pulmonary, intravenous, intra-arterial, intramuscular, intraperitoneal, topical or other appropriate administration routes.

A therapeutically effective amount of a modulator is administered to a patient. The dose of a modulator may be determined according to various parameters, especially according to the substance used; the age, weight and condition of the patient to be treated; the route of administration; and the required regimen. A physician will be able to determine the required route of administration and dosage for any particular patient. A typical daily dose is from about 0.1 to 50 mg per kg of body weight, according to the activity of the specific modulator, the age, weight and conditions of the subject to be treated, the type and severity of the degeneration and the frequency and route of administration. Preferably, daily dosage levels are from 5 mg to 2 g.

Nucleic acid encoding a Shoca polypeptide of the invention which inhibits or enhances Shoca activity or antisense nucleic acid may be administered to the mammal. Nucleic acid, such as RNA or DNA, and preferably, DNA, is provided in the form of a vector, such as the polynucleotides described above, which may be expressed in the cells of the mammal.

Nucleic acid administered to the mammal for gene therapy may encode a variant of Shoca with an impaired function such as a dominant negative mutant that disrupts the function of endogenous Shoca or may encode a constitutively active variant of Shoca that enhances the function of endogenous Shoca.

Nucleic acid encoding the polypeptide may be administered by any available technique. For example, the nucleic acid may be introduced by needle injection, preferably intradermally, subcutaneously or intramuscularly. Alternatively, the nucleic acid may be delivered directly across the skin using a nucleic acid delivery device such as particle-mediated gene delivery. The nucleic acid may be administered topically to the skin, or to mucosal surfaces for example by intranasal, oral, intravaginal or intrarectal administration.

Uptake of nucleic acid constructs may be enhanced by several known transfection techniques, for example those including the use of transfection agents. Examples of these agents includes cationic agents, for example, calcium phosphate and DEAE-Dextran and lipofectants, for example, lipofectam and transfectam. The dosage of the nucleic acid to be administered can be altered. Typically the nucleic acid is administered in the range of 1 pg to 1 mg, preferably to 1 pg to 10 μg nucleic acid for particle mediated gene delivery and 10 μg to 1 mg for other routes.

The following Examples illustrate the invention.

EXAMPLE 1

Shoca-1, a Novel Gene Involved in Wnt-mediated Signalling

We have recently identified in mouse and human tissue a novel gene whose product is directly involved in wnt-mediated signalling. The gene (SEQ ID NO: 1 and SEQ ID NO: 3) encodes an SH2-domain containing adaptor protein of 52 kDa (as demonstrated by Western blotting) and has thus been designated Shoca-1. Subsequently, a second Shoca-like gene has been identified by use of EST analysis in the public domain (SEQ ID NO: 5). Neither existence nor function of these genes have yet been reported in any species.

Mouse Shoca-2 was found by doing a blast search in the EST database using the mouse Shoca-1 cDNA sequence. Using the partial EST sequences, 5′ and 3′ RACE was performed in order to obtain the full coding sequence. Since then a full length cDNA has been submitted to the public databases with a sequence identical to mouse Shoca-2 (accession code AK008803). Similarly, human Shoca-2 was found by BLAST search of the human EST and the human genome databases. Human Shoca-2 is found in the EST database (accession code AK024799). The human Shoca-2 sequence is entirely taken from the EST database.

The chromosomal localisations in human are 10q22-q23.1 for human Shoca-1 and 8pter-p23.3 for human Shoca-2. In addition, a fragmented DNA sequence corresponding to the N-terminal part of mouse Shoca-1 was found in the public domain. However, an error in the open reading frame of this sequence introduced a translation error. By correcting this error (one base pair) an amino acid sequence of 214 residues could correctly be translated.

There is a splice variant for mouse Shoca-1 which has an alternative exon 1 and hence a different amino acid sequence at the N-terminus of the protein. So far no evidence that this variant exists in human (based on the genomic sequence in the Shoca-1 region) has been determined and it is not known if it has any biological function. The mouse and human Shoca-2 differ by a stretch of a few amino acid residues which seem to be coded in a single exon (based on the human genomic sequence). This sequence has some interesting Prosite motifs. So far it is not know if this exon is included in certain mouse transcripts or if it is lacking in certain human transcripts.

The Shoca family is well conserved between mouse and man over the entire sequence revealing a sequence homology between mouse and man of approximately 90% for Shoca-1 and 70% for Shoca-2. The amino acid sequence between the orthologs of mouse and humans displays a 91% homology and 95% similarity (FIG. 4). We have also detected in zebra fish (D. rerio) two Shoca family members (for which there are presently only EST sequences known with accession codes AW419549 and BE016614, respectively). The N-terminal and the C-terminal sequences, where available, of mouse, man and zebra fish are strikingly similar, thus revealing well conserved domains of possibly distinct function(s) (FIGS. 2 and 3). Although bearing an SH2 motif, Shoca-1 is almost exclusively expressed in the nucleus. Mutants of Shoca-1 missing the first N-terminal 50 amino-acids fail to translocate from the cytoplasm to the nucleus, suggesting that a motif within this sequence contains the information for nuclear localization. Predictions have revealed that position 56–63 of SEQ ID NO:4 or 9 (PPKTKRAA) to over 30% probability contains the NLS in human Shoca-1.

EXAMPLE 2

Generation of Shoca Specific Antibodies

Antibody Preparation A

The anti Shoca-1 antibodies (rabbit polyclonal serum) used to determine the subcellular localization were generated in our Institute. Different batches were used whereby the animals were bled at different times after repetitive boosting. The immunogen was a mouse Shoca-1 derived peptide (SEQ ID NO:19) coupled to the carrier protein KLH

  • Peptide Shoca#0: NH2-CLPDTSPPSPLTGPDRTWERPLRC-CONH2

This peptide represents a stretch of 22 amino acids corresponding to the mouse Shoca-1 residue positions 272 through 293. The N-terminal and C-terminal cysteines were introduced to allow loop formation on the protein carrier in order to enhance immunization.

Antibody Preparation B

The anti Shoca-1 antibodies that have been used in the staining experiments in Example 5 were generated in two rabbits by Eurogentec and also represent polyclonal preparations. All preparations used in stainings were affinity-purified using a peptide loaded column. The serum purified was derived from a single animal following the fourth booster immunization. The immunogens represent a mixture of two mouse Shoca-1 derived peptides (SEQ ID NOS:20–21, respectively) coupled to the carrier protein KLH and were injected concommitently:

  • Peptide Shoca#1: NHCOCH3-CGEGPGDKPYEEISEEC-COOH
  • Peptide Shoca#2: NHCOCH3-ADEERSRRAQRARDEYRRC-CONH2

Peptide#1 represents stretch 83 through 97 of mouse Shoca-1 protein sequence, 15 amino acid residues and peptide#2 represents stretch 220 through 237 of mouse Shoca-1 protein sequence, 18 amino acid residues. The N-terminal (for peptide#1) and C-terminal (for both peptides) cysteines were introduced to allow loop formation on the protein carrier for immunization (peptide #1) or to introduce a C-terminal anchoring residue in peptide #2. Both peptides were coupled onto carrier proteins and injected into rabbits concomitantly.

Antibody Preparation C

The human specific anti Shoca-1 antibodies were generated in rabbits by Eurogentec and do also represent a polyclonal preparation. The immunogen represents a human Shoca-1 derived peptide (SEQ ID NO:22) coupled to the carrier protein KLH taking advantage of cysteines added to the specific Shoca sequence N- or C-terminally and the heterobifunctional crosslinker MBS. Peptide-KLH conjugates were injected subcutaneously:

  • Peptide Shoca#3: NHCOCH3-CGLRPPKTKRAASDKHIQC-COOH

Peptide#3 represents the 17 amino acid residues from position 53 through 69 of the human Shoca-1 protein sequence. The preparation used in staining experiments was affinity-purified using a peptide-loaded column as described below. The purified serum was derived from a single animal following the fourth booster immunisation.

Crude antisera were filtered through 0.45 μm filters and affinity-purified on peptide columns. The free peptide, with which animals were immunised, was covalently bound to iodoacetyl-coupled crosslinked agarose via its free sulfhydryl groups (SulfoLink Coupling Gel, Pierce #20401). Unbound reactive iodacetyl groups were quenched with cysteine. Antisera of the respective reactivity were allowed to bind to the peptide-columns. The column-bound fraction was eluted with 0.1 M Glycine, pH 3.0. The eluate was immediately neutralised with 1 M Tris-HCl to achieve pH 7.0. The purified antibodies were equilibrated against PBS (pH 7.3) and concentrated in 50 kD MWCO columns (Vivascience #VS0131). The protein concentration was determined using the BCA method (Pierce #23223/23224) using purchased rabbit IgG as concentration standards (Peprotech #500-P00). The final preparation was stabilised by adding 0.02% NaN3. The serum purified derived from a single animal following the fourth booster immunisation.

Antibody Preparation D

The SH2 domain specific anti Shoca-1 antibodies were generated and affinity-purified as described for antibody preparation C above except that a C-terminal cysteine was introduced as an anchoring residue. SEQ ID NO:23

  • Peptide Shoca#4: NHCOCH3-DASGDFYSFLGVDPNRHC-CONH2

Peptide#4 represents the 17 amino acid residues from position 376 through 392 of the human Shoca-1 protein sequence. This sequence stretch is identical in human and mouse Shoca-1. The peptide was coupled to a carrier protein as described above and injected into rabbits.

Antibody Preparation E

The human specific anti Shoca-2 antibodies were generated and affinity-purified as described for antibody preparation D. SEQ ID NO:24

  • Peptide Shoca#5: NHCOCH3-QQMLADSINRMKC-CONH2

Peptide#5 represents the 12 amino acid residues from position 181 through 192 of the human Shoca-2 protein sequence. This sequence has neither sequence identity with human Shoca-1 nor with mouse Shoca-1 or -2. The peptide was coupled to a carrier protein and injected into rabbits.

Verification of Antibody Preparations

Western blot analysis was performed on various cell and protein material in order to verify the specificity of the antibody preparations. In particular, a blot was analysed with antibody preparation B. HEK293 cells transfected with various mouse Shoca-1 constructs namely 1. HEK293 with control plasmid; 2. HEK293 transfected with mouse Shoca-1 untagged; 3. HEK293 transfected with mouse Shoca-1 C-terminal HA-tag; and 4. HEK293 untransfected.

Antibody preparation B: Single bands corresponding to untagged and HA tagged Shoca-1 were seen in mouse Shoca-1 transfected HEK293 cells (data not shown).

Antibody preparation C: A single band is seen in the nuclear fraction of the human tumour cell line NCI-H520 at the correct molecular weight. No band was detected when staining mouse TEC cells verifying that this preparation is human specific.

Antibody preparation D: Nuclear detection of Shoca-1 in mouse TEC cells was carried out using a blot with antibody preparation D. Cytoplasmic and nuclear fractions of mouse thymic epithelial cells were used: 1. TEC1-2, cytoplasmic; 2. TEC1-2 nuclear (data not shown). Staining of recombinantly expressed mouse Shoca-1 SH2 domain. A blot with anti-penta His antibodies and antibody preparation D respectively were carried out. Bacterial expression of mouse Shoca-1 SH2 domain (14.5 kDa including His tag) was identified, with higher levels being detected 5 hr after induction in the supernatant: 1. supernatant collected 3 hr after induction; 2. supernatant collected 5 hr after induction; 3. pellet collected 5 hr after induction (data not shown). Specificity for other SH2 domain proteins has been tested. GST fused Grb2-SH2 was not stained with antibody preparation D whereas the control anti-GST gave a nice band.

The western blot analysis were performed according to the following protocol. For total lysate, cells were suspended in lysis buffer (75 mM Tris pH8.0; 100 mM NaCl, 1% NP-40, 0.1 mM AEBSF and a protease inhibitor-mix) and centrifuged to remove debris. Supernatants were collected and same protein amounts were subjected to SDS-PAGE on 10% Bis/Tris gels under reducing conditions. Proteins were transferred onto PVDF membrane by semi-dry blotting (buffer: 25 mM Tris, 0.2M glycin, 20% ethanol). Membranes were blocked with 5% milk powder in TBST before incubation with affinity purified anti-Shoca antibodies (100–200 ng/ml). After 3 washes in TBST, membranes were incubated with HRP-coupled anti-rabbit-Ig antibodies (Amersham/Pharmacia) at a dilution of 1:2000. Finally, membranes were washed and developed by ECL-plus (Amersham/Pharmacia) chemiluminescence. For cytosolic versus nuclear lysates, cells were swollen for 15 min on ice in lysis buffer A (10 mM Hepes, 10 mM KCl, 0.1 mM EDTA, 1 mM EGTA, 1 mM DTT, protease inhibitor-mix). NP-40 was then added to a final concentration of 0.6% immediately followed by vortexing for 10 seconds and centrifugation for 30 seconds. The supernatant was referred to as cytosolic extract. The pellet was washed once in buffer A, resuspended in buffer B (20 mM Hepes, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, protease inhibitor-mix) and vortexed for 30 min at 4° C. After centrifugation for 5 min the supernatant was recovered as nuclear extract.

EXAMPLE 3

Shoca-1 and Shoca-2 Expression Profile

Shoca-1 is expressed in mice in thymic epithelial cells as early as the first detection of a thymic anlage and is also present in thymi of nude mice. Thus, Shoca-1 expression is independent of thymic lymphopoiesis and in particular the structured cross-talk between thymocytes and thymic epithelial cells. Shoca-1 expression has also been detected in bone marrow and in particular in stroma cells known to support hematopoiesis. Brain, kidney, and lung constitute other sites where Shoca-1 is expressed at low abundancy when assayed by PCR (FIG. 6), although Northern blotting was insufficiently sensitive to detect specific transcripts. By contrast, Shoca-2 expression is much more commonly expressed in different tissues (FIG. 6).

EXAMPLE 4

Functional Studies Reveal Epistatic Placement of Shoca-1 in the Wnt/β-catenin Signalling Pathway

The functional in vitro analysis of Shoca-1 has revealed that its expression in thymic epithelial cells represses the transcriptional activation of β-catenin-LEF/TCF regulated activation of a reporter gene. This suppression is dependent on a functional SH2-domain as a point mutation in that domain ablates any repressive function (FIG. 7). Arg350 (of mouse Shoca-1) in the SH2 domain was changed to a lysine residue. This arginine is located in the pTyr pocket and is critical for the SH2 domain function (Sawyer, 1998, Biopolymers 47: 243–261). It forms important contacts with the phosphate oxygen of the pTyr side chain of pTyr containing ligands to the SH2 domain. Overexpression of the R/K mutant of Shoca-1 has furthermore been associated with a decreased cellular proliferation. Electric mobility shift assays using Shoca-1 specific antibodies revealed that Shoca-1 is complexed with LEF/TCF.

This finding has been further confirmed in independent experiments where DNA sequences encoding the TCF-binding sequences could trap Shoca-1 from nuclear extracts. In these experiments, a biotinylated dsDNA adaptor containing a TCF binding site was incubated with nuclear extract from murine TEC 1-2 cells. The adaptor (and hence proteins complexed to the TCF binding site) was captured using paramagnetic streptavidin beads. The beads were washed, mixed with protein sample buffer, loaded on a PAGE gel and blotted onto a nitrocellulose membrane. Western analysis was then performed using polyclonal rabbit anti-Shoca antibody as a primary antibody.

The interaction with a transcriptionally active complex containing not only LEF/TCF but also β-catenin is further corroborated by confocal microscopy which shows that Shoca co-localizes with β-catenin in the nucleus. In addition, increased phosphorylation is observed of Shoca-1 after Li stimulation. This was demonstrated by incubating murine TEC 1-2 cells with medium containing 20 mM lithium for different timepoints, immunoprecipitating Shoca-1 using polyclonal rabbit anti-Shoca antibody, separating the proteins on a PAGE gel and probing with a phosphotyrosine specific antibody in a Western analysis.

All in all, these data support a very central and epistatic placement of the Shoca proteins in the Wnt/β-catenin signalling pathway. In contrast to the observations in thymic epithelial cells, Shoca-1 overexpression in fibroblast stimulates LEF/TCF-dependent transcription of a reporter gene thus arguing for further tissue-specific molecules functionally and/or physically interacting with Shoca-1. Thus, Shoca-1 may effect a tissue specific repressor function in possible combination with a secondary molecule.

EXAMPLE 5

Tissue Restricted Expression and Role of Shoca in Oncogenesis

The major role of Wnt signalling in adult tissues is the regulation of cell proliferation. Constitutive mutations in APC or β-catenin lead to hyperproliferation and carcinogenesis. Results from screening arrays containing normal and malignant tissue from different human organs has revealed that a number of tumours mainly of epithelial cell origin express Shoca-1 (Table 1).

TABLE 1
Tissue micro array immunostaining for Shoca-1 expression
N = Number of samples that could be analysed
Score = Number of moderate to strong stainers divided by N
Percentage = Percentage value of score
Any score above 0.3 was taken as significant and marked with an asterisk
Pathology N Neg. Weak Mod. Strong Score Percentage
Adenomatoid tumor 8 1 0 3 4 7/8 87.5% *
Adrenal gland, adenoma 15 12 0 3 0  3/15 20.0%
Adrenal gland, cancer 6 4 0 1 0 1/6 16.7%
Angiosarcoma 3 0 1 1 1 2/3 66.7% *
Anus, squamous cell cancer 5 3 0 2 0 2/6 40.0%
Astrocytoma 34 23 1 8 2 10/34 29.4%
Benign histiocytoma 26 5 5 6 10 16/25 61.5% *
Breast, apocrine cancer 2 0 1 1 0 1/2 50.0% *
Breast, cribriform cancer 8 5 1 2 0 2/8 25.0%
Breast, ductal cancer 46 23 8 12 3 15/46 32.6% *
Breast, lobular cancer 37 5 10 13 9 22/37 59.5% *
Breast, medullary cancer 27 19 4 4 0  4/27 14.8%
Breast, mucinous cancer 23 2 5 9 7 16/23 69.6% *
Breast, Phylloides tumor 11 3 0 4 4 8/4 72.7% *
Breast, tubular cancer 24 4 2 8 10 18/24 75.0% *
Carcinoid tumor 33 29 2 2 0  2/33 6.1%
CML 5 4 0 1 0 1/5 20.0%
Colon adenoma, mild dysplasia 45 5 8 18 4 32/45 48.9% *
Colon adenoma, moderate dysplasia 45 7 8 25 5 30/45 66.7% *
Colon adenoma, severe dysplasia 44 17 5 22 0 22/44 50.0% *
Colon, adenocarcinoma 45 33 5 7 0  7/45 15.6%
Craniophayryngeoma 4 0 1 2 1 3/4 75.0% *
Dermatofibroma protuberans 4 0 0 4 0 4/4 100.0% *
Endometrioid stroma sarcoma 4 0 1 0 0 0/4 0.0%
Endometrium endometroid carcinoma 47 35 6 4 2  6/47 12.8%
Endometrium, serous carcinoma 19 9 3 6 1  9/19 36.8% *
Ependymoma 7 0 1 4 2 6/7 85.7% *
Epitheloid Hemangioma 1 1/1 0.0%
Epitheloid sarcoma 2 2/2 0.0%
Esophagus, adenocarcinoma 6 3 2 1 0 1/6 16.7%
Esophagus, small cell carcinoma
Esophagus, squamous cell carcinoma 34 24 3 7 0  7/34 20.6%
Esthesioneuroblastoma 3 0 0 2 0 2/3 66.7% *
Fibrosarcoma 8 3 1 4 0 4/8 50.0% *
Gall bladder, adenocarcinoma 27 11 6 2 8 10/27 37.0%*
Ganglioneuroma 7 0 3 3 1 4/7 57.1% *
GIST 13 6 0 7 0 7/6 53.8%*
Glioblastoma multiforme 45 24 6 8 7 15/45 33.3% *
Glomus tumor 9 3 1 2 3 5/9 55.6% *
Granular cell tumor 8 2 4 2 0 2/8 25.0%
Hemangiopericytoma 16 4 2 3 3  6/16 37.5% *
Hepatocellular carcinoma 46 40 3 3 0  3/46 6.5%
Hodgkin lymphoma, mixed cell 15 8 3 4 0  4/15 26.7%
Hodgkin lymphoma, nodular sclerosis 9 6 3 0 0 0/9 0.0%
Kapillary hemangioma 26 2 3 3 18 21/26 80.8% *
Kaposi Sarcoma 27 12 2 11 2 13/27 48.1% *
Kidney, chromophobic cancer 14 12 0 2 0  2/14 14.3%
Kidney, clear cell cancer 44 35 0 6 3  9/44 20.5%
Kidney, oncocytoma 10 2 0 7 1  8/10 80.0% *
Kidney, papillary cancer 43 29 6 3 5  8/43 18.6%
Larynx, squamous cell carcinoma 40 7 5 20 8 28/40 70.0% *
Leiomyoblastoma 7 4 0 3 3 6/7 85.7% *
Leiomyoma 55 16 11 18 10 28/55 50.9% *
Leiomyosarcoma 46 29 6 9 2 11/46 23.9%
Lipoma 16 5 1 5 5 10/16 62.5% *
Liposarcoma 23 7 8 4 4  8/23 34.8% *
Lung, adenocarcinoma 44 21 11 9 3 12/44 27.3%
Lung, large cell cancer 44 35 6 3 0  3/44 6.8%
Lung, small cell cancer 43 37 3 3 0  3/43 7.0%
Lung, squamous cell carcinoma 48 35 7 3 3  6/48 12.5%
Malignant fibrous histiocytoma 26 13 4 7 2  9/26 34.6% *
Malignant mesothelioma 25 14 6 2 3  5/25 20.0%
Malignant Schwanoma 12 3 0 9 0  9/12 75.0% *
MALT lymphoma 46 35 8 1 0  1/46 2.2%
Medulloblastoma 4 3 0 1 0 1/4 25.0%
Meningeoma 44 31 4 6 3  9/44 20.5%
Neurofibroma 36 17 9 10 0 10/36 27.8%
NHL, diffuse large B 22 17 3 1 1  2/22 9.1%
NHL, others 28 19 6 9 0  9/28 32.1% *
Oligodendroglioma 21 13 2 5 1  6/21 28.6%
oral cavity, squamous cell carcinoma 49 18 13 18 0 18/49 36.7% *
Ovarian cancer, other types 12 4 1 7 0  7/12 58.3% *
Ovary, Brenner tumor 8 5 0 3 0 3/8 37.5% *
Ovary, endometroid cancer 31 14 6 9 2 11/31 35.5% *
Ovary, mucinous cancer 14 4 0 3 7 10/14 71.4% *
Ovary, serous cancer 43 17 6 15 5 20/43 46.5% *
Pancreas, adenocarcinoma 43 28 4 8 3 11/43 25.6%
Paraganglioma 10 10 0 0 0 0/6 0.0%
Parathyroid, adenoma 26 9 0 17 0 17/26 65.4% *
Parathyroid, cancer 2 0 0 2 0 2/2 100.0% *
Penile ca 39 24 8 7 0  7/39 17.9%
Pharynx, lamphoepithelial cancinoma 5 2 3 0 0 0/5 0.0%
Pheochromocytoma 28 28 0 0 0  0/28 0.0%
PNET 15 11 1 3 0  3/15 20.0%
Prostate cancer, hormon-refractory 46 35 5 6 0  6/46 13.0%
Prostate cancer, untreated 47 26 12 8 1  9/47 19.1%
Rhabdomyosarcoma 13 6 1 4 2  6/13 46.2% *
Salivary gland, acinus cell cancer 5 4 0 1 0 1/5 20.0%
Salivary gland, adenolymphoma 26 3 4 17 2 19/26 73.1% *
Salivary gland, cylindroma 44 9 13 17 5 22/44 50.0% *
Salivary gland, mucoepidermoid 2 1 1 0 0 0/2 0.0%
Salivary gland, Pleomorphic adenoma 43 3 7 11 22 33/43 76.7% *
Schwannoma 39 31 3 4 1  5/39 12.8%
Skin, basalioma 41 13 9 19 0 19/41 46.3% *
Skin, benign appendix tumor 26 5 5 14 2 16/26 61.5% *
Skin, benign nevus 45 16 7 20 2 22/45 48.9% *
Skin, malignant melanoma 44 26 4 12 2 14/44 31.8%
Skin, Merkel cell cancer 4 2 0 2 0 2/4 50.0% *
Skin, squamouse cell cancer 39 10 9 18 2 20/39 51.3% *
Small intestine, ademocarcinoma 9 3 1 4 1 5/9 55.6% *
Stomach, diffuse adenocarcinoma 19 10 5 3 1  4/19 21.1%
Stomach, intestinal adenocarcinoma 41 26 5 10 0 10/41 24.4%
Synovial sarcoma 4 2 0 2 0 2/2 50.0% *
Tendon sheet, giant cell tumor 32 5 13 13 1 14/32 43.8% *
Teratoma 2 1 1 0 0 0/2 0.0%
Testis, non-seminomatous cancer 45 19 13 7 6 13/45 28.9%
Testis, seminoma 47 34 6 4 3  7/47 14.9%
Thymoma 23 17 1 5 0  5/23 21.7%
Thyroid, adenoma 43 17 15 10 1 11/43 25.6%
Thyroid, anaplastic cancer 7 1 0 2 4 6/7 85.7% *
Thyroid, follicular cancer 46 14 5 18 9 27/46 58.7% *
Thyroid, medullary cancer 8 4 1 0 3 3/8 37.5% *
Thyroid, papillary cancer 33 9 2 10 12 22/33 66.7% *
Urinary bladder cancer, cancer, TCC 41 26 10 5 0  5/41 12.2%
invasive
Urinary bladder cancer, TCC non-invasive 40 22 8 8 2 10/40 25.0%
Urinary bladder, adenocarcinoma 4 1 1 2 0 2/4 50.0% *
Urinary bladder, inverted papilloma 1 0 0 1 0 1/1 100.0% *
Urinary bladder, sarcomatoid cancer 6 2 2 2 0 2/6 33.3%
Urinary bladder, small cell cancer 5 1 1 1 2 3/5 60.0% *
Urinary bladder, squamous cell cancer 7 2 1 1 3 4/7 57.1% *
Urinary bladder, squamous cell carcinoma 41 22 7 9 3 12/41 29.3%
Uterus, carcinsarcoma 6 2 2 1 1 2/6 33.3% *
Uterus, cervix, adenocarcinoma 2 0 0 2 0 2/2 100.0% *
Uterus, cervix, CIN III 16 0 3 13 0 13/16 81.3% *
Vagina, squamous, cell cancer 5 3 2 0 0 0/5 0.0%
Vulva, squamous, cell cancer 39 14 11 13 1 14/39 35.9% *

A set of tissue micro arrays (7 slides each) was analysed for Shoca expression. The set contained about 3000 tumours of 129 different tumour categories. Immunostaining was first optimised on test slides. The conditions described below were considered optimal. Then, all TMA slides used for this study were immunostained in one experiment. Only the negative control reaction was performed later (when reagents were provided). Immunostainings were done according to the following protocols:

Antibody: Shoca-1 specific type B

Slide pre-treatment: pronase, 15 min, 37° C.

Peroxidase blocking: 0.3% H2O2/Methanol, 30 minutes

Antibody dilution: 1:32'000

Incubation: overnight (4° C.)

Detection system: ABC; DAB

Positive control: thymus epithelial cells

Negative control: serum of the animal producing the antibody (after antibody extraction)

Using the conditions described above, the negative control reactions were completely negative while a staining of various intensities was observed for the Shoca-1 antibody in many tumours and normal tissues. All sections (stained and control sections) were reviewed by one pathologist on one day to maximise the internal consistency. For all tumour samples the fraction of positive cells were estimated and staining intensity was recorded according to a four step scale (0–3+). To categorise the tumours an arbitrarily selected system was used (Table 2).

TABLE 2
Categorisation of tumours
Category Definition
Negative no staining
Weak 0–50% of cells 1+
Moderate >50% 1+ or <50% 2+
Strong >50% 2+ or any 3+ staining

The protein seems to be expressed in many different cell types and neoplastic tissues. It is possible that the protein is also expressed (at lower level) in tissues that were considered negative at the selected immunohistochemistry conditions. Despite all inherent shortcomings of immunohistochemistry, it can be expected that the different staining levels as determined on the tissue microarrays do at least represent true differences in the expression level of Shoca-1. This means, that tumours that are scored as 3+ will in general have a higher expression level than 2+ tumours, 2+ tumours will have a higher expression level than 1+ tumours, and 1+ tumours will express more Shoca-1 than tumours that are scored negative.

These data demonstrate the involvement of Shoca-1 in distinct tumour types including breast cancer, colon cancer and cervical cancer. A comprehensive analysis of the different tissues and tumour entities indicated further that normal tissue from a broad range of organs was low positive to negative for Shoca-1 while expression of this molecule was associated with less malignant tumour forms in these tissues. Moreover, cancerous progression coincided with a loss of Shoca-1 expression in many of the tumours (Table 3). This finding is particularly interesting as there is presently to our knowledge extremely few clinically relevant prognostic markers are available which are down-modulated or lost upon tumour progression in breast, colon and cervical cancer.

TABLE 3
Relationship of Shoca expression and malignancy

EXAMPLE 6

Shoca Gene Expression in Human Malignancies

The role of Shoca-1 and Shoca-2 in malignancy was examined by a reverse transcription polymerase chain reaction (RT-PCR) in over 50 human cancer cell lines, representing various malignancies and different stages of cancer development.

The starting material was total RNA isolated from cultured cell lines by Qiagen Rneasy Total RNA isolation kit. Starting with 1 μg total RNA, random hexamers (Roche) were used to prime a reverse transcription reaction (Titan One Tube RT-PCR (Roche). cDNA was amplified in two rounds for both Shoca-1 and Shoca-2. In both primary PCR reactions, a full length amplicon was generated, and a portion of this was amplified in the secondary PCR reaction. The primers used are specified below:

TABLE 4
PCR primers
Nucleotide
Name Position Sequence (5′–3′)
Primary PCR Primers for Shoca-1.
Shocal 5′ TGC TGC AGC AGA TCC TGC AC
Shocal 3′ CCT GAA GTA ACT CTC CTC C
Shoca_F1 n258–278  CCCTGGTGACAAGCCCTACGA
Shoca_R1 n710–731  ATAGCACGGAGCGAGTGGTGTC
Primary PCR Primers for Shoca-2
Shoca2_F2 348–365 TCA CTC TGA AGA ATT CAC
Shoca2_R2 1063–1046 TGA GTG TGA GAA TTC CAT
Nested PCR primers for Shoca-2 Reactions
Shoca2_F3 511–528 GAT CAC TCT CCA GTT CTT
Shoca2_R3 717–697 GGA TTT TCG CAG AGA TGC
CTG

PCR products were separated by electrophoresis on a 0.8% agarose gel overnight and examined under UV light after staining with 0.5 μg/ml ethidium bromide. The table below details the findings. Results are given as Pos, where a band of the correct molecular weight was detected, and Neg, where no PCR product was detected.

TABLE 5
Shoca gene expression in various human cancer cells lines
Results for 20 of the 54 cell lines are listed. All the 34 remaining
cell lines were negative for Shoca-1 and positive for Shoca-2.
Name Tumour Type Shoca-1 Shoca-2
1. T47 D/6 Breast NEG POS
2. PAN 02 Pancreatic NEG NEG
3. U-87 Glioblastoma NEG POS
4. T84 MCB lung met from colon carcinoma NEG POS
5. NCI-H520 Squamous cell carcinoma lung POS POS
6. KLE Endometrial carcinoma NEG NEG
7. SK-LU- 1 Lung adenocarcinoma N.D. POS
8. U-251 MG Glioma NEG NEG
9. NCI-H128. SCLC met pleural effusion NEG NEG
10. SCATT Renal NEG POS
11. NCI-H460 Large cell lung carcinoma NEG POS
12. LoVo Colon met site supraclavicular NEG POS
13. GLC-08 SCLC NEG POS
14. Hep G2 Hepatocellular carcinoma NEG POS
15. HT1376 Urinary bladder carcinoma NEG POS
16. N417 Small Cell Lung NEG NEG
17. LN Cap Prostate NEG POS
18. U105MG Glioma NEG NEG
19. SW 837 Rectal adenocarcinoma NEG POS
20. Colo 320 Colon NEG NEG
21. no template NEG NEG

The findings for Shoca-1 demonstrate that it is rarely expressed in human cancer cell lines, with only one (NCI H520) clearly positive. Shoca-2 was far more widely expressed in human tumours than Shoca-1. Only 7 cell lines were clearly negative of the 54 tested. These were PAN02, KLE, U251MG, NCIH128, N417, U105MG, and Colo320. These tumours cover 6 different tumour types, with only Gliomas represented twice. Another Glioma (U87), was positive for Shoca-2.

Claims

The invention claimed is:

1. An isolated Shoca-1 polypeptide comprising the amino acid sequence of SEQ ID NO:4.

2. An isolated Shoca-1 polypeptide consisting of the amino acid sequence of SEQ ID NO:4.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: