Patent application title:

Method for cloning and expression of BsrGI restriction endonuclease and BsrGI methyltransferase in E. coli

Publication number:

-

Publication date:
Application number:

10/338,898

Filed date:

2003-01-08

✅ Patent granted

Patent number:

US 6,869,786 B1

Grant date:

2005-03-22

PCT filing:

-

PCT publication:

-

Examiner:

Charles L. Patterson, Jr.

Adjusted expiration:

2023-09-07

Abstract:

The present invention relates to recombinant DNA encoding the BsrGI restriction endonuclease as well as BsrGI methyltransferase, expression of BsrGI restriction endonuclease and BsrGI methyltransferase in E. coli cells containing the recombinant DNA.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

Description

BACKGROUND OF THE INVENTION

The present invention relates to recombinant DNA that encodes the BsrGI restriction endonuclease (BsrGI endonuclease or BsrGI) as well as BsrGI methyltransferase (BsrGI methylase or M.BsrGI) and to the expression of BsrGI endonuclease and/or methylase in E. coli cells containing the recombinant DNA.

BsrGI endonuclease is found in the strain of Bacillus stearothermophilus GR75 (New England Biolabs' strain collection). It recognizes the double-stranded symmetric DNA sequence 5′ T/GTACA 3′ (/ indicates the cleavage position) and cleaves between the T and G to generate 4-base 5′ overhang ends. BsrGI methylase (M.BsrGI) is also found in the same strain, which recognizes the same DNA sequence and presumably modifies hemi-methylated or non-methylated BsrGI sites.

Type II restriction endonucleases are a class of enzymes that occur naturally in bacteria and in some viruses. When they are purified away from other bacterial/viral proteins, restriction endonucleases can be used in the laboratory to cleave DNA molecules into small fragments for molecular cloning and gene characterization.

Restriction endonucleases recognize and bind particular sequences of nucleotides (the ‘recognition sequence’) along the DNA molecules. Once bound, they cleave the molecule within (e.g. BamHI), to one side of (e.g. SapI), or to both sides (e.g. TspRI) of the recognition sequence. Different restriction endonucleases have affinity for different recognition sequences. Over two hundred and twenty-eight restriction endonucleases with unique specificities have been identified among the many hundreds of bacterial species that have been examined to date (Roberts and Macelis, Nucl. Acids Res.29:268-269 (2001)).

Restriction endonucleases typically are named according to the bacteria from which they are discovered. Thus, the species Deinococcus radiophilus for example, produces three different restriction endonucleases, named DraI, DraII and DraIII. These enzymes recognize and cleave the sequences 5′ TTT/AAA 3′, 5′ PuG/GNCCPy 3′ and 5′ CACNNN/GTG 3′ respectively. Escherichia Coli RY13, on the other hand, produces only one enzyme, EcoRI, which recognizes the sequence 5′ G/AATTC 3′.

A second component of bacterial/viral restriction-modification (R-M) systems are the methylase. These enzymes co-exist with restriction endonucleases and they provide the means by which bacteria are able to protect their own DNA and distinguish it from foreign DNA. Modification methylases recognize and bind to the same recognition sequence as the corresponding restriction endonuclease, but instead of cleaving the DNA, they chemically modify one particular nucleotide within the sequence by the addition of a methyl group (C5 methyl cytosine, N4 methyl cytosine, or N6 methyl adenine). Following methylation, the recognition sequence is no longer cleaved by the cognate restriction endonuclease. The DNA of a bacterial cell is always fully modified by the activity of its modification methylase. It is therefore completely insensitive to the presence of the endogenous restriction endonuclease. Only unmodified, and therefore identifiably foreign DNA, is sensitive to restriction endonuclease recognition and cleavage. During and after DNA replication, usually the hemi-methylated DNA (DNA methylated on one strand) is also resistant to the cognate restriction digestion.

With the advancement of recombinant DNA technology, it is now possible to clone genes and overproduce the enzymes in large quantities. The key to isolating clones of restriction endonuclease genes is to develop an efficient method to identify such clones within genomic DNA libraries, i.e. populations of clones derived by ‘shotgun’ procedures, when they occur at frequencies as low as 10−3 to 10−4. Preferably, the method should be selective, such that the unwanted clones with non-methylase inserts are destroyed while the desirable rare clones survive.

A large number of type II restriction-modification systems have been cloned. The first cloning method used bacteriophage infection as a means of identifying or selecting restriction endonuclease clones (EcoRII: Kosykh et al., Mol. Gen. Genet. 178:717-719, (1980); HhaII: Mann et al., Gene 3:97-112, (1978); PstI: Walder et al., Proc. Nat. Acad. Sci. 78:1503-1507, (1981)). Since the expression of restriction-modification systems in bacteria enables them to resist infection by bacteriophages, cells that carry cloned restriction-modification genes can, in principle, be selectively isolated as survivors from genomic DNA libraries that have been exposed to phage. However, this method has been found to have only a limited success rate. Specifically, it has been found that cloned restriction-modification genes do not always confer sufficient phage resistance to achieve selective survival.

Another cloning approach involves transferring systems initially characterized as plasmid-borne into E. coli cloning vectors (EcoRV: Bougueleret et al., Nucl. Acids. Res. 12:3659-3676, (1984); PaeR7: Gingeras and Brooks, Proc. Natl. Acad. Sci. USA 80:402-406, (1983), Therlault and Roy, Gene 19:355-359 (1982); PvuII: Blumenthal et al., J. Bacteriol. 164:501-509, (1985); Bsr45I: Wayne et al. Gene 202:83-88, (1997)).

A third approach is to select for active expression of methylase genes (methylase selection) (U.S. Pat. No. 5,200,333 and BsuRI: Kiss et al., Nucl. Acids. Res. 13:6403-6421 (1985)). Since restriction-modification genes are often closely linked together, both genes can often be cloned simultaneously. This selection does not always yield a complete restriction system however, but instead yields only the methylase gene (BspRI: Szomolanyi et al., Gene 10:219-225, (1980); BcnI: Janulaitis et al., Gene 20:197-204 (1982); BsuRI: Kiss and Baldauf, Gene 21:111-119, (1983); and BsrI; Walder et al., J. Biol. Chem. 258:1235-1241, (1983)).

A more recent method, the “endo-blue method”, has been described for direct cloning of thermostable restriction endonuclease genes into E. coli based on the indicator strain of E. coli containing the dinD::lacZ fusion (Fomenkov et al., U.S. Pat. No. 5,498,535; Fomenkov et al., Nucl. Acids Res. 22:2399-2403 (1994)). This method utilizes the E. coli SOS response signals following DNA damage caused by restriction endonucleases or non-specific nucleases. A number of thermostable nuclease genes (TaqI, Tth111I, BsoBI, Tf nuclease) have been cloned by this method (U.S. Pat. No. 5,498,535). The disadvantage of this method is that some positive blue clones containing a restriction endonuclease gene are difficult to culture due to the lack of the cognate methylase gene.

There are three major groups of DNA methyltransferases based on the position and the base that is modified (C5 cytosine methylases, N4 cytosine methylases, and N6 adenine methylases). N4 cytosine and N6 adenine methylases are amino-methyltransferases (Malone et al. J. Mol. Biol. 253:618-632 (1995)). When a restriction site on DNA is modified (methylated) by the methylase, it is resistant to digestion by the cognate restriction endonuclease. Sometimes methylation by a non-cognate methylase can also confer DNA sites resistant to restriction digestion. For example, Dcm methylase modification of 5′ CCWGG 3′ (W=A or T) can also make the DNA resistant to PspGI restriction digestion. Another example is that CpM methylase can modify the CG dinucleotide and make the NotI site (5′ GCGGCCGC 3′) refractory to NotI digestion (New England Biolabs' catalog, 2000-01, page 220). Therefore methylases can be used as a tool to modify certain DNA sequences and make them resistant to cleavage by restriction enzymes.

Type II methylase genes have been found in many sequenced bacterial genomes (GenBank, http://www.ncbi.nlm.nih.gov; and Rebase™, http://rebase.neb.com/rebase). Direct cloning and over-expression of ORFs adjacent to the methylase genes have yielded restriction enzymes with novel specificities (Kong et al. Nucl. Acids Res. 28;3216-3223 (2000)). Thus microbial genome mining has emerged as a new way of screening and cloning new type II restriction enzymes and methylases and their isoschizomers.

Because purified restriction endonucleases and modification methylases are useful tools for creating recombinant molecules in the laboratory, there is a strong commercial interest to obtain bacterial strains through recombinant DNA techniques that produce large quantities of restriction enzymes and methylases. Such over-expression strains should also simplify the enzyme purification process.

SUMMARY OF THE INVENTION

The present invention relates to a method for cloning BsrGI restriction endonuclease gene (bsrGIR) from Bacillus stearothermophilus GR75 into E. coli by inverse PCR and direct PCR from genomic DNA using primers that were based on the DNA sequences obtained via methylase selection.

The bsrGIM gene was cloned from a mixture of seven DNA libraries by the methylase selection. The methylase gene and its adjacent DNA were sequenced by primer walking of the original methylase positive clone and its subclones. A truncated ORF of 309 bp was found upstream of the bsrGIM gene. Since R-M genes in a restriction and modification system are usually located in close proximity to each other, efforts were made to clone the upstream ORF by inverse PCR and direct PCR. Following two rounds of inverse PCR, one 1170-bp ORF was found upstream of the methylase gene. Two small ORFs were also identified downstream of the methylase gene. The 1170-bp ORF was amplified by PCR and cloned in a T7 expression vector pACYC-T7ter. BsrGI restriction endonuclease was detected in IPTG-induced cell extract. The final recombinant BsrGI expression strain was E. coli ER2566 [pUC-BsrGIM, pACYC-T7ter-BsrGIR].

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Gene organization of BsrGI R-M system, bsrGIR, BsrGI restriction endonuclease gene; bsrGIM, BsrGI methylase gene.

FIG. 2. BsrGI methylase gene sequence (bsrGIM, 1947 bp) (SEQ ID NO:1) and the encoded amino acid sequence (SEQ ID NO:2).

FIG. 3. BsrGI endonuclease gene sequence (bsrGIR, 1170 bp) (SEQ ID NO:3) and the encoded amino acid sequence (SEQ ID NO:4).

FIG. 4. Schematic diagram of cloning vector pUC-Cm. CmR, Chloramphenicol resistance gene flanked by BsrGI sites. ApR, ampicillin resistance gene (β-lactamase), lacZα, β-galactosidase gene α fragment. MCS, multiple cloning sites.

FIG. 5. Recombinant BsrGI endonuclease activity in cell extract. A DNA was used as the substrate. Lanes 1, DNA size marker; Lanes 2 and 6, λ DNA digested with native BsrGI; Lanes 3-5, ⅛, {fraction (1/16)}, {fraction (1/32)}, diluted cell extract added in the restriction digestions; Lane 7, λ DNA.

DETAILED DESCRIPTION OF THE INVENTION

The method described herein by which the bsrGIM and bsrGIR genes are preferably cloned and expressed in E. coli include the following steps:

1. Preparation of Genomic DNA, Restriction Digestion, and Construction of Genomic DNA Library

Genomic DNA was prepared from Bacillus stearothermophilus GR75 (BsrGI-producing strain) and digested with BamHI, HindIII, PstI, SacI, SalI, SphI, and XbaI, respectively. A pUC19-derived cloning vector (pUC-Cm) was constructed to include the CmR gene that was flanked by two BsrGI sites. The original cloning vector pUC19 does not contain any BsrGI site. Our experience has shown that simply introducing a cut site into cloning vectors provides a high background and, in general is not an efficient selection tool. The introduction of CmR gene flanked by two BsrGI provided more powerful selection for the M.BsrGI+ clones. The cloning vector pUC-Cm was digested with BamHI, HindIII, PstI, SacI, SalI, SphI, and XbaI, respectively. After CIP treatment of the vector the genomic DNA was ligated to the vector with compatible ends. The ligated DNA was used to transform cells by electroporation. Approximately 4,000 ApR transformants were obtained for each library. The cells from seven libraries were pooled together and amplified. Plasmid DNA was prepared, generating a mixed plasmid library.

2. Cloning of bsrGIM Gene by Methylase Selection

The mixed primary plasmid library DNA was challenged with BsrGI endonuclease. The digested DNA was transferred into ER1992 by transformation, producing ˜500 ApR CmR survivors. Plasmid DNA was prepared from cultures of 72 transformants. One BsrGI resistant clone was identified following BsrGI digestion and gel electrophoresis.

3. Restriction Mapping and Subcloning of the Insert

The plasmid DNA from BsrGI resistant clone was digested with restriction enzymes AflIII, BamHI, BsaXI, HincII, HindIII, KasI, KpnI, NdeI, PstI, Sad, SalI, SapI, SphI, StuI, and XbaI to estimate the insert size. The insert was determined to be approximately 11 kb which was derived from the XbaI library. To facilitate the sequencing of the insert, seven HincII fragments from the 11 kb insert were subcloned into pUC19.

4. Construction of bsrGIM Gene Deletion Clones

The original methylase positive plasmid was digested with KpnI, NdeI, and SphI, respectively. The plasmid DNA was self-ligated in low DNA concentration to promote deletion. The deletion subclones, ˜3.5 kb KpnI fragment deletion, ˜9.5 kb NdeI fragment deletion, ˜1.2 kb SphI fragment deletion, were all cleaved by BsrGI, indicating that the deleted DNA removed part of or all of the bsrGIM gene. It demonstrated the resistance to BsrGI digestion was conferred by the gene product within the 11 kb insert.

5. DNA Sequence Analysis of the bsrGIM Gene

The HincII subclones were sequenced by pUC universal forward and reverse primers. One amino acid sequence translated from the DNA sequence indicated conserved amino-methyltransferase motifs. The methylase gene was sequenced by primer walking from the HincII subclone and the original methylase positive clone. The bsrGIM gene was found to be 1947 bp, encoding a protein of 76.2 kDa.

6. Inverse PCR Amplification of DNA Upstream of BsrGI Methylase

After identification of the bsrGIM gene, efforts were made to clone adjacent DNA. Two small ORFs (306 bp and 399 bp) were found downstream of the bsrGIM gene, but these two ORFs are too small to encode an endonuclease. Thus, inverse PCR efforts were concentrated on the upstream of the M gene, where a truncated ORF of 309 bp was located.

The genomic DNA was digested with restriction enzymes, purified, and self-ligated. The circular DNA molecules were used as templates for inverse PCR. PCR products were found in the Apol, DraI, PacI, RsaI, and TaqI templates. The PCR products were purified and sequenced. It generated about 600 bp of new sequence. A second round of inverse PCR was carried out from which a ˜800 bp PCR product was found in the HaeIII-derived template. The PCR product was purified and sequenced, which provide another ˜400 bp of new sequence. A stop codon was found in the finished ORF with 1170 bp, encoding a protein with molecular mass of 44.7 kDa.

7. Expression of bsrGIR Gene in E. coli

The successful expression strategy was to express bsrGIM gene in a high-copy-number plasmid pUC and the bsrGIR gene in a low-copy-number T7 vector pACYC-T7ter.

The plasmid pUC-Cm-BsrGIM was the original methylase positive clone isolated from the methylase selection. The CmR gene was deleted to make plasmid pUC-BsrGIM, which was transferred into ER2566 to premodify E. coli host. The bsrGIR gene was amplified from genomic DNA by PCR with Vent® DNA polymerase. Following purification and digestion with NdeI and BamHI, it was ligated to CIP-treated pACYC-T7ter (CmR) with compatible ends. The ligated DNA was transferred into pre-modified host ER2566 [pUC-BsrGIM] by transformation. Ten ml of cell cultures were made from four individual transformants and target protein production induced with IPTG. Cell extracts were prepared and assayed for BsrGI endonuclease activity on λ DNA substrate. Two active BsrGI-producing clones were found in IPTG-Induced cell extracts. The BsrGI activity of one active clone was shown in FIG. 5.

The plasmid DNA pACYC-T7ter-BsrGIR clone was prepared by Qiagen (Germantown, Md.) column and the entire insert was sequenced. It was found that the insert contained the wild type coding sequence.

The Example is given to illustrate embodiments of the present invention as its presently preferred to practice. It will be understood that the Example is illustrative and that is not considered as restricted thereto except as indicated in the appended claims.

The references cited above and below are herein incorporated by reference.

EXAMPLE 1

Cloning of BsrGI Restriction-Modification System in E. coli

1. Preparation of Genomic DNA

Genomic DNA was prepared from 5 g of Bacillus stearothermophilus GR75 (NEB#813, New England Biolabs strain collection, New England Biolabs, Inc., Beverly, Mass.) by the standard procedure consisting of the following steps:

    • a. Cell lysis by addition of lysozyme (2 mg/ml final), sucrose (1% final), and 50 mM Tris-HCl, pH 8.0.
    • b. Further cell lysis by addition of SDS at a final concentration of 0.1%.
    • c. Further cell lysis by addition of 1% Triton X-100, 62 mM EDTA, 50 mM Tris-HCl, pH 8.0.
    • d. Removal of proteins by phenol-CHCl3 extraction of DNA 3 times (equal volume) and CHCl3 extraction once.
    • e. Dialysis in 4 liters of TE buffer, buffer change twice.
    • f. RNase A treatment at 37° C. for 1 h to remove RNA.
    • g. Genomic DNA precipitation in 95% ethanol, centrifuged, washed, dried and resuspended in TE buffer.
      2. Restriction Digestion of Genomic DNA and Construction of Genomic DNA Library

The genomic DNA was digested completely with BamHI, HindIII, PstI, SacI, SalI, SphI, and XbaI, respectively at 37° C. for 1 h. A pUC19-derived cloning vector (pUC-Cm) was constructed to contain the CmR gene that was flanked by two BsrGI sites. The original cloning vector pUC19 does not contain any BsrGI site for M.BsrGI methylase selection. The introduction of CmR gene flanked by two BsrGI provided more powerful selection for the M.BsrGI+ clones. The cloning vector pUC-Cm was also digested with BamHI, HindIII, PstI, SacI, SalI, SphI, and XbaI, respectively at 37° C. for 2 h. The linearized DNA was then treated with 10 units of CIP at 37° C. for 1 h. CIP was removed by heat-inactivation and the DNA further purified by running through a Qiagen (Germantown, Md.) spin column. Genomic DNA was ligated to the vector with compatible ends at 16° C. overnight using T4 DNA ligase. The ligated DNA was used to transform cells by electroporation and transformed cells plated on Ap plates (100 μg/ml). Approximately 4,000 ApR transformants were obtained from each library. The cells from seven libraries were mixed together and amplified in 1 L LB plus Ap. Plasmid DNA was prepared by Qiagen (Germantown, Md.) Maxi column, generating a mixed plasmid library.

2. Cloning of bsrGIM Gene by Methylase Selection

The primary plasmid DNA (1 μg, 2 μg, 3 μg, 4 μg and 5 μg DNA, respectively) was challenged with 50 units of BsrGI digestion at 60° C. for 4 h. The challenged DNA was transferred into E. coli ER1992 by transformation, generating ˜500 APR survivors. The standard transformation procedure was described as follows. 10-50 ng of digested plasmid DNA were mixed with 100 μl of chemical competent cells and incubated at 4° C. for 30 min. The cell-DNA mixture was heat-treated at 37° C. for 5 min. Equal volume of SOB or LB was added to the cell mixture and amplification was carried out at 37° C. for 1 h. Cells were plated on Ap (100 μg) plus Cm (33 μg) plates and incubated at 37° C. incubator overnight. ApR and CmR double selection greatly reduced the number of survivor transformants. 72 plasmid DNAs were prepared by Qiagen (Germantown, Md.) spin columns from 1.5 ml overnight cell cultures. After digestion with BsrGI and gel electrophoresis, one true resistant clone was found (#23).

3. Restriction Mapping and Subcloning of the Insert

The BsrGI resistant clone #23 was digested with restriction enzymes AflIII, BamHI, HincII, HindIII, KasI, KpnI, NdeI, PstI, SacI, SalI, SapI, SphI, StuI, and XbaI, respectively to estimate the insert size. The insert was determined to be approximately 11 kb which was derived from the XbaI genomic DNA library. To facilitate the sequencing of the insert, seven HincII fragments in the range of 600 bp-2300 bp were subcloned into pUC19.

4. Construction of bsrGIM Gene Deletion Clones

To confirm the resistance is due to methylation of BsrGI site by the cloned methylase and not due to the deletion of BsrGI sites in the vector, the original methylase positive plasmid was digested with KpnI, NdeI, and SphI, respectively. The plasmid DNA was self-ligated in low DNA concentration to promote deletion. The deletion subclones, ˜3.5 kb KpnI fragment deletion, ˜9.5 kb NdeI fragment deletion, ˜1.2 kb SphI fragment deletion, were all cleaved by BsrGI, indicating that the deleted DNA removed part of or all of the bsrGIM gene. It demonstrated the resistance to BsrGI digestion was conferred by the 11 kb insert, in which the bsrGIM gene was located.

5. DNA Sequence Analysis of the bsrGIM Gene

HincII-fragment subclones were sequenced by the dideoxy terminator method using AmpliTaq (Torrence, Calif.) dideoxy terminator sequencing kit and an ABI 373A sequencing machine with pUC universal forward and reverse primers. One amino acid sequence translated from the DNA sequence indicated conserved amino-methyltransferase motifs. The bsrGIM methylase gene was sequenced by primer walking from the HincII-subclones and the original methylase positive clone. The bsrGIM gene was found to be 1947 bp, encoding a protein of 76.2 kDa. M.BsrGI is predicted to be an amino-methyltransferase (N4C methylase or N6A methylase) based on the amino acid sequence homology with other methylases. The sequencing primers used in the primer walking were listed below:

  • 5′ ACTCTGCAATGGCAGCCATTATGTTA 3′ 287-042 (SEQ ID NO:5)
  • 5′ ACATTCTCGGCTATGTTGGCTCTC 3'287-043 (SEQ ID NO:6)
  • 5′ ACTGAAAATGGAGMGTCGATGTG 3′ 287-044 (SEQ ID NO:7)
  • 5′ TATGCAATACAGACATACTTTAGC 3′ 287-045 (SEQ ID NO:8)
  • 5′ ACTAGATAGAGTCGATATTATAATAGG 3′ 287-107 (SEQ ID NO:9)
  • 5′ GAACCACATGTTGGGTCTAAATAAG 3′ 287-108 (SEQ ID NO:10)
  • 5′ CACATTCTCGGCTATGTTGGCTCTCTC 3′ 287-265 (SEQ ID NO:11)
  • 5′ AGAAGCTTATAAACTAGATAGAGTCG 3′ 287-266 (SEQ ID NO:12)
  • 5′ GGCAGAAGTGATTGAGTTTTATTC 3′ 287-267 (SEQ ID NO:13)
  • 5′ AAGCTTATAAACTAGATAGAGTCG 3′ 287-313 (SEQ ID NO:14)
  • 5′ AATCCACCTTGGGTTAACTGGGAGTAC 3′ 287-314 (SEQ ID NO:15)
  • 5′ CATTTATAAGGCGAGAACAGGTGT 3′ 287-375 (SEQ ID NO:16)
  • 5′ CACTGGGGGTGCGAACGCTGTATAC 3′ 287-376 (SEQ ID NO:17)
  • 5′ GTGTGGAGATATATTGCAACTGAG 3′ 288-102 (SEQ ID NO:18)
  • 5′ AGTGATGTATATTAGCATGGATGA 3′ 288-103 (SEQ ID NO:19)
    6. Inverse PCR Amplification of DNA Upstream of BsrGI Methylase

After identification of the bsrGIM gene, efforts were made to clone adjacent DNA. Two small ORFs of 306 bp and 399 bp were found downstream of the bsrGIM gene, but these two ORFs are too small to encode an endonuclease although it was not ruled out that they may encode a protein with two heterodimeric subunits. It was demonstrated below that the bsrGIR gene is located upstream of the M gene and the downstream 306 bp and 399 bp ORFs are not bsrGIR gene.

Inverse PCR efforts were concentrated on the upstream region of the bsrGIM gene, where a truncated ORF of 309 bp was located. Two inverse PCR primers were synthesized with the following sequence:

  • 5′ TCAAGGTAAAGCCTCTTGTCAGAG 3′ 287-315. (SEQ ID NO:20)
  • 5′ ATAGAGCTACCACAGATAATGGTG 3'287-316. (SEQ ID NO:21)

The Bst genomic DNA was digested with restriction enzymes Apol, DraI, HindIII, HpyCH4V, MfeI, PacI, RsaI, SphI, TaqI, and XmnI, respectively at the desired temperatures (ApoI digestion at 50° C., TaqI digestion at 65° C., the remaining digestion at 37° C.). The digested DNA was purified through Qiagen (Germantown, Md.) spin columns. Self-ligation was set up at a low DNA concentration at 2 μg/ml overnight at 16° C. T4 DNA ligase was inactivated at 65° C. for 30 min and the circular DNA was precipitated in ethanol and used as the template for inverse PCR. PCR conditions were 94° C. for 2 min, 1 cycle; 94° C. for 30 sec, 55° C. for 30 sec, 72° C. for 2 min for 35 cycles. PCR products were found in the ApoI, DraI, PacI, RsaI, and TaqI templates. The PCR products were purified from a low-melting agarose gel, treated with β-agarase for 2 h, precipitated with ethanol, and sequenced directly with primers 287-315 and 316. The first round of inverse PCR generated about 600 bp of new sequence.

In a second round of inverse PCR, two primers were made with the following sequence:

  • 5′ GGGTTCTCACAAAAACCTACTCCA 3′ 288-74 (SEQ ID NO:22)
  • 5′ GGTACAATAGTCAAAATGATAGATG 3′ 288-75 (SEQ ID NO:23)

The Bst genomic DNA was digested with restriction enzymes AgeI, AluI, ApoI, BsaWI, BsrFI, HaeIII, HincII, HpaII, MfeI PacI, SpeI, SspI, TaqI, and XbaI, respectively at the desired temperatures (ApoI digestion at 50° C., BsaWI digestion at 60° C., TaqI digestion at 65° C., the remaining digestion at 37° C.). The digested DNA was purified through Qiagen (Germantown) spin columns. Self-ligation was set up at a low DNA concentration at 2 μg/ml overnight at 16° C. T4 DNA ligase was inactivated at 65° C. for 30 min and the circular DNA was precipitated in ethanol and used as the template for inverse PCR. PCR conditions were 94° C. for 2 min, 1 cycle; 94° C. for 30 sec, 55° C. for 30 sec, 72° C. for 2 min for 35 cycles. An 800 bp PCR product was found in the HaeIII template. The PCR product was purified from a low-melting agarose gel, treated with β-agarase for 2 h, precipitated with ethanol, and sequenced directly with primers 288-74 and 75, which provided another ˜400 bp of new sequence. A stop codon was found in the finished bsrGIM gene of 1170 bp, encoding a protein with molecular mass of 44.7 kDa.

7. Expression of bsrGIR Gene in E. coli

The successful expression strategy was co-expression of bsrGIM gene in a high-copy-number plasmid pUC and the bsrGIR gene in a low-copy-number T7 vector pACYC-T7ter.

The plasmid pUC-Cm-BsrGIM was the original methylase positive clone isolated from the methylase selection. The CmR gene was deleted to make plasmid pUC-BsrGIM, which was transferred into ER2566 to pre-modify E. coli host by standard transformation.

The 1170-bp bsrGIR gene was amplified from genomic DNA by PCR with Vent DNA polymerase. The PCR primers have the following sequences. The forward and the reverse primers contain NdeI site and BamHI site, respectively. PCR conditions were 94° C. for 2 min, 1 cycle; 94° C. for 30 sec, 55° C. for 30 sec, 72° C. for 3 min for 20 cycles. Following purification through Qiagen (Germantown, Md.) spin columns and digestion with NdeI and BamHI overnight at 37° C., the PCR DNA was purified again by passing through Qiagen (Germantown, Md.) spin columns. It was then ligated to CIP-treated pACYC-T7ter (CmR) with compatible ends (ligation condition: ˜100 ng vector, ˜500 ng PCR insert, 2 μl 10× ligation buffer, 1 μl T4 DNA ligase (400 units), in a total volume of 20 μl at 16° C. overnight). The ligated DNA was transferred into pre-modified host ER2566 [pUC-BsrGIM] by transformation. ER2566 [pUC-BsrGIM] competent cells were made competent by CaCl2 treatment of the exponential phase cells at 4° C. for 30 min. Ten ml of cell cultures were made from four individual transformants and target protein production induced with IPTG. Cell extracts were prepared and assayed for BsrGI endonuclease activity on 1 DNA substrate. Two active BsrGI-producing clones were found in IPTG-induced cell extracts. The BsrGI activity of one active clone (#4) was shown in FIG. 4. The plasmid DNA pACYC-T7ter-BsrGIR was prepared by Qiagen (Germantown, Md.) column and the entire insert was sequenced. It was confirmed that the insert contained the wild type coding sequence.

8. Thermostability of the Recombinant BsrGI Endonuclease

Cell extracts containing recombinant BsrGI were heated at 50° C. and 60° C., respectively, for 30 min. Heat-denatured E. coli proteins were removed by centrifugation at 14 K rpm for 15 min. The clarified lysates were used to digest λ DNA at 37° C. It was found that pre-treatment at 50° C. did not alter cleavage activity. However, heat-treatment at 60° C. reduced BsrGI cleavage activity ˜94%. It is concluded that restriction digestion using recombinant BsrGI can be carried out at 37° C. to 50° C. BsrGI is a thermostable restriction endonuclease.

The strain NEB#1502, ER2566 [pUC-BsrGIM, pACYC-T7ter-BsrGIR] has been deposited under the terms and conditions of the Budapest Treaty with the American Type Culture Collection on 08 Jan. 2003 and received ATCC Accession No. PTA 4892.

Claims

1. Isolated DNA encoding the BsrGI restriction endonuclease, wherein the isolated DNA is obtainable from Bacillus stearothermophilus GR75.

2. A recombinant DNA vector comprising a vector into which a DNA segment encoding the BsrGI restriction endonuclease has been inserted.

3. Isolated DNA encoding the BsrGI restriction endonuclease and BsrGI methylase, wherein the isolated DNA is obtainable from ATCC No. PTA-4892.

4. A vector which comprise the isolated DNA of claim 3.

5. A host cell transformed by the vector of claims 2 or 4.

6. A method of producing recombinant BsrGI restriction endonuclease comprising culturing a host cell transformed with the vector of claims 2 or 4 under conditions suitable for expression of said endonuclease and methylase.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: