-
2012-02-28
10/398,011
2001-10-05
US 8,124,391 B2
2012-02-28
WO; PCT/EP01/11529; 20011005
WO; WO02/29016; 20020411
Richard Hutson
2023-02-02
The invention relates to a thermostable polymerase based on thermococcus pacificus; DNA molecules which code for one such polymerase; expression vectors; host cells; methods for producing one such polymerase and the use thereof for polymerising nucleic acid, especially in the polymerase chain reaction.
Get notified when new applications in this technology area are published.
C12N9/12 IPC
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
This application is a United States national filing under 35 U.S.C. §371 of international (PCT) application No. PCT/EP01/11529, filed Oct. 5, 2001, designating the US, and claiming priority to German Application No. 100 49 211.8, filed Oct. 5, 2000.
The present invention relates to a thermostable polymerase from Thermococcus pacificus, DNA molecules which code for such a polymerase, expression vectors, host cells, process for preparing a polymerase of this kind and the use thereof for the polymerisation of nucleic acid, particularly in the polymerase chain reaction.
DNA polymerases are a family of enzymes which catalyse the polymerisation of nucleic acids and play a part in both DNA replication and in DNA repair. Thermostable DNA polymerases are frequently used in in-vitro processes, for example in the polymerase chain reaction (PCR), which has become an indispensable process in molecular biology. A common problem of the DNA polymerases used for this purpose is the incorporation of the wrong nucleotides during DNA synthesis, which leads to mutated PCR products. This may cause problems in some molecular-biological applications, particularly in the cloning and subsequent recombinant expression of protein, as the mutations introduced may lead to inactive protein or protein which differs from the original protein in its properties. The mis-incorporation may be corrected by polymerases which have an inherent 3′-5′-exonuclease activity (so-called proofreading enzymes). The enzyme most commonly used in PCR, Taq DNA polymerase, does not have this enzymatic activity, and it is known that the error rate of this enzyme is more than ten times higher than that of the proofreading enzymes (U.S. Pat. No. 5,545,552).
Various other known heat-stable DNA polymerases do indeed have a proofreading activity, but have other disadvantages (Lundberg et al. 1991, Gene 108:1-6; EP 0 455 430; EP 0 701 000; WO 92/03556; WO 92/09689). Thermostable DNA polymerases with 3′-5′-exonuclease activity are also known particularly from the organisms Thermococcus gorgonarius (WO 98/14590 A1) and the Archaeon strain KOD1 (EP 0 745 675 A2).
There is still a need for new thermostable DNA polymerases with proofreading activity and improved properties with regard to their usefulness in molecular biology, particularly increased heat stability, 3′-5′-exonuclease activity, and proofreading ability under PCR-conditions.
This problem is solved by the provision of a new thermostable DNA polymerase, obtainable from the organism Thermococcus pacificus.
The present invention relates particularly to a thermostable DNA polymerase from Thermococcus pacificus with 3′-5′-exonuclease activity. Preferably a DNA polymerase of this kind has the amino acid sequence SEQ ID NO: 2 (numerical code <210>2 or <400>2 in the attached sequence listing).
In another aspect the present invention relates to a DNA molecule which codes for a thermostable DNA polymerase with 5′-3′-polymerase activity, and which
By stringent conditions are meant for the purposes of the present invention conditions under which two DNA molecules in a hybridisation experiment hybridise with one another if they have a sequence identity of 97% or more, preferably 98% or more, most preferably 99% or more in the hybridising section. The skilled man knows how to achieve such conditions (Sambrook, Fritsch, Maniatis. Molecular Cloning. A Laboratory Manual, 1989. 9.47).
One way of obtaining a DNA molecule according to the invention is to isolate it from the organism Thermococcus pacificus. Thermococcus pacificus is known in the art (Miroshnichenko et al. 1998, Thermococcus gorgonarius sp. nov. and Thermococcus pacificus sp. nov.: heterotrophic extremely thermophilic archaea from New Zealand submarine hot vents. Int. J. Syst. Bacteriol. 48:23-29) and obtainable from public collections (DSMZ-Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Mascheroder Weg 1 b, 38124 Braunschweig, German, DSM No. 10394; American Type Culture Collection, 10801 University Boulevard, Manassas, Va. 20110, USA, ATCC 700653).
The organism may be cultivated in a manner known per se. A ready-made medium produced by Messrs Becton Dickinson (Bacto Marine Broth 2216) may be used. The medium may be made up in accordance with the manufacturer's instructions and the DSMZ (media 514 and 760); the addition of sulphur may be omitted, with a slight loss of yield. The medium may be made anaerobic by treatment with N2 gas; this can be checked by adding resazurin (1 mg/l final concentration). In order to cultivate larger volumes of culture, for example, preliminary cultures may be used to begin with. For these, 2 ml of the starting culture obtained from the DSMZ (DSM 10394) may be inoculated onto 20 ml of medium under anaerobic conditions. The incubation may take place overnight at 85° C. without shaking in culture flasks with an airtight seal. To start up the main cultures 20 ml of the preliminary culture may be anaerobically inoculated onto 500 ml of fresh medium and incubated under the same conditions as the preliminary cultures.
The harvesting of the cultures may be done by transferring the cultures into anaerobic centrifuge cups and then centrifuging the samples for 15 min at 4° C. and 4000×g. The cell pellet thus obtained can then be used for the preparation of the genomic DNA by current methods.
The purified genomic DNA can be subject to a PCR reaction for example with the primers SEQ ID NO. 3, ATGATCCTCGATGCCGACTAC (Tpac3′) and SEQ ID NO. 4, TCATGTCTTAGGTTTTAGCCACGC (Tpac5′), in which the SEQ ID NO. 1 is amplified. The amplification product can then be purified by standard methods, e.g. with the QIAquick PCR Purification Kit or QIAquick gel Extraction Kit (QIAGEN GmbH, Hilden, Germany).
Another method of producing a DNA molecule of the present invention consists in chemically synthesising such a DNA molecule. To do this, for example, suitable oligonucleotides are first prepared by methods known per se for synthesising oligonucleotides (e.g. Gait, M. J., 1984, Oligonucleotide Synthesis. A Practical Approach. IRL Press, Oxford, UK), from which a synthetic gene can be prepared by various methods. Such methods are known in the art (e.g. Stemmer et al. 1995, Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides, Gene 164(1): 49-53; Ye et al. 1992, Gene synthesis and expression in E. coli for pump, a human matrix metalloproteinase, Biochem Biophys Res Commun 186(1):143-9; Hayden et Mandecki 1988, Gene synthesis by serial cloning of oligonucleotides, DNA 7(8): 571-7). In this way for example a DNA molecule with the sequence SEQ ID NO: 1 may be prepared by methods known per se.
It is within the capabilities of the average man skilled in the art to prepare DNA molecules which are variants of a DNA molecule with the SEQ ID NO: 1 and similarly code for a thermostable DNA polymerase with essentially unaltered properties. Such variants differ from DNA molecules of SEQ ID NO: 1 in that one, two, three, four, five, six, seven, eight, nine, ten or more nucleotides are deleted or substituted by nucleotides with other bases, or additional nucleotides are inserted or added. By routine experiments the skilled man can determine whether such a modification has a significant influence on the properties of the polypeptide coded by a DNA molecule of this kind. He has no difficulty finding, by routine experiments, a large number of such variants which code for a thermostable DNA polymerase with essentially unaltered properties. Such variants are therefore expressly included in the invention.
Thus, the skilled man can in particular produce variants which are degenerate compared with a DNA molecule with the sequence SEQ ID NO: 1 in terms of the genetic code, i.e. DNA molecules with a nucleotide sequence other than SEQ ID NO: 1, but which code for the same amino acid sequence. This may be useful, when a DNA molecule of this kind is expressed in a host cell, for optimising the codons with regard to the codons of the host cell in question which are preferably used. The skilled man will be aware of such processes.
It is also within the capabilities of the average person skilled in the art to delete smaller or larger sequence fragments, leading during expression to polypeptides with corresponding deletions in the amino acid sequence. Using computer methods known per se based on comparing a sequence, in this case SEQ ID NO: 1, with the sequences of other, well characterised proteins, the skilled man can determine which sequence fragments (domains) are responsible for the enzymatic activities, polymerase or exonuclease activity. Outside these domains in particular deletions (and of course substitutions as well) are possible, which have no major effect on the enzymatic activity. It is easy to tell whether a particular deletion in this sense has no effects.
It is also possible to modify the DNA molecule so that the DNA polymerase according to the invention takes the form of a fusion protein with additional amino acid sequences. Thus for example an affinity marker in the form of a short peptide sequence may be attached to the C-terminus, for example a histidine hexamer which makes it easier to purify the protein (see below).
The skilled man may also deliberately switch off one of the two enzymatic activities by mutation, for example by substitution or deletion of one or more amino acids, or by deletion of an entire sequence fragment in the corresponding domain up to deletion of the entire domain. Thus, for example, the skilled man may prepare a DNA molecule which codes for a polypeptide which has a polymerase, but not an exonuclease activity. This may be advantageous if a polypeptide of this kind is to be used for example in DNA sequencing.
In one particular embodiment, the DNA molecule according to the invention codes for a polypeptide which has both 5′-3′-DNA polymerase and 3′-5′-exonuclease activity.
In another aspect the present invention relates to a vector which contains a DNA molecule according to the invention, particularly an expression vector. Preferably an expression vector of this kind has the following features:
In an expression vector of this kind the DNA molecule according to the invention is operatively connected with these features, with the result that the expression vector allows expression of the thermostable DNA polymerase according to the invention in a host cell. Expression vectors which are suitable for such purposes are known in large numbers in the prior art, as are methods of introducing the DNA molecule according to the invention into such a vector, introducing the vector into host cells, cultivating the host cells and isolating the polypeptide formed (cf. e.g. Sambrook et al., Molecular Cloning, 2nd Ed., Cold Spring Harbour 1989, particularly Chapter 17). Suitable expression vectors are for example the pQE vectors which may be obtained commercially from Messrs Qiagen GmbH, 40724 Hilden, Germany. These vectors enable an affinity marker, for example a histidine hexamer, to be incorporated at the same time into the polypeptide formed, by means of which the polypeptide can be purified easily and effectively. (Crowe et al., 1994, 6xHis-Ni-NTA chromatography as a superior technique in recombinant protein expression/purification, Methods Mol Biol. 31:371-87; Stüber et al. 1990, System for high-level production in Escherichia coli and rapid purification of recombinant proteins, Immunol. Methods 4:121).
Accordingly, in another aspect, the present invention relates to a host cell which contains such a vector. Preferably, the host cell is Escherichia coli.
In another aspect the present invention relates to a process for preparing the DNA polymerase according to the invention, characterised in that (a) host cells as described above are cultivated in a suitable medium; and (b) the polypeptide formed is isolated from the medium or from the host cells.
In another aspect the present invention relates to a polypeptide which can be prepared by expression of a DNA molecule according to the invention. In particular this is a polypeptide with a 5′-3′-DNA polymerase activity, preferably additionally with a 3′-5′-exonuclease activity.
The present invention also relates to a polypeptide which has a DNA polymerase activity, preferably a 5′-3′-DNA polymerase activity, and contains a sequence which constitutes a cohesive fragment of at least 100 amino acids, preferably at least 200 amino acids of the sequence SEQ ID NO: 2. A particularly preferred polypeptide is one with the sequence SEQ ID NO: 2 or a polypeptide which contains the sequence SEQ ID NO: 2.
The thermostable DNA polymerase according to the invention may advantageously be used for the polymerisation of nucleic acid, particularly by polymerase chain reaction (PCR). It is highly thermostable, efficient and as a result of its proofreading activity has only a very small error content. Methods of polymerising nucleic acid by matrix-dependent polymerisation of nucleotides using DNA polymerases as catalysts, particularly polymerase chain reaction, are known in the art (cf. e.g. Sambrook et al., Molecular Cloning, 2nd Ed., Cold Spring Harbour 1989, particularly Chapter 14).
In another aspect the present invention relates to a kit for use in the polymerisation of nucleic acid, containing in separate containers
Optionally a kit of this kind may additionally contain dATP, dGTP, dCTP, and dTTP, either as a mixture or in individual containers.
FIG. 1: Heat stability of Thermococcus pacificus DNA polymerase. Cf. Example 6. M: marker; −: empty trace; 0-90: preincubation of the polymerase for 0, 5, 10 etc. minutes at 95° C.; A, B: M13 DNA single strand controls with no added polymerase.
FIG. 2: Detecting the 3′-5′ exonuclease activity of Thermococcus pacificus DNA polymerase. Cf. Example 7. Tpac: Thermococcus pacificus polymerase; Pfu: Pyrococcus furiosus polymerase; exo− Pfu: Pyrococcus furiosus polymerase the 3′-5′ exonuclease of which is mutated so that there is no detectable exonuclease activity; +: addition of dNTPs; −: reaction mixture without dNTPs; 5, 10 . . . : incubation period in minutes.
FIG. 3: Detection of the proofreading ability of Thermococcus pacificus DNA polymerase under PCR conditions. Cf. Example 8. Tpac: Thermococcus pacificus polymerase; Pfu: Pyrococcus furiosus polymerase; exo− Pfu: Pyrococcus furiosus polymerase, the 3′-5′ exonuclease of which is mutated so that there is no detectable exonuclease activity; A, B: characterise 2 independent PCR reactions; M: marker; +: digestion with BamHI takes place; −: undigested PCR fragment.
The organism DSM No. 10394 was cultivated using a ready-made medium made by Messrs Becton Dickinson (Bacto Marine Broth 2216). The medium was prepared in accordance with the manufacturer's instructions and according to the DSMZ (Media 514 and 760) without the use of sulphur. The medium was made anaerobic by the use of N2; this could be checked by the addition of resazurin (1 mg/l final concentration).
First, preliminary cultures were prepared. For this, 2 ml of the starting culture obtained from the DSMZ (DSM 10394) were inoculated onto 20 ml medium under anaerobic conditions. The culture was incubated overnight at 85° C. without agitation in culture flasks with an airtight seal. To start up the main cultures 20 ml of the preliminary culture were anaerobically inoculated onto 500 ml of fresh medium and incubated under the same conditions as the preliminary cultures.
The cultures were harvested by transferring them into anaerobic centrifuge cups and then centrifuging the samples for 15 min at 4° C. and 4000×g. The cell pellet thus obtained was then used for the preparation of the genomic DNA using a commercially obtainable purification kit (Qiagen Genomic-tip System, Qiagen GmbH, Hilden, Germany) in accordance with the manufacturer's instructions.
The expression vector was prepared by generally known molecular-biological methods. The polymerase gene was isolated from the genomic DNA of the organism Thermococcus pacificus by polymerase chain reaction (PCR). The primers used for this contained, in addition to the sequences homologous to the polymerase gene, a non-complementary nucleic acid sequence which coded for a restriction cutting site, so that by restricting the amplified material and the expression vector the amplified material can be cloned into the expression vector. Oligonucleotides were obtained from Life Technologies GmbH, Karlsruhe, Germany. Other reagents for carrying out the polymerase chain reaction such as Taq DNA polymerase were obtained from QIAGEN GmbH, Hilden, Germany. The coding polymerase gene sequence SEQ ID NO: 1 was amplified using 2.5 units Taq DNA polymerase or the proofreading DNA polymerase Pfu DNA polymerase (Stratagene, Heidelberg, Germany). Also added to the reaction were oligonucleotides (0.2-1.0 μM) as primer, 200 μM of each dNTP and 1× reaction buffer of the corresponding polymerase. A 3-step PCR programme consisting of a denaturing step for melting the starting nucleic acid at about 94° C., a step of annealing of the oligonucleotides to their complementary DNA sequence at about 50-68° C. and an extension step at about 72° C. for amplification was carried out. Depending on the amount of starting nucleic acid, 30 to 40 amplification cycles were carried out. After the PCR reaction the reaction product was examined on an agarose gel by comparison with a suitable DNA size marker to determine its specific length. PCR products of the expected size were either purified directly from the gel or from the PCR reaction. Commercially obtainable systems were used for this (QIAquick PCR Purification Kit or QIAquick gel Purification Kit, QIAGEN GmbH, Hilden, Germany). Purified PCR product and vector-DNA were cut with the corresponding restriction enzymes and the reaction products were again purified as described above. The vector-DNA used was the plasmid pQE80 (QIAGEN GmbH, Hilden), which after the insertion of the target gene is able to express a fusion protein from a so-called His tag and the target protein. In the subsequent ligation reaction equimolar amounts of vector-DNA and PCR product were used and ligated using T4-ligase (Life Technologies GmbH, Karlsruhe, Germany), the corresponding reaction buffer and ATP overnight in a final volume of 20 μl at about 16° C.
1 to 2 μl of the ligation reaction were transformed into calcium-competent DH5α-bacterial cells which optionally additionally contained the plasmid pRep4 (QIAGEN GmbH, Hilden). Some of the transformation reaction was then plated out on an agar plate which contained the antibiotic ampicillin and kanamycin or ampicillin on its own as selection marker. The plates were incubated overnight for about 15 to 18 hours at 37° C. Then colonies of bacteria were picked up using sterile toothpicks or pipette tips, transferred into about 3 ml of LB-medium with the appropriate antibiotic and incubated overnight at 37° C. Plasmids were isolated the next day according to the manufacturer's instructions with commercially obtainable kits such as the QIAprep Mini Kit or the QIAGEN Plasmid Tips (QIAGEN GmbH, Hilden, Germany). Plasmids were then checked using suitable restriction enzymes and sequencing to see whether they contained the polymerase gene.
A construct which contained the error-free nucleic acid sequence of the DNA polymerase was transformed into DH5α/pRep4 competent cells. Cells were cultivated in the presence of ampicillin and kanamycin in NZ-amine medium and the expression of the polymerase gene was induced by the addition of IPTG. After the bacterial cells had been harvested, they were lysed using lysozyme, ultrasound and brief decoction. The polymerase protein with a His tag was selectively purified using a commercially obtainable purification kit (QIAexpress protein Purification System, QIAGEN GmbH, Hilden, Germany) according to the manufacturer's instructions by metal affinity chromatography with nickel-NTA-agarose. The protein eluted with imidazole was dialysed against a storage buffer which consisted of 20 mM TrisHCl (pH 8 at 20° C.), 100 mM KCl, 1 mM EDTA, 0.5% (v/v) Nonidet P-40 substitute, 0.5% (v/v) Tween 20 and 50% (v/v) glycerol. The polymerase was stored in this buffer at −20° C.
To demonstrate that the cloned nucleic acid sequence codes for a DNA polymerase, a test was carried out to check for DNA polymerase activity. The assay shows the extension of an oligonucleotide which is hybridised to single-stranded M13-DNA. If the primer is extended, which can only be done if the protein preparation added has a DNA polymerase activity, a double-stranded DNA molecule is formed from the single-stranded starting nucleic acid. The activity is then detected on an agarose gel by means of a difference in migration of the double-stranded DNA compared with the single-stranded starting DNA. The extension rate is dependent on the polymerase used. The quantity of end product of double-stranded DNA is dependent on the amount of DNA polymerase, the polymerase-specific extension rate and the time taken to carry out the reaction.
All the polymerisation reactions contained 50 ng of M13 mp18-DNA (20 fmol; 7250 bases), 0.1 μM 30-mer oligonucleotide of the sequence 5′-TTTCCCAGTCACGACGTTGTAAAACGACGG-3′ (SEQ ID NO: 5) and 50 μM of each dNTP in 10 μl of 10 mM TrisHCl. Polymerisation reactions contained different amounts of Taq DNA polymerase (0.2, 0.1, 0.05 and 0.01 units; QIAGEN GmbH, Hilden, Germany) or the polymerase preparation to be tested in various dilutions. The reaction was carried out for both enzymes in 1× reaction buffer of Taq DNA polymerase (QIAGEN GmbH, Hilden), to which 1 μg/ml BSA was added, in order to saturate any non-specific protein binding sites on the surface of the reaction vessel.
The polymerisation reaction was carried out in a model PTC-200 Thermocycler made by MJ Research (Biozym, Hess. Oldendorf, Germany). The reaction conditions were chosen as follows: 1 sec denaturing to dissolve any secondary structures present in the DNA, 30 sec hybridisation of the oligonucleotide at 55° C., followed by the primer extension at 72° C. for 3 min.
After the reactions had ended the reaction products were mixed with 1 μl of gel loading buffer (50% glycerol, 1× TAE buffer, 0.02 mg/ml bromophenol blue) and applied to a 1% agarose gel which contained 0.5 μg/ml ethidium bromide to stain the DNA. The gel was analysed at 80 mA for about 15 min in 1× TAE buffer, to separate the single-stranded and double-stranded DNA. The results show that the protein preparation obtained after the expression of the SEQ ID NO:1 has a DNA-dependent DNA polymerase activity.
The heat stability of the polymerase was examined using the primer extension test described in Example 6. For this purpose, as a modification of the assay described above, 1 unit of the polymerase preparation was preincubated for different lengths of time at 95° C. (0 min, 5 min, 10 min, 15 min, 30 min, 60 min and 90 min). Then the assay was carried out as described in Example 5 with these differently pretreated polymerase preparations. In a modification of the assays described in Example 5 the buffer of Pfu DNA polymerase (Stratagene, Heidelberg) was used as the 1× reaction buffer. The results are shown in FIG. 1. Two control reactions which contained no DNA polymerase were also carried out. The results clearly show that the polymerase shows absolutely no loss of activity even after 90 min incubation, i.e. it has extremely high heat stability (as a comparison: Taq DNA polymerase loses about 50% of the polymerase activity after 60 min incubation at 94° C.).
The test described as follows was intended to examine to what extent the Thermococcus pacificus DNA polymerase has a 3′-5′ exonuclease activity. The error rate with which a DNA polymerase duplicates the parent DNA during the replication of the chromosomal DNA is dependent on a number of factors: on the one hand, the choice of base complementary to the starting nucleic acid is crucial, as well as the extent to which a wrongly incorporated nucleotide can have another nucleotide of the polymerase attached to it, and how much 3′-5′ exonuclease activity the polymerase has. Using this exonuclease activity, wrongly incorporated nucleotides can be hydrolytically cleaved, so that a nucleotide incorporated by mistake can be replaced by the correct complementary nucleotide. This enzyme activity is also known as the proofreading ability of a polymerase.
The 3′-5′ exonuclease activity is detected by means of the hydrolytic breakdown of a DNA. For this purpose the following substances were mixed together: 1 μg DNA size marker VI (Roche Biochemicals), optionally 200 μM of each dNTP, 1× Pfu DNA polymerase reaction buffer (Stratagene, Heidelberg) and 1 unit of Thermococcus pacificus DNA polymerase. Reactions were set up with and without nucleotides: in the absence of nucleotides the exonuclease activity is predominant, whereas it is inhibited by the addition of dNTPs. As a positive control, 1 unit of Pfu DNA polymerase was used (Stratagene, Heidelberg), having a 3′-5′ exonuclease activity, while the negative control used was Pfu Exo minus DNA polymerase (Stratagene, Heidelberg), the exonuclease activity of which is sharply reduced by point mutagenesis. The reactions were incubated for different periods (5 min, 10 min, 30 min, 60 min and 90 min) at 72° C. and then analysed on a 1% agarose gel. The results shown in FIG. 2 clearly demonstrate that the Thermococcus pacificus DNA polymerase has a 3′-5′ exonuclease activity many times greater than that of Pfu DNA polymerase.
Extremely thermostable DNA polymerases with proofreading ability are used in particular in PCR reactions which are intended for the preparation of mutation-free DNA fragments. This is particularly important for certain molecular-biological applications such as the cloning of error-free PCR fragments for protein expression. DNA polymerases which have a 3′-5′ exonuclease activity synthesise PCR products with an error rate up to 12 times lower than Taq DNA polymerase, the standard enzyme for PCR applications.
In the present test the ability of Thermococcus pacificus DNA polymerase to correct errors under PCR conditions in a mismatch repair assay was tested. This assay was developed specially for this purpose (U.S. Pat. No. 5,491,086) and comprises an amplification step and a diagnostic restriction digestion. For the PCR reaction either primers (wild-type primers) are used which are totally homologous to the target DNA sequence (Taq DNA polymerase genes) and the 151 bp long PCR product of which can be cleaved by the BamHI restriction enzyme, thereby generating a DNA fragment 132 bp and 19 bp in size. Parallel to this, reactions were carried out, the primer molecules of which have a base mismatch at the 3′ end. If the incorrect base is not corrected during the PCR, the BamHI cutting site is destroyed and the PCR product cannot be cleaved in a restriction digestion with the enzyme BamHI. If on the other hand the polymerase is capable of recognising wrongly paired bases and hydrolytically removing them, the correct complementary base can be incorporated and the PCR product yields the two expected DNA fragments after restriction digestion. The wild-type primers used have the sequences: 5′-GCACCCCGCTTGGGCAGAG-3′ (SEQ ID NO: 6) and 5′-TCCCGCCCCTCCTGGAAGAC-3′ (SEQ ID NO: 7). Alternatively, primers were used the 3′ ends of which had a C:A, C:T or C:C mismatch. PCR reactions were carried out with the Thermococcus pacificus DNA polymerase, Pfu DNA polymerase (Stratagene, Heidelberg, Germany), which has a mismatch correction, and Pfu Exo minus DNA polymerase (Stratagene, Heidelberg, Germany), which cannot perform this error correction. PCR reactions contained 20 ng of plasmid pQE-31 (Qiagen GmbH, Hilden, Germany), which contained the Taq DNA polymerase gene target sequence, 1 unit of the appropriate DNA polymerase, 1× Pfu reaction buffer, 200 μM of each dNTP and 1.5 μM of each primer. The final volume of the reaction was 50 μl. The PCR reactions were carried out in an MJ Research PTC-200 Thermocycler (Biozym, Hess. Oldendorf, Germany). The PCR programme comprised an initial 1 min denaturing step at 94° C., a 30 sec denaturing step at 94° C., a hybridisation step at 62° C. and an extension step at 72° C. for 1 min. PCR products were purified with the QIAquick PCR Purification Kit (QIAGEN GmbH, Hilden, Germany). Identical amounts of PCR product were digested per 100 ng of PCR product with one unit of BamHI for 90 min at 37° C. Then the PCR products thus treated were analysed on a 4% Metaphor Agarose gel (Biozym, Hess. Oldendorf, Germany). The results are shown in FIG. 3. The results show that, as expected, the Pfu Exo minus DNA polymerase is unable to repair the mismatch, i.e. the PCR product produced with mutated primers cannot be cleaved by the restriction enzyme BamHI. By contrast the non-mutated Pfu DNA polymerase is capable of correcting the base mismatch. The Thermococcus pacificus DNA polymerase is capable on the one hand of synthesising the desired PCR product under PCR conditions, and can also recognise mismatched bases under PCR conditions, remove them hydrolytically and replace them with the correct complementary nucleotide. Thus, it is clear that Thermococcus pacificus DNA polymerase is suitable for carrying out so-called High Fidelity PCR reactions.
1. An isolated polypeptide having 5′-3′-DNA polymerase activity, which polypeptide is encoded by a DNA molecule, wherein said DNA molecule is
the sequence of SEQ ID NO: 1,
wherein said polypeptide further exhibits 3′-5′ exonuclease activity.
2. A kit for use in the polymerization of nucleic acid, said kit comprising:
(a) a polypeptide according to claim 1; and
(b) a reaction buffer for the polymerization reaction; and optionally
(c) dATP, dGTP, dCTP, and dTTP, either as a mixture or in individual containers.