-
2008-04-08
10/362,463
2001-08-16
US 7,354,728 B2
2008-04-08
WO; PCT/EP01/09499; 20010816
WO; WO02/16426; 20020228
Manjunath N. Rao | Shulamith H Shafer
2022-07-25
The invention provides a protein having an amino acid sequence as in SEQ ID 7, 8, 11 or 12, similar proteins, naturally occurring variants and homologous functional equivalents thereof, as well as the use of a polynucleotide encoding such protein, for use in an assay and for use in a method of modulation of transcriptional activity promoted by a responsive nuclear receptor and a coactivator, which coactivator is the mentioned protein and is named COASTER, and which nuclear receptor is preferrably a steroid receptor.
Get notified when new applications in this technology area are published.
G01N33/53 IPC
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing Immunoassay; Biospecific binding assay; Materials therefor
C12N5/00 IPC
Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
C07K1/00 IPC
General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
This application is a national phase filing of PCT/EP01/09499, filed Aug. 16, 2001.
This application claims priority of European patent applications EPO 002029056, filed Aug. 21, 2000, and EPO 012017711, filed May 14, 2001.
This invention relates to a new protein, to an assay for binding between a responsive nuclear receptor and a coactivator and to a method of modulation of transcriptional activity promoted by a responsive nuclear receptor.
This invention is in the field of the use of functions of nuclear receptors in organisms. Nuclear receptors have a wide range of function, but their most conspicuous role is to enable cells to respond to hormones, such as estradiol, cortisol, and progesterone. Via the nuclear receptors the hormones influence gene transcription in cells, whereby the cells can change their function. Furthermore, it is known that the activation of gene transcription by nuclear receptors is facilitated or even enabled by coactivators. Several such coactivators are known. For example, Nishikawa et al (Toxicol. Appl. Pharmacol. 154, pp 76-83, 1999) describe screening methods for chemicals with hormonal activities using the interaction of nuclear hormone receptors with a coactivator. Their method is based on the finding that the interaction between the coactivator and a nuclear receptor, which is responsive to that particular coactivator, can be stabilised by a ligand that binds to the nuclear receptor. Such assays are also important in order to unravel the action of hormones and mechanisms for control of transcription of genes in general. With these techniques new medicines can be developed in order to specifically influence physiological processes related to the functioning of nuclear receptors for therapeutic, diagnostic, cosmetic and contraceptive purposes.
This invention makes a protein available which has the amino acid sequence as given in SEQ ID's 7, 8, 11 or 12. Such a protein has the effect of coactivating a responsive nuclear receptor in its DNA-transcription promoting function.
With the finding of the function of such a protein as a coactivator this invention also provides a new method of modulation of transcriptional activity promoted by a responsive nuclear receptor and a coactivator in a system, comprising the addition of an agent to the system, which agent interferes with, or enhances, the function of the coactivator of this invention. This method can be performed both by introducing the gene for the coactivator in the system in order to bring it into expression as well as by identification and subsequent use of compounds which can change the functioning of the coactivator and/or the coactivator-nuclear receptor complex. Thus the term agent refers here, for example, to a chemical compound or to a vector, which vector comprises the gene encoding the protein of the invention. Such modulation can be used to interfere with, or to enhance, nuclear transcription processes for therapeutic, contraceptive, diagnostic and cosmetic purposes and it can be used in assays for quantification of the modulation. Thus, the term system refers to a molecularly and/or biologically defined environment and refers to in vitro systems as well as to in vivo systems in which the modulating agent can be introduced. In vitro systems are mixtures allowing DNA and/or RNA transcription/translation and in vivo systems are cells, which can be either in a cell or tissue culture or within a human or animal body. Obviously, the term modulation of the activity of a nuclear receptor can mean either an increase or a decrease in the transcriptional activity of the receptor, whereas the term coactivation means the enhancement of the transcriptional activity of the receptor.
A sequence, putatively representing such a protein, is reported previously with gene number KIAA0576 in a publication by Nagase et al. (DNA Research vol 5, pp 31-39, 1998) by reference to accession number AB011148 for the EMBL/GenBank/DDBJ databases, where it is linked to protein_id BAA25502. The gene KIAA0576 was not made to expression beyond the RNA stage and no more specific function other than nucleic acid management was assumed based on a very weak homology (<30% identical nucleotides) to a known DNA sequence.
Since it is obvious that minor modifications in the sequence of the protein are equally useful for the above described use, the invention also provides for a protein having an amino acid sequence which has at least 90%, or preferably at least 95%, more preferably at least 99% and most preferably 100% similarity to the sequence in SEQ ID's 7, 8, 11 or 12. The term similarity refers to a degree of similarity between proteins in view of differences in amino acids, but which different amino acids are functionally similar in view of almost equal size, lipophilicity, acidity etc. A percent similarity can be calculated by optimal alignment of the sequences using a similarity scoring matrix such as the blosum62 matrix described in Henikoff and Henikoff (Proc. Natl. Acad. Sci. USA 89; 10915-10919 (1992)). Calculation of the percentage similarity and optimal alignment of two sequences using the blosum62 similarity matrix and the algorithm of Needleman and Wunsch (J. Mol. Biol. 48; 443-453 (1970)) can be performed using the GAP program of the Genetics Computer Group (GCG, Madison, Wis., USA) using the default parameters of the program.
It is a further aspect of the invention that the above described coactivating function can also be obtained with a protein having the sequence of amino acid number 1-234 in SEQ ID's 7 or 8. It is known that truncated proteins can have the same or partially the same function as the larger protein. It was found that this truncated protein can also be used and therefore this aspect of the invention also provides a protein having a sequence which has at least 90%, or preferably at least 95%, more preferably at least 99% and most preferably 100% similarity to the sequence of amino acid number 1-234 in SEQ ID's 7 or 8.
It is a further aspect of the invention to provide a protein which is a naturally occurring variant of a protein having the sequence as in SEQ ID's 7, 8, 11 or 12. Proteins which have at least 80% similarity, preferably at least 90%, more preferably at least 95%, even more preferably at least 99% and most preferably 100% similarity to the protein defined in SEQ ID's 7, 8, 11 or 12 and originating from human tissues or tissues of non-human species can likewise be used for coactivating a responsive nuclear receptor. Such polymorphic forms and species homologues are also included in the class of proteins made available by this invention. A naturally occurring protein belonging to the class defined by commonalities in the indicated structure and function of the protein defined by SEQ ID's 7, 8, 11 or 12, will be named by the arbitrary letter sequence COASTER proteins. In earlier documents, at least in documents having circulated within our research organisation the arbitrary letter sequence MFC has been used in order to provide a name for the proteins according to this invention. Thus, MFC and COASTER are synonyms. Other COASTER fragments also occur in biological tissue. Such fragments are encoded by splice variants.
Furthermore, having disclosed the structure of the protein and function of a COASTER protein, the invention also provides a protein which is a homologous functional equivalent of the protein as defined above. A homolous functional equivalent is a protein, which does not fullfill completely the earlier defined characteristics, because it has either less similarity than one of the above indicated percentages, or it is not the fragment as defined above, or it is of non-natural origin, but still has a characteristic function in common with the earlier defined proteins of the invention. For example, a fragment of a COASTER protein, can not only be used by itself for coactivation of the responsive nuclear receptor, but can also be fused with other protein sequences known from other proteins in order to take advantage of the nuclear receptor activating effect. Such fragments need not be 100% identical to the sequences of fragments of intact COASTER-proteins. Moreover, proteins functionally equivalent to COASTER proteins and splice variants thereof can be made artificially by deliberate mutations, insertions or deletions in the encoding poly-nucleotide sequence. A large degree of similarity of a protein with a protein specifically characterised in this description make a protein functionally equivalent to a COASTER protein. In this description a protein of this invention refers to any structurally similar or functionally equivalent artificial protein, splice variant or COASTER protein as defined above.
In view of the usefulness of the proteins, it is an aspect of the invention to provide the use of a polynucleotide encoding the protein of this invention by bringing the polynucleotide into expression in a system which also comprises a responsive nuclear receptor. The polynucleotide can either be a DNA or an RNA since both a DNA nucleotide sequence as well as an RNA sequence will serve the purpose of encoding the proteins of the invention. Preferred DNA's for use in this invention are the sequences given in SEQ ID's 1, 2, 3, 4, 5, 6, 9 or 10. Expression can be obtained by artificially incorporating the polynucleotide in eukaryotic cells, bacteria, plasmids or vectors and enabling transcription of the gene by methods generally known in the art. The system, which can be a mixture with components for DNA or RNA transcription and/or translation or an intact cell, possibly part of a whole organism, should also contain or generate the responsive nuclear receptor in order to be able to use the interaction between the protein of the invention and the nuclear receptor. A practical source of information on these techniques can be found in Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold Spring Harbor laboratory Press, Cold Spring Harbor, 1989.
In the context of nucleotides one can also refer to degrees of similarity, whereby nucleotide triplets encoding the same amino acid can replace triplets in the above sequences. More common is to refer to homologous sequences of nucleotides:
Homology of a polynucleotide is defined as:
Homology
ā¢
ā¢
(
%
)
=
Number
ā¢
ā¢
of
ā¢
ā¢
identical
ā¢
ā¢
residues
ā¢
ā¢
between
ā¢
ā¢
two
ā¢
ā¢
sequences
Length
ā¢
ā¢
of
ā¢
ā¢
aligned
ā¢
ā¢
sequences
-
Length
ā¢
ā¢
of
ā¢
ā¢
all
ā¢
ā¢
gaps
after optimal alignment of the sequences. Optimal alignment can be performed using the algorithm of Needleman and Wunsch (J. Mol. Biol. 48; 443-453 (1970)) that maximizes the number of matches and minimizes the number of gaps. In fact, a more restricted range of proteins can be defined by replacing the term similarity by homology having the analogous definition of homology of a polynucletide. Such a use of the term homology for a protein of the invention is based on the percentage identity of amino acid residues in the protein. Alternatively, the term degree of homology of a protein defined in this way, may also be replaced by the term degree of identity of a protein.
To accommodate codon variability, the invention also includes polynucleotide sequences coding for the same amino acid sequences as the sequences disclosed herein. The sequence information as provided herein should not be so narrowly construed as to require exclusion of erroneously identified bases. The specific sequence disclosed herein can readily be used to isolate the complete genes of several other species or allelic variants. The sequence can e.g. be used to prepare probes or as a source to prepare synthetic oligonucleotides to be used as primers in DNA amplification reactions allowing the isolation and identification of the complete variant genes. The complete genetic sequence can be used in the preparation of vector molecules for expression of the protein in suitable host cells.
The present invention further relates to polynucleotides having slight variations or having polymorphic sites. Polynucleotides having slight variations may encode variant polypeptides which retain the same biological function or activity as the natural, mature protein. Polymorphic sites are useful for diagnostic purposes.
In another aspect, the invention provides for a method to isolate a polynucleotide comprising the steps of: a) hybridizing a DNA according to the present invention under stringent conditions against nucleic acids being RNA, (genomic) DNA or cDNA isolated preferably from tissues which highly-express the polynucleotide of interest; and b) isolating said nucleic acids by methods known to a skilled person in the art. The tissues preferably are from human origin. Preferably ribonucleic acids are isolated from oocytes, ovaria or testes. The hybridization conditions are preferably highly stringent.
According to the present invention the term astringent means washing conditions of 1ĆSSC, 0.1% SDS at a temperature of 65° C.; highly stringent conditions refer to a reduction in SSC towards 0.3ĆSSC, more preferably to 0.1ĆSSC. Preferably the first two washings are subsequently carried out twice each during 15-30 minutes. If there is a need to wash under highly stringent conditions an additional wash with 0.1ĆSSC is performed once during 15 minutes. Hybridization can be performed e.g. overnight in 0.5M phosphate buffer pH 7.5/7% SDS at 65° C.
As an alternative the method to isolate the gene might comprise gene amplification methodology using primers derived from the nucleic acid according to the invention. Complete cDNAs might also be obtained by combining clones obtained by e.g. hybridization with e.g. RACE cDNA clones.
In order to use the modulation of transcription the system should also comprise genes for responsive nuclear receptors and responsive promoter elements for these nuclear receptors. The poly-nucleotide encoding a protein of this invention can be used for the production of recombinant COASTER protein to serve, in combination with a recombinant nuclear receptor protein, in an assay for binding of the protein with the responsive nuclear receptor.
The term responsive nuclear receptor is used in this description to refer to any nuclear receptor that can be activated by a COASTER-protein. Preferably the nuclear receptor in the system of the assay is a steroid receptor, or more preferrably a progestogen receptor, an estrogen receptor or a glucocorticoid receptor.
A method of modulation of transcriptional activity promoted by a responsive nuclear receptor and a coactivator according to this invention can be an in vitro assay for determination of the degree of modulation and comprises quantifying the degree of modulation. Provisions for quantification of the degree of modulation or binding may comprise a yeast two-hybrid assay such as described here or an analogous two-hybrid assay in a mammalian cell system. Alternatively, the binding efficiency may be measured using isolated recombinant proteins of COASTER and the nuclear receptor that are suitably labelled to allow detection of the binding efficiency. Labelling of the proteins may involve radioactive or fluorescent molecules or molecules with enzymatic properties that are directly or indirectly attached to the recombinant proteins. Alternatively, the binding efficiency may be measured by an affinity based biosensor system such as the BIACORE. Alternatively, the binding efficiency might be measured by in vitro or in vivo complementation assays that use the interaction of COASTER protein and the nuclear receptor to drive complementation of a functional protein, such as β-galactosidase or dihydrofolate reductase, whereby the function of the complemented protein is used as a measure for the binding efficiency.
The method of modulation of transcriptional activity promoted by a responsive nuclear receptor and a coactivator according to this invention can also be a treatment of the human or animal body comprising the administration of the agent to the human or animal. Such an agent can be a vector inserting the gene for the coactivator into cells of the organism thereby enabling production of more coactivator for activation of the nuclear receptor or it can be a vector inserting a gene for a defective coactivator into cells of the organism thereby enabling production of a protein according to the invention which interferes with the action of the endogenous COASTER protein, resulting in diminished action of the nuclear receptor. The agent can also be a chemical compound which influences the interaction between the coactivator and the responsive nuclear receptor. Such a compound can be obtained by routine screening in an assay for binding between the coactivator and the responsive nuclear receptor or in an assay for quantification of the modulation of the action of the responsive nuclear receptor.
It is therefore a further aspect of the invention that the assay or method according to the invention can be used to select compounds which modulate the binding between a COASTER protein and a responsive nuclear receptor, or which modulate the activity of a nuclear receptor-COASTER complex. In such an assay, compounds are being tested for their ability to induce or perturb an interaction between COASTER and a responsive nuclear receptor, or, alternatively, upon their ability to modulate transcription via a responsive nuclear receptor and in the presence of COASTER and a reporter DNA.
A reporter DNA consists of a promoter that is responsive to the nuclear receptor under study, and a reporter gene whose transcriptional activity can be monitored. The promoter may either be an isolated natural promoter of a nuclear receptor-responsive gene, or a synthetic cassette of (multiple copies on a consensus nuclear receptor responsive element fused to a basal core promoter (e.g. a TATA box). Suitable reporter genes include genes that encode enzymes whose activity can be monitored via an enzymatic assay (e.g. luciferase or β-galactosidase), genes that encode proteins with fluorescent properties (e.g. Green Fluorescent Protein), or genes whose transcripts levels can be monitored.
The latter assay is particularly advantageous because COASTER potentiates the action of an estrogen-receptor-responsive element (ERE) containing promoter in the presence of the estrogen receptor a and a partial agonist, thereby enabling the identification of novel partial agonists. Known ERE-based assays are not able to recognize all partial agonists (e.g. raloxifen).
The invention also provides a pharmaceutical composition as a medicine for the mentioned method of modulation of transcriptional activity promoted by a responsive nuclear receptor and a coactivator in a system, comprising the administration of an agent to a human or animal body, which agent interferes with, or enhances, the function of the coactivator of this invention. This the invention also provides a pharmaceutical composition for use in the mentioned, which pharmaceutical composition comprises the agent which interferes with, or enhances, the function of the coactivator. As explained above a compound identified with the assays provided by the invention can interfere with, or enhance, the function as coactivator of the protein of the invention. Alternatively, a vector comprising the gene for a protein according to the invention can be formulated for medicinal use.
A method of preparation of a medicine by mixing the agent with one or more pharmaceutically acceptable auxiliaries such as described in the standard reference Gennaro et al., Remmington's Pharmaceutical Sciences, (18th ed., Mack publishing Company, 1990, see especially Part 8: Pharmaceutical Preparations and Their Manufacture.) is well known in the art. Suitable auxiliaries are described in e.g. the Handbook of Pharmaceutical Excipients (2nd Edition, Editors A. Wade and P J. Weller; American Pharmaceutical Association; Washington; The Pharmaceutical Press; London, 1994). The mixture of the agent and the pharmaceutically acceptable auxliary may be compressed into solid dosage units, such as pills, tablets, or be processed into capsules or suppositories. By means of pharmaceutically suitable liquids the agent can also be applied as an injection preparation in the form of a solution, suspension, emulsion, or as a spray, e.g. nasal spray. For making dosage units, e.g. tablets, the use of conventional additives such as fillers, colorants, polymeric binders and the like is contemplated.
Such pharmaceutical compositions can be used in a COASTER-activated nuclear receptor related treatment, more specifically against hormone stimulated tumor growth, for male or female contraception, for the treatment of menopausal complaints and post-menopausal disorders in women, for anabolic drug treatment, for heart diseases and for the treatment of aging due to reduced hormonal activity.
Since the COASTER protein displays a tissue-specific expression profile, such medicines may contribute to tissue-specific treatments. Moreover, the presence or modulation of COASTER may alter the pharmacology of nuclear receptor ligands. For example, raloxifen is usually an antagonist, but when COASTER is clearly expressed in the cell, raloxifen displays agonistic properties.
Properly labelled poly-nucleotides having a sequence encoding proteins for the invention or fragments thereof are also made available by this invention. These can be used in methods of diagnosis by stringent quantitative hybridisation of RNA in order to identify diseases related to abnormal expression of COASTER-RNA in an organism. These methods can advantageously involve the use of such a labelled poly-nucleotide having a length of at least 500 nucleotides, in order to have accurate identification of RNA with hybridisation. However a length of between 20 and 50 nucleotides can also be preferred as being more practical and still effective for this purpose. For diagnostic purposes, expression of the COASTER mRNA can also be detected by nucleotide chain reaction, such as reverse-transcriptase polymerase chain reaction (RT-PCR). To this end, cDNA is synthesized from RNA isolated from a sample specimen using a reverse transcriptase enzyme. The cDNA is subsequently used as a template in a polymerase chain reaction in the presence of a COASTER antisense and sense oligonucleotide primer. The amount of amplified PCR product, that can be determined by isotopic or non-isotopic labeling in combination with appropriate detection methods or by direct spectrophotometric or calorimetric methods, reflects the relative expression level of the COASTER mRNA.
Labelling can be done in various ways. In the case of radioactive labelling, hybridisation of poly-nucleotides may be measured by quantitation of the number of desintegrations per second of the radiolabeled hybrid. Alternatively, hybridised radiolabeled fragments may be visualized by autoradiography or similar methods. Non-isotopic labelling methods often make use of biotinylated nucleotides that are incorporated during labelling of the fragment. Successfully hybridised fragment can subsequently be detected by virtue of the incorporated biotin. The biotin moiety can be detected using an avidin molecule conjugated to a molecule with fluorescent or enzymatic properties. The amount of fluorescence or enzymatic activity is used as a measure for the hybridisation efficiency.
The diagnostic method will be particularly useful for diseases involving tumour growth. It is striking that the COASTER gene is strongly expressed in tumor cell lines. The diagnostic method can be performed by scanning or taking biopsies from the organism to be diagnosed, but the method can be strictly limited to a method which is not practised on the human or animal body. In that situation the method comprises in vitro testing of available biological material for hybridisation. In view of the sensitivity of the nuclear receptors for COASTER the method is preferrably to be used when the suspected disease relates to malfunction of a steroid receptor, or more preferrably with a progestogen receptor, an estrogen receptor or a glucocorticoid receptor.
The proteins for the invention can also be used to produce anti-bodies directed to these proteins, which antibodies can be used in diagnostic methods of disorders involving changes in the coactivation process disclosed in this invention.
Methods for the production of monoclonal and polyclonal antibodies can be found in a standard laboratory manual such as Current Protocols in Molecular Biology (F M. Ausubel, R. Brent, R E. Kingston, D. D. Moore, J G. Seidman, J A. Smith, K. Struhl eds., John Wiley & Sons Inc.). Immunisation may be performed using crude or purified preparations of COASTER protein or via DNA vaccination using a mammalian expression vector for COASTER that is directly used to immunise the antibody donor organism.
Poly-nucleotides encoding COASTER artificially incorporated in eukaryotic cells, bacteria, plasmids or vectors and COASTER protein can be obtained by amplification by a polymerase chain reaction on a cDNA template that has been obtained by reverse transcription of RNA from human testis. The polymerase chain reaction should make use of a sense primer encompassing the start codon of the COASTER cDNA (e.g. ATGGGAGACCCGGGGTCGGA; SEQ ID 13) and an antisense primer encompassing the stop codon of the COASTER cDNA (e.g. TTACATTTCCTCAAGACTTC; SEQ ID 14). Cloning of the thus obtained cDNA in a suitable expression vector will allow production of the COASTER protein.
By deletions and insertions of nucleotides partially identical artificial COASTER proteins can be obtained with methods well known to the skilled person, for example as described in Sambrook (op. cit.).
The COASTER protein may be introduced into an organism by transfection of an expression vector containing the COASTER cDNA. The vector should contain a promoter that is able to drive gene expression in the transfected organism, and the COASTER cDNA downstream of this promoter. In addition, the vector should contain signals for proper initiation and termination of transcription and translation, and signals for proper processing of the transcript. For introduction of COASTER in mammalian cells viral promoters such as the Simian Virus 40, Rous Sarcoma long terminal repeat or Cytomegalovirus immediate early promoters are suitable for driving transcription of the COASTER cDNA. Examples of plasmid vectors containing viral promoters include pCDNA3.1, pRSV and pNGV1. In addition to introduction of COASTER into mammalian cells with the aid of plasmids, COASTER may be introduced into mammalian cells by transduction using viral vehicles for delivery and expression of COASTER. Suitable viruses include retroviruses, adenoviruses and baculovirus.
For introduction of COASTER in bacterial cells vectors containing bacterial promoters such as the T7 promoter are suitable. Examples of bacterial expression vectors include pRSET and pET. For introduction of COASTER in yeast, suitable vectors include pYES for introduction in Saccharomyces cerevisiae and pPIC for introduction in Pichia pastoris.
A straightforward method is available to select a responsive nuclear receptor for the assay. For example, it can be tested whether a nuclear receptor is coactivated by COASTER protein in a transient transfection assay. When there is coactivation, the nuclear receptor is responsive. The action of a nuclear receptor is the induction of transcription of a gene linked down stream to a promoter. With a two-hybrid assay, for example, it can be tested whether the nuclear receptor interacts with the COASTER protein.
Likewise, the functional equivalence to COASTER protein of an artificial protein can routinely be tested in an assay as described in the examples.
The following description of variants and use of the invention is intended to further enable the invention and the use of it.
Coactivation of the Selective Estrogen Receptor Modulator (SERM) Liganded ERα Depends on the AF1 Region.
FIG. 4 shows that COASTER is a coactivator for the 4OH-tamoxifen liganded ERα but not for the 4OH-tamoxifen liganded ERβ. These results are in good agreement with previous observations that the SERM 4OH-tamoxifen signals via the AF1 function of ERα. The AF1 function resides in the AB domain of the ERα and is neither structurally nor functionally conserved in ERβ (McInerney et al., 1998, Endocrinology 139, 4513-4522). To substantiate this notion, we tested the coactivating potential of COASTER on two receptor chimeras. The ERβ/α, chimera contains the AB domain of ERβ fused to the CDEF domains of ERα as described previously (McInerney et al., 1998, Endocrinology 139, 4513-4522). In transfection experiments the ERβ/α receptor permits coactivation by COASTER in the presence of 17β-estradiol, but not in the presence of the SERMs 4OH-tamoxifen and raloxifene (FIG. 8). This observation indicates that coactivation by COASTER of the SERM liganded receptor is distinct from coactivation of the 17β-estradiol liganded receptor. In line with the previous observation that signalling by 4OH-tamoxifen requires the ERα AF1, our results show that 4OH-tamoxifen does not display agonism on the ERβ/α chimera. Furthermore, our data show that elevating the COASTER levels in the cell cannot overcome this block in activity, indicating that coactivation of the SERM liganded receptor requires the ERα AF1. The situation on the ERα/β chimera, which contains the ERα AF1 fused to the CDEF domains of ERβ, is more complex. It has been shown previously that the ERα/β chimera shows agonism of 4OH-tamoxifen and an activity in the presence of 17β-estradiol that is reduced compared to that of the wild type ERα or ERβ receptors (McInerney et al., 1998, Endocrinology 139, 4513-4522). Our data confirm and extend these results and show that in addition to 4OH-tamoxifen and 17β-estradiol, raloxifene is also able to signal via the ERα/β chimera. However, the ERα/β chimera is insensitive to coactivation by COASTER. The combined results indicate that the ERα/β chimera adapts a unique conformation and suggest that the coactivation as seen on the 17β-estradiol-liganded wild type ERβ depends on both the AF2 function and sequences in the N-terminus of ERβ.
COASTER Identifies Novel SERMs
The results presented in FIGS. 4 and 5 show that in the absence of COASTER, 4OH-tamoxifen may function as an agonist on ERα whereas raloxifene may not. Elevation of the COASTER levels in the cell allows the identification of raloxifene as a ligand with agonistic potential. We questioned whether COASTER would allow the identification of novel potential SERMs in a pool of compounds that have previously been identified as anti-estrogens. To this end, we tested the activities of the compounds ORG 43143, ORG 39660 and ORG 39669 that were identified as novel anti-estrogens in a high throughput screening assay (Method in Dechering et al., 2000, Current Medicinal Chemistry 7, 561-576). FIG. 9 shows that these compounds all behave as anti-estrogens. Notably, compound ORG 39669 shows a partial activity in the anti-estrogenic assay. When tested in a COASTER co-activation assay, this group of anti-estrogens falls apart into three distinct functional classes (FIG. 10). The first class comprises 4OH-tamoxifen and ORG 39669 and represents a group of compounds that show some agonism on ERα and enhanced agonism in the presence of COASTER. The second class is a group of anti-estrogens that are silent on ERα mediated transcription of an ERE reporter in the absence of COASTER. However, when COASTER levels are elevated, these compounds become agonists. The compounds raloxifene and the novel anti-estrogen ORG 43143 are representatives of this second class. The final class of anti-estrogens includes ICI 164,384 and ORG 39660 and represents a group of compounds that do not show agonism on an ERE reporter and remain silent in the presence of COASTER.
Tissue Distribution of COASTER
The tissue distribution of COASTER mRNA was investigated by Northern blot analysis and RT-PCR. Human multiple tissue Northern blots were hybridized with a 794 bp COASTER cDNA fragment. Almost all tissues examined show hybridisation to an mRNA species of approximately 5 kB in size, with higher signals in testis, ovary, heart, placenta, and skeletal muscle, and lower to no signals in the other tissues (FIG. 6). In addition, a very strong hybridisation signal is observed to a 4 kB transcript that is uniquely present in testis. The size of the 5 kB transcript is in good agreement with the size of the cDNA that we have isolated. The 4 kB transcript may represent a splice-variant. The testis specific expression pattern of this transcript is striking and suggests a functional role in testis physiology.
Expression of mRNA from COASTER was also investigated by RT-PCR analysis in different human cell lines derived from tumors, and in RNA samples from human and Macaca fasciculata (Cynomolgus monkey) tissues. The semi-quantitative results of the RT-PCR are shown in FIGS. 7 and 11. The results show high expression in the breast epithelial carcinoma cell lines MCF-7 and T-47 and the vaginal epithelial cell line SW954. Moderate expression was observed in the osteosarcoma cell lines U-2 OS and HOS, the endometrial epithelial carcinoma cell line Ishikawa, the vascular endothelial cell line VE103ERα, and the endothelial cell line HS760T. No expression was detected in the osteosarcoma cell line MG63 and the endometrial epithelial carcinoma cell line ECC-1. The cell lines that show high expression of COASTER (MCF-7, T-47D, SW954) have been reported to contain high levels of ERα (Dechering et al., Curr. Med. Chem. 7, 561-576), suggesting that COASTER may contribute to ERα-mediated growth of tumor cells. The RT-PCR results on RNA derived from tissues are presented in FIG. 11. The RT-PCR method confirms the high expression in testis as revealed by the Northern blot (FIG. 6). In addition, high expression is seen in bone tissue. This indicates that ligands that allow the nuclear receptor-COASTER interaction might influence bone metabolism.
Further examples and figures serve to illustrate and clarify or specify the invention.
The description is illustrated with the following figures:
FIG. 1. Example of a nucleotide and amino acid sequence of COASTER. This COASTER cDNA sequence has a length of 4999 base-pairs with an open reading frame of 3039 base-pairs (1013 amino acids). A previously published sequence of the cDNA encoding KIAA0576 (accession number AB01148) with near complete homology (99%) shows an insertion of 144 nucleotides at position 2832 that results in an open reading frame of 1061 amino acids. Zinc finger motifs are shown in bold, an LXXLL motif is underlined. The amino acid sequence of a consensus nuclear localisation signal is shown in italics and underlined. The ATG start codon and in-frame translational stop codons are shown in bold and italics.
FIG. 2. The COASTER cDNA sequence encodes a protein of approximately 115 kiloDaltons. Template pCDNA3.1HISC.COASTER that contains the complete open reading frame of COASTER was in vitro transcribed and translated in the presence of [35S]-methionine. As a control, pBK-SRC-1 (Onate et al., Science 270, 1354-1357) was transcribed and translated in parallel. Labeled proteins were analyzed by SDS-PAGE. The figure shows an autoradiograph of the electrophoresis pattern. Lane 1: translation product of pBK-SRC-1. Lane 2: translation product of pCDNA3.1HISC.COASTER. The position of the COASTER protein is indicated with an arrow.
FIG. 3. Hormone dependent interaction between ERβ and COASTER. A yeast two-hybrid assay was performed in yeast host Strain AH109 that was transformed with plasmid pGBT9. ERβ and a plasmid encoding a fusion between a GAL4 activation domain and COASTER amino acids 1-234. The figure shows β-galactosidase activity of the transformed yeast cells in response to 10ā8 M 17β-estradiol (shaded bar) and 10ā5 M raloxifen (solid bar). The background β-galactosidase activity of the transformed yeast cells is indicated with an open bar.
FIG. 4. Differential coactivation of ERα and ERβ in response to 4OH-tamoxifen and raloxifen. U-2 OS cells were transiently transfected with p4ERE-TATA-LUC and pNGV1.ERα or pNGV1ERβ as indicated. Where indicated, cells were cotransfected with COASTER expression constructs pCDNA3.1HISA.COASTERĪ or pCDNA3.1HISC.COASTER, or with expression construct pCDNA3.1HISC.GRIP1. The figure shows luciferase activity (l.a.) following incubation of the cells with no hormone (open bars), 10ā7 M raloxifen (hatched bars) or 10ā7 M 4OH-tamoxifen (solid bars). Error bars indicate the standard deviations in a triplicate experiment.
FIG. 5. Dose-dependent activation of an estrogen-response element in the presence of ERα or ERα in combination with COASTER. U-2 OS cells were transiently transfected with p4ERE-TATA-LUC and pNGV1.ERα. Transfection experiments indicated with solid markers were supplemented with COASTER expression construct pCDNA3.1HISC.COASTER. The figure shows luciferase activity (l.a.) following incubation of the cells with an increasing concentration of raloxifen (indicated with squares) or 4OH-tamoxifen (indicated with triangles). Error bars indicate the standard deviations in a triplicate experiment.
FIG. 6. Tissue distribution of COASTER transcripts. Human multiple tissue Northern blots were hybridised with a [32P]-labeled COASTER cDNA probe. The figure shows an autoradiograph of the blots. The COASTER probe hybridises to two mRNA species of approximately 5 kB and 4 kB in size, indicated with arrows. The tissues represented on the blots include spleen (a), thymus (b), prostate (c), testis (d), ovary (e), small intestine (f), colon (g), peripheral blood leukocytes (h), heart (i), brain (j), placenta (k), lung (l), liver (m), skeletal muscle (n), kidney (o) and pancreas (p). The migration pattern of a size standard is indicated at the left side of the figure (size in kilobases).
FIG. 7. COASTER expression in tumor cell lines. The relative expression levels of COASTER was determined by RT-PCR. The figure shows relative intensity of the PCR products as measured by scanning of the agarose gel electrophoresis images of the PCR products. The cell lines represented include: MCF-7 (a), T-47D (b), U-2 OS (c), MG63 (d), HOS (e), ECC-1 (f), Ishikawa (g), VE103 (h), HS760T (i) and SW 954 (j).
FIG. 8. Luciferase expression quatified with light counts per second (cps) in cells transfected with an ERβ/α chimeric receptor and COASTER in response to addition of estradiol (E2), raloxifene or 4-hydroxy-tamoxifen (4OHT).
FIG. 9. Percentage estrogenic activity in response to addition of a standard dose of estradiol in the presence of various concentrations, expressed as logarithm of the concentration, of raloxifene, 4-hydroxy tamoxifen (4OHT), ICI 164,384, Org 43143, Org 39660 and Org 39669, respectively.
FIG. 10. Effect of compounds in a COASTER coactivation assay.
FIG. 11. COASTER expression in human and M. fascicutlata tissues. The relative expression levels of COASTER were determined by RT-PCR. The figure shows relative intensity of the PCR products as measured by a Taqman real-time quantitative PCR method. The tissues that served as the source for the RNA material are indicated at the bottom of the figure. All tissues were from human origin, except for the bone tissue which was derived from M. fasciculata.
Results and Discussion
Yeast Two Hybrid Screen
For identification of COASTER as protein that interacts with ERβ in a hormone dependent way, a yeast two-hybrid screen was performed using ERβ as bait. The two-hybrid system consisted of a yeast strain (AH109) that expressed the HIS3, MEL1, ADE2 and lacZ reporter genes from a GAL responsive promoter. ERβ was expressed in this strain in a fusion with a GAL4 DNA binding domain. In this system, ERβ alone is not able to activate the reporter genes in the presence of 17β-estradiol (results not shown). The ERβ expressing host strain was transformed with a human osteosarcoma cDNA library. This library expresses cDNA as a translational fusion with a GAL4 transactivating domain. Interaction between ERβ and a library encoded protein permits activation of the reporter genes and growth on media lacking histidine and/or adenine. A total of 3.5Ć106 colonies were screened. The transformed yeast cells were selected for growth on media lacking histidine and in the presence of 17-β estradiol. 560 HIS+ colonies were selected and screened by replica plating on their ADE+ phenotype in the absence or presence of 17-β estradiol. 27 Yeast transformants that showed a hormone dependent HIS+, ADE+ phenotype were selected. The library-derived plasmid DNA was isolated from these 27 clones, and re-introduced in the AH109.pGBT9.ERβ host yeast strain to verify that the observed phenotypes were dependent on the transformed DNA. In a yeast β-galactosidase (lacZ transactivation assay, 21 out of the 27 positives that were retested showed a hormone inducible lacZ+ phenotype. Sequence analysis of these positives identified two well-known coactivators for steroid receptors, UBC9 (ubiquitin conjugating enzyme) and SUG1. In addition, a cDNA sequence was identified that was predicted to encode for a nuclear protein with several zinc finger motifs and an LXXLL domain, which apparently is implicated in the interaction between steroid receptors and coactivators. This cDNA was selected for further study and proved to encode a functional coactivator for steroid receptors. We have, therefore, termed this novel coactivator COASTER.
COASTER: A Novel Coactivator for Steroid Receptors
Primary Structure of COASTER
The insert of plasmid pACT2.COASTERĪ that was isolated in the two-hybrid screen was sequenced, and this sequence was compared with the Incyte Lifeseq Gold and Genbank databases using the BLAST algorithm. A total of 270 Incyte EST sequences were identified. Clone 2905757, containing the 3ā² end of the COASTER cDNA, was obtained from Incyte Genomics (Palo Alto, USA) and sequenced entirely. In addition, searching of the Genbank database revealed that the COASTER sequence shares near complete homology (99%) with the gene encoding KIAA0576, a putative protein of unknown function (Nagase et al., DNA Res. 5, 31-39). The KIAA0576 sequence represents a splice-variant of COASTER and contains an in-frame insertion of 144 base pairs. RACE PCR was employed to identify the 5ā² end of the COASTER cDNA sequence. Two distinct fragments that differ in their 5ā² untranslated regions were identified. FIG. 1 shows an overview of the complete COASTER cDNA sequence. The cDNA corresponding with the longest RACE fragment has a length of 4099 nucleotides and contains an open reading frame of 3039 nucleotides (1013 amino acids). The KIAA0576 shows an insertion of 144 nucleotides at position 2832 that results in an open reading frame of 1061 amino acids. For both COASTER and KIAA0576, the amino acid sequence deduced from the cDNA predicts a protein that contains 9 zinc finger domains (C2H2 type), a nuclear localization site and an LXXLL nuclear receptor interaction motif.
The COASTER cDNA Encodes a Protein
To test whether the COASTER cDNA indeed encoded a protein, plasmid pCDNA3.1HISC.COASTER that contains the complete open reading frame of COASTER (amino acids 1-1013) was in vitro transcribed and translated. FIG. 2 shows that a protein of approximately 115 kiloDaltons is encoded by the COASTER cDNA. The observed size of the protein is in perfect agreement with the length of the cDNA sequence presented in FIG. 1. The results furthermore show that the COASTER cDNA encodes a protein that is distinct from the protein encoded by pBK-SRC-1, which contains the open reading frame for the known coactivator SRC-1.
COASTER Interacts with ERβ in Yeast
Plasmid pACT2.COASTERΠwas originally isolated in the yeast two-hybrid screen. To verify that the protein encoded by this plasmid indeed interacts with ERβ in yeast, plasmid pACT2.COASTERΠwas re-introduced into the AH109.pGBT9.ERβ recipient strain. FIG. 3 shows the results of a subsequent two-hybrid assay. The results show that addition of 17β-estradiol to the growth medium results in a dose-dependent induction of the β-galactosidase reporter activity. In contrast, the anti-estrogens raloxifen is not able to induce the activity of the reporter. This failure may relate to the resistance of yeast cell to anti-estrogens as has been reported earlier (Lyttle et al., J Steroid Biochem. Biol. 42, 677-685; IH, unpublished results). Alternatively, it may indicate that the anti estrogen induced conformation of ERβ does not permit an interaction with COASTER. Transformation of the yeast strain with either the ERβ expression plasmid or the COASTER expression plasmid alone did not result in a 17β-estradiol inducible lacZ+ phenotype (data not shown). Together, the results indicate that ERβ and COASTER interact in a 17β-estradiol-dependent manner in yeast. The interaction is independent of the LXXLL motif of COASTER as this motif is not encoded by plasmid pACT2.COASTERΠthat was used in the yeast two-hybrid assay.
COASTER is a Functional Coactivator in Mammalian Cells
To test the functional role of COASTER in a mammalian setting, the full length COASTER (amino acids 1-1013) cDNA was cloned in a mammalian cell expression vector. The functional role of COASTER was analyzed by cotransfection of U-2 OS cells with the COASTER expression plasmid in combination with a steroid receptor expressing plasmid, and a plasmid containing a luciferase reporter gene under control of a hormone responsive element. Following transfection, cells were stimulated with the appropriate hormone for the receptor under study. The results are presented in Table 1:
| TABLE 1 | ||||
| no | 10ā8 M ICI | |||
| T st cells | hormone | 164,384 | ||
| 10ā8 M 17β- | ||||
| estradiol | ||||
| 1 | Erβ | 150 ± 14 | 500 ± 109 | 134 ± 28 |
| ERβ + | 133 ± 16 | 8200 ± 819ā | 101 ± 6ā | |
| COASTER | ||||
| 2 | ERα | 180 ± 22 | 9505 ± 2122 | 174 ± 18 |
| ERα + | 134 ± 18 | 15400 ± 1179ā | 275 ± 55 | |
| COASTER | ||||
| 10ā8 M Org | ||||
| 2058 | ||||
| 3 | PR | ā62 ± 22 | 822 ± 112 | |
| PR + | ā81 ± 48 | 3229 ± 683ā | ||
| COASTER | ||||
| 10ā8 M Dexa- | ||||
| methasone | ||||
| 4 | GR | 44 ± 3 | 1232 ± 82ā | |
| GR + | 103 ± 33 | 35245 ± 8679ā | ||
| COASTER | ||||
As can be seen in table 1, COASTER is a coactivator for the progesterone receptor (PR), glucocorticoid receptor (GR) and the estrogen receptors α and β (ERα and ERβ). In all cases, the activity of the receptor liganded with an agonist is further enhanced by co-expression of COASTER. When ERα or ERβ are liganded with the antagonist ICI164,384, co-expression of COASTER does not enhance the transcriptional activity, indicating that the antagonist induced conformation does not allow COASTER to function as a coactivator. The activity of the reporter gene was not induced when COASTER was transfected in the absence of a steroid receptor (data not shown), indicating that both the steroid receptor and COASTER are required for the enhanced activity.
COASTER Identifies Partial Agonists for the Estrogen Receptor α
The coactivating potential of COASTER on ERα and ERβ was further studied in the presence of the anti-estrogens raloxifen and 4OH-tamoxifen. For comparison, the activity of the coactivator GRIP1, which is the mouse orthologue of human TIF2/SRC-2, was analyzed in parallel. Transfection-experiments showed that in U-2 OS cells, 4OH-tamoxifen acts as an agonist on the transcriptional activity of ERα, but not ERβ, when an ERE-reporter is used as a read-out (FIG. 4). Cotransfection of either COASTER or GRIP1 results in an enhanced activity of the 4OH-tamoxifen-liganded ERα. Interestingly, COASTER is able to activate transcription in the presence of raloxifen, which compound is otherwise not an agonist in this system. This phenomenon is observed on ERα-mediated transcription, but not when ERβ is present as the estrogen receptor. Moreover, the coactivator GRIP1 is not able to activate expression of the reporter gene in the presence of raloxifen and ERα. The data show that the activity of the truncated form of COASTER, COASTERĪ, is identical to that of full length COASTER. This indicates that amino acids 1 to 234 are sufficient for the coactivating potential of COASTER on the raloxifen or 4OH-tamoxifen liganded ERα. The effects of COASTER on ERα mediated transcription were further studied by making dose-response curves for the ligands raloxifen and 4OH-tamoxifen in the presence and absence of COASTER. The data presented in FIG. 5 confirm the observation that raloxifen acts as an agonist on ERE-driven gene transcription in the presence of ERα and COASTER. When COASTER is omitted, raloxifen is not able to activate the reporter gene, even at high concentrations of the ligand. The anti-estrogen 4OH-tamoxifen is an agonist in this system. However, the expression of COASTER increases the magnitude of the transcriptional response. For both compounds, the activity of the reporter in the presence of ERα and COASTER is dependent on the concentration used in the assay.
The results presented here show that COASTER can influence the agonist/antagonist balance of mixed profile anti-estrogens such as raloxifen and 4OH-tamoxifen. Previous reports have shown that raloxifen may act as an agonist via non-classical (non-ERE) pathways on ERβ (Zou et al., Mol Endocrinol. 13, 418-430; Paech et al., Science 277, 1508-1510). To the best of our knowledge, these data provide the first observations of agonism of raloxifen on the classical estrogen-responsive element (ERE) pathway. In addition, these are the first indications that raloxifen may act as an agonist on ERα. These observations are important to our understanding of the mechanisms of action of anti-estrogens. The property of COASTER to activate the raloxifen-liganded ERα sets COASTER apart from the coactivators, such as GRIP1, described to date. Moreover, the assay described here can be used with particular adantage for the pharmacological screening of novel estrogen receptor ligands as COASTER is able to identify partial agonistic properties of compounds.
Tissue Distribution of COASTER
The tissue distribution of COASTER mRNA was investigated by Northern blot analysis and RT-PCR. Human multiple tissue Northern blots were hybridized with a 794 bp COASTER cDNA fragment. Almost all tissues examined show hybridisation to an mRNA species of approximately 5 kB in size, with higher signals in testis, ovary, heart, placenta, and skeletal muscle, and lower to no signals in the other tissues (FIG. 6). In addition, a very strong hybridisation signal is observed to a 4 kB transcript that is uniquely present in testis. The size of the 5 kB transcript is in good agreement with the size of the cDNA that we have isolated. The 4 kB transcript may represent a splice-variant of which the detailed structure is as yet unknown. However, the testis specific expression pattern of this transcript is striking and suggests a functional role in testis physiology.
Expression of mRNA from COASTER was also investigated by RT-PCR analysis in different human cell lines derived from tumors. The semi-quantitative results of the RT-PCR are shown in FIG. 7. The results show high expression in the breast epithelial carcinoma cell lines MCF-7 and T-47 and the vaginal epithelial cell line SW954. Moderate expression was observed in the osteosarcoma cell lines U-2 OS and HOS, the endometrial epithelial carcinoma cell line Ishikawa, the vascular endothelial cell line VE103ERα, and the endothelial cell line HS760T. No expression was detected in the osteosarcoma cell line MG63 and the endometrial epithelial carcinoma cell line ECC-1. The cell lines that show high expression of COASTER (MCF-7, T-47D, SW954) have been reported to contain high levels of ERα (Dechering et al., Curr. Med. Chem. 7, 561-576), indicating that COASTER can contribute to ERα-mediated growth of tumor cells.
Materials and Methods
Yeast Two Hybrid Screen
Yeast Media
Yeast host strains and transformants were cultured in complete medium (YPD) or in minimal Synthetic Dropout (SD) medium. The complete medium is a blend of peptone, yeast extract, and dextrose in optimal proportions for growth of yeast strains (see yeast protocols handbook Clontech, Palo Alta, USA, protocol PT3024-1). The minimal SD medium contains 2% dextrose, 0.67% yeast nitrogen base, and a specific mixture of amino acids and nucleosides (e.g. SD-His-Leu-Trp is a medium that lacks histidine, leucine and tryptophan). All these media were purchased from BIO101 (Beverly, USA).
Two-Hybrid Screen
Saccharomyces cerevisiae strain AH109 (MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4Ī, gal80Ī, LYS2::GAL1UAS-GAL1TATA-HIS3,GAL2UAS-GAL2TATA-ADE2, URA3::MEL1TATA-lacZ) was obtained from Clontech, Palo Alto USA: To express the ERβ protein as a bait in yeast strain AH109, plasmid pGBT9.ERβ was used (kind gift of W. Kruijer, Rijksuniversiteit Groningen, The Netherlands). This plasmid contains the coding sequence of ERβ (amino acids 1 to 530) fused to a sequence encoding a GAL4 DNA binding domain and contains the TRP1 gene as a selectable marker. The yeast strain AH109 was transformed with pGBT9.ERβ, using a standard lithium-acetate method following the instruction manual from Clontech (Palo Alto, USA, protocol#PT3247-1) and transformants were selected on SD-Tryptophan (SD-Trp) plates.
From this plate single colonies were selected and stored as parental clones. Subsequently, the HIS3 background expression of these clones was determined by plating on the appropriate selection plates. Clones that grew on histidine-deficient media in the presence of 17β-estradiol were discarded. Subsequently, clones with low HIS3 background expression were transformed with a positive control pGRIP1 (kind gift of M. Stallcup, University of Southern California, USA), a plasmid that encodes the coactivator GRIP1 that has been shown to interact with the estrogen receptor in yeast (Hong et al., Mol. Cell. Biol. 17, 2735-2744). The parental clone (AH109.ERβ) that showed high HIS3 expression in the presence of pGRIP1 and 17β-estradiol was subsequently chosen as the recipient clone for screening of the library. A human osteosarcoma Matchmaker cDNA library was obtained from Clontech (Clontech, Palo Alto, USA, cat.#: HL4026AH). This library is constructed in vector pACT2, which contains a LEU2 gene as a selectable marker and expresses the cloned inserts in fusion with a GAL4-activation domain (AD). Recipient clone AH109.ERβ was transformed with 100 μg plasmid DNA from the osteosarcoma cDNA library. Transformants were selected on SD-Trp-Leu-His plates containing 10ā8 M 17β-estradiol, and HIS+ colonies were identified. HIS+ colonies were rescreened by replica plating on SD-Trp-Leu-His-Ade media in the absence and presence of 10ā8 M 17β-estradiol. Yeast transformants that showed a hormone dependent HIS+/ADE+ phenotype were selected for subsequent studies. From these transformants, DNA was isolated following a protocol for crude miniprep isolation (see basic protocols Y1.4). The crude miniprep was used to transform E. coli KC8 by electroporation and transformants containing the library-derived plasmid were selected on leucine deficient medium. Library inserts were sequenced on an ABI sequencer from Perkin Elmer (Norwalk, USA). Blast similarity searches were performed against the Incyte database.
Chemiluminescent Reporter Gene assay for β-galactosidase in yeast: A single colony was cultured in liquid SD-Trp-Leu medium overnight at 30° C. These overnight cultures were diluted to an OD600 of 0.1 in 90 μl SD-Trp-Leu medium in a 96-well culture plate. 10 μl of a 10 times concentrated hormone stock solution were added and plates were incubated for 5 hours at 30° C. and under vigorous shaking at 200 rpm.
Subsequently, β-galactosidase activity was measured using the One-Step Yeast Lysis buffer and Galacton Plus chemiluminescent detection system of Tropix (Tropix, Inc., Avenue, Bedford, USA). Light emission was monitored using a Victor Instrument (Perkin Elmer, Norwalk, USA).
5ā² RACE (Rapid Amplification of cDNA Ends) of COASTER:
To isolate the 5ā² end of the COASTER cDNA, 5ā²RACE-PCR experiments were performed using Human testis Marathon-Ready cDNA (Clontech, Palo Alto, USA, Cat.# 7414-1). RACE PCR was performed using a Marathon cDNA amplification kit (Clontech, Palo Alto, USA) in combination with gene specific primer CCAGACACCCACGTGTGGCC following instructions of the manufacturer. Two distinct fragments (Ė650 bp and Ė800 bp) were obtained. The fragments were isolated from an agarose gel, purified using Quaquick spin column (Qiagen, Valencia, USA) and cloned using the pCR2.1TOPO kit (Invitrogen, Carlsbad, USA). Colonies containing inserts were identified by colony PCR using gene specific primers CCAGACACCCACGTGTGGCC and AAGCCACCATGGACAGCAGGAGCAGTGGTG. Sequence analysis of positive clones was performed on an ABI sequencer (Perkin Elmer, Norwalk, USA).
Recombinant Plasmids:
Initially, a plasmid encoding a truncated form of COASTER (pACT2.COASTERĪ, amino acids 1-234) was isolated in the yeast two hybrid screen. The insert from this plasmid was cloned in the mammalian cell expression vector pCDNA3.1HISA (Invitrogen, Carlsbad, USA) to yield plasmid pCDNA3.1HISA.COASTERĪ. A plasmid containing the 3ā² end of the COASTER cDNA was obtained from Incyte Genomics (Palo Alto, USA). This plasmid (Incyte clone ID 2905757) was digested with SacI/NotI (amino acid 330 to 1061). The 5ā² end of the COASTER (amino acid 1 to 332) was amplified by PCR on human-testis Marathon Ready cDNA (Clontech, Palo Alto, USA, cat.#7414-1) using primers CTAGGTACCGGACAGCAGGAGCAGTGGTGC (SEQ ID 15) and GGCAGTGAGCTCCATGTGGG (SEQ ID 16) (restriction sites are underlined). The resulting PCR product was digested with KpnI and SacI and ligated together with the SacI-NotI restriction fragment into the KpnI-NotI restricted pCDNA3.1HISC vector (Invitrogen, Carlsbad, USA). The latter plasmid was termed pCDNA3.1HISC.COASTER. For transfection studies, the protein coding regions of the cDNA's for the human estrogen receptors α and β and the glucocorticoid receptor, were inserted into the mammalian expression vector pNGV1 (accession number X99274). The protein coding region of the progesterone receptor was inserted into the mammalian expression vector pKCRE (Stam et al., Eur. J. Pharmacol. 227,153). The reporter plasmid pMMTV-LUC was constructed by modification of vector pManMneoLUC (Clontech, Palo Alto, USA). The neomycin cassette was removed by digestion with endoR HindIII/BamHI, followed by blunting with Klenow polymerase, and ligation by T4 DNA ligase. The reporter vector 4ERE.TATALuc contains a luciferase gene under control of four estrogen-response elements (ERE) and was a gift from P. v.d. Saag (Nederlands Instituut voor Ontwikkelingsbiologie, Utrecht, The Netherlands). A mammalian expression plasmid for GRIP1 was constructed by restriction digestion of pGRIP1 (kind gift of M. Stallcup, University of Southern California, USA) with EcoRI and BamHI. The resulting fragment was ligated into a EcoRI/BamHI digested pCDNA3.1HISC vector to yield plasmid pCDNA3.1HISC.GRIP1.
Cell Culture and Transient Transfection:
U-2 OS cells were obtained from ATTC (HTB-96) and maintained at 37° C. in a humidified atmosphere (5% CO2) as a monolayer culture in phenolred-free M505 medium. The latter medium consists of a mixture (1:1) of Dulbecco's Modified Eagle's Medium (DMEM, Gibco BRL,Breda, the Netherlands) and Nutrient Medium F12 (Ham's F12, Gibco BRL,Breda, the Netherlands) supplemented with 2.5 mg/ml sodium carbonate, 55 μg/ml sodium pyruvate, 2.3 μg/ml β-mercaptomethanol, 1.2 μg/ml ethanolamine, 360 μg/ml L-glutamine, 0.45 μg/ml sodium selenite, 62.5 μg/ml streptomycin, and 5% charcoal-treated bovine calf serum (Hyclone). 1.105 cells were seeded in 24-wells tissue culture plates and DNA was introduced by use of lipofectin (Gibco BRL,Breda, the Netherlands). To this end, plasmid DNAs in 62.5 μl Optimem (Gibco BRL Breda, the Netherlands) was mixed with an equal volume of diluted lipofectin reagent (1.75 μl lipofectin in 62.5 μl Optimem) and allowed to stand at room temperature for 30 min. After washing the cells once with serum-free M505 medium, 250 μl Optimem together with the DNA-lipofectin mixture was added to the cells. After incubation for a 5 hour period at 37° C. (5% CO2) cells were washed once with M505 medium supplemented with 5% charcoal-treated bovine calf serum and hormones were added to the medium. Cells were incubated overnight at 37° C. The next day, cells were washed once with phosphate buffered saline (PBS) and cell extracts were made by addition of 75 μl lysis buffer (0.1 M phosphate buffer pH 7.8, 0.2% Triton X-100). After incubation for 5 min at room temperature, a 30 μl aliquot was added to 50 μl luciferase assay reagent (Promega; Wisconsin, USA). Light emission was measured using a Victor Instrument (Perkin Elmer, Norwalk, USA).
Northern Blot Analysis:
Plasmid pCDNA3.1HISA.COASTERĪ was digested with EcoRI and XbaI to generate a probe (nucleotides 183-928). The DNA fragment was labeled with [α32P]dCTP with Ready-To Go DNA labeling beads following instructions of the manufacturer (Pharmacia). Human multiple tissue northern blots (Clontech, Palo Alto, USA, cat.# 7760-1 and 7759-1) were hybridized with the α32PdCTP-labelled DNA fragment (see basic protocols R1.5). Northern blots were washed using the following washing conditions: 2Ć30 min. 2ĆSSC/0.1% SDS at 65° C. and 1Ć15 min. 1ĆSSC/0.1% SDS at 65° C.
RT-PCR Analysis of COASTER Expression in Cell Lines:
cDNA was made using 2 μg of total RNA, isolated from a number of human cell lines using RNAzol B (Cinna/Biotecx), using the SuperscriptII kit (BRL). A portion of cDNA was used for specific PCR amplification of COASTER (primers sense TGAGGCATCTGAGTCAACA and anti sense CGAGCCAGAGTTAAAGCA. After 20, 25, 30 and 35 PCR-cycles, samples were taken. The PCR samples were analyzed on 1.5% agarose gels. Gel images were quantified with Imagequant 5.0 (Molecular dynamics).
In Vitro Translation:
A TnT Coupled Reticulocyte Lysate Systems (Promega,Madison, USA, cat.#L5020) was used for in vitro transcription/translation of COASTER from a pCDNA3.1HISC.COASTER template in the presence of [35S]-methionine following instructions provided with the lysate. A fragment of SRC-1 encoded by plasmid pBK-SRC-1 (Onate et al., Science 270, 1354-1357) was analyzed in parallel as a control. Labeled proteins were separated by SDS-PAGE and visualized by autoradiography.
1. An in vitro screening method for determining the transcription modulating activity of an agent, comprising:
providing a cell-based transcription system comprising a coactivator having at least 95% similarity with amino acids 1-234 of SEQ ID NO:7 or amino acids 1-234 of SEQ ID NO:8, a nuclear receptor responsive to the coactivator and a reporter gene whose transcription is promoted by the combination of the responsive nuclear receptor and the coactivator;
adding the agent to the cell-based transcription system;
quantifying the degree of transcription of the reporter gene in the presence of the agent; and
comparing the degree of transcription of the reporter gene in the presence of the agent with the degree of transcription of the reporter gene in the absence of the agent, thereby determining the transcription modulating activity of the agent.
2. The in vitro screening method of claim 1, wherein the coactivator has at least 95% similarity with amino acids 1-234 of SEQ ID) NO:7.
3. The in vitro screening method of claim 2, wherein the responsive nuclear receptor is a steroid receptor.
4. The in vitro screening method of claim 3, wherein the steroid receptor is selected from the group consisting of a progesterone receptor, an estrogen receptor and a glucocorticoid receptor.
5. The in vitro screening method of claim 2, wherein the coactivator has at least 95% similarity with SEQ ID NO:7.
6. The in vitro screening method of claim 5, wherein the responsive nuclear receptor is a steroid receptor.
7. The in vitro screening method of claim 6, wherein the steroid receptor is selected from the group consisting of a progesterone receptor, an estrogen receptor and a glucocorticoid receptor.
8. The in vitro screening method of claim 5, wherein the coactivator is SEQ ID NO:7.
9. The in vitro screening method of claim 8, wherein the responsive nuclear receptor is a steroid receptor.
10. The in vitro screening method of claim 9, wherein the steroid receptor is selected from the group consisting of a progesterone receptor, an estrogen receptor and a glucocorticoid receptor.
11. The in vitro screening method of claim 1, wherein the coactivator has at least 95% similarity with amino acids 1-234 of SEQ ID NO:8.
12. The in vitro screening method of claim 11, wherein the responsive nuclear receptor is a steroid receptor.
13. The in vitro screening method of claim 12, wherein the steroid receptor is selected from the group consisting of a progesterone receptor, an estrogen receptor and a glucocorticoid receptor.
14. The in vitro screening method of claim 11, wherein the coactivator has at least 95% similarity with SEQ ID NO:8.
15. The in vitro screening method of claim 14, wherein the responsive nuclear receptor is a steroid receptor.
16. The in vitro screening method of claim 15, wherein the steroid receptor is selected from the group consisting of a progesterone receptor, an estrogen receptor and a glucocorticoid receptor.
17. The in vitro screening method of claim 14, wherein the coactivator is SEQ ID NO:8.
18. The in vitro screening method of claim 17, wherein the responsive nuclear receptor is a steroid receptor.
19. The in vitro screening method of claim 18, wherein the steroid receptor is selected from the group consisting of a progesterone receptor, an estrogen receptor and a glucocorticoid receptor.