-
2006-12-26
10/389,431
2003-03-13
US 7,153,650 B2
2006-12-26
-
-
Quang Nguyen
2024-08-02
This disclosure provides a system for qualifying embryonic stem cells intended for human therapy. A large-scale sequencing project has identified important markers that are characteristic of undifferentiated pluripotent cells. Combinations of these markers can be used to validate the self-renewing capacity of ES cells, and their ability to differentiate into tissue types suitable for regenerative medicine. The marker system of this invention has been used to screen feeder cells, media additives, and culture conditions that promote proliferation of stem cells without differentiation. A culture system optimized by following these markers is suitable for rapid expansion of undifferentiated cells from existing lines, or the derivation of new lines that are equally apposite for clinical use.
Get notified when new applications in this technology area are published.
C12Q1/00 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
G01N33/53 IPC
Investigating or analysing materials by specific methods not covered by groups -; Biological material, e.g. blood, urine ; Haemocytometers; Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing Immunoassay; Biospecific binding assay; Materials therefor
C12N5/00 IPC
Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
This invention relates generally to the field of cell biology of stem cells. More specifically, it relates to phenotypic markers that can be used to characterize, qualify, and control differentiation of pluripotent cells, and to evaluate clinical conditions associated with marker expression.
A promising development in the field of regenerative medicine has been the isolation and propagation of human stem cells from the early embryo. These cells have two very special properties: First, unlike other normal mammalian cell types, they can be propagated in culture almost indefinitely, providing a virtually unlimited supply. Second, they can be used to generate a variety of tissue types of interest as a source of replacement cells and tissues for use in therapy.
Thomson et al. (Science 282:114, 1998; U.S. Pat. No. 6,200,806) were the first to successfully isolate and propagate embryonic stem cells from human blastocysts. Gearhart and coworkers derived human embryonic germ cell lines from fetal gonadal tissue (Shambloft et al., Proc. Natl. Acad. Sci. USA 95:13726, 1998; U.S. Pat. No. 6,090,622).
International Patent Publication WO 99/20741 (Geron Corp.) describes methods and materials for the growth of primate-derived primordial stem cells. International Patent Publication WO 01/51616 (Geron Corp.) provides techniques for growth and differentiation of human pluripotent stem cells. An article by Xu et al. (Nature Biotechnology 19:971, 2001) describes feeder-free growth of undifferentiated human embryonic stem cells. Lebkowski et al. (Cancer J. 7 Suppl. 2:S83, 2001) discuss the culture, differentiation, and genetic modification of human embryonic stem cell for regenerative medicine applications. These publications report exemplary culture methods for propagating human embryonic stem cells in an undifferentiated state, and their use in preparing cells for human therapy.
Markers for identifying undifferentiated pluripotent stem cells include SSEA-4, Tra-1-60, and Tra-1-81 (Thomson et al. and Gearhart et al., supra). They also express human telomerase reverse transcriptase, and the POU transcription factor Oct 3/4(WO 01/51616; Amit et al., Dev. Biol. 227:271, 2000; Xu et al., supra).
Loring et al. (Restor. Neurol. Neurosci. 18:81, 2001) review gene expression profiles of embryonic stem cells and ES-derived neurons. Pesce et al. (Bioessays 20:722, 1998) comment on the potential role of transcription factor Oct-4 in the totipotent germ-line cycle of mice. Gajovic et al. (Exp. Cell Res. 242:138, 1998) report that genes expressed after retinoic acid-mediated differentiation of embryoid bodies are likely to be expressed during embryo development. Zur Nieden et al. (Toxicol. in Vitro 15:455, 2001) propose certain molecular markers for embryonic stem cells. Henderson et al. (Stem Cells 20:329, 2002) report that pre-implantation human embryos and ES cells have comparable expression of SSEAs. Tanaka et al. (Genome Res. 12:1921, 2002) profile gene expression in mouse ES cells to identify candidate genes associated with pluripotency and lineage specificity. Draper et al. (J. Anat. 299:249, 2002) review change of surface antigens of human embryonic stem cells upon differentiation in culture.
Kelly et al. (Mol Reprod. Dev. 56:113, 2000) report DNA microarray analyses of genes regulated during the differentiation of embryonic stem cells. Woltjen et al. (Nucl. Acids Res. 28:E41, 2000) report retro-recombination screening of a mouse embryonic stem cell genomic library. Monk et al. (Oncogene 20:8085, 2001) list human embryonic genes re-expressed in cancer cells. Tanaka et al. (Genome Res. 12:1921, 2002) discuss gene expression profiling of embryo-derived stem cells, and candidate genes putatively associated with pluripotency and lineage specificity. Monk et al. report developmental genes identified by differential display (Reprod. Fertil. Dev. 13:51, 2001). Natale et al. (Reprod. 122:687, 2001) characterize bovine blastocyst gene expression patterns by differential display RT-PCR.
Fan et al. (Dev. Biol. 210:481, 1999) propose that forced expression of the homeobox-containing gene Pem blocks differentiation of embryonic stem cells. Abdel-Rahman et al. (Hum. Reprod. 10:2787, 1995) report the effect of expressing transcription regulating genes in human preimplantation embryos. Jackson et al. (J. Biol. Chem. 277:38683, 2002) describe the cloning and characterization of Ehox, a homeobox gene that reportedly plays a role in ES cell differentiation.
The following disclosure provides new markers and marker combinations that are effective means to identify, characterize, qualify, and control differentiation of pluripotent cells.
This invention identifies a number of genes that are up- or down-regulated during the course of differentiation of early-stage pluripotent stem cells obtained from primates, exemplified by human embryonic stem cells. As a consequence, the genes are differentially expressed in undifferentiated versus differentiated cells. This property confers special benefit on these genes for identification, characterization, culturing, differentiation, and manipulation of stem cells and their progeny, and other cells that express the same markers.
One aspect of this invention is a system for assessing a culture of undifferentiated primate pluripotent stem (pPS) cells or their progeny, in which expression of one or more of the identified markers listed in the disclosure is detected or measured. The level of expression can be measured in isolation or compared with any suitable standard, such as undifferentiated pPS cells maintained under specified conditions, progeny at a certain stage of differentiation, or stable end-stage differentiated cells, such as may be obtained from the ATCC. Depending on whether the marker(s) are up- or down-regulated during differentiation, presence of the markers is correlated with the presence or proportion of undifferentiated or differentiated cells in the population.
An exemplary (non-limiting) combination suitable for qualifying cultures of undifferentiated pPS cells is a marker selected from the list of Cripto, gastrin-releasing peptide (GRP) receptor, and podocalyxin-like protein, in combination with either hTERT and/or Oct 3/4 (POU domain, class 5 transcription factor), or a second marker from the list. Additional markers can also be measured as desired. Markers can be detected at the mRNA level by PCR amplification, at the protein or enzyme product level by antibody assay, or by any suitable technique.
The marker system of this invention can be used for quantifying the proportion of undifferentiated pPS cells or differentiated cells in the culture; for assessing the ability of a culture system or component thereof (such as a soluble factor, culture medium, or feeder cell) to maintain pPS cells in an undifferentiated state; for assessing the ability of a culture system or component thereof to cause differentiation of pPS cells into a culture of lineage-restricted precursor cells or terminally differentiated cells; or for any other worthwhile purpose. This invention includes kits and the use of specific reagents in order to measure the expression of the markers whenever appropriate.
This invention also provides a system assessing the growth characteristics of a cell population by detecting or measuring expression of one or more of the differentially expressed marker genes identified in this disclosure. This can be applied not only to various types of pPS cells and progenitor cells in various stages of differentiation, but also to clinical samples from a disease condition associated with abnormal cell growth. Renewed expression of markers of a relatively undifferentiated phenotype may be diagnostic of disease conditions such as cancer, and can serve as a means by which to target therapeutic agents to the disease site.
The marker system can also be used to regulate gene expression. Transcriptional control elements for the markers will cause an operatively linked encoding region to be expressed preferentially in undifferentiated or differentiated cells. For example, the encoding sequence can be a reporter gene (such as a gene that causes the cells to emit fluorescence), a positive selection marker (such as a drug resistance gene), or a negative selection marker. Vector constructs comprising recombinant elements linked in this fashion can be used to positively select or deplete undifferentiated, differentiated, or cancerous cells from a mixed population or in vivo, depending on the nature of the effector gene and whether transcription is up- or down-regulated during differentiation. They can also be used to monitor culture conditions of pPS cells, differentiation conditions, or for drug screening.
The marker system of this invention can also be used to sort differentiated cells from less differentiated cells. The marker can be used directly for cell separation by adsorption using an antibody or lectin, or by fluorescence activated cell sorting. Alternatively, these separation techniques can be effected using a transcription promoter from the marker gene in a promoter-reporter construct.
The marker system of this invention can be used to map differentiation pathways or influence differentiation. Markers suited for this purpose may act as transcription regulators, or encode products that enhance cell interaction in some fashion. pPS cells or their differentiated progeny are genetically altered to increase expression of one or more of the identified genes using a transgene, or to decrease expression, for example, using an antisense or siRNA construct. Alternatively, gene products involved in cell interaction or signaling can be added directly to the culture medium. The effect of this can be to help maintain the transfected cell in the undifferentiated state, promote differentiation in general, or direct differentiation down a particular pathway.
Another aspect of the invention are methods for identifying these and other genes that are up- or down-regulated upon differentiation of any cell type. The methods involve comparing expression libraries obtained from the cells before and after differentiation, by sequencing transcripts in each of the libraries, and identifying genes that have statistically significant differences in the relative number of transcripts (as a percentage of transcripts in each library) at a confidence level of 67%, 95%, or 98%. The method can be enhanced by creating assemblies in which different sequences are counted for the same transcript if they are known to correspond to a single transcript according to previously compiled data.
Amongst the differentially expressed markers identified in this disclosure are 39 nucleotide sequences which are not present in their entirety in the UniGene database. These are listed in this disclosure as SEQ. ID NOs:101 to 139. This invention includes novel nucleic acids consisting of or containing any of these sequences or the complementary sequences, and novel fragments thereof. This invention also includes novel polypeptides encoded in these sequences (made either by expressing the nucleic acid or by peptide synthesis), antibodies specific for the polypeptides (made by conventional techniques or through a commercial service), and use of these nucleic acids, peptides, and antibodies for any industrial application.
Also embodied in this invention are culture conditions and other cell manipulations identified using the marker system of this invention that are suitable for maintaining or proliferating pPS cells without allowing differentiation, or causing them to differentiate in a certain fashion. Culture conditions tested and validated according to this invention are illustrated in the example section.
Other embodiments of the invention will be apparent from the description that follows.
FIG. 1 shows the profile of genes preferentially expressed in undifferentiated pluripotent stem cells, upon preliminary differentiation of the cells by culturing in retinoic acid or DMSO. Level of gene expression at the mRNA level was measured by real-time PCR assay. Any of the genes showing substantial down-regulation upon differentiation can be used to characterize the undifferentiated cell population, and culture methods suitable for maintaining them in an undifferentiated state.
FIG. 2 shows the level of expression of five genes in hES cells, compared with fully differentiated cells. This five-marker panel provides robust qualification of the undifferentiated phenotype.
FIG. 3 show results of an experiment in which hES cells of the H1 line were maintained for multiple passages in different media. Medium conditioned with feeder cells provides factors effective to allow hES cells to proliferate in culture without differentiating. However, culturing in unconditioned medium leads to decreased percentage of cells expressing CD9, and the classic hES cell marker SSEA-4.
FIG. 4 illustrates the sensitivity of hTERT, Oct 3/4, Cripto, GRP receptor, and podocalyxin-like protein (measured by real-time PCR) as a means of determining the degree of differentiation of the cells. After multiple passages in unconditioned medium, all five markers show expression that has been downregulated by 10 to 104-fold.
FIG. 5 shows results of an experiment in which the hES cell line H1 was grown on different feeder cell lines: mEF=mouse embryonic fibroblasts; hMSC=human mesenchymal stem cells; UtSMC=uterine smooth muscle cells; WI-38=human lung fibroblasts. As monitored using Cripto, the hMSC is suitable for use as feeder cells to promote hES cell proliferation without differentiation.
FIG. 6 shows results of an experiment in which different media were tested for their ability to promote growth of hES cells without proliferation. The test media were not preconditioned, but supplemented with 8–40 ng/mL bFGF, with or without stem cell factor, Flt3 ligand, or LIF. Effective combinations of factors (Conditions 4 to 8) were identified by following the undifferentiated phenotype using the markers of this invention. Alterations in expression profiles were temporary and reversible, showing that the cells are still undifferentiated.
The propensity of pluripotent stem cells to differentiate spontaneously has made it challenging for investigators to work with these cells. Consistent cultures of undifferentiated stem cells are required to compare results obtained from multiple experiments performed within or between laboratories. Unfortunately, morphological characterization is subjective and especially difficult for cultures that often contain 10–20% differentiated cells. Nevertheless, having a set of standardized criteria will be important in qualifying these cells for use in clinical therapy.
The marker system identified in this disclosure provides the basis for establishing these standards. 148,453 different transcripts were amplified and sequenced from undifferentiated human embryonic stem cells, and three types of progeny. As a result of this sequencing effort, 532 genes were identified having substantially higher EST counts in undifferentiated cells, and 142 genes were identified having substantially higher EST counts after differentiation. Other differentially expressed genes were identified by microarray analysis of undifferentiated cells, compared with cells at the beginning of the differentiation process.
The system provided by this invention can be used not only to qualify populations of undifferentiated cells, but in other powerful ways of maintaining and manipulating cells described later in this disclosure. Culture systems have been identified and protocols have been developed to expand cultures of undifferentiated cells and produce commercially viable quantities of cells for use in research, drug screening, and regenerative medicine.
Definitions
“Pluripotent Stem cells” (pPS cells) are pluripotent cells that have the characteristic of being capable under appropriate conditions of producing progeny of several different cell types that are derivatives of all of the three germinal layers (endoderm, mesoderm, and ectoderm), according to a standard art-accepted test, such as the ability to form a teratoma in 8–12 week old SCID mice. The term includes both established lines of stem cells of various kinds, and cells obtained from primary tissue that are pluripotent in the manner described. For the purposes of this disclosure, the pPS cells are not embryonal carcinoma (EC) cells, and are not derived from a malignant source. It is desirable (but not always necessary) that the cells be euploid. Exemplary pPS cells are obtained from embryonic or fetal tissue at any time after fertilization.
“Human Embryonic Stem cells” (hES cells) are pluripotent stem cells derived from a human embryo in the blastocyst stage, or human pluripotent cells produced by artificial means (such as by nuclear transfer) that have equivalent characteristics. Exemplary derivation procedures and features are provided in a later section.
hES cell cultures are described as “undifferentiated” when a substantial proportion (at least 20%, and possibly over 50% or 80%) of stem cells and their derivatives in the population display morphological characteristics of undifferentiated cells, distinguishing them from differentiated cells of embryo or adult origin. It is understood that colonies of undifferentiated cells within the population will often be surrounded by neighboring cells that are differentiated. It is also understood that the proportion of cells displaying the undifferentiated phenotype will fluctuate as the cells proliferate and are passaged from one culture to another. Cells are recognized as proliferating in an undifferentiated state when they go through at least 4 passages and/or 8 population doublings while retaining at least about 50%, or the same proportion of cells bearing characteristic markers or morphological characteristics of undifferentiated cells.
A “differentiated cell” is a cell that has progressed down a developmental pathway, and includes lineage-committed progenitor cells and terminally differentiated cells.
“Feeder cells” or “feeders” are terms used to describe cells of one type that are co-cultured with cells of another type, to provide an environment in which the cells of the second type can grow. hES cell populations are said to be “essentially free” of feeder cells if the cells have been grown through at least one round after splitting in which fresh feeder cells are not added to support the growth of pPS cells.
The term “embryoid bodies” refers to aggregates of differentiated and undifferentiated cells that appear when pPS cells overgrow in monolayer cultures, or are maintained in suspension cultures. Embryoid bodies are a mixture of different cell types, typically from several germ layers, distinguishable by morphological criteria and cell markers detectable by immunocytochemistry.
A cell “marker” is any phenotypic feature of a cell that can be used to characterize it or discriminate it from other cell types. A marker of this invention may be a protein (including secreted, cell surface, or internal proteins; either synthesized or taken up by the cell); a nucleic acid (such as an mRNA, or enzymatically active nucleic acid molecule) or a polysaccharide. Included are determinants of any such cell components that are detectable by antibody, lectin, probe or nucleic acid amplification reaction that are specific for the cell type of interest. The markers can also be identified by a biochemical or enzyme assay that depend on the function of the gene product. Associated with each marker is the gene that encodes the transcript, and the events that lead to marker expression.
The terms “polynucleotide” and “nucleic acid” refer to a polymeric form of nucleotides of any length. Included are genes and gene fragments, mRNA, cDNA, plasmids, viral and non-viral vectors and particles, nucleic acid probes, amplification primers, and their chemical equivalents. As used in this disclosure, the term polynucleotide refers interchangeably to double- and single-stranded molecules. Unless otherwise specified, any embodiment of the invention that is a polynucleotide encompasses both a double-stranded form, and each of the two complementary single-stranded forms known or predicted to make up the double-stranded form.
A cell is said to be “genetically altered” or “transfected” when a polynucleotide has been transferred into the cell by any suitable means of artificial manipulation, or where the cell is a progeny of the originally altered cell that has inherited the polynucleotide.
A “control element” or “control sequence” is a nucleotide sequence involved in an interaction of molecules that contributes to the functional regulation of a polynucleotide, including replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. “Operatively linked” refers to an operative relationship between genetic elements, in which the function of one element influences the function of another element. For example, an expressible encoding sequence may be operatively linked to a promoter that drives gene transcription.
The term “antibody” as used in this disclosure refers to both polyclonal and monoclonal antibody. The ambit of the term deliberately encompasses not only intact immunoglobulin molecules, but also such fragments and derivatives of immunoglobulin molecules that retain a desired binding specificity.
General Techniques
Methods in molecular genetics and genetic engineering are described generally in the current editions of Molecular Cloning: A Laboratory Manual, (Sambrook et al.); Oligonucleotide Synthesis (M. J. Gait, ed.); Animal Cell Culture (R. I. Freshney, ed.); Gene Transfer Vectors for Mammalian Cells (Miller & Calos, eds.); Current Protocols in Molecular Biology and Short Protocols in Molecular Biology, 3rd Edition (F. M. Ausubel et al., eds.); and Recombinant DNA Methodology (R. Wu ed., Academic Press). Antibody production is described in Basic Methods in Antibody Production and Characterization (Howard & Bethell eds., CRC Press, 2000).
A survey of relevant techniques is provided in such standard texts as DNA Sequencing (A. E. Barron , John Wiley, 2002), and DNA Microarrays and Gene Expression (P. Baldi et al., Cambridge U. Press, 2002). For a description of the molecular biology of cancer, the reader is referred to Principles of Molecular Oncology (M. H. Bronchud et al. eds., Humana Press, 2000); The Biological Basis of Cancer (R. G. McKinnel et al. eds., Cambridge University Press, 1998); and Molecular Genetics of Cancer (J. K. Cowell ed., Bios Scientific Publishers, 1999).
Sources of Stem Cells
This invention is based on observations made with established lines of hES cells. The markers are suitable for identifying, characterizing, and manipulating related types of undifferentiated pluripotent cells. They are also suitable for use with pluripotent cells obtained from primary embryonic tissue, without first establishing an undifferentiated cell line. It is contemplated that the markers described in this application will in general be useful for other types of pluripotent cells, including embryonic germ cells (U.S. Pat. Nos. 6,090,622 and 6,251,671), and ES and EG cells from other mammalian species, such as non-human primates.
Embryonic Stem Cells
Embryonic stem cells can be isolated from blastocysts of members of primate species (U.S. Pat. No. 5,843,780; Thomson et al., Proc. Natl. Acad. Sci. USA 92:7844, 1995). Human embryonic stem (hES) cells can be prepared from human blastocyst cells using the techniques described by Thomson et al. (U.S. Pat. No. 6,200,806; Science 282:1145, 1998; Curr. Top. Dev. Biol. 38:133 ff., 1998) and Reubinoff et al, Nature Biotech. 18:399, 2000. Equivalent cell types to hES cells include their pluripotent derivatives, such as primitive ectoderm-like (EPL) cells, outlined in WO 01/51610 (Bresagen).
hES cells can be obtained from human preimplantation embryos. Alternatively, in vitro fertilized (IVF) embryos can be used, or one-cell human embryos can be expanded to the blastocyst stage (Bongso et al., Hum Reprod 4: 706, 1989). Embryos are cultured to the blastocyst stage in G1.2 and G2.2 medium (Gardner et al., Fertil. Steril. 69:84, 1998). The zona pellucida is removed from developed blastocysts by brief exposure to pronase (Sigma). The inner cell masses are isolated by immunosurgery, in which blastocysts are exposed to a 1:50 dilution of rabbit anti-human spleen cell antiserum for 30 min, then washed for 5 min three times in DMEM, and exposed to a 1:5 dilution of Guinea pig complement (Gibco) for 3 min (Solter et al., Proc. Natl. Acad. Sci. USA 72:5099, 1975). After two further washes in DMEM, lysed trophectoderm cells are removed from the intact inner cell mass (ICM) by gentle pipetting, and the ICM plated on mEF feeder layers.
After 9 to 15 days, inner cell mass derived outgrowths are dissociated into clumps, either by exposure to calcium and magnesium-free phosphate-buffered saline (PBS) with 1 mM EDTA, by exposure to dispase or trypsin, or by mechanical dissociation with a micropipette; and then replated on mEF in fresh medium. Growing colonies having undifferentiated morphology are individually selected by micropipefte, mechanically dissociated into clumps, and replated. ES-like morphology is characterized as compact colonies with apparently high nucleus to cytoplasm ratio and prominent nucleoli. Resulting ES cells are then routinely split every 1–2 weeks by brief trypsinization, exposure to Dulbecco's PBS (containing 2 mM EDTA), exposure to type IV collagenase (−200 U/mL; Gibco) or by selection of individual colonies by micropipette. Clump sizes of about 50 to 100 cells are optimal.
Propagation of pPS Cells in an Undifferentiated State
pPS cells can be propagated continuously in culture, using culture conditions that promote proliferation without promoting differentiation. Exemplary serum-containing ES medium is made with 80% DMEM (such as Knock-Out DMEM, Gibco), 20% of either defined fetal bovine serum (FBS, Hyclone) or serum replacement (US 20020076747 A1, Life Technologies Inc.), 1% non-essential amino acids, 1 mM L-glutamine, and 0.1 mM β-mercaptoethanol. Just before use, human bFGF is added to 4 ng/mL (WO 99/20741, Geron Corp.).
Traditionally, ES cells are cultured on a layer of feeder cells, typically fibroblasts derived from embryonic or fetal tissue. Embryos are harvested from a CF1 mouse at 13 days of pregnancy, transferred to 2 mL trypsin/EDTA, finely minced, and incubated 5 min at 37° C. 10% FBS is added, debris is allowed to settle, and the cells are propagated in 90% DMEM, 10% FBS, and 2 mM glutamine. To prepare a feeder cell layer, cells are irradiated to inhibit proliferation but permit synthesis of factors that support ES cells (˜4000 rads y-irradiation). Culture plates are coated with 0.5% gelatin overnight, plated with 375,000 irradiated mEFs per well, and used 5 h to 4 days after plating. The medium is replaced with fresh hES medium just before seeding pPS cells.
Scientists at Geron have discovered that pPS cells can be maintained in an undifferentiated state even without feeder cells. The environment for feeder-free cultures includes a suitable culture substrate, particularly an extracellular matrix such as Matrigel® or laminin. The pPS cells are plated at >15,000 cells cm−2 (optimally 90,000 cm−2 to 170,000 cm−2). Typically, enzymatic digestion is halted before cells become completely dispersed (say, ˜5 min with collagenase IV). Clumps of ˜10 to 2,000 cells are then plated directly onto the substrate without further dispersal. Alternatively, the cells can be harvested without enzymes before the plate reaches confluence by incubating ˜5 min in a solution of 0.5 mM EDTA in PBS. After washing from the culture vessel, the cells are plated into a new culture without further dispersal. In a further illustration, confluent human embryonic stem cells cultured in the absence of feeders are removed from the plates by incubating with a solution of 0.05% (wt/vol) trypsin (Gibco) and 0.053 mM EDTA for 5–15 min at 37° C. The remaining cells in the plate are removed and the cells are triturated into a suspension comprising single cells and small clusters, and then plated at densities of 50,000–200,000 cells cm−2 to promote survival and limit differentiation.
Feeder-free cultures are supported by a nutrient medium containing factors that support proliferation of the cells without differentiation. Such factors may be introduced into the medium by culturing the medium with cells secreting such factors, such as irradiated (˜4,000 rad) primary mouse embryonic fibroblasts, telomerized mouse fibroblasts, or fibroblast-like cells derived from pPS cells. Medium can be conditioned by plating the feeders at a density of ˜5–6×104 cm−2 in a serum free medium such as KO DMEM supplemented with 20% serum replacement and 4 ng/mL bFGF. Medium that has been conditioned for 1–2 days is supplemented with further bFGF, and used to support pPS cell culture for 1–2 days. Alternatively or in addition, other factors can be added that help support proliferation without differentiation, such as ligands for the FGF-2 or FGF-4 receptor, ligands for c-kit (such as stem cell factor), ligands for receptors associated with gp130, insulin, transferrin, lipids, cholesterol, nucleosides, pyruvate, and a reducing agent such as p-mercaptoethanol. Aspects of the feeder-free culture method are further discussed in International Patent Publications WO 99/20741, WO 01/51616; Xu et al., Nat. Biotechnol. 19:971, 2001; and PCT application PCT/US02/28200. Exemplary culture conditions tested and validated using the marker system of this invention are provided below in Example 5.
Under the microscope, ES cells appear with high nuclear/cytoplasmic ratios, prominent nucleoli, and compact colony formation with poorly discernable cell junctions. Conventional markers for hES cells are stage-specific embryonic antigen (SSEA) 3 and 4, and markers detectable using antibodies Tra-1-60 and Tra-1-81 (Thomson et al., Science 282:1145, 1998). Differentiation of pPS cells in vitro results in the loss of SSEA-4, Tra-1-60, and Tra-1-81 expression, and increased expression of SSEA-1.
Markers of Undifferentiated PPS Cells and their Differentiated Progeny
The tables and description provided later in this disclosure provide markers that distinguish undifferentiated pPS cells from their differentiated progeny.
Expression libraries were made from ES cells (WO 01/51616), embryoid bodies (WO 01/51616), and cells differentiated towards the hepatocyte (WO 01/81549) or neural cell (WO 01/88104) lineage. mRNA was reverse transcribed and amplified, producing expressed sequence tags (ESTs) occurring in frequency proportional to the level of expression in the cell type being analyzed. The ESTs were subjected to automatic sequencing, and counted according to the corresponding unique (non-redundant) transcript. A total of 148,453 non-redundant transcripts were represented in each of the 4 libraries. Genes were then identified as having a differential expression pattern if the number of EST counts of the transcript was statistically different between the libraries being compared.
In a parallel set of experiments, mRNA from each of the cell types was analyzed for binding to a broad-specificity EST-based microarray, performed according to the method described in WO 01/51616. Genes were identified as having a differential expression pattern if they showed a comparatively different signal on the microarray.
Significant expression differences determined by EST sequencing, microarray analysis, or other observations were confirmed by real-time PCR analysis. The mRNA was amplified by PCR using specific forward and reverse primers designed from the GenBank sequence, and the amplification product was detected using labeled sequence-specific probes. The number of amplification cycles required to reach a threshold amount was then compared between different libraries.
Distinguishing markers fall into several categories. Those of particular interest include the following:
Now that genes have been identified that are up-regulated or down-regulated upon differentiation, a number of commercial applications of these markers will be apparent to the skilled reader. The sections that follow provide non-limiting illustrations of how some of these embodiments can be implemented.
Use of Cell Markers to Characterize pPS Cells and their Differentiated PROGENY
The markers provided in this disclosure can be used as a means to identify both undifferentiated and differentiated cells—either a population as a whole, or as individual cells within a population. This can be used to evaluate the expansion or maintenance of pre-existing cell populations, or to characterize the pluripotent nature (or lineage commitment) of newly obtained populations.
Expression of single markers in a test cell will provide evidence of undifferentiated or differentiated phenotype, according to the expression pattern listed later in this disclosure. A plurality of markers (such as any 2, 3, 4, 5, 6, 8, 10, 12, 15, or 20 markers from Tables 2–3 or 5–9) will provide a more detailed assessment of the characteristics of the cell. Expression of genes that are down-regulated and/or lack of expression of genes that are up-regulated upon differentiation correlates with a differentiated phenotype. Expression of genes that are up-regulated and/or lack of expression of genes that are down-regulated upon differentiation correlates with an undifferentiated phenotype. The markers newly identified in this disclosure may be analyzed together (with or without markers that were previously known) in any combination effective for characterizing the cell status or phenotype.
Tissue-specific markers can be detected using any suitable immunological technique—such as flow cytochemistry for cell-surface markers, or immunocytochemistry (for example, of fixed cells or tissue sections) for intracellular or cell-surface markers. Expression of a cell-surface antigen is defined as positive if a significantly detectable amount of antibody will bind to the antigen in a standard immunocytochemistry or flow cytometry assay, optionally after fixation of the cells, and optionally using a labeled secondary antibody or other conjugate to amplify labeling.
The expression of tissue-specific gene products can also be detected at the mRNA level by Northern blot analysis, dot-blot hybridization analysis, or by reverse transcriptase initiated polymerase chain reaction (RT-PCR) using sequence-specific primers in standard amplification methods. See U.S. Pat. No. 5,843,780 for further details. Sequence data for particular markers listed in this disclosure can be obtained from public databases such as GenBank.
These and other suitable assay systems are described in standard reference texts, such as the following: PCR Cloning Protocols, 2nd Ed (James & Chen eds., Humana Press, 2002); Rapid Cycle Real-Time PCR: Methods and Applications (C. Wittwer et al. eds., Springer-Verlag N.Y., 2002); Immunoassays: A Practical Approach (James Gosling ed., Oxford Univ Press, 2000); Cytometric Analysis of Cell Phenotype and Function (McCarthy et al. eds., Cambridge Univ Press, 2001). Reagents for conducting these assays, such as nucleotide probes or primers, or specific antibody, can be packaged in kit form, optionally with instructions for the use of the reagents in the characterization or monitoring of pPS cells, or their differentiated progeny.
Use of Cell Markers for Clinical Diagnosis
Stem cells regulate their own replenishment and serve as a source of cells that can differentiate into defined cell lineages. Cancer cells also have the ability to self-renew, but lack of regulation results in uncontrolled cellular proliferation. Three key signaling pathways, Wnt, Sonic hedgehog (Shh), and Notch, are known growth regulators of tumor cells. The genomics data provided in this disclosure indicate that all three of these pathways are active in hES cells.
It is a hypothesis of this invention that many of the markers discovered to be more highly expressed in undifferentiated pPS cells can also be up-regulated upon dedifferentiation of cells upon malignant transformation. Accordingly, this disclosure provides a system for evaluating clinical conditions associated with abnormal cell growth, such as hyperplasia or cancers of various kinds. Markers meeting the desired criteria include those contained in Tables 2, 5, 7 and 9.
Expression of each marker of interest is determined at the mRNA or protein level using a suitable assay system such as those described earlier; and then the expression is correlated with the clinical condition that the patient is suspected of having. As before, combinations of multiple markers may be more effective in doing the assessment. Presence of a particular marker may also provide a means by which a toxic agent or other therapeutic drug may be targeted to the disease site.
In a similar fashion, the markers of this invention can be used to evaluate a human or non-human subject who has been treated with a cell population or tissue generated by differentiating pPS cells. A histological sample taken at or near the site of administration, or a site to which the cells would be expected to migrate, could be harvested at a time subsequent to treatment, and then assayed to assess whether any of the administered cells had reverted to the undifferentiated phenotype. Reagents for conducting diagnostic tests, such as nucleotide probes or primers, or specific antibody, can be packaged in kit form, optionally with instructions for the use of the reagents in the determination of a disease condition.
Use of Cell Markers to Assess and Manipulate Culture Conditions
The markers and marker combinations of this invention provide a system for monitoring undifferentiated pPS cells and their differentiated progeny in culture. This system can be used as a quality control, to compare the characteristics of undifferentiated pPS cells between different passages or different batches. It can also be used to assess a change in culture conditions, to determine the effect of the change on the undifferentiated cell phenotype.
Where the object is to produce undifferentiated cells, a decrease in the level of expression of an undifferentiated marker because of the alteration by 3-, 10-, 25-, 100- and 1000-fold is progressively less preferred. Corresponding increases in marker expression may be more beneficial. Moderate decreases in marker expression may be quite acceptable within certain boundaries, if the cells retain their ability to form progeny of all three germ layers is retained, and/or the level of the undifferentiated marker is relatively restored when culture conditions are returned to normal.
In this manner, the markers of this invention can be used to evaluate different feeder cells, extracellular matrixes, base media, additives to the media, culture vessels, or other features of the culture as illustrated in WO 99/20741 and PCT application PCT/US02/28200. Illustrations of this technique are provided below in Example 5 (FIGS. 3 to 6).
In a similar fashion, the markers of this invention can also be used to monitor and optimize conditions for differentiating cells. Improved differentiation procedures will lead to higher or more rapid expression of markers for the differentiated phenotype, and/or lower or more rapid decrease in expression of markers for the undifferentiated phenotype.
Use of Cell Markers to Regulate Gene Expression
Differential expression of the markers listed in this disclosure indicates that each marker is controlled by a transcriptional regulatory element (such as a promoter) that is tissue specific, causing higher levels of expression in undifferentiated cells compared with differentiated cells, or vice versa. When the corresponding transcriptional regulatory element is combined with a heterologous encoding region to drive expression of the encoding region, then the expression pattern in different cell types will mimic that of the marker gene.
Minimum promoter sequences of many of the genes listed in this disclosure are known and further described elsewhere. Where a promoter has not been fully characterized, specific transcription can usually be driven by taking the 500 base pairs immediately upstream of the translation start signal for the marker in the corresponding genomic clone.
To express a heterologous encoding region according to this embodiment of the invention, a recombinant vector is constructed in which the specific promoter of interest is operatively linked to the encoding region in such a manner that it drives transcription of the encoding region upon transfection into a suitable host cell. Suitable vector systems for transient expression include those based on adenovirus and certain types of plasmids. Vectors for long-term expression include those based on plasmid lipofection or electroporation, episomal vectors, retrovirus, and lentivirus.
One application of tissue-specific promoters is expression of a reporter gene. Suitable reporters include fluorescence markers such as green fluorescent protein, luciferase, or enzymatic markers such as alkaline phosphatase and β-galactosidase. Other reporters such as a blood group glycosyltransferase (WO 02/074935), or Invitrogen's pDisplay™, create a cell surface epitope that can be counterstained with labeled specific antibody or lectin. pPS cells labeled with reporters can be used to follow the differentiation process directly, the presence or absence of the reporter correlating with the undifferentiated or differentiated phenotype, depending on the specificity of the promoter. This in turn can be used to follow or optimize culture conditions for undifferentiated pPS cells, or differentiation protocols. Alternatively, cells containing promoter-reporter constructs can be used for drug screening, in which a test compound is combined with the cell, and expression or suppression of the promoter is correlated with an effect attributable to the compound.
Another application of tissue-specific promoters is expression of a positive or negative drug selection marker. Antibiotic resistance genes such as neomycin phosphotransferase, expressed under control of a tissue-specific promoter, can be used to positively select for undifferentiated or differentiated cells in a medium containing the corresponding drug (geneticin), by choosing a promoter with the appropriate specificity. Toxin genes, genes that mediate apoptosis, or genes that convert a prodrug into a toxic compound (such as thymidine kinase) can be used to negatively select against contaminating undifferentiated or differentiated cells in a population of the opposite phenotype (WO 02/42445; GB 2374076).
Promoters specific for the undifferentiated cell phenotype can also be used as a means for targeting cancer cells—using the promoter to drive expression of a gene that is toxic to the cell (WO 98/14593, WO 02/42468), or to drive a replication gene in a viral vector (WO 00/46355). For example, an adenoviral vector in which the GRPR promoter (AY032865) drives the E1a gene should specifically lyse cancer cells in the manner described in Majumdar et al., Gene Ther. 8:568, 2001. Multiple promoters for the undifferentiated phenotype can be linked for improved cancer specificity (U.S. Ser. No. 10/206,447).
Other useful applications of tissue-specific promoters of this invention will come readily to the mind of the skilled reader.
Use of Markers for Cell Separation or Purification
Differentially expressed markers provided in this disclosure are also a means by which mixed cell populations can be separated into populations that are more homogeneous. This can be accomplished directly by selecting a marker of the undifferentiated or differentiated phenotype, which is itself expressed on the cell surface, or otherwise causes expression of a unique cell-surface epitope. The epitope is then used as a handle by which the marked cells can be physically separated from the unmarked cells. For example, marked cells can be aggregated or adsorbed to a solid support using an antibody or lectin that is specific for the epitope. Alternatively, the marker can be used to attach a fluorescently labeled antibody or lectin, and then the cell suspension can be subject to fluorescence-activated cell sorting.
An alternative approach is to take a tissue-specific promoter chosen based on its expression pattern (as described in the last section), and use it to drive transcription of a gene suitable for separating the cells. In this way, the marker from which the promoter is chosen need not itself be a cell surface protein. For example, the promoter can drive expression of a fluorescent gene, such as GFP, and then cells having the marked phenotype can be separated by FACS. In another example, the promoter drives expression of a heterologous gene that causes expression of a cell-surface epitope. The epitope is then used for adsorption-based separation, or to attach a fluorescent label, as already described.
Use of Cell Markers to Influence Differentiation
In another embodiment of this invention, the differentially expressed genes of this invention are caused to increase or decrease their expression level, in order to either inhibit or promote the differentiation process. Suitable genes are those that are believed in the normal case of ontogeny to be active in maintaining the undifferentiated state, active in the general process of differentiation, or active in differentiation into particular cell lineages. Markers of interest for this application are the following:
Another way of manipulating gene expression is to alter transcription from the endogenous gene. One means of accomplishing this is to introduce factors that specifically influence transcription through the endogenous promoter. Another means suitable for down-regulating expression at the protein level is to genetically alter the cells with a nucleic acid that removes the mRNA or otherwise inhibits translation (for example, a hybridizing antisense molecule, ribozyme, or small interfering RNA). Dominant-negative mutants of the target factor can reduce the functional effect of the gene product. Targeting a particular factor associated with the undifferentiated phenotype in this fashion can be used to promote differentiation. In some instances, this can lead to de-repression of genes associated with a particular cell type.
Where the gene product is a soluble protein or peptide that influences cell interaction or signal transduction (for example, cytokines like osteopontin and Cripto), then it may be possible to affect differentiation simply by adding the product to the cells—in either recombinant or synthetic form, or purified from natural sources. Products that maintain the undifferentiated phenotype can then be withdrawn from the culture medium to initiate differentiation; and products that promote differentiation can be withdrawn once the process is complete.
Since differentiation is a multi-step process, changing the level of gene product on a permanent basis may cause multiple effects. In some instances, it may be advantageous to affect gene expression in a temporary fashion at each sequential step in the pathway, in case the same factor plays different effects at different steps of differentiation. For example, function of transcription factors can be evaluated by changing expression of individual genes, or by invoking a high throughput analysis, using cDNAs obtained from a suitable library such as exemplified in Example 1. Cells that undergo an alteration of interest can be cloned and pulled from multi-well plates, and the responsible gene identified by PCR amplification.
The effect of up- or down-regulating expression of a particular gene can be determined by evaluating the cell for morphological characteristics, and the expression of other characteristic markers. Besides the markers listed later in this disclosure, the reader may want to follow the effect on particular cell types, using markers for later-stage or terminally differentiated cells. Tissue-specific markers suitable for this purpose are listed in WO 01/81549 (hepatocytes), WO 01/88104 (neural cells), PCT/US02/20998 (osteoblasts and mesenchymal cells), PCT/US02/22245 (cardiomyocytes), PCT/US02/39091 (hematopoietic cells), PCT/US02/39089 (islet cells), and PCT/US02/39090 (chondrocytes). Such markers can be analyzed by PCR amplification, fluorescence labeling, or immunocytochemistry, as already described. Promoter-reporter constructs based on the same markers can facilitate analysis when expression is being altered in a high throughput protocol.
cDNA libraries were prepared from human embryonic stem (hES) cells cultured in undifferentiated form. cDNA libraries were also prepared from progeny, subject to non-specific differentiation as embryoid bodies (EBs), or taken through the preliminary stages of established differentiation protocols for neurons (preNEU) or hepatocytes (preHEP).
The hES cell lines H1, H7, and H9 were maintained under feeder-free conditions. Cultures were passaged every 5-days by incubation in 1 mg/mL collagenase IV for 5–10 min at 37° C., dissociated and seeded in clumps at 2.5 to 10×105 cells/well onto Matrigel™-coated six well plates in conditioned medium supplemented with 8 mg/mL bFGF. cDNA libraries were made after culturing for 5 days after the last passage.
EBs were prepared as follows. Confluent plates of undifferentiated hES cells were treated briefly with collagenase IV, and scraped to obtain small clusters of cells. Cell clusters were resuspended in 4 mL/well differentiation medium (KO DMEM containing 20% fetal bovine serum in place of 20% SR, and not preconditioned) on low adhesion 6-well plates (Costar). After 4 days in suspension, the contents of each well was transferred to individual wells pre-coated with gelatin. Each well was re-fed with 3 mL fresh differentiation medium every two days after replating. Cells were used for the preparation of cytoplasmic RNA on the eighth day after plating.
PreHEP cells were prepared based on the hepatocyte differentiation protocol described in WO 01/81549. Confluent wells of undifferentiated cells were prepared, and medium was changed to KO DMEM plus 20% SR+1% DMSO. The medium was changed every 24 h, and cells were used for preparation of cytoplasmic RNA on day 5 of DMSO treatment.
PreNEU cells were prepared based on the neural differentiation protocol described in WO 01/88104. hES cells of the H7 line (p29) were used to generate EBs as described above except that 10 μM all-trans RA was included in the differentiation medium. After 4 days in suspension, EBs were transferred to culture plate precoated with poly-L-lysine and laminin. After plating, the medium was changed to EPFI medium. Cells were used for the preparation of cytoplasmic RNA after 3 days of growth in EPFI.
Partial 5′ end sequences (an expressed sequence tag, or EST) were determined by conventional means for independent clones derived from each cDNA library. Overlapping ESTs were assembled into conjoined sequences.
| TABLE 1 |
| Non-redundant EST sequences |
| Number | ||
| Library | of ESTs | |
| hESC | 37,081 | |
| EB | 37,555 | |
| preHEP | 35,611 | |
| preNEU | 38,206 | |
| Total | 148,453 | |
The sequences were then compared to the Unigene database of human genes. ESTs that were at least 98% identical, over a stretch of at least 150 nucleotides each, to a common reference sequence in Unigene, were assumed to be transcribed from the same gene, and placed into a common assembly. The complete set of 148,453 ESTs collapsed to a non-redundant set of 32,764 assemblies.
Candidate markers were selected from a database based on the imputed level of gene expression. The frequency of ESTs for any particular gene correlates with the abundance of that mRNA in the cells used to generate the cDNA library. Thus, a comparison of frequencies of ESTs among the libraries indicates the relative abundance of the associated mRNA in the different cell types.
Candidate molecular markers were selected from the expressed gene (EST) database from their greater abundance in undifferentiated hES cells, relative to differentiated hES cells. Genes were identified as having a differential expression pattern (being up- or down-regulated) during the differentiation process, if the count of ESTs sequenced in the undifferentiated cells was substantially different from the sum of ESTs in the three differentiated libraries.
Oct 3/4(a POU domain-containing transcription factor) and telomerase reverse transcriptase (hTERT) are known to be expressed preferentially in undifferentiated hES cells (WO 01/51616). Other genes suitable for characterizing or manipulating the undifferentiated phenotype are those that are down-regulated upon differentiation with a significance of p≦0.05, as determined by the Fisher Exact Test (explained below). 193 genes were found to have 4-fold more ESTs in hES cells, relative to each of the three cell types. 532 genes were found that were 2-fold greater hES cells, with a confidence of over 95% as determined by the Fisher Exact Test, relative to the sum of ESTs of the three cell types (minimum of 4 ESTs in hES cells). The following markers are of particular interest:
| TABLE 2 |
| EST Frequency of Genes that are Down-regulated upon Differentiation of hES cells |
| EST counts |
| Geron ID | GenBank ID | Name | ES | EB | preHEP | preNEU |
| GA_10902 | NM_024504 | Pr domain containing 14 (PRDM 14) | 12 | 1 | 0 | 0 |
| GA_11893 | NM_032805 | Hypothetical protein FLJ14549 | 25 | 0 | 0 | 0 |
| GA_12318 | NM_032447 | Fibrillin3 | 6 | 0 | 0 | 0 |
| GA_1322 | NM_000142 | Fibroblast growth factor receptor 3 precursor | 9 | 1 | 5 | 1 |
| (FGFR-3) | ||||||
| GA_34679 | NM_002015 | Forkhead box o1a (FOXO1a) | 4 | 0 | 1 | 1 |
| GA_1470 | NM_003740 | potassium channel, subfamily K, member 5 | 4 | 0 | 0 | 1 |
| (KCNK5), mRNA | ||||||
| GA_1674 | NM_002701 | Octamer-Binding Transcription Factor 3a | 24 | 1 | 2 | 0 |
| (OCT-3A) (OCT-4) | ||||||
| GA_2024 | NM_003212 | Teratocarcinoma-derived growth factor 1 | 20 | 1 | 0 | 0 |
| (CRIPTO) | ||||||
| GA_2149 | NM_003413 | Zic family member 3 (ZIC3) | 7 | 0 | 1 | 0 |
| GA_2334 | NM_000216 | Kallmann syndrome 1 sequence (KAL1) | 5 | 0 | 1 | 0 |
| GA_23552 | NM_152742 | hypothetical protein DKFZp547M109 | 6 | 0 | 1 | 2 |
| (DKFZp547M109), mRNA | ||||||
| GA_2356 | NM_002851 | Protein tyrosine phosphatase, receptor-type, | 10 | 0 | 0 | 0 |
| z polypeptide 1 (PTPRZ1), | ||||||
| GA_2357 | NM_001670 | Armadillo repeat protein deleted in | 6 | 0 | 0 | 0 |
| velo-cardio-facial syndrome (ARVCF) | ||||||
| GA_23578 | BM454360 | AGENCOURT_6402318 NIH_MGC_85 | 6 | 0 | 0 | 0 |
| Homo sapiens cDNA clone IMAGE: 5497491 | ||||||
| 5′, mRNA sequence | ||||||
| GA_2367 | NM_003923 | Forkhead box H1 (FOXH1) | 5 | 0 | 0 | 0 |
| GA_2436 | NM_004329 | Bone morphogenetic protein receptor, type Ia | 7 | 3 | 1 | 1 |
| (BMPR1A) (ALK-3) | ||||||
| GA_2442 | NM_004335 | Bone marrow stromal antigen 2 (BST-2) | 13 | 0 | 2 | 3 |
| GA_2945 | NM_005232 | Ephrin type-a receptor 1 (EPHA1) | 5 | 1 | 1 | 1 |
| GA_2962 | NM_005314 | Gastrin-releasing peptide receptor (GRP-R) | 4 | 0 | 0 | 0 |
| GA_2988 | NM_005397 | Podocalyxin-like (PODXL) | 59 | 23 | 5 | 8 |
| GA_3337 | NM_006159 | NELL2 (nel-like protein 2) | 5 | 3 | 2 | 0 |
| GA_3559 | NM_005629 | Solute carrier family 6, member 8 (SLC6A8) | 5 | 1 | 0 | 1 |
| GA_3898 | NM_006892 | DNA (cytosine-5-)-methyltransferase 3 beta | 49 | 2 | 3 | 1 |
| (DNMT3B) | ||||||
| GA_5391 | NM_002968 | Sal-like 1 (SALL1), | 7 | 1 | 1 | 0 |
| GA_33680 | NM_016089 | Krab-zinc finger protein SZF1-1 | 15 | 0 | 1 | 0 |
| GA_36977 | NM_020927 | KIAA1576 protein | 9 | 2 | 1 | 0 |
| GA_8723 | NM_152333 | Homo sapiens chromosome 14 open reading | 14 | 1 | 1 | 3 |
| frame 69 (C14orf69), mRNA | ||||||
| GA_9167 | AF308602 | Notch 1 (N1) | 6 | 2 | 1 | 0 |
| GA_9183 | NM_007129 | Homo sapiens Zic family member 2 (odd- | 8 | 1 | 1 | 0 |
| paired homolog, Drosophila) (ZIC2), mRNA | ||||||
| GA_35037 | NM_004426 | Homo sapiens polyhomeotic-like 1 | 34 | 9 | 5 | 4 |
| (Drosophila) (PHC1), mRNA | ||||||
Three genes were observed from EST frequency queries that were of particular interest as potentially useful markers of hES cells. They were Teratocarcinoma-derived growth factor (Cripto), Podocalyxin-like (PODXL), and gastrin-releasing peptide receptor (GRPR). These genes were not only more abundant in undifferentiated cells, relative to differentiated hES cells, but also encoded for proteins expressed on the surface of cells. Surface markers have the added advantage that they could be easily detected with immunological reagents. ESTs for Cripto and GRPR were quite restricted to hES cells, with one or zero ESTs, respectively, scored in any of the differentiated cells. PODXL ESTs were detected in all 4-cell types, but substantially fewer (2.5×–12×) in differentiated cells. All three markers retained a detectable level of expression in differentiated cultures of hES cells. There may be a low level of expression of these markers in differentiated cells, or the expression detected may be due to a small proportion of undifferentiated cells in the population. GABA(A) receptor, Lefty B, Osteopontin, Thy-1 co-transcribed, and Solute carrier 21 are other significant markers of the undifferentiated phenotype.
By similar reasoning, genes that show a higher frequency of ESTs in differentiated cells can be used as specific markers for differentiation. ESTs that are 2-fold more abundant in the sum of all three differentiated cell types (EBs, preHEP and preNEU cells) and with a p-value≦0.05 as determined by the Fisher Exact Test, compared with undifferentiated hES cells are candidate markers for differentiation down multiple pathways. ESTs that are relatively abundant in only one of the differentiated cell types are candidate markers for tissue-specific differentiation. The following markers are of particular interest:
| TABLE 3 |
| EST Frequency of Genes that are Upregulated upon Differentiation |
| EST counts |
| Geron ID | GenBank ID | Name | ES | EB | preHEP | preNEU |
| GA_35463 | NM_024298 | Homo sapiens leukocyte receptor cluster | 0 | 4 | 9 | 8 |
| (LRC) member 4 (LENG4), mRNA | ||||||
| GA_10492 | NM_006903 | Inorganic pyrophosphatase (PPASE) | 0 | 5 | 5 | 6 |
| GA_38563 | NM_021005 | Homo sapiens nuclear receptor subfamily 2, | 0 | 9 | 8 | 9 |
| group F, member 2 (NR2F2), mRNA | ||||||
| GA_38570 | NM_001844 | Collagen, type II, alpha 1 (COL2A1), transcript | 15 | 31 | 5 | |
| variant 1 | ||||||
| GA_1476 | NM_002276 | Keratin type I cytoskeletal 19 (cytokeratin 19) | 1 | 26 | 14 | 38 |
| GA_34776 | NM_002273 | Keratin type II cytoskeletal 8 (cytokeratin 8) | 9 | 71 | 144 | 156 |
| (CK 8) | ||||||
| GA_1735 | NM_002806 | Homo sapiens proteasome (prosome, | 1 | 7 | 7 | 8 |
| macropain) 26S subunit, ATPase, 6 (PSMC6), | ||||||
| mRNA | ||||||
| GA_1843 | NM_000982 | 60s ribosomal protein I21 | 1 | 7 | 48 | 42 |
| GA_35369 | NM_003374 | Voltage-dependent anion-selective channel | 1 | 5 | 6 | 10 |
| (VDAC-1) | ||||||
| GA_23117 | NM_004772 | P311 protein [Homo sapiens ] | 1 | 5 | 7 | 6 |
| GA_2597 | NM_138610 | Homo sapiens H2A histone family, member Y | 1 | 5 | 5 | 14 |
| (H2AFY), transcript variant 3, mRNA | ||||||
| GA_3283 | NM_004484 | Homo sapiens glypican 3 (GPC3), mRNA | 1 | 6 | 7 | 12 |
| GA_3530 | NM_002539 | Homo sapiens ornithine decarboxylase 1 | 1 | 10 | 8 | 9 |
| (ODC1), mRNA | ||||||
| GA_4145 | NM_002480 | Protein phosphatase 1, regulatory(inhibitor) | 1 | 6 | 6 | 6 |
| subunit 12A (PPP1R12A) | ||||||
| GA_5992 | NM_014899 | Homo sapiens Rho-related BTB domain | 0 | 10 | 7 | 13 |
| containing 3 (RHOBTB3), mRNA | ||||||
| GA_6136 | NM_016368 | Homo sapiens myo-inositol 1-phosphate | 1 | 7 | 5 | 16 |
| synthase A1 (ISYNA1), mRNA | ||||||
| GA_6165 | NM_015853 | Orf (LOC51035) | 1 | 5 | 9 | 5 |
| GA_6219 | NM_016139 | 16.7 Kd protein (LOC51142), | 1 | 5 | 13 | 14 |
| GA_723 | NM_005801 | Homo sapiens putative translation initiation | 1 | 14 | 15 | 19 |
| factor (SUI1), mRNA | ||||||
| GA_9196 | NM_000404 | Homo sapiens galactosidase, beta 1 (GLB1), | 0 | 6 | 10 | 7 |
| transcript variant 179423, mRNA | ||||||
| GA_9649 | NM_014604 | Tax interaction protein 1 (TIP-1) | 0 | 8 | 5 | 5 |
To verify the expression patterns of particular genes of interest at the mRNA level, extracts of undifferentiated hES cells and their differentiated progeny were assayed by real-time PCR. Cells were cultured for 1 week with 0.5% dimethyl sulfoxide (DMSO) or 500 nM retinoic acid (RA). The samples were amplified using sequence-specific primers, and the rate of amplification was correlated with the expression level of each gene in the cell population.
Taqman™ RT-PCR was performed under the following conditions: 1×RT Master Mix (ABI), 300 nM for each primer, and 80 nM of probe, and 10 pg to 100 ng of total RNA in nuclease-free water. The reaction was conducted under default RT-PCR conditions of 48° C. hold for 30 min, 95° C. hold for 10 min, and 40 cycles of 95° C. at 15 sec and 60° C. hold for 1 min. RNA was isolated by a guanidinium isothiocyanate method (RNAeasy™ kit, Qiagen) according to manufacturer's instructions, and subsequently DNAse treated (DNAfree™ kit, Ambion). Gene-specific primers and probes were designed by PrimerExpress™ software (Ver. 1.5, ABI). Probe oligonucleotides were synthesized with the fluorescent indicators 6-carboxyfluorescein (FAM) and 6-carboxy-tetramethylrhodamine (TAMRA) at the 5′ and 3′ ends, respectively. Relative quantitation of gene expression between multiple samples was achieved by normalization against endogenous 18S ribosomal RNA (primer and probe from ABI) using the ΔΔCT method of quantitation (ABI). Fold change in expression level was calculated as 2−ΔΔCT.
The table below shows the results of this analysis. Since the cells have been cultured in RA and DMSO for a short period, they are at the early stages of differentiation, and the difference in expression level is less dramatic than it would be after further differentiation. Of particular interest for following or modulating the differentiation process are markers that show modified expression within the first week of differentiation by more than 2-fold (*), 5-fold (**), 10-fold (***), or 100-fold (****).
| TABLE 4 |
| Quantitative RT-PCR analysis of gene expression in hESC differentiation |
| Fold Change |
| Geron ID | GenBank ID | Name | RA | DMSO | |
| A. | GA_10902 | NM_024504 | Pr domain containing 14 (PRDM14)** | −1.9 | −8.3 |
| GA_11893 | NM_032805 | Hypothetical protein FLJ14549*** | −2.3 | −10.0 | |
| GA_12318 | NM_032447 | Fibrillin3 | |||
| GA_1322 | NM_000142 | Fibroblast growth factor receptor 3 precursor | 1.5 | 2.3 | |
| (FGFR-3)* | |||||
| GA_1329 | NM_002015 | Forkhead box o1a (foxo1a)* | −1.6 | −2.9 | |
| GA_1470 | NM_003740 | Potassium channel subfamily k member 5 (TASK-2) | −1.6 | 1.0 | |
| GA_1674 | NM_002701 | Octamer-binding transcription factor 3a (OCT-3A) | −3.7 | −7.7 | |
| (OCT-4)** | |||||
| GA_2024 | NM_003212 | Teratocarcinoma-derived growth factor 1 | −4.0 | −12.5 | |
| (CRIPTO)*** | |||||
| GA_2149 | NM_003413 | Zic family member 3 (ZIC3)** | −1.7 | −5.3 | |
| GA_2334 | NM_000216 | Kallmann syndrome 1 sequence (KAL1)* | −1.1 | −2.5 | |
| GA_23552 | BC027972 | Glypican-2 (cerebroglycan) | −1.5 | −1.2 | |
| GA_2356 | NM_002851 | Protein tyrosine phosphatase, receptor-type, z | −1.7 | −3.3 | |
| polypeptide 1 (PTPRZ1)* | |||||
| GA_2367 | NM_003923 | Forkhead box h1 (FOXH1)** | −1.8 | −5.6 | |
| GA_2436 | NM_004329 | Bone morphogenetic protein receptor, type Ia | −2.4 | −2.4 | |
| (BMPR1A) (ALK-3)* | |||||
| GA_2442 | NM_004335 | Bone marrow stromal antigen 2 (BST-2) | 1.1 | −1.9 | |
| GA_2945 | NM_005232 | Ephrin type-a receptor 1 (EPHA1) | −1.3 | −1.9 | |
| GA_2962 | NM_005314 | Gastrin-releasing peptide receptor (GRP-R)** | −6.3 | −9.1 | |
| GA_2988 | NM_005397 | Podocalyxin-like (PODXL)* | −2.6 | −4.3 | |
| GA_3337 | NM_006159 | Nell2 (NEL-like protein 2) | −1.3 | −1.3 | |
| GA_3559 | NM_005629 | Solute carrier family 6, member 8 (SLC6A8) | −1.1 | −1.1 | |
| GA_420 | X98834 | Zinc finger protein, HSAL2* | −1.4 | −2.8 | |
| GA_5391 | NM_002968 | Sal-like 1 (SALL1), | 1.4 | −1.3 | |
| GA_6402 | NM_016089 | Krab-zinc finger protein SZF1-1* | −1.8 | −3.1 | |
| GA_9167 | AF308602 | Notch 1 (N1) | 1.3 | 1.0 | |
| GA_9183 | AF193855 | Zinc finger protein of cerebellum ZIC2* | 1.0 | −2.9 | |
| GA_9443 | NM_004426 | Early development regulator 1 (polyhomeotic 1 | −1.8 | −5.6 | |
| homolog) (EDR1)** | |||||
| B. | GA_9384 | NM_020997 | Left-right determination, factor b (LEFTB)** | −16.7 | −25.0 |
| GA_12173 | BC010641 | Gamma-aminobutyric acid (GABA) A receptor, | −2.8 | −5.6 | |
| beta 3** | |||||
| GA_10513 | NM_033209 | Thy-1 co-transcribed*** | −12.5 | −11.1 | |
| GA_1831 | NM_002941 | Roundabout, axon guidance receptor, homolog 1 | 1.1 | 1.0 | |
| (ROBO1), | |||||
| GA_2753 | NM_000582 | Secreted phosphoprotein 1 (osteopontin)*** | −3.8 | −10.0 | |
| GA_32919 | NM_133259 | 130 kDa leucine-rich protein (LRP 130) | −1.9 | −1.9 | |
| GA_28290 | AK055829 | FLJ31267 (acetylglucosaminyltransferase-like | −2.3 | −4.5 | |
| protein)* | |||||
| C. | GA_28053 | T24677 | EST**** | <−100* | <−100* |
| GA_26303 | NM_138815 | Hypothetical protein BC018070*** | −3.2 | −10.0 | |
| GA_2028 | NM_003219 | Telomerase reverse transcriptase (TERT)* | −2.1 | −2.3 | |
Genes that undergo up- or down-regulation in expression levels during differentiation are of interest for a variety of different commercial applications, as described earlier. This experiment provides an example in which certain genes were selected as a means to monitor the ability of culture conditions to maintain the undifferentiated cell phenotype—and hence, the pluripotent differentiation capability of the cells.
Particular genes were chosen from those identified as having differential expression patterns, because they are known or suspected of producing a protein gene product that is expressed at the cell surface, or is secreted. These attributes are helpful, because they allow the condition of the cells to be monitored easily either by antibody staining of the cell surface, or by immunoassay of the culture supernatant. Genes were chosen from the EST database (Groups 1), microarray analysis (Group 2), and other sources (Group 3).
| TABLE 5 |
| Additional Genes analyzed by real-time PCR |
| GenBank or | ||
| Name | ID No. | |
| Group 1 | Bone marrow stromal antigen | NM_004335 |
| Podocalyxin-like | NM_005397 | |
| Rat GPC/glypican-2 (cerebroglycan) | TA_5416486 | |
| Potassium channel subfamily k member 5 | NM_003740 | |
| (TASK-2) | ||
| Notch 1 protein | AF308602 | |
| Teratocarcinoma-derived growth factor 1 | NM_003212 | |
| (Cripto) | ||
| Nel 1 like/NELL2 (Nel-like protein 2) | NM_006159 | |
| Gastrin releasing peptide receptor | NM_005314 | |
| Bone morphogenetic protein receptor | NM_004329 | |
| ABCG2- ABC transporter | AY017168 | |
| Solute carrier family 6, member 8 (SLC6A8) | NM_005629 | |
| hTERT | NM_003219 | |
| Oct 3/4 octamer-binding transcription factor | NM_002701 | |
| 3a (oct-3a) (oct-4) | ||
| Group 2 | Left-right determination factor b (LEFTB) | NM_020997 |
| Secreted phosphoprotein 1 (osteopontin) | NM_000582 | |
| Gamma-aminobutyric acid (GABA) A receptor, | NM_021912 | |
| beta 3 | ||
| Roundabout, axon guidance receptor, | NM_002941 | |
| homologue 1 (ROBO1), | ||
| Glucagon receptor | NM_00160 | |
| Leucine-rich PPR-motif hum 130 kDa | M92439 | |
| hum130leu 130 kd Leu | ||
| Thy-1 co-transcribed | NM_033209 | |
| Solute carrier family 21 | NM_016354 | |
| LY6H lymphocyte antigen 6 complex locus H | NM_002347 | |
| Plexin (PLXNB3) | NM_005393 | |
| ICAM | NM_000201 | |
| Group 3 | Rhodopsin | NM_000539 |
| Kallmann syndrome 1 sequence (KAL1) | NM_000216 | |
| Armadillo repeat protein deleted in velo-cardio- | NM_001670 | |
| facial syndrome (ARVCF) | ||
| Ephrin type-a receptor 1 (EPHA1) | NM_005232 | |
FIG. 1 shows the decrease in expression of the genes in Group I (Upper Panel) and Group II (Lower Panel) in H9 hES cells after culturing for 7 days with RA or DM. Gene expression of rhodopsin and ICAM was below the limit of detection in differentiated cells. KALL and EPHAL were not tested.
Besides hTERT and Oct 3/4, three other genes were selected as characteristic of the undifferentiated hES cell phenotype. They were Teratocarcinoma-derived growth factor (Cripto), Podocalyxin-like (PODXL), and gastrin-releasing peptide receptor (GRPR).
FIG. 2 compares the level of expression of these five genes in hES cells with fully differentiated cells: BJ fibroblasts, BJ fibroblasts transfected to express hTERT (BJ-5TA), and 293 (human embryonic kidney) cells. The level of all markers shown was at least 10-fold higher, and potentially more than 102, 103, 104, 105, or 106-fold higher in pluripotent stem cells than fully differentiated cells. All five markers retained a detectable level of expression in differentiated cultures of hESC. It is not clear if there is lower level of expression of these markers in differentiated cells, or if the detectable expression derived from the undifferentiated cells in the population. The one exception observed in this experiment was the hTERT transgene, expressed at an elevated level as expected in the BJ-5TA cells.
High-level expression of Cripto, GRPR and PODXL in undifferentiated hES cells reveals interesting aspects of the biology of these cells. Cripto has been implicated in normal mammalian development and tumor growth. Cripto encodes a glycosylphosphoinositol anchored protein that contains an EGF repeat and a cysteine rich motif, which makes it a member of the EGF-CFC family. It has been demonstrated that Cripto serves as a co receptor for Nodal, which is essential for mesoderm and endoderm formation in vertebrate development (Yeo et al., Molecular Cell 7:949, 2001). The finding that Cripto is expressed preferentially on undifferentiated hESC suggests that Nodal is an important signaling molecule for stem cells, perhaps to promote survival and/or proliferation.
PODXL encodes for transmembrane sialoprotein that is physically linked to the cytoskeleton. PODXL is suspected to act as an inhibitor of cell-cell adhesion and has been implicated in the embryonic development of the kidney podocyte. The anti-adhesion properties of PODXL when expressed on undifferentiated hESC may be an important feature related to stem cell migration.
The receptor for gastrin releasing peptide (GRP) is a G-protein coupled receptor that mediates numerous biological effects of Bombesin-like peptides, including regulation of gut acid secretion and satiety. A critical role has also been established for GRP and GRPR in control growth of cultured cells and normal mammalian development. GRP and GRPR may be oncofetal antigens that act as morphogens in normal development and cancer.
This example illustrates the utility of the differentially expressed genes identified according to this invention in the evaluation of culture environments suitable for maintaining pluripotent stem cells.
FIG. 3 show results of an experiment in which hES cells of the H1 line were maintained for multiple passages in different media. Medium conditioned with feeder cells provides factors effective to allow hES cells to proliferate in culture without differentiating. However, culturing in unconditioned medium leads to loss of the undifferentiated phenotype, with an increasing percentage of the cells showing decreased expression of CD9 (a marker for endothelial cells, fibroblasts, and certain progenitor cells), and the classic hES cell marker SSEA-4.
FIG. 4 illustrates the sensitivity of hTERT, Oct 3/4, Cripto, GRP receptor, and podocalyxin-like protein (measured by real-time PCR assay) as a means of determining the degree of differentiation of the cells. After 4 passages in unconditioned X-VIVO™ 10 medium containing 8 ng/mL bFGF, all 5 markers show expression that has been downregulated by about 10-fold. After 8 passages, expression has decreased by 102, 103, or 104-fold.
FIG. 5 shows results of an experiment in which the hES cell line H1 was grown on different feeder cell lines: mEF=mouse embryonic fibroblasts; hMSC=human mesenchymal stem cells; UtSMC=human uterine smooth muscle cells; WI-38=an established line of human lung fibroblasts. As monitored by RT-PCR assay of Cripto, Oct 3/4, and hTERT, at least under the conditions used in this experiment, the hMSC are better substitutes for mEF feeders than the other cell lines tested.
FIG. 6 shows results of an experiment in which different media were tested for their ability to promote growth of hES cells without differentiation. Expression of Podocalyxin-like protein, Cripto, GFP Receptor, and hTERT were measured by RT-PCR. The test media were not preconditioned, but supplemented with the growth factors as follows:
| TABLE 6 |
| Growth Conditions Tested for Marker Expression |
| DMEM preconditioned | ||
| Standard conditions: | with mEF + bFGF (8 ng/mL) | |
| Condition 3 | X-VIVO ™ 10 + bFGF (8 ng/mL) | |
| Condition 4 | X-VIVO ™ 10 + bFGF (40 ng/mL) | |
| Condition 5 | X-VIVO ™ 10 + bFGF (40 ng/mL) + | |
| stem cell factor (SCF, 15 ng/mL) | ||
| Condition 6 | X-VIVO ™ 10 + bFGF (40 ng/mL) + | |
| Flt3 ligand (75 ng/mL) | ||
| Condition 7 | X-VIVO ™ 10 + bFGF (40 ng/mL) + | |
| LIF (100 ng/mL) | ||
| Condition 8 | QBSF ™-60 + bFGF (40 ng/mL) | |
| TABLE 7 |
| SEQUENCE DATA |
| Sequences Listed in this Disclosure |
| SEQ. | ||
| ID NO: | Designation | Reference |
| 1 | hTERT mRNA sequence | GenBank Accession NM_003129 |
| 2 | hTERT protein sequence | GenBank Accession NM_003129 |
| 3 | Oct 3/4 mRNA sequence | GenBank Accession NM_002701 |
| 4 | Oct 3/4 protein sequence | GenBank Accession NM_002701 |
| 5 | Cripto mRNA sequence | GenBank Accession NM_003212 |
| 6 | Cripto protein sequence | GenBank Accession NM_003212 |
| 7 | podocalyxin-like protein | GenBank Accession NM_005397 |
| mRNA sequence | ||
| 8 | podocalyxin-like protein | GenBank Accession NM_005397 |
| amino acid sequence | ||
| 9 | GRP receptor mRNA | GenBank Accession NM_005314 |
| sequence | ||
| 10 | GRP receptor proteins | GenBank Accession NM_005314 |
| sequence | ||
| 11 to 81 | Primers & probes for | This disclosure |
| real-time PCR assay | ||
| 82–100 | Human telomeric repeats | U.S. Pat. No. 5,583,016 |
| SEQ. ID NO: 1 | ||
| LOCUS | TERT 4015 bp mRNA linear PRI 31-OCT-2000 | |
| DEFINITION | Homo sapiens telomerase reverse transcriptase (TERT), mRNA. | |
| ACCESSION | NM_003219 | |
| AUTHORS | Nakamura, T. M., Morin, G. B., Chapman, K. B., Weinrich, S. L., | |
| Andrews, W. H., Lingner, J., Harley, C. B. and Cech, T. R. | ||
| TITLE | Telomerase catalytic subunit homologs from fission yeast and human | |
| JOURNAL | Science 277 (5328), 955–959 (1997) | |
| CDS | 56 . . . 3454 | |
| SEQ. ID NO: 3 | ||
| LOCUS | POU5F1 1158 bp mRNA linear PRI 31-OCT-2000 | |
| DEFINITION | Homo sapiens POU domain, class 5, transcription factor 1 (POU5F1), | |
| mRNA. | ||
| ACCESSION | NM_002701 | |
| AUTHORS | Takeda, J., Seino, S. and Bell ,G. I. | |
| TITLE | Human Oct3 gene family: cDNA sequences, alternative splicing, gene | |
| organization, chromosomal location, and expression at low levels in | ||
| adult tissues | ||
| JOURNAL | Nucleic Acids Res. 20 (17), 4613–4620 (1992) | |
| CDS | 102 . . . 899 | |
| SEQ. ID NO: 5 | ||
| LOCUS | TDGF1 2033 bp mRNA linear PRI 05-NOV-2002 | |
| DEFINITION | Homo sapiens teratocarcinoma-derived growth factor 1 (TOGF1), mRNA. | |
| ACCESSION | NM_003212 | |
| AUTHORS | Dono, R., Montuori, N., Rocchi, M., De Ponti-Zilli, L., Ciccodicola, A. | |
| and Persico, M. G. | ||
| TITLE | Isolation and characterization of the CRIPTO autosomal gene and its | |
| X-linked related sequence | ||
| JOURNAL | Am. J. Hum. Genet. 49 (3), 555–565 (1991) | |
| CDS | 248 . . . 814 | |
| SEQ. ID NO: 7 | ||
| LOCUS | PODXL 5869 bp mRNA linear PRI 01-NOV-2000 | |
| DEFINITION | Homo sapiens podocalyxin-like (PODXL), mRNA. | |
| ACCESSION | NM_005397 | |
| AUTHORS | Kershaw, D. B., Beck, S. G., Wharram, B. L., Wiggins, J. E., Goyal, M., | |
| Thomas, P. E. and Wiggins, R. C. | ||
| TITLE | Molecular cloning and characterization of human podocalyxin-like | |
| protein. Orthologous relationship to rabbit PCLP1 and rat | ||
| podocalyxin | ||
| JOURNAL | J. Biol. Chem. 272 (25), 15708–15714 (1997) | |
| CDS | 251 . . . 1837 | |
| SEQ. ID NO: 9 | ||
| LOCUS | GRPR 1726 bp mRNA linear PRI 05-NOV-2002 | |
| DEFINITION | Homo sapiens gastrin-releasing peptide receptor (GRPR), mRNA. | |
| ACCESSION | NM_005314 | |
| AUTHORS | Xiao, D., Wang, J., Hampton, L. L. and Weber, H. C. | |
| TITLE | The human gastrin-releasing peptide receptor gene structure, its | |
| tissue expression and promoter | ||
| JOURNAL | Gene 264 (1), 95–103 (2001) | |
| CDS | 399 . . . 1553 | |
| Bone Marrow Stromal antigen | ||
| Forward primer: ACCTGCAACCACACTGTGATG | SEQ. ID NO: 11 | |
| Probe: 6fam-CCCTAATGGCTTCCCTGGATGCAGA-tam | SEQ. ID NO: 12 | |
| Reverse Primer: TTTCTTTTGTCCTTGGGCCTT | SEQ. ID NO: 13 | |
| Podocalyxin-like | ||
| Forward primer: GCTCGGCATATCAGTGAGATCA | SEQ. ID NO: 14 | |
| Probe: 6fam-TCTCATCCGAAGCGCCCCCTG-tam | SEQ. ID NO: 15 | |
| Reverse Primer: AGCTCGTCCTGAACCTCACAG | SEQ. ID NO: 16 | |
| Rat GPC/glpican-2 (cerebroglycan) | ||
| Forward primer: CTGGAAGAAATGTGGTCAGCG | SEQ. ID NO: 17 | |
| Probe: 6fam-AGCGCTTAAGGTGCCGGTGTCTGAAG-tam | SEQ. ID NO: 18 | |
| Reverse Primer: CATCAGAGCCTGGCTGCAG | SEQ. ID NO: 19 | |
| Potassium channel subfamily k member 5 (TASK-2) | ||
| Forward primer: ACCATCGGCTTCGGTGAC | SEQ. ID NO: 20 | |
| Probe: 6fam-TGTGGCCGGTGTGAACCCCA-tam | SEQ. ID NO: 21 | |
| Reverse Primer: TACAGGGCGTGGTAGTTGGC | SEQ. ID NO: 22 | |
| Notch 1 protein | ||
| Forward primer: TGAGAGCTTCTCCTGTGTCTGC | SEQ. ID NO: 23 | |
| Probe: 6fam-CAAGGGCAGACCTGTGAGGTCGACA-tam | SEQ. ID NO: 24 | |
| Reverse Primer: GGGCTCAGAACGCAGTCGT | SEQ. ID NO: 25 | |
| Teratocarcinoma-derived growth factor 1 (Cripto) | ||
| Forward primer: TGAGCACGATGTGGGCA | SEQ. ID NO: 26 | |
| Probe: 6fam-AGAGAACTGTGGGTCTGTGCCCCATG-tam | SEQ. ID NO: 27 | |
| Reverse Primer: TTCTTGGGCAGCCAGGTG | SEQ. ID NO: 28 | |
| Nel 1 like/NELL2 (Nel-like protein 2) | ||
| Forward primer: CTTAAGTCGGCTCTTGCGTATGT | SEQ. ID NO: 29 | |
| Probe: 6fam-ATGGCAAATGCTGTAAGGAATGCAAATCG-tam | SEQ. ID NO: 30 | |
| Reverse Primer: AAGTAGGTTCGTCCTTGAAATTGG | SEQ. ID NO: 31 | |
| Gastrin releasing peptide receptor | ||
| Forward primer: CCGTGGAAGGGAATATACATGTC | SEQ. ID NO: 32 | |
| Probe: 6fam-AGAAGCAGATTGAATCCCGGAAGCGA-TAM | SEQ. ID NO: 33 | |
| Reverse Primer: CACCAGCACTGTCTTGGCAA | SEQ. ID NO: 34 | |
| Bone morphogenetic protein receptor | ||
| Forward primer: CAGATTATTGGGAGCCTATTTGTTC | SEQ. ID NO: 35 | |
| Probe: 6fam-TCATTTCTCGTGTTCAAGGACAGAATCTGGAT-tam | SEQ. ID NO: 36 | |
| Reverse Primer: CATCCCAGTGCCATGAAGC | SEQ. ID NO: 31 | |
| ABC G2-ABC transporter | ||
| Forward primer: GGCCTCAGGAAGACTTATGT | SEQ. ID NO: 38 | |
| Probe: SYBR Green Detection Method | ||
| Reverse Primer: AAGGAGGTGGTGTAGCTGAT | SEQ. ID NO: 39 | |
| Solute carrier family 6, member B (SLC6A8) | ||
| Forward primer: CCGGCAGCAT CAATGTCTG | SEQ. ID NO: 40 | |
| Probe: 6fam-TCAAAGGCCTGGGCTACGCCTCC-tam | SEQ. ID NO: 41 | |
| Reverse Primer: GTGTTGCAGTAGAAGACGATCACC | SEQ. ID NO: 42 | |
| Oct 3/4 octamer-binding trasncription factor 3a (oct3a) (oct-4) | ||
| Forward primer: GAAACCCACACTGCAGCAGA | SEQ. ID NO: 43 | |
| Probe: 6fam-CAGCCACATCGCCCAGCAGC-TAM | SEQ. ID NO: 44 | |
| Reverse Primer: CACATCCTTCTCGAGCCCA | SEQ. ID NO: 45 | |
| Left-right determination factor b (LEFTB) | ||
| Forward primer: TGCCGCCAGGAGATGTACA | SEQ. ID NO: 46 | |
| Probe: 6fam-TGGGCCGAGAACTGGGTGCTG-tam | SEQ. ID NO: 47 | |
| Reverse Primer: TCATAAGCCAGGAAGCCCG | SEQ. ID NO: 48 | |
| Secreted phosphoprotein 1 (osteopontin) | ||
| Forward primer: TTGCAGCCTTCTCAGCCAA | SEQ. ID NO: 49 | |
| Probe: 6fam-CGCCGACCAAGGAAAACTCACTACCA-tam | SEQ. ID NO: 50 | |
| Reverse Primer: GGAGGCAAAAGCAAATCACTG | SEQ. ID NO: 51 | |
| Gamma-aminobutyric aci (GABA) A receptor, beta 3 | ||
| Forward primer: CCGTCTGGTCTCGAGGAATG | SEQ. ID NO: 52 | |
| Probe: 6fam-TCTTCGCCACAGGTGCCTATCCTCG-tam | SEQ. ID NO: 53 | |
| Reverse Primer: TCAACCGAAAGCTCAGTGACA | SEQ. ID NO: 54 | |
| Roundabout, axon guidance receptor, homologue 1 (ROBO1) | ||
| Forward primer: GAGAGGAGGCGAAGCTGTCA | SEQ. ID NO: 55 | |
| Probe: 6fam-CAGTGGAGGGAGGCCTGGACTTCTC-tam | SEQ. ID NO: 56 | |
| Reverse Primer: GCGGCAGGTTCACTGATGT | SEQ. ID NO: 57 | |
| Glucagon receptor | ||
| Forward primer: CCACACAGACTACAAGTTCCGG | SEQ. ID NO: 58 | |
| Probe: 6fam-TGGCCAAGTCCACGCTGACCCT-tam | SEQ. ID NO: 59 | |
| Reverse Primer: CTTCGTGGACGCCCAGC | SEQ. ID NO: 60 | |
| Leucine-rich PPR-motif hum 130kda hum 130kd leu | ||
| Forward primer: GCAGCAGACCCCTTCTAGGTTAG | SEQ. ID NO: 61 | |
| Probe: 6fam-ACCCGTGTCATCCAGGCATTGGC-tam | SEQ. ID NO: 62 | |
| Reverse Primer: TGAACTACTTCTATGTTTTCAACATCACC | SEQ. ID NO: 63 | |
| Thy-1 co-transcribed | ||
| Forward primer: AGCCTCCAAGTCAGGTGGG | SEQ. ID NO: 64 | |
| Probe: 6fam-CAGAGCTGCACAGGGTTTGGCCC-TAM | SEQ. ID NO: 65 | |
| Reverse Primer: GGAGGAAGTGCCTCCCTTAGA | SEQ. ID NO: 66 | |
| Solute carrier family 21 | ||
| Forward primer: GCGTCACCTACCTGGATGAGA | SEQ. ID NO: 67 | |
| Probe: 6fam-CCAGCTGCTCGCCCGTCTACATTG-tam | SEQ. ID NO: 68 | |
| Reverse Primer: TGGCCGCTGTGTAGAAGATG | SEQ. ID NO: 69 | |
| LY6H lympohocyte antigen 6 complex locus H | ||
| Forward primer: CGAATCACCGATCCCAGC | SEQ. ID NO: 70 | |
| Probe: 6fam-CAGCAGGAAGGATCACTCGGTGAACAA-tam | SEQ. ID NO: 71 | |
| Reverse Primer: CGAAGTCACAGGAGGAGGCA | SEQ. ID NO: 72 | |
| Plexin (PLXNB3) | ||
| Forward primer: GAGAAGGTGTTGGACCAAGTCTACA | SEQ. ID NO: 73 | |
| Probe: 6fam-CCTCAGTGCATGCCCTAGACCTTGAGTG-tam | SEQ. ID NO: 74 | |
| Reverse Primer: CTTCGTCCGATAGGGTCAGG | SEQ. ID NO: 75 | |
| ICAM | ||
| Forward primer: ACTCCAGAACGGGTGGAACTG | SEQ. ID NO: 76 | |
| Probe: 6fam-ACCCCTCCCCTCTTGGCAGCC-tam | SEQ. ID NO: 77 | |
| Reverse Primer: CGTAGGGTAAGGTTCTTGCCC | SEQ. ID NO: 78 | |
| Rhodopsin | ||
| Forward primer: CCGGCTGGTCCAGGTACAT | SEQ. ID NO: 79 | |
| Probe: 6fam-CCGAGGGCCTGCAGTGCTCG-tam | SEQ. ID NO: 80 | |
| Reverse Primer: TTGAGCGTGTAGTAGTCGATTCCA | SEQ. ID NO: 81 | |
| * * * * * * * * * * |
The Subject Matter Provided in this Disclosure can be Modified as a Matter of Routine Optimization, Without Departing from the Spirit of the Invention, or the Scope of the Appended Claims.
1. A method for assessing the differentiation of a population of human embryonic stem cells in vitro, comprising measuring the gastrin-releasing peptide (GRP) receptor expression level in the population of human embryonic stem cells; wherein a decrease in the GRP receptor expression level relative to the GRP receptor expression level measured in the population at an earlier time point indicates that the population is differentiating.
2. The method of claim 1, wherein the GRP receptor expression level is measured at the mRNA level.
3. The method of claim 2, wherein the GRP receptor expression level is measured at the mRNA level by PCR amplification.
4. The method of claim 1, wherein the GRP receptor expression level is measured at the protein level.
5. The method of claim 4, wherein the GRP receptor expression level is measured at the protein level by antibody assay.
6. The method of claim 1, wherein the GRP receptor expression level is measured using flow cytometry.