-
2007-03-20
10/404,724
2003-03-31
US 7,192,737 B2
2007-03-20
-
-
James Ketter
2024-12-10
The present invention provides novel methods and materials for increasing the expression of recombinant polypeptides. Methods and materials of the invention allow increased expression of transcription units that include recombinant DNA sequences which encode polypeptides of interest. The present invention provides expression vectors which contain multiple copies of a transcription unit encoding a polypeptide of interest separated by at least one selective marker gene and methods for sequentially transforming or transfecting host cells with expression vectors to increase transcription unit dosage and expression.
Get notified when new applications in this technology area are published.
C12P21/02 IPC
Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
This application claims the priority of U.S. Provisional Application No. 60/368,530 filed Mar. 29, 2002, the disclosure of which is incorporated by reference herein in its entirety.
Recombinant polypeptide compositions are increasingly being used in a wide variety treatments or therapies across the health-related fields. Recombinant polypeptides are being used in diagnostic procedures, as tools in preventative medicine, and to directly save lives through administrative therapies. In addition, recombinant polypeptides are found in a wide array of both health and cosmetic products, used to increase the quality of life. Complex polypeptide products are also routinely used in research laboratories both as end-products of analyses themselves and as agents in assays for the study or preparation of other molecules. Such uses often lead to the discovery of the causes of disease and an understanding of the underlying disease mechanism(s), furthering development toward diagnoses and/or viable treatments. Recombinant polypeptide products also play a vital role in a variety of industrial settings, in areas ranging from farming to the processing of food materials and the raising of livestock to the catalytic degradation of both natural and synthetic by-products and waste materials.
The production of polypeptides for preclinical and clinical evaluation often requires multigram quantities [Kelley, Bio/Technology 14: 28–31 (1996)]. Industrial applications using such polypeptides generally require even greater quantities and the costs of production are often prohibitive. While there are a variety of ways to chemically synthesize simple polypeptides when the amino acid sequence is known, this method of production has problems with respect to larger polypeptides, e.g., uncertain deviations from native conformational folding, an absence of intracellular post-translational modification, and reduced or limited bioactivity. For these and other reasons, recombinant DNA technology is the most common production method of choice and offers the greatest potential for large-scale production at high efficiency and reasonable cost. Accordingly, the production of useful quantities of these important polypeptides is typically generated through standard recombinant DNA technology, especially where the polypeptide of interest is ultimately modified or where it only occurs naturally in very small amounts.
Current recombinant DNA techniques used for expressing polypeptides can exhibit numerous limitations, including, for example, significant production costs for materials and reagents and low product yield. In addition, production can be time consuming and can require substantial monitoring with limited control. These, as well as other problems and limitations involved in production of recombinant polypeptides, along with inefficiencies in the current methods for producing recombinant polypeptides, ultimately can result in a significant toll in costs, resources, health, and life itself. Thus, given the fundamental role and countless uses for recombinant polypeptides and the limitations current methods for recombinant polypeptide production, it is of primary importance to employ a method of recombinant gene expression that maximizes protein production and, ultimately, saves time, money and other resources. Accordingly, there exists a need for methods that can increase, maximize and/or optimize the production of recombinant polypeptides.
Several factors can influence recombinant expression in mammalian cells, including promoter strength, the context of the translation initiation region, the efficiency of the 3′ untranslated region to polyadenylate and terminate transcription, the insertion site of the randomly integrated recombinant gene in the host chromosome, and the number of integrated copies of the gene that is being expressed. Of these factors, the choice of promoter and 3′ untranslated regions can significantly impact expression levels. Viral promoters are often used because they are thought to promote high expression levels. The optimal translation initiation sequence, ACCATGG, also known as the Kozak box, can promote more efficient polypeptide synthesis and, therefore, higher expression levels.
One strategy employed for increasing expression of polypeptides uses expression vectors containing multiple integrated copies of a desired gene. Improvements in recombinant polypeptide expression in mammalian cells can be achieved in this manner by effectively increasing the gene dosage in a transfected host cell. Increases in gene copy number are most commonly achieved by gene amplification using cell lines deficient in an enzyme such as dihydrofolate reductase (DHFR) or glutamine synthetase (GS) in conjunction with expression vectors containing genes encoding these enzymes and agents such as methotrexate (MTX), which inhibits DHFR, and methionine sulfoxamine (MSX), which inhibits GS. Using expression vectors containing the recombinant gene under control of a strong promoter and genes encoding DHFR or GS, DHFR+ or GS+ transfectants, respectively, are first obtained and gene amplification is then achieved by growing the transfectants in progressively increasing concentrations of MTX or MSX.
While gene amplification can result in higher levels of expression, it has several drawbacks. First, cell lines that have mutations in the genes encoding the selective enzymes are generally used for gene amplification. In the case of DHFR, both chromosomal copies need to be mutated and, consequently, these cell lines can be less robust than wildtype cells. This can ultimately lead to cells which secrete lower net amounts of the protein of interest as compared to more robust cells that thrive and are stable. In the case of GS, the lymphoid cell line NSO is naturally GS−, but CHO-K1, another commonly-used cell line, is GS+ and requires selection directly for MSX-resistant transfectants. A second problem with current methods of gene amplification is that the amplification can result in cell lines that are unstable in the absence of selective pressure, thus requiring the maintenance of selective pressure. Finally, current methods for gene amplification can be exceedingly time-consuming and can require up to several months to complete with a proportional allocation of both resources and costs. Another strategy for increasing expression of polypeptides uses sequential transfections with expression vectors, each containing single copies of a desired gene but with different selective marker genes such as gpt, neo and his. Gene copy number for the first transfection is one, from the second transfection, two and so on. While this approach can achieve higher levels of expression, it has drawbacks in that the number of gene copies increases only modestly even after three sequential transfections.
Therefore, in view of all these problems, novel ways to increase gene expression through increased gene copy number by methods that do not depend on the use of mutant cell lines and current methods for gene amplification would be highly desirable.
For all the foregoing reasons, there is a need in the art for improved methods of expressing polypeptides of interest at increased net concentrations from stable cell lines, while maximizing efficiency and minimizing expenditure of time, resources, and costs in production. Furthermore, there is a need for expression vectors and stable cell lines harboring and/or integrating into their chromosomes such vectors that are capable of efficiently producing secreting high concentrations of valuable and useful polypeptide products.
The present invention provides novel methods and materials for increasing the expression of recombinant polypeptides. In one aspect, the present invention is directed to novel methods for efficiently increasing the expression of recombinant polypeptides from host cells, thus satisfying the need for producing increased concentrations of valuable proteins and polypeptides of interest. The benefits of such methods can include minimizing time, resources and/or costs of production. In another aspect, the present invention is directed to novel vectors comprising multiple copies of a recombinant DNA sequence encoding, for example, a recombinant polypeptide of interest, separated by at least one selective marker gene and cell lines harboring such vector constructs, thus satisfying the need for vectors and host cells, including stable cell lines, which are capable of efficiently producing increased concentrations of valuable and/or useful polypeptide products.
According to the present invention, the number of transcription units, i.e., recombinant DNA sequences which encode a recombinant polypeptide of interest, introduced into a host cell is increased so that there are more copies of the transcription unit to express. This is achieved by incorporating at least two copies of the transcription unit on the same vector. In certain embodiments, each transcription unit copy is placed under control of its own promoter and 3′ untranslated region. Increasing transcription unit dosage and expression is achieved by transfection with such a vector. Performing additional transformations or transfections with additional vectors, for example, a second and then third sequential transformation or transfection with such vectors, each containing at least two transcription unit copies can yield further increases in transcription unit dosage and expression relative to a vector with only a single transcription unit copy. Preferably, each additional vector for each sequential transformation or transfection contains a different selective marker gene.
While integration into a host cell chromosome of a linear DNA sequence containing two transcription unit copies on the same vector can increase gene dosage and therefore expression, it could also lead to instability due to homologous recombination. According to the present invention, such potential instability, especially during the early stages of cell line development, is overcome by the design of the vector so that a gene encoding a selective marker is positioned between at least two identical or similar transcription units encoding a recombinant polypeptide of interest. Preferably, the vector is linearized (e.g. via a unique restriction enzyme site prior to transfection or transformation such that the selective marker gene is positioned between at least two and no more than 8 transcription unit copies, each transcription unit encoding recombinant polypeptide(s) of interest. For example, the vector comprises as [(transcription unit)x-selective marker gene-(transcription unit)x], wherein x=1–4. Using such a vector, any homologous recombination between, for example, two identical or similar transcription unit DNA sequences would then potentially delete or inactivate the gene encoding resistance to the selective agent. Thus, cells transfected or transformed with such a vector and that underwent homologous recombination would not be able to grow in the presence of the selective agent. Application of at least some selective pressure should promote maintenance of transcription unit copies from such novel vectors.
One aspect of the invention involves the design, construction and use of vectors, preferably mammalian expression vectors containing at least two copies of a transcription unit encoding a recombinant polypeptide of interest to be expressed, each under control of a promoter and a 3′ untranslated region and positioned so that, when the vector is linearized by digestion at a unique restriction enzyme site, at least two transcription unit copies are separated by a selective marker gene in the linear sequence. According to this aspect of the invention, the design or configuration includes positioning the selective marker gene between at least two transcription units for example, [(transcription unit)—selective marker gene—(transcription unit)], which will in turn stabilize the linear vector DNA with that position of the selective marker gene between transcription units integrated into a host cell chromosome. In contrast, homologous recombination between at least two copies of the transcription unit can lead to the loss of at least one of the transcription units and the selective marker gene. As an additional benefit, this aspect of the present invention can yield a vector that has multiple enhancers. As an example, the multiple enhancers can include several from promoters controlling transcription unit expression and one from a promoter controlling the selective marker gene(s). Because enhancers are known to act bi-directionally and also at a distance, this vector design or configuration can lead to increased transcription and consequently increased net concentrations of the polypeptide of interest.
Another aspect of the invention also provides for the use of vectors containing two or more transcription units (preferably between two and no more than eight) with various selective marker genes, including, for example, gpt, neo or his, for selection of mammalian cell transfectants. By use of these additional selective marker genes, transfectants can be obtained with multiple copies of a transcription unit and further increased by performing a number of sequential transfections with vectors according to the invention.
In addition to selective marker genes such as gpt, neo and his for selection of transfectants, the vector configuration as described herein can be used in conjunction with genes encoding amplifiable selective marker genes such as DHFR or GS. Amplification of such vectors may yield transfectants with vector DNA integrated into a host cell chromosome so that transcription units are separated by the DHFR or GS marker gene.
The present invention provides multiple transcription unit vectors, including, those containing for example, two, three, four, five, six, seven and eight and so on, copies of a transcription unit with DNA sequences encoding a recombinant polypeptide of interest. Preferably, there are at least two and no more than eight transcription units. Such vectors are constructed with at least one selective marker gene positioned between or separating the transcription units in a manner that allows the stable integration into a host cell chromosome and reduction, avoidance or nullification of homologous recombination. Vectors comprising multiple copies of a transcription unit each separated by a selective marker gene, wherein the transcription unit encodes a polypeptides are provided by the invention. All such permutations of multiple transcription unit copies are contemplated by this invention as one skilled in the art would recognize from the disclosure herein.
An aspect of the present invention includes vectors containing transcription units which encode subunits of dimeric or higher order multimeric proteins. According to the invention, transcription units encoding different subunits of a multimeric protein, each under control of a promoter and a 3′ untranslated region, are separated by a selective marker gene. For multimeric proteins encoded by at least two distinct genes (for instance, immunoglobulin light and heavy chains or at least the variable regions of immunoglobulin light and heavy chains), transcription units encoding the desired subunits are first linked with or without an internal ribosome entry site (IRES) and this bi (or poly) transcription unit can be placed under the control of a promoter and a 3′ untranslated region. These transcription units then can be combined to construct vectors with at least two copies of a bi-cistronic unit separated by a selective marker gene. For example, vectors comprise [(transcription unit-IRES-transcription unit)-selective marker gene-(transcription unit-IRES-transcription unit)]. Also, for example, vectors can comprise [(transcription unit-transcription unit)-selective marker-(transcription unit-transcription unit)]. In certain embodiments, each transcription unit copy is placed under control of its own promoter (P) and 3′ untranslated region (3′ UT). For example, vectors can comprise [(P-transcription unit-3′ UT)-(CP-transcription unit-3′ UT)-selective marker gene-(P-transcription unit-3′ UT)-(CP-transcription unit-3′ UT)].
The present invention provides methods of producing a recombinant polypeptide and/or of increasing the expression of a transcription unit comprising the following steps:
The present invention provides methods for constructing vectors or segments thereof comprising building an expression vector or cloning vector with multiple copies of a transcription unit separated by at least one selective marker gene. According to the invention, the number of multiple copies of the transcription unit is at least two. Preferably, the number of multiple copies of the transcription unit on a single vector is less than or equal to eight.
The present invention provides vectors comprising multiple copies of a transcription unit encoding recombinant mammalian polypeptides of interest separated by at least one selective marker gene. According to the invention, the number of multiple copies of the transcription unit on the vector or transformed/transfected into host cells is at least two. Preferably, the number of multiple copies of the transcription unit is equal to or less than eight. Multiple vectors can be used and multiple transformations or transfections can be carried out to produce clones and cell lines expressing the polypeptide of interest. Exemplary vectors are described herein containing a transcriptional unit encoding a BPI protein product, for example, a BPI fragment, BPI analog, BPI variant or BPI-derived peptide. An exemplary expression vector described herein contains a transcriptional unit encoding rBPI21. The present invention further provides vectors containing transcription units encoding different subunits of a multimeric protein, including vectors containing transcription units encoding antibody light and heavy chains, or at least the variable regions of light and heavy chains.
According to the present invention, vectors contain selective marker genes which can vary, but may include a gpt, neo or his gene. A vector according to the present invention can also include multiple copies of a transcription unit in a direct repeat orientation and/or in an inverted repeat orientation. Additionally, the present invention provides a vector containing multiple copies of transcription units that are identical or similar. Such copies can be homologous copies, for example, at least 25% homologous. Accordingly, the copies can be identical or similar by any percentage between 25% and 100% homologous, preferably identical or similar by at least 80%, including 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%.
The present invention further embodies all variations of vectors or segments thereof within the scope and spirit of this disclosure or as may be understood or contemplated by one skilled in the art through this disclosure and/or the art.
The present invention provides host cells comprising vectors or segments thereof, [(transcription unit)x-selective marker gene-(transcription unit)x], wherein x=1–4 as disclosed herein. According to the invention, host cells include any or all eukaryotic host cell types. By way of example, eukaryotic host cell types may include any mammalian cell, for example, the Chinese hamster ovary (CHO) cell line, the DHFR+CHO-K1 cell line, the DHFR−DUKX-B11 (DXB11) cell line or DG-44 cell line. Eukaryotic host cell types may also include plant, insect, and yeast cells. In addition, the present invention provides any stable cell line comprising vectors or segments thereof within the scope and spirit of this disclosure or as may be understood or contemplated by one skilled in the art through this disclosure and/or the art. Such cells may be propagated by any means, and may include cells in an attached or suspension state with any growth or support medium or sustaining solution.
In view of all the current problems and limitations in the art, including those discussed hereinabove, there are many advantages of the present invention over the art, including increased recombinant polypeptide production, increased production efficiency, greater control and/or regulation over the quantities of polypeptide expressed, increased stability of cell lines, and/or decreased costs for materials, reagents, and/or other resources. For example, the present invention provides methods of vector construction that, when such vectors are linearized, minimize or avoid homologous recombination of multiple copies of transcription units by separating transcription units containing DNA sequences encoding polypeptides of interest with at least one selective marker gene. As another example, the present invention provides methods to further increase expression through sequential transfections with multiple-transcription unit constructs. This leads to clones and/or cell lines which can produce substantially increased levels of polypeptides of interest, while still maintaining viability and stability in growth medium.
While various modifications may be suggested by those versed in the art, it should be understood that this invention contemplates all embodiments within the scope of the patent warranted hereon and all such modifications as reasonably and properly come within the scope of this contribution to the art.
These and other features, aspects, and advantages of the present invention will become better understood with reference to the following description, appended claims, and accompanying drawings where:
FIG. 1 depicts a construction map for vector pING1733.
FIG. 2 depicts a construction map for vector pING1737.
FIG. 3A shows the structure of vector pING1737 linearized with XbaI.
FIG. 3B shows the structure of vector pING1737 linearized with NotI.
FIG. 4 depicts a construction map for vector pING1753.
FIG. 5 depicts a construction map for vector pING1744.
FIG. 6 shows the structure of vector pING 1744 linearized with XbaI.
FIG. 7 shows a linear map of vector pING4155 showing the location of binding of an rBPI21 probe.
FIG. 8 shows a Northern blot of rBPI21 RNA isolated from untransfected CHO-K1 cells, Clone 228 and Clone 689.
FIG. 9 depicts a construction map for vector pING1928.
FIG. 10 depicts a construction map for vector pING 1931.
FIG. 11 depicts construction maps for vector pING1932 and pING1932R.
FIG. 12 depicts a construction map for vector pING1933.
FIG. 13 shows the amino acid changes (underlined) made during human engineering of the ING-1 light chain variable region, including mouse and human light chain variable region sequences, risk line for human engineered method, and low as well as moderate risk changes (SEQ ID NOS:6, 39, 10 and 12).
FIG. 14 depicts a construction map for vector pING1936.
FIG. 15 shows the amino acid changes (underlined) made during human engineering of the ING-1 heavy chain variable region, including mouse and human heavy chain variable region sequences, risk line for human engineered method, and low as well as moderate risk changes (SEQ ID NOS:8, 72, 23 and 25).
FIG. 16 depicts a construction map for vector pING1937.
FIG. 17 depicts a construction map for vector pING1959.
FIG. 18 depicts a construction map for vector pING1957.
FIG. 19 depicts a construction map for vector pING1963.
FIG. 20 depicts a construction map for vector pING1964.
FIG. 21 depicts a construction map for vector pING1965.
FIG. 22 shows the structure of vector pING1964 linearized with Not1.
FIG. 23 shows competition binding results for human engineered low risk ING-1.
FIG. 24 shows competition binding results for human engineered anti-Ep-CAM antibodies, including low risk as well as low plus moderate risk ING-1 as compared with mouse-human chimeric ING-1.
FIG. 25 shows competition binding results for ING-1 with combinations of light and heavy chains modified at either low or low plus moderate risk positions ING-1 (heMab) has both heavy and light chains modified at low risk positions.
FIG. 26 shows competition binding results for human engineered low risk ht chain with additional P2 or P3) or pair combinations (P1P2 or P1P3) of moderate risk proline changes.
FIG. 27 depicts a construction map for vector pING1954.
FIG. 28 shows a direct binding ELISA for human engineered (low risk) ING-1 with soluble Ep-CAM.
FIG. 29 depicts a construction map for vector pING1732-R1ClaRV (SEQ ID NO:65).
FIG. 30 depicts a construction map for vector pING1736-R1C1aKpnl (SEQ ID NO:63).
FIG. 31 depicts a construction map for vector pING2050.
FIG. 32 depicts a construction map for vector pING2051.
FIG. 33 depicts the DNA and amino acid sequence (SEQ ID NO:71) for an anti-CD18 light chain (designated LDP-01 or LDP-1 LC).
FIG. 34 depicts the DNA and amino acid sequence for an anti-CD18 heavy chain (designated LDP-01 or LDP-1 HC).
FIG. 35 depicts a construction map for vector pING2052.
FIG. 36 depicts a construction map for vector pING2057.
FIG. 37 shows the structure of vector pING2052 linearized with XbaI.
FIG. 38 shows the growth and productivity of various anti-CD18 producing clones, including 1–15, 1–37, 66B9, 84C4, 128D12, 90B6.
FIG. 39 shows the level of expression from clones 264EZ and 254G12 in additional commercially available media, including ProCH04 and ProCH05.
FIG. 40 depicts a construction map for vector pING2053.
FIG. 41 depicts a construction map for vector pING2054.
FIG. 42 depicts a construction map for vector pING2055.
FIG. 43 depicts a construction map for vector pING2056.
FIG. 44 shows the structure of vectors pING2054 and pING2055 linearized with XbaI.
FIG. 45 shows the growth and productivity of Clone 3G8 neo Subclone G5F1.
The present invention provides novel materials and methods for increasing the expression of recombinant polypeptides, including expression from stable cell lines. Novel expression vectors are provided comprising multiple copies of a transcription unit containing a recombinant DNA sequence which encodes a polypeptide of interest, separated by a selective marker gene. Cell lines harboring these vector constructs are also provided that are capable of expressing the polypeptides encoded by the transcription units. Methods of increasing expression of any polypeptide of interest, including multimeric polypeptides such as immunoglobulins, are provided. An exemplary polypeptide described herein is a BPI protein product, such as rBPI21. Another exemplary polypeptide is an immunoglobulin, or a polypeptide comprising at least the variable regions of the light and heavy chains of an immunoglobulin. As described herein, two or more copies of a recombinant gene are inserted into an expression vector wherein the genes are separated by various selective marker genes such as gpt, neo or his, in order to prepare and/or select cell transformants or transfectants, preferably mammalian cell transformants or transfectants and to reduce, minimize or avoid homologous recombination. An increase in net yield of recombinant polypeptide product from host cells harboring these vector constructs is achieved.
Examples of polypeptides expressed through use of the methods of the present invention can include any polypeptide of interest. Expressed recombinant polypeptides of the invention can include any sequences known or contemplated in the art. Polypeptides of interest can be produced by any means through use of the methods disclosed herein, including transformation or transfection of host cells such as mammalian cells with the disclosed vector constructs. Polypeptide production can be provided by any means in a host cell, including accumulation in an intracellular compartment or secretion from the cell into a culture supernatant. Host cells of the present invention may be propagated or cultured by any method known or contemplated in the art, including but not limited to growth in culture tubes, flasks, roller bottles, shake flasks or fermentors. Isolation and/or purification of polypeptide products may be conducted by any means known or contemplated in the art.
In accordance with the invention, vectors were designed that contain multiple copies of a transcription unit encoding a polypeptides of interest. Two-transcription unit vectors were constructed and used to prepare cell lines expressing the encoded polypeptides. Two of these two-transcription unit vectors were used in sequential transfections with cells to produce cell lines, which produced approximately twice the level of polypeptide as a cell line which contained a single two-transcription unit vector or two one-transcription unit vectors as a result of sequential transfection. This increased productivity appeared to result from a two-fold increase in specific productivity and not merely from an increase in cell density. The examples herein demonstrate that increased expression can be achieved through increased transcription unit dosage in a non-amplified expression system through the methods of the present invention in at least two different employed strategies with surprising effectiveness. First, by positioning the selective marker gene between multiple copies of transcription units encoding the gene of interest, the problem of homologous recombination can be avoided and high producing, stable cell lines can be developed which express multiple copies of this gene. Second, by sequentially transfecting cells in the methods of the present invention, the number of multiple integrated copies of transcription units can be increased stepwise to increase expression levels. The present invention contemplates the use of any transcription unit encoding any polypeptide of interest.
The present invention thus provides vectors comprising multiple copies of transcription units that are identical or similar. An aspect of the present invention includes vectors containing transcription units which encode subunits of dimeric or higher order multimeric proteins. Such copies can be homologous copies, for example, at least 25% homologous. Accordingly, the copies can be identical or similar by any percentage between 25% and 100% homologous. Percent sequence identity can be determined by standard methods that are commonly used to compare the similarity in position of the amino acids of two polypeptides. Using a computer program such as BLAST or FASTA, two polypeptides are aligned for optimal matching of their respective amino acids (either along the full length of one or both sequences, or along a pre-determined portion of one or both sequences). The programs provide a default opening penalty and a default gap penalty, and a scoring matrix such as PAM 250 [a standard scoring matrix; see Dayhoff et al., in: Atlas of Protein Sequence and Structure, vol 5, supp.3 (1978)] can be used in conjunction with the computer program. For example, the percent identity can then be calculated as: the total number of identical matches multiplied by 100 and then divided by the sum of the length of the longer sequence within the matched span and the number of gaps introduced into the longer sequences in order to align the two sequences.
Transcription Unit refers to a DNA sequence encoding a polypeptide and can include a promoter and/or a 3′ untranslated region.
DNA sequence or recombinant DNA sequence refers to any natural or synthetic DNA sequence derived using molecular biology and/or cloning techniques including, but not limited to, cDNA sequences, genomic sequences, polymerase chain reaction (PCR)-amplified DNA sequences, as well as any chemically-synthesized DNA sequences obtained using techniques known by those of ordinary skill in the art. Recombinant DNA sequences for use in the present invention may be derived from any native or natural source, including prokaryotic DNA sequences or eukaryotic DNA sequences, from sources such as mammalian, plant, yeast, bacterial or viral sources, or from any synthetic or non-natural source, such as chemically-synthesized oligonucleotides.
Polypeptide refers to a molecule comprising a polymer of amino acids linked together by a peptide bond(s). Polypeptides include polypeptides of any length, including proteins (e.g., ≧50 amino acids) and peptides (e.g., 2–49 amino acids) [Alberts et al., Molecular Biology of the Cell, 3rd Ed., (1994)]. Polypeptides include proteins or peptides of any activity or bioactivity, including, for example, bioactive polypeptides, such as enzymatic proteins or peptides (e.g., protases, kinases, phosphatases), receptor proteins or peptides, transporter proteins or peptides, bactericidal and/or endotoxin-binding proteins or peptides, structural proteins or peptides, immune proteins or peptides (e.g., antibodies or antigen-binding portions thereof), cytokine proteins or peptides, toxins, chemotherapeutic agents, antibiotics, hormones, growth factors, vaccines, or the like. For example, polypeptides include, but are not limited to, full length proteins, fragments, analogs, variants or derivatives of proteins, fusion proteins, chimeric proteins, multimeric proteins or their subunits. Peptides include, but are not limited to, antimicrobial peptides, herbicidal peptides, peptide hormones, neuropeptides, toxins or the like.
Bioactive polypeptide refers to a polypeptide product exhibiting bioactivity akin to that of a protein or peptide innately produced within a living organism for a physiological purpose, as well as to intermediates which can be processed into such proteins and peptides, as by cleavage away of DNA sequences encoding superfluous protein, folding, combination (as in the case of the A and B chains of insulin or the heavy and light chains of immunoglobulins), post-translational modification, etc.
Vector refers to an agent or vehicle for carrying polynucleotide sequences (e.g., DNA or RNA). Thus, vectors are said to contain (i.e., comprise) such polynucleotide sequences.
Cloning vector refers to an agent or vehicle that may be capable of autonomously replicating, including but not limited to plasmids, phagemids, or phage, comprising a polynucleotide molecules, including a DNA molecule, to which one or more additional polynucleotide segments, including DNA segments, can be or have been added.
Expression vector refers to a vector into which one or more transcriptional and translational regulation sequence(s) have been incorporated.
Promoter refers to a site on a DNA molecule to which an RNA polymerase and/or any associated factors attaches and at which transcription is initiated. Promoters may include those well-known in the art, including from SV40, HSV, bovine growth hormone, thymidine kinase, MPSV, mouse beta globin, human EF1, MSV-LTR, RSV, MMTV-LTR, CMV, MLV, Chinese hamster elongation factor, mouse Abelson LTR, human C-fos promoter or the like. Promoters for yeast, insect, plant and/or bacterial expression are also well-known in the art.
Enhancer refers to a control element that can increase expression of a gene or genetic sequence.
Selective marker or selectable marker refers to a gene or any genetic material that encodes for a phenotype that may encourage or inhibit the growth of a cell or organism in the absence or presence of a chosen compound or condition. Selective marker genes may include gpt, res, his genes, or also genes for adenosine deaminase (ADA), thymidine kinese (TK), adenine phosphoribosyl transferase (APRT), zeocin resistance gene, hygromycin resistance gene, or puromycin resistance gene.
Transformation or transfection refers to the introduction of genetic material, such as a vector, including a cloning or expression vector, into a recipient host cell that changes the genotype and results in a phenotypic change in the recipient cell. A host cell or those colonies resulting from a host cell that has undergone successful transformation or transfection is said to be transformed or transfected or may be referred to as a transformant or transfectant.
The present invention specifically provides for the development of exemplary vectors, including two and four transcription unit expression vectors which are functional and selectable in a host cell.
A series of exemplary vectors have been constructed containing two copies of a gene encoding a BPI protein product, rBPI21, each under the control of a hCMV promoter and mouse light chain 3′ untranslated region with 0, 1 or 2 copies of a human heavy chain enhancer and either a gpt or neo gene for selection of transformants or transfectants. The vectors also differed in the orientation of rBPI21 genes on the vector. Initial testing of these vectors indicated that a preferred configuration was represented by the gpt vector, pING1737 (FIG. 2). This vector and its neo version, pING1733 (FIG. 1) were selected for use in full-scale cell line development.
According to the present invention, the presence of two copies of a rBPI21 gene and flanking promoter and 3′ untranslated region sequences in pING1737 and pING1733 should promote higher expression through increased gene dosage. However, one potentially adverse consequence of this configuration could be instability of the integrated DNA as a result of recombination between two homologous rBPI21 and flanking sequences leading to elimination of one of the rBPI21 copies and lower expression. To reduce the chance of recombination, these vectors have been designed according to the invention so that when linearized at a unique XbaI site, the rBPI21 genes would be separated by the selective marker gene as integrated into a host cell chromosome. This configuration would have the greatest potential stability in the chromosome, at least as long as the transfectants were maintained in the presence of selective agent(s), because homologous recombination between the gene copies of rBPI21 would also eliminate selective marker gene(s). To evaluate the effect of gene placement on both gene expression and clone stability, both configurations were tested in cell line development for rBPI21 expression described in the examples that follow.
Bactericidal/permeability-increasing protein (BPI) is a protein isolated from the granules of mammalian polymorphonuclear leukocytes (PMNs or neutrophils), which are blood cells essential in the defense against invading microorganisms. Human BPI protein has been isolated from PMNs by acid extraction combined with either ion exchange chromatography [Elsbach, J. Biol. Chem., 254: 11000 (1979)] or E. coli affinity chromatography [Weiss, et al., Blood 69: 652 (1987)]. BPI obtained in such a manner is referred to herein as natural BPI and was initially shown by Elsbach and Weiss to have bactericidal activity against gram-negative bacteria. The molecular weight of human BPI is approximately 55,000 daltons (55 kD). The amino acid sequence of the entire human BPI protein and the nucleic acid sequence of DNA encoding the protein have been reported in FIG. 1 of [Gray, et al., J. Biol. Chem. 264: 9505 (1989)].
BPI protein products have a wide variety of beneficial activities. BPI protein product refers to and includes naturally and recombinantly produced BPI protein; natural, synthetic, and recombinant biologically active polypeptide fragments of BPI protein; biologically active polypeptide variants of BPI protein or fragments thereof, including hybrid fusion proteins and multimer of monomers; biologically active polypeptide analogs of BPI protein or fragments or variants thereof, including cysteine-substituted analogs; and BPI-derived peptides. U.S. Pat. Nos. 5,198,541 and 5,641,874, the disclosures of which are incorporated herein by reference, discloses recombinant genes encoding and methods for expression of BPI proteins including recombinant BPI holoprotein, referred to as rBPI and recombinant fragments of BPI. U.S. Pat. No. 5,439,807 and corresponding International Publication No. WO 93/23540 (PCT/US93/04752), which are all incorporated herein by reference, disclose novel methods for the purification of recombinant BPI protein products expressed in and secreted from genetically transformed or transfected mammalian host cells in culture and disclose how one may produce large quantities of recombinant BPI products suitable for incorporation into stable, homogeneous pharmaceutical preparations.
Biologically active fragments of BPI (BPI fragments) include biologically active molecules that have the same or similar amino acid sequence as a natural human BPI holoprotein, except that the fragment molecule lacks amino-terminal amino acids, internal amino acids, and/or carboxy-terminal amino acids of the holoprotein, including those described in U.S. Pat. Nos. 5,198,541 and 5,641,874. Nonlimiting examples of such fragments include an N-terminal fragment of natural human BPI of approximately 25 kD, described in [Ooi et al., J. Exp. Med., 174: 649 (1991)], or the recombinant expression product of DNA encoding N-terminal amino acids from 1 to about 193 to 199 of natural human BPI, described in [Gazzano-Santoro et al., Infect. Immun. 60: 4754–4761 (1992)], and referred to as rBPI23. In that publication, an expression vector was used as a source of DNA encoding a recombinant expression product (rBPI23) having the 31-residue signal sequence and the first 199 amino acids of the N-terminus of the mature human BPI, as set out in FIG. 1 of [Gray et al., supra], except that valine at position 151 is specified by GTG rather than GTC and residue 185 is glutamic acid (specified by GAG) rather than lysine (specified by AAG). Recombinant holoprotein (rBPI) has also been produced having the sequence (SEQ ID NOS: 1 and 2) set out in FIG. 1 of [Gray et al., supra], with the exceptions noted for rBPI23 and with the exception that residue 417 is alanine (specified by GCT) rather than valine (specified by GTT). Another fragment consisting of residues 10–193 of BPI has been described in U.S. Pat. No. 6,013,631, continuation-in-part U.S. application Ser. No. 09/336,402, filed Jun. 18, 1999, and corresponding International Publication No. WO 99/66044 (PCT/US99/13860), all of which are incorporated herein by reference. Other examples include dimeric forms of BPI fragments, as described in U.S. Pat. Nos. 5,447,913, 5,703,038, and 5,856,302 and corresponding International Publication No. WO 95/24209 (PCT/US95/03125), all of which are incorporated herein by reference. Preferred dimeric products include dimeric BPI protein products wherein the monomers are amino-terminal BPI fragments having the N-terminal residues from about 1 to 175 to about 1 to 199 of BPI holoprotein. A particularly preferred dimeric product is the dimeric form of the BPI fragment having N-terminal residues 1 through 193, designated rBPI42 dimer.
Biologically active variants of BPI (BPI variants) include but are not limited to recombinant hybrid fusion proteins, comprising BPI holoprotein or biologically active fragment thereof and at least a portion of at least one other polypeptide, or dimeric forms of BPI variants. Examples of such hybrid fusion proteins and dimeric forms are described in U.S. Pat. No. 5,643,570 and corresponding International Publication No. WO 93/23434 (PCT/US93/04754), which are all incorporated herein by reference and include hybrid fusion proteins comprising, at the amino-terminal end, a BPI protein or a biologically active fragment thereof and, at the carboxy-terminal end, at least one constant domain of an immunoglobulin heavy chain or allelic variant thereof.
Biologically active analogs of BPI (BPI analogs) include but are not limited to BPI protein products wherein one or more amino acid residues have been replaced by a different amino acid. For example, U.S. Pat. Nos. 5,420,019, 5,674,834 and 5,827,816 and corresponding International Publication No. WO 94/18323 (PCT/US94/01235), all of which are incorporated herein by reference, disclose polypeptide analogs of BPI and BPI fragments wherein a cysteine residue is replaced by a different amino acid. A stable BPI protein product has been described that is the expression product of DNA encoding from amino acid 1 to approximately 193 or 199 of the N-terminal amino acids of BPI holoprotein, but wherein the cysteine at residue number 132 is substituted with alanine. This product is designated rBPI21Δcys or rBPI21. Production of this N-terminal analog of BPI, rBPI21, has been described in [Horwitz et al., Protein Expression Purification, 8: 28–40 (1996)]. Similarly, an analog consisting of residues 10–193 of BPI in which the cysteine at position 132 is replaced with an alanine (designated rBPI(10-193)C132A or rBPI(10-193)ala132) has been described in U.S. Pat. No. 6,013,631, continuation-in-part U.S. application Ser. No. 09/336,402, filed Jun. 18, 1999, and corresponding International Publication No. WO 99/66044 (PCT/US99/13860), all of which are incorporated herein by reference. Other examples include dimeric forms of BPI analogs; e.g. U.S. Pat. Nos. 5,447,913, 5,703,038, and 5,856,302 and corresponding International Publication No. WO 95/24209 (PCT/US95/03125), all of which are incorporated herein by reference.
Other BPI protein products useful according to the methods of the invention are peptides derived from or based on BPI produced by synthetic or recombinant means (BPI-derived peptides), such as those described in International Publication No. WO 97/04008 (PCT/US96/03845), which corresponds to U.S. application Ser. No. 08/621,259 filed Mar. 21, 1996, and International Publication No. WO 96/08509 (PCT/US95/09262), which corresponds to U.S. Pat. No. 5,858,974, and International Publication No. WO 95/19372 (PCT/US94/10427), which corresponds to U.S. Pat. Nos. 5,652,332 and 5,856,438, and International Publication No. WO94/20532 (PCT/US94/02465), which corresponds to U.S. Pat. No. 5,763,567 which is a continuation of U.S. Pat. No. 5,733,872, which is a continuation-in-part of U.S. application Ser. No. 08/183,222, filed Jan. 14, 1994, which is a continuation-in-part of U.S. application Ser. No. 08/093,202 filed Jul. 15, 1993 (corresponding to International Publication No. WO 94/20128 (PCT/US94/02401)), which is a continuation-in-part of U.S. Pat. No. 5,348,942, as well as International Application No. PCT/US97/05287, which corresponds to U.S. Pat. No. 5,851,802, the disclosures of all of which are incorporated herein by reference. Methods of recombinant peptide production are described in U.S. Pat. No. 5,851,802 and International Publication No. WO 97/35009 (PCT/US97/05287), the disclosures of which are incorporated herein by reference. Three separate functional domains within the BPI sequence have been identified and designate regions of the amino acid sequence of BPI that contribute to the total biological activity of the protein (Domain I—from about amino acid 17 to about amino acid 45; Domain II—from about amino acid 65 to about amino acid 99; and Domain III—from about amino acid 142 to about amino acid 169). The biological activities of peptides derived from or based on these functional domains (i.e., BPI-derived peptides) may include LPS binding, LPS neutralization, heparin binding, heparin neutralization or antimicrobial including antifungal and antibacterial (including e.g., anti-gram-positive and anti-gram-negative) activity.
Many utilities of BPI protein products, including rBPI23 and rBPI21, have been described due to the wide variety of biological activities of these products.
Exemplary vectors have been developed according to the invention, with multiple transcription units encoding an exemplary polypeptide of interest, rBPI21. Using such vectors, exemplary clones and cell lines have been developed. For example, a CHO-K1 cell line, Clone 689, has been developed, as detailed in the following examples, which secretes up to ˜125 μg/ml of rBPI21 in shake flasks. This cell line was developed using a novel expression vectors containing two copies of the rBPI21 gene, each under the control of the human immediate early cytomegalovirus (hCMV) promoter and the mouse light chain 3′ untranslated region, and either the gpt (pING1737) or neo (pING1733) genes for selection of mycophenolic acid or G418-resistant transfectants, respectively. These vectors were designed so that when linearized at a unique XbaI restriction site prior to transfection, the two copies of the rBPI21 transcription unit are separated by the selective marker gene. This configuration provides a selective pressure against recombination because recombination between the two rBPI21 genes would result in deletion of the selective marker gene, and thereby results in enhanced stability of clones developed with these vectors.
As detailed in the following examples, a total of ˜500 mycophenolic acid-resistant transfectants were screened from a pING1737 transfection. The highest-secreting transfectants, based on the 24 well plate cultures, were adapted to suspension growth in Ex-Cell 301 medium supplemented with 2% Fetal Bovine Serum (FBS) and tested in shake flask tests with S-Sepharose beads. The highest producer, Clone 51, consistently secreted ˜50 μg/ml in shake flask tests. This level is similar to that produced by Clone 228 which contains two rBPI21 gene copies as a result of a sequential transfection with vectors each containing one rBPI21 gene. Clone 51 maintained this productivity level in the absence of selection for up to 14 weeks and was subsequently re-transfected with the neo vector, pING1733, for selection of G418-resistant transfectants. A total of 1253 clones were screened and Clone 689 was the highest producer at ˜100 μg/ml based on results of initial shake flask tests. Clone 689 was adapted to growth in Ex-Cell 301 medium without FBS and re-designated Clone 689b. This clone maintained its productivity during passage in the absence of selection for at least 12 weeks.
As further detailed in the following examples, the results of initial shake flask tests indicated that after adaptation to Ex-Cell 301 medium without FBS, Clone 689b secreted ˜75–80 μg/ml compared to ˜50 μg/ml for Clone 228. Typically, these tests were performed with 250 ml flasks that are closed for the entire 12 days of incubation until the beads are harvested. It was discovered that by periodically opening the flasks (thus allowing gas exchange to occur), the expression levels for Clone 689 increased to ˜125 μg/ml compared to ˜60 μg/ml for Clone 228 under the same conditions. Clones 228 and 689 produced ˜4 and 9 pg/cell/day, respectively, during the period when the cells were at their highest levels of viability, indicating that increased gene dosage resulted in increased specific productivities. Consistent with these results, Northern blot analysis revealed that Clone 689 expressed almost 2-fold higher levels of rBPI21 mRNA than Clone 228. Several research cell banks based on these clones have been prepared.
An additional series of exemplary vectors comprising multiple transcription units encoding anti-Ep-CAM immunoglobulin polypeptides were developed, including vectors containing two genes encoding mouse-human chimeric or human engineered anti-Ep-CAM antibody light plus heavy chains, each under the control of a hCMV promoter and mouse light chain 3′ untranslated region with 0, 1 or 2 copies of a human heavy chain enhancer and either a gpt or neo gene for selection of transformants or transfectants. The vectors also differed in the orientation of light and heavy chains genes on the vector.
ING-1 is a mouse-human chimeric antibody comprising variable regions from the mouse antibody Br-1 and human constant regions (see, e.g., U.S. Pat. No. 5,576,184). It is now known that the mouse anti-carcinoma antibody Br-1 binds the Epithelial Cell Adhesion Molecule (Ep-CAM). This murine antibody was first made and characterized by Colcher et al. from the B38.1 hybridoma cell line (described in U.S. Pat. No. 4,612,282). The ING-1 antibody is a mouse-human chimeric version of Br-1 and was previously developed and expressed in Sp2/0 cells using vectors pING2207 encoding the mouse-human chimeric ING-1 light chain mammalian and pING2225 encoding the mouse-human chimeric ING-1 heavy chain (see, e.g., U.S. Pat. No. 5,576,184).
Antibody products that target Ep-CAM derived from the ING-1 antibody produced by cell line HB9812 as deposited with the ATCC (see, e.g., U.S. Pat. No. 5,576,184) have a variety of beneficial activities for diagnostic, prognostic and/or therapeutic uses involving diseases, disorders or conditions related to the expression of Ep-CAM, including for use with Ep-CAM-positive tumor cells, particularly the metastasis of Ep-CAM positive tumor cells. ING-1 antibody product refers to and includes an antibody heavy and/or light chain protein comprising at least an antibody variable region wherein the heavy and/or light chain variable region binds to Ep-CAM and wherein the heavy and/or light chain variable region shares at least 80% (including, for example, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity with the murine heavy and/or light chain variable regions of the ING-1 antibody produced by cell line HB9812 as deposited with the ATCC.
Exemplary vectors have been developed according to the invention, with multiple transcription units encoding an exemplary immunoglobulin polypeptide of interest, including mouse-human chimeric or human engineered anti-Ep-CAM antibodies derived from the ING-1 antibody produced by cell line HB9812 as deposited with the ATCC. Using such vectors, exemplary clones and cell lines have been developed. For example, a CHO-K1 cell line, Clone 146, has been developed, as detailed in the following examples, which secretes up to ˜60 μg/ml of immunoglobulin polypeptides in shake flasks and about 200 mg/L in a fermentor. This cell line was developed using a novel expression vector pING1937 containing two genes, one copy each of the low risk human engineered ING-1 light and heavy chain genes and a neo (G418-resistant) gene, each under the control of a human cytomegalovirus (hCMV) promoter and mouse light chain 3′ untranslated region, and a neo gene for selection of G418-resistant transfectants.
The present invention provides for increasing expression and production of human engineered anti-Ep-CAM immunoglobulin polypeptides through a second transfection of an exemplary cell line with a second multiple transcription unit vector. For example, Clone 373 was developed, as detailed in the following examples, by transfecting a subclone of Clone 146, Clone 146.3, with the expression vector pING1959 which is similar to pING1937 except that it contains a gpt selective marker gene. Clone 373 expressed ˜225 and ˜257 μg/ml of the human engineered anti-Ep-CAM antibody as determined by shake flask results in Ex-Cell 301 medium.
A series of exemplary vectors have also been constructed containing four genes, two copies of each of the low risk human engineered ING-1 light and heavy chain genes (pING1965, four gene vector), each under the control of a hCMV promoter and mouse light chain 3′ untranslated region with 0, 1 or 2 copies of a human heavy chain enhancer and either a gpt or neo gene for selection of transformants or transfectants. Using such vectors, exemplary clones and cell lines have been developed. For example, a CHO-K1 cell line, Clone 17, has been developed, as detailed in the following examples, which secretes up to ˜216 μg/ml in ExCell 301 medium supplemented with 1% FBS and ˜214 μg/mI in ExCell 301 medium without FBS supplementation. This cell line was developed using a novel expression vector pING1964 containing four genes, two copies each of the low risk human engineered ING-1 light and heavy chain genes and the neo (G418-resistant) gene, each under the control of a human cytomegalovirus (hCMV) promoter and mouse light chain 3′ untranslated region.
An additional series of exemplary vectors comprising multiple transcription units encoding anti-CD18 immunoglobulin polypeptides, including vectors containing two genes encoding anti-CD18 antibody light and heavy chains, each under the control of a hCMV promoter and mouse light chain 3′ untranslated region with 0, 1 or 2 copies of a human heavy chain enhancer and either a gpt or neo gene for selection of transformants or transfectants. The vectors also differed in the orientation of light and heavy chains genes on the vector. The anti-CD18 antibody was originally developed as a rat antibody YFC51.1.1 to the human lymphocyte surface antigen CD18 and later humanized by CDR grafting as described in U.S. Pat. Nos. 5,985,279 and 5,997,867.
Antibody products that target CD18 have a wide variety of beneficial activities. For example, anti-CD18 adhesion of neutrophils to endothelial cells and restenosis in primate model with stents and balloon angioplasty. Anti-CD18 protein product refers to and includes anti-CD18 antibodies that comprise CDRs derived from the YFC 5.1.1.1 antibody (see, e.g., U.S. Pat. No. 5,985,279). Anti-CD18 antibody product refers to and includes an antibody heavy and/or light chain protein comprising at least an antibody variable region wherein the heavy and/or light chain variable region binds to CD18, wherein the CDRs are those of the YFC 5.1.1.1 antibody as shown in SEQ ID NOS: 3–8 and 11–16 of U.S. Pat. No. 5,985,279, and wherein the heavy and/or light chain variable region shares at least 80% (including, for example, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92% 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identify with the murine heavy and/or light chain variable regions of the YFC 5.1.1.1 antibody.
Exemplary vectors have been developed according to the invention, with multiple transcription units encoding additional exemplary immunoglobulin polypeptides of interest, including humanized anti-CD18 immunoglobulin. Using such vectors, exemplary clones and cell lines have been developed. For example, a CHO-K1 cell line, Clone 128D12, has been developed, as detailed in the following examples, which secrets ˜200 μg/ml of immunoglobulin in shake flasks. This cell line was developed using a novel expression vector pING2052 containing two genes, one copy each of the anti-CD18 light and heavy chain genes and a neo (G418-resistance) gene, each under the control of a human cytomegalovirus (hCMV) promoter and mouse light chain 3′ untranslated region, and a neo gene for selection of G418-resistanct transfectants, respectively.
The current invention provides for increasing expression and production of anti-CD18 immunoglobulin through a second transfection of an exemplary cell line with a second multiple transcription unit vector. For example, Clone 264E2 was developed by sequential transfection of Clone 128D12, with the expression vector pING2057 which is similar to pING2052 except that it contains a his selective marker gene. Clone 264E2 in several shake flash tests in Ex-Cell 301 medium produced approximately 1.5 to greater than two times as much immunoglobulin polypeptides as Clone 128D12 as measured by Protein A-HPLC.
An additional series of exemplary vectors comprising multiple transcription units encoding complement inhibitory polypeptides were developed, including vectors containing multiple copies of the complement inhibitory peptide designated CAB2.1 (see., e.g., U.S. Pat. Nos. 5,866,402; 6,316,253; and 6,451,539). For example, a vector was constructed containing two copies of a gene encoding a CAB2.1 polypeptide each under the control of a hCMV promoter and mouse light chain 3′ untranslated region and either a neo or his gene for selection of transformants or transfectants. Initial testing of these vectors indicated that a preferred configuration was represented by the vector, pING2055 with a neo gene for selection. This vector and its his version, pING2056 were selected for use in full-scale cell line development.
Complement Activation Blocker-2 (CAB2.1) is a chimeric or fusion protein consisting of two human complement inhibitory proteins, membrane cofactor protein (MCP, CD46) at its N-terminus and decay accelerating factor (DAF, CD55) at its C-terminus. CAB2.1 protein has been isolated from CHO-DuKX-B11 DHFR− cells transfected with a vector containing the CAB2.1 gene along with the DHFR gene for selection in the presence of methotrexate either by affinity chromatography with MCP-specific Mab (GB24) or by employing acid precipitation, anion exchange chromatography, immobilized metal affinity chromatograpy, and hydrophobic interaction chromatography [Higgins et al., J. Immunol. 158: 2872–2881 (1989)]. CAB2.1 obtained in such a manner was initially shown by Higgins [Higgins et al., J. Immunol. 158: 2872–2881 (1989)] to possess both factor 1 cofactor activity and decay-accelerating activity, and to inactivate both the classical and alternative pathways of complement activation by inactivating C3/C5 convertases. The molecular weight of CAB2.1 is approximately 110,000 daltons (110 kD). The amino acid sequence of the entire CAB2.1 protein and the nucleic acid sequence of DNA encoding the protein have been reported (see, e.g., U.S. Pat. No. 6,316,253).
CAB2.1 protein products have therapeutic potential for the prevention of complement mediated lysis of normal tissue, for example in the treatment of acute human diseases in which excessive complement activation causes damage to normal tissues. Some diseases in which complement is known to be activated include systemic lupus erythematosus, acute myocardial infarction, burn, sepsis, and adult respiratory distress syndrome. CAB2.1 protein product refers to and includes recombinantly produced CAB2.1 protein; complement inhibitory polypeptide fragments of CAB2.1 protein; complement inhibitory polypeptide variants of CAB2.1 protein or fragments thereof, including hybrid fusion proteins and multimer of monomers; complement inhibitory analogs of CAB2.1 protein or fragments or variants thereof; and complement inhibitory CAB2.1-derived peptides. Complement inhibitory fragments of CAB2.1 include biologically active molecules that have the same or similar amino acid sequence as a full length CAB2.1, except that the fragment molecule lacks amino-terminal amino acids, internal amino acids, and/or carboxy-terminal amino acids of the full length CAB2.1. Complement inhibitory analogs of CAB2.1 include but are not limited to CAB2.1 protein products wherein one or more amino acid residues have been replaced by a different amino acid. Other CAB2.1 protein products useful according to the methods of the invention are complement inhibitory peptides derived from or based on CAB2.1 produced by synthetic or recombinant means (CAB2.1-derived peptides).
Using vectors encoding CAB2.1, exemplary clones and cell lines expressing CAB2.1 were developed. For example, a CHO-K1 cell line, Clone 217B4 was developed, as detailed in the following examples, which secreted up to about 200 μg/ml of CAB2.1 in shake flasks. This cell line was developed using novel expression vectors containing one and two copies of the CAB2.1 gene, each under the control of a human cytomegalovirus (hCMV) promoter and mouse light chain 3′ untranslated region, and either a neo (pING2054) or his (pING2056) genes for selection of G418-resistant or histinol transfectants, respectively.
Other aspects, versions, and advantages of the present invention will be understood upon consideration of the following illustrative examples, wherein Example 1 addresses the construction of vectors according to the present invention that comprise multiple copies of a given transcription unit encoding a polypeptide of interest; Example 2 addresses development of an rBPI21-Producing CHO-K1 cell line, Clone 51, by transfection with a two-transcription unit vector, pING1737; Example 3 addresses transfection of Clone 51 with a second two-transcription unit vector, pING1733, to yield the exemplary Clone 689; Example 4 addresses a third sequential transfection with a two-transcription unit vector, pING1753, to yield the exemplary Clone 341 and subclones thereof; and Example 5 addresses sequential transfection with a two-transcription unit vectors lacking an Ig enhancer, pING1744 and pING1915, to yield the exemplary Clones 338 and 58, respectively. Example 6 addresses the construction of additional vectors according to the present invention that comprise multiple copies of a given transcription unit, including those encoding immunoglobulin polypeptides; Example 7 includes development of a mouse-human chimeric ING-1 producing CHO-K1 cell line, Clone 40, by transfection with a two-transcription unit vector, pING1932 and the development of Clone 146, by transfection with a two-transcription unit vector, pING1937; Example 8 addresses the development of Clones 259 and 373 by sequential transfection of Clone 146 with a two-transcription unit vector pING1957 and Clone 373 by sequential transfection of Subclone 146.3 with a two-transcription unit vector pING1959; Example 9 addresses the development Clone 132 by sequential transfection of Clone 373 with a two-transcription unit vector pING1957; Example 10 addresses the development of Clones 53 and 157 by transfection with a two-transcription unit vector pING1959, containing one copy of each of the light and heavy chain genes of a human engineered anti-EpCAM antibody, and the development of Clone 17 transfected with a four-transcription unit vector pING1964, containing two copies of each of the light and heavy chain genes of a human engineered anti-EpCAM antibody; Example 11 addressing the binding activity of exemplary immunoglobulin polypeptides, including those encoding anti-Ep-CAM immunoglobulin polypeptides; Example 12 addresses the cloning of soluble Ep-CAM and the development of a direct binding ELISA assay with soluble Ep-CAM; Example 13 addresses the construction of additional expression vectors according to the present invention that contain multiple copies of a given transcription unit, including those encoding additional immunoglobulin polypeptides; Example 14 addresses the development of an anti-CD18 antibody-producing clone 128D12 by transfection with a two-transcription unit vector pING2052; Example 15 addresses the development of an anti-CD18 antibody-producing clone 264E2 by sequential transfection of clone 128D12 with the two-transcription unit vector pING264E2; Example 16 addresses the use of a number of additional cell culture media for anti-CD18 antibody production in selected cell lines; Example 17 addresses the construction of expression vectors that contain multiple copies of a given transcription unit, including those encoding complement inhibitory polypeptides; Example 18 addresses the development of Clone 3G8 and its Subclone G5F 1 transfected with CAB2.1-encoding vectors, including a single-transcription unit neo vector pING2054 and Clones 156B8 and 176C6 transfected with a two-transcription unit neo vector pING2055; Example 19 addresses the development of additional CAB2.1-producing clones by sequential transfection of Clone 3G8 with the two-transcription unit his vector pING2056 followed by subcloning of the top producing clones.
This example describes the construction of vectors that contain (i.e., comprise) multiple copies of an exemplary transcription unit. Exemplary vector constructs are also described containing multiple copies of exemplary gene sequences encoding a polypeptide of interest.
A. Construction of Expression Vectors Containing Two rBPI21 Genes and a Single Copy of the Mouse Immunoglobulin Heavy Chain Enhancer
The expression vectors, pING1729, pING4144, pING4151 and pING4155 were used as the source of DNAs encoding rBPI21 sequences (SEQ ID NO: 3 and 4). Plasmids pING4144 and pING4151 have been described in co-owned U.S. Pat. No. 5,674,834 by Theofan et al. pING4155 is similar to pING4144 and pING4151 except that it contains the neo gene for selection of G418-resistant transfectants. pING1729 is similar to pING4144 except that it lacks the mouse immunoglobulin heavy chain enhancer. This vector was constructed by deleting a ˜700 bp HindIII restriction fragment containing the enhancer.
The plasmid pING1733 was constructed from pING4155 and pING1729 (FIG. 1). pING4155 was first digested with XbaI, which cuts at a unique site adjacent to the Ig enhancer. The XbaI-digested DNA was treated with T4 DNA polymerase in the presence of deoxyribonucleotides, which fills in the 4 bp 5′ extension to make the ends blunt, and then digested with NotI, which cuts at a unique site within the vector ˜500 bp counterclockwise to XbaI on a circular map. The resulting ˜8700 bp vector fragment was gel purified. pING1729 was digested with NotI and HpaI and a ˜3700 bp restriction fragment containing the human cytomegalovirus (hCMV) promoter, the gene encoding rBPI21 and the mouse kappa light chain 3′ untranslated region was gel purified. Ligation of these restriction fragments re-created the XbaI site and retained the NotI site. The resulting vector, pING1733 (FIG. 1), contains the neo gene for selection of G418-resistant transfectants, two copies of the rBPI21 gene each under the control of the CMV promoter and mouse kappa light chain 3′ untranslated region and one IgG enhancer unit.
The plasmid pING1737 is similar to pING1733 except that it contains the gpt instead of the neo gene for selection of mycophenolic acid-resistant transfectants and was constructed from pING1733 and the gpt vector, pING4144 (FIG. 2). pING1733 and pING4144 were each digested with HpaI and NotI and a 7600 bp restriction fragment from pING1733 (containing the two rBPI21 transcription units) and a 4400 bp restriction fragment from pING4144 (containing the gpt gene) were ligated. As with pING1733, pING1737 contains two copies of the rBPI21 gene each under control of the CMV promoter with one Ig enhancer and unique XbaI and NotI sites. Digestion of pING1737 with NotI (FIG. 3A) or XbaI (FIG. 3B) yields linear plasmids identical to pING1733 digested with the same restriction enzymes except that they contain the gpt instead of the neo gene.
The plasmid pING1753 was constructed in a similar manner to pING1737 except that the vector, pING4151, containing the his gene for selection of histidinol-resistant transfectants, was used instead of the gpt-containing vector, pING4144. Both plasmids were digested with HpaI and NotI and the fragment containing the two rBPI21 transcription units from pING1733 and the fragment containing the his gene from pING4151 were gel purified and ligated (FIG. 4). As with pING1737 and pING1733, pING1753 contains two copies of the rBPI21 gene each under control of the CMV promoter with one Ig enhancer and unique XbaI and NotI sites. Digestion of pING1753 with XbaI or NotI yields linear plasmid maps similar to those of pING1733 and pING1737 digested with the same restriction enzymes except that pING1753 contain the his instead of the neo or gpt genes.
Digestion of pING1733, 1737 or 1753 at the unique XbaI site each yields a linear restriction fragment containing both copies of the rBPI21 gene configured so that the selection marker gene, neo gpt or his, is positioned between the two identical rBPI21 transcription units. For example, pING1733 viewed as linear XbaI-digested DNA, the order of elements within the vector is as follows: IgG enhancer, CMV promoter, rBPI21 gene, light chain 3′ untranslated region, neo gene, bla (Ampr) gene, CMV promoter, rBPI21 gene, light chain 3′ untranslated region. Digestion of pING1733 at a unique NotI site yields a linear restriction fragment with the two rBPI21 transcription units being adjacent to each other and the selective marker gene positioned outside of the these two recombinant rBPI21 transcription units. Viewed as linear NotI-digested DNA, the order of elements within the vector is as follows: CMV promoter, rBPI21 gene, light chain 3′ untranslated region, IgG enhancer, CMV promoter, rBPI21 gene, light chain 3′ untranslated region, neo gene, bla (Ampr) gene.
B. Construction of an Expression Vector Containing Two rBPI21 Genes without the Immunoglobulin Heavy Chain Enhancer
The expression vector pING1744 (FIG. 5) was constructed using pING1732 and pING1740 as the source of DNAs encoding rBPI21. pING1732 is similar to pING1729 except that it contains the neo gene. pING1740 was constructed by first cloning a multilinker site between the NotI and HindIII sites of pING1732 to generate pING1736, which contains the neo gene encoding resistance to G418. This linker destroyed the original NotI site and introduced a new NotI site adjacent to a XbaI site. The neo gene from pING1736 was then replaced with the gpt gene from pING4144 by ligating a 2090 bp XmnI-XhoI fragment containing the multilinker, the CMV promoter and the rBPI21 gene from pING1736 with a 5600 bp XmnI-XhoI fragment from pING4144 containing the gpt gene. To construct pING1744, a ˜3700 bp HpaI-NotI rBPI21-containing fragment from pING1732 was ligated with a ˜7700 bp fragment from pING1740 generated by digestion with XbaI, treatment with T-4 DNA polymerase and deoxyribonucleotides to blunt end, and then digestion with NotI (FIG. 5). pING1744 contains the gpt gene for selection of mycophenolic acid-resistant transfectants and two copies of the rBPI21 gene each under the control of the CMV promoter and mouse kappa light chain 3′ untranslated region. This vector lacks the Ig enhancer. Digestion of pING1744 at a unique XbaI site yields a linear restriction fragment containing both copies of the rBPI21 gene configured so that the gpt selective marker gene is positioned between the two identical rBPI21 transcription units. Viewed as linear DNA, the order of elements within the expression vector is as follows: CMV promoter, rBPI21 gene, light chain 3′ untranslated region, gpt gene, bla (Ampr) gene, CMV promoter, rBPI21 gene, light chain 3′ untranslated region (FIG. 6).
This example describes the development and characterization of clones and cell lines transfected with an exemplary vector following an embodiment of the present invention. The development and characterization of an rBPI21-producing CHO-K1 cell line, Clone 51, is described from a transfection with a two-gene vector as described in Example 1. The CHO-K1 cell line used for the development of Clone 51 was obtained from ATCC (CCL61). The cells were grown in Ham's F12 culture medium supplemented with 10% FBS.
Prior to transfection, 40 μg of pING1737 was linearized with either NotI or XbaI. CHO-K1 cells from Research Cell Bank C1754 were transfected with either NotI- or XbaI-digested pING1737 using electroporation by the procedure of [Andreason, et al., BioTechniques 6: 650 (1988)]. Following a 48-hour recovery period in Ham's F12 medium supplemented with 10% FBS, the cells were trypsinized, diluted in selective medium (Ham's F12 medium supplemented with 10% fetal bovine serum (FBS), 292 mg/L glutamine, 105 units/L penicillin, 100 mg/L streptomycin, and 0.01 M HEPES, 250 mg/L xanthine and 25 mg/L mycophenolic acid [MPA]) and ˜1×104 cells/well were transferred to 96-well plates. The cells were incubated at 37° C. in a CO2 incubator.
Starting at about 2 weeks of incubation, culture supernatants from 96-well plate wells containing only one colony per well were screened using the BPI sandwich ELISA by the procedure of [White, et al. J. Immunol. Methods 167: 227–235 (1988)]. Approximately 500 clones each were screened for cells transfected with the NotI- and AbaI-digested pING1737. The 42 clones from the NotI-digested pING1737 (NotI clones) and the 26 clones from the XbaI-digested pING1737 (XbaI clones) secreting the highest levels of rBPI21 were transferred to Ham's F12 selective medium in 24-well plates. The cells were grown to confluence, and the master and replica 24-well plate cultures were prepared. To assess productivity, the cells in the replica plate were grown to confluence in the Ham's F12 medium (48–72 hours), the medium removed and replaced with 1 ml/well of serum-free medium (HB-CHO, Irvine Scientific) plus 40 μl of sterile S-Sepharose beads and the cells incubated for an additional seven days. The S-Sepharose beads were then removed, washed once with ˜1 ml of Tris buffer (20 mM Tris, pH 7.4, 0.1 M NaCl), and the rBPI21 was eluted from the beads with 1 ml 1.5 M NaCl in 20 mM sodium acetate pH 4.0. The level of secreted rBPI21 eluted from the S-Sepharose beads was quantitated using the sandwich ELISA. The results demonstrated that the top transfectants from each group secreted up to ˜3 μg/ml. The top 10 XbaI clones (including, for example, clones 51 and 127) and top 11 NotI clones (including, for example, clones 255 and 266) were chosen for further study.
Cells from the 24-well plate cultures were transferred to 24-well plate wells containing Ex-Cell 301 medium (JRH Biosciences, Lenexa, Kans.) supplemented with 25 μg/ml MPA and 250 μg/ml xanthine (Selective Ex-Cell 301 medium) plus 10% FBS. At confluency, the cells from the 24-well plate wells were transferred to 125 ml Erlenmeyer flasks containing 20 ml selective Ex-Cell 301 medium supplemented with 2% FBS. The clones were maintained in Erlenmeyer flasks in the selective Ex-Cell 301 medium containing 2% FBS during the screening period.
An initial productivity test was performed for the top 11 NotI and 10 XbaI clones. At this stage, the cells were growing in selective Ex-Cell 301 medium and supplemented with 2% FBS. They were transferred to a 250 ml Erlenmeyer (shake) flask containing a total volume of 50 ml of Ex-Cell 301 medium plus 2% FBS (includes inoculum) and 2 ml of SP-Sepharose (Big Beads) and grown at 37° C., 100 RPM for 12 days. As controls, Clone 180 (which contains a single copy of the rBPI21 gene) and Clone 228 (which contains two copies of the rBPI21 gene from two successive transfections of single copies of the rBPI21 gene) were also included in this test. Following incubation, the beads were removed, washed with low salt buffer (20 mM sodium phosphate, pH 7.0, 0.15 M NaCl) and the rBPI21 eluted in 20 mM sodium acetate (pH 4.0) buffer containing 1.5 M NaCl. The rBPI21 level in the eluates was measured by ion exchange HPLC. The results indicated that three clones from the transfection with NotI-digested DNA and two from the transfection with XbaI-digested DNA expressed rBPI21 at levels similar to those of Clone 228. The results further indicated that both rBPI21 gene copies in pING1737 were being maximally expressed at least in some of the clones.
Upon continued growth of these clones as suspension cells in selective Ex-Cell 301 medium (supplemented with 2% FBS), those arising from transfection with the NotI-digested DNA eventually lost productivity gradually over the course of a ten week period from a range of ˜37–60 μg/ml to ˜5–35 μg/ml rBPI21 even though selection was maintained. This outcome was not entirely unexpected as the two rBPI21 genes were positioned in tandem and could be subject to recombination. By comparison, Clone 51, arising from transfection with the XbaI-digested pING1737, maintained or increased its productivity for the 10 week period of the study. These results indicated that the placement of the selective marker (gpt) gene between the two rBPI21 genes within the integrated expression vector can help maintain both rBPI21 gene copies in the transfectants.
During the course of additional passages of Clone 51, the FBS content was gradually reduced until a serum-free condition was achieved. Clone 51 growing in Ex-Cell 301 medium without FBS was redesignated as Clone 51b.
The stability of Clones 51 and 51b in Ex-Cell 301 medium with and without 2% FBS supplementation, respectively, was examined. For this test, the cells were maintained in a 125 ml Erlenmeyer flask containing 25 ml of Ex-Cell 301 medium with (Clone 51) or without (Clone 51b) 2% FBS and with or without full selection and passage twice each week. Once a week, a shake flask test was set up and performed as described above. The stability study for Clone 51 and Clone 51b lasted 16 weeks. For the Clone 51b study, the level of expression was compared to that of Clone 228 maintained in selective Ex-Cell 301 medium. The results of the Clone 51 stability study demonstrated that after an initial drop in expression levels, the cells in selective and non-selective medium maintained similar rBPI21 expression levels at least out to week 11. Clone 51b maintained similar productivity in the presence and absence of selection during the entire 18 week course of the experiment. Throughout the course of the Clone 51b study, productivity was equal to or greater than that of Clone 228, which also contains two rBPI21 genes as a consequence of sequential transfection with vectors containing one rBPI21 gene.
This example describes the further increase in expression and production of polypeptides through a second transfection of an exemplary cell line with a second multi-transcription unit vector. The development and characterization of an rBPI21-producing CHO-K1 cell line, Clone 689, is described. Clone 689 was developed by transfecting Clone 51 cells as described in Example 2 adapted to Ex-Cell 301 medium supplemented with 2% FBS with the neo expression vector, pING1733 (FIG. 1) digested with XbaI prior to transfection. Clone 51 cells still growing in selective Ex-Cell 301 medium supplemented with 2% FBS (rather than completely adapted to serum-free growth) were used to allow prompt initiation of the second transfection.
A. Transfection of Clone 51 with pING1733
Clone 51 cells growing in selective Ex-Cell 301 medium supplemented with 2% FBS, MPA and xanthine were electroporated with 40 μg of XbaI-digested pING1733. Following a 48-hour recovery period in non-selective Ex-Cell 301 medium supplemented with 2% FBS, the cells were placed in selective medium (Ex-Cell 301 medium supplemented 0.8 mg/ml G418 and 2% FBS) and transferred to 96-well plates at ˜1×104 cells/well. The MPA and xanthine were not included in the medium at this time. The cells were placed in a CO2 incubator at 37° C. Two additional transfections were performed as above.
B. Screening and Selection of Clone 689
A total of 1,253 clones were screened at the 96-well level from the three transfections. The 125 clones secreting the highest rBPI21 levels were transferred to selective Ex-Cell 301 medium (250 μg/ml xanthine, 25 μg/ml mycophenolic acid and 0.8 mg/ml G418) supplemented with 2% FBS in 24-well plates. Although the transfectants had been selected in 96-well plates in Ex-Cell 301 with 2% FBS, they initially grew poorly when transferred to the 24-well plates with this medium. This problem was solved by temporarily increasing the FBS concentration to 4%. The cells were grown to confluence, and then master and replica 24-well plate cultures were prepared as described above for Clone 51. To screen for productivity in the 24-well plate cultures, the cells were transferred to 1 ml of selective Ex-Cell 301 medium containing 4% FBS plus 40 μl of sterile S-Sepharose beads and they were incubated until extinct (7–10 days). The S-Sepharose beads were removed, washed once with ˜1 ml of Tris buffer (20 mM Tris, pH 7.4, 0.1 M NaCl), and the rBPI21 was eluted from the beads into 1 ml of the same buffer containing 1.5 M NaCl. The level of secreted rBPI21 eluted from the S-Sepharose beads was quantitated using the sandwich ELISA. The top 46 clones were transferred from the 24-well plate to a 125 ml Erlenmeyer (shake) flask containing 25 ml of Ex-Cell 301 supplemented with 4% FBS and selective agents at one-half the concentration used for selection of transfectants. Shake flask tests were performed with these clones in the Ex-Cell 301 medium with 4% FBS. From these and subsequent tests, a number of high producing clones were identified (including, for example, clones 357, 548, 689, and 815). The results of these tests indicated that Clone 689 was the top producer at ˜100 μg/ml. Subsequent shake flask tests confirmed that Clone 689 was the best producer with an average of 104.3+1.99 μg/ml in six tests in Ex-Cell 301 medium with 4% FBS. Vials of Clone 689 were frozen (designated Research Cell Bank C3043). Clone 689 was maintained in Ex-Cell 301 medium supplemented with 4% FBS and used for the initial stability study set forth below.
C. Adaptation of Clone 689 to Ex-Cell 301 Medium without FBS
Clone 689 was adapted to growth in Ex-Cell 301 medium without FBS by reducing the serum level by one half at each passage. The adaptation to serum-free growth was completed and vials were frozen (designated Research Cell Bank C3056).
A second, more aggressive adaptation of Clone 689 to Ex-Cell 301 medium without FBS was undertaken. Prior to this adaptation, a vial of research cell bank C3043 had been thawed and placed in culture. This Ex-Cell 301-adapted clone was designated as Clone 689b and a research cell bank, (designated C3071), was prepared. Additional research cell banks (designated C3131 and C3287) were also prepared.
Although Clone 689 produced ˜100 μg/ml in the initial shake flask tests, including one test immediately following its adaptation to growth in serum-free medium, its productivity slowly dropped over the course of 6 weeks on continued passage until it leveled out to ˜75–80 μg/ml. As with Clone 51, it is not clear why a decline was observed.
D. Stability of Clone 689
Three stability studies were performed with Clone 689. As controls, the expression levels of Clones 228 and 180 (both in selective Ex-Cell 301 medium) were also monitored as a part of these studies. The first study was initiated with Clone 689 adapted to growth in Ex-Cell 301 medium supplemented with 4% FBS with and without selection (mycophenolic acid, xanthine, G418) in 125 ml Erlenmeyer flasks (25 ml cells/flask). The cultures were incubated at 37° C., 100 RPM and passaged twice each week. Once each week, the cells were also inoculated into 50 ml of non-selective Ex-Cell 301 medium supplemented with 2% FBS and 2.5 ml sterile SP-Sepharose beads (Big Beads). These cultures were then grown at 37° C. for 12 days after which the beads were collected, washed and the rBPI21 eluted and analyzed by HPLC as above. This study was completed after a total of 14 weeks. The results demonstrated that after an initial decline through week 6 for cells grown both in the presence and absence of selection (similar to that observed with Clone 51), thereafter Clone 689 maintained similar productivity (˜75–80 μg/ml) in the presence and absence of selection at least through the eleventh week, after which productivity of cells grown without selection seemed to decline very slightly through week 14 to a level of ˜65–70 μg/ml. The second study was performed with Clone 689b, resulting from the second adaptation of Clone 689 to completely FBS-free medium. This study was conducted for a total of 14 weeks. For both studies, the cultures were incubated in Ex-Cell 301 medium with and without selection and evaluated for productivity as described above. The results of the Clone 689b stability study demonstrated that there was no significant decrease in expression levels in the absence of selection out to 14 weeks. A similar result was obtained with the Clone 689 cells that had been initially adapted to Ex-Cell 301.
E. Growth and Productivity
The average productivity of Clone 689 was at least ˜1.5 fold higher than Clone 228 and Clone 51. Since productivity is a function of both specific productivity and cell density, tests were conducted to determine if relative expression levels for various clones were reflected in specific productivity differences. Therefore, growth and productivities of Clone 180 (1 copy), Clones 228 and 51 (2 copies), and Clone 689 (˜4 copies) were compared in shake flask tests. For each clone, cells were grown to logarithmic phase and inoculated at 1–2×105 cells/ml into seven 250 ml Erlenmeyer flasks each containing 50 ml of Ex-Cell 301 medium supplemented with 2% FBS and 2% S-Sepharose (big beads). One flask was dedicated for each time point. Previous studies had indicated that a high concentration (>100 μg/ml) of rBPI21 was inhibitory for CHO-K1 cell growth. Therefore, a flask without SP-Sepharose was also inoculated for each clone to compare the growth with and without beads. The cells were incubated at 37° C. and SP-Sepharose was harvested from flasks at Days 2, 3, 4, 5, 8 and 12.
The cell growth results for cultures with and without SP-Sepharose indicated that there were no significant growth differences with and without SP-Sepharose beads even for the highest producers. These results suggested that the secreted rBPI21 did not significantly influence cell growth under conditions where it was not absorbed by the SP-Sepharose beads. The greatest growth was observed with Clone 180 (maximum cell density of ˜3.5×106 cells/ml) followed by Clone 228 (maximum cell density of ˜3×106 cells/ml). The next highest density was Clone 689 (maximum cell density of ˜2.5×106 cells/ml) and Clone 51 displayed the lowest maximum cell density although this result may actually be a consequence of cell clumping.
The results of productivity tests for cultures supplemented with SP-Sepharose demonstrated that as previously observed, the maximum productivities of Clones 228 and 51 were ˜2 times that of Clone 180 (˜50 vs. 25 μg/ml) while the productivity of Clone 689 was ˜1.5 times that of Clone 228, at least when measured at Day 5 (the day Clone 228 achieved its maximum productivity). However, Clone 689 slowly accumulated up to ˜100 μg/ml by Day 12 in this test.
The above results indicated that the relative expression levels in the shake flasks for Clones 180, 228, 51 and 689 were directly proportional to gene dosage, assuming that as with Clones 180 and 228, Clones 51 and 689 received only one copy of the plasmids from each transfection. To confirm that this increased yield resulted from a higher specific productivity (pg/cell/day), we estimated this value from Days 2 to 4 for Clone 180 and Days 3 to 5 for the other cell lines at which time the cell viabilities were high (>90%) and the cultures were at or approaching their maximum cell densities. This calculation was made by dividing the average daily production during these 2 days by the average cell density during this period. The results demonstrated that the specific productivity for Clone 689 (˜9 pg/cell/day) was about twice that of Clone 228 (˜4 pg/cell/day) which, in turn, was about twice that of Clone 180 (˜2 pg/cell/day). Clone 51, which was from the initial transfection with the 2-gene vector and served as the parent for Clone 689, had almost the same specific productivity as Clone 689, although this value is probably inflated due to the abnormally low cell counts as a result of cell clumping.
F. Effect of Culture Conditions on rBPI21 Expression by Clone 689
Typically, shake flask tests were performed in Erlenmeyer flasks that were sealed after inoculation and only re-opened after the 12-day incubation period. Under these conditions, Clone 689, on average has produced ˜75–80 μg/ml compared to ˜45–50 μg/ml for Clone 228.
As part of the evaluation of the growth characteristics of Clone 689 in the presence of S-Sepharose, an experiment was performed in which cells were inoculated with ˜1×105 cells/ml into three flasks containing Ex-Cell 301 with 2% FBS and S-Sepharose. One of the flasks remained sealed during the course of the experiment, as is usually the case, while the other two were used to perform cell counts at days 2–7, 9, 11. After day 11, the S-Sepharose was removed, washed, eluted and the levels of rBPI21 determined by HPLC. Surprisingly, while cells in the sealed flask expressed rBPI21 at 75 μg/ml as expected, cells in the flasks from which samples were taken for cell counts expressed an average of ˜130 μg/ml (for two tests), representing a ˜70% increase. As previously observed, the Clone 689 cells achieved a maximum cell density of ˜2.5×106 cells/ml at days 4–5 indicating that the increased rBPI21 expression in the “opened” flasks was not due to significantly higher cell densities.
To further examine this phenomenon with Clone 689 and determine if it occurred with other clones, a similar experiment was performed with Clones 180, 228 and 689. The results demonstrated that a similar phenomenon occurred to some extent with all of the tested clones. As before, Clone 689 produced 79 μg/ml in the closed flask and up to 128 μg/ml in the open flask, representing a 62% increase. Clone 228 produced up to 47 and 62 μg/ml in the “closed” and “open” flasks, respectively, representing a 32% increase. Clone 180 expression levels increased ˜20% in the open vs. closed flask.
In the initial open flask experiment with Clone 689, we also observed that the media in the flasks that had been opened appeared to be less acidic. To determine if this were the case with the second experiment, the pH values of the culture supernatants from each flask were measured. The results demonstrated that the pH of the media from the flasks that had been opened was 0.2 to 0.5 units higher than that of the flasks which had remained sealed. The greatest pH difference between the closed and open flasks occurred with Clone 689. It is possible that the gas exchange that occurs when the flasks are opened allows the cells to more efficiently utilize glucose and perhaps produce less lactic acid, which may adversely affect both growth and production.
The results of these experiments indicated that future shake flask tests could incorporate the gas exchange step because the highest productivities were observed under these conditions.
G. rBPI21 Expression Levels without S-Sepharose
Previous experiments showed that the presence of S-Sepharose facilitates efficient detection and recovery of rBPI21 from the culture supernatants of transfected cells [Horwitz, A. H. et al., Protein Expr Purif. 18: 77–85 (2000)]. The loss of rBPI21 from the culture supernatants without beads may be due to its interaction with heparan proteoglycans on the surface of the CHO cells.
One potential consequence of achieving higher expression levels is that the surface receptors for rBPI21 eventually might be saturated, resulting in elevated levels of rBPI21 in the supernatant in the absence of S-Sepharose. To determine if this was the case, the levels of rBPI21 expression were compared with and without SP-Sepharose for Clones 180, 228, and 689. The rBPI21 levels in the supernatants from cultures without beads were measured by ELISA, while the rBPI21 levels eluted from the beads were measured by both ELISA and HPLC. The results demonstrated that the level of rBPI21 present both during the production phase and at the end of the incubation period increased with higher expression occurring with Clone 689. However, even for Clone 689, SP-Sepharose beads were still required for optimal detection and recovery of rBPI21.
H. RNA Levels
Relative levels of rBPI21 mRNA were compared for Clones 228 and 689. Clone 228, 689 and untransfected CHO-K1 cells were grown to logarithmic phase in Ex-Cell 301 medium and total cytoplasmic RNA was isolated as described by [Gough Anal. Biochem. 173: 93–95 (1988)]. The RNA samples were first checked for the level of ribosomal RNAs and then run on a formamide, 1% agarose gel, blotted to nitrocellulose and hybridized with a 32P-labeled DNA probe for the light chain 3′ untranslated region (FIG. 7). The membrane was washed to remove non-specifically-bound counts and exposed to X-ray film. The results as shown in FIG. 8 indicate that Clone 689 expressed rBPI21 mRNA at an estimated ˜1.6× higher level than Clone 228. However, a method such as RNAase protection or quantitative PCR will be needed to provide more accurate quantitation of the mRNA levels.
I. Summary
Thus, in accordance with the invention, vectors were designed that contain (i.e., comprise) multiple copies of a cDNA encoding rBPI21. Two of these two-transcription unit vectors were used in sequential transfections with CHO-K1 cells to produce a cell line, Clone 689, which produced approximately twice the rBPI21 level as Clone 228 which contained two one-transcription unit vectors as a result of sequential transfection. This increased productivity appeared to result from a two-fold increase in specific productivity (compared to Clone 228), and not merely from an increase in cell density. Indeed, Clone 689 cells did not grow to as high a cell density as Clone 228 cells while producing higher rBPI21 levels. In addition, Clone 689 maintained its productivity in the absence of selection for up to 14 weeks, an amount of time sufficient to account for scale-up into large fermenters. This example demonstrates that increased expression can be achieved through increased transcription unit dosage in a non-amplified expression system through the methods of the present invention in at least two different employed strategies with surprising effectiveness. First, by positioning the selective marker gene between multiple copies of transcription units encoding the rBPI21 gene, the problem of homologous recombination can be avoided and high producing, stable cell lines can be developed which express multiple copies of the rBPI21 gene. Second, by sequentially transfecting cells in the methods of the present invention, the number of multiple integrated copies of transcription units can be increased stepwise to increase expression levels. The present invention contemplates the use of any transcription unit encoding any polypeptide of interest and is in no way limited to BPI protein products, as exemplified by rBPI21, as would be understood by one skilled in the art.
This example describes the further increase in expression and production by a third sequential transfection of an exemplary cell line with a third multi-transcription unit vector, resulting in clones and cell lines that express increased levels of polypeptide production.
A. Selection of Sequential Transfectants and Development Thereof
Further sequential transfections with multiple copies of transcription units separated by selective marker genes were carried out to test for still further increased expression of the transcription units. A third sequential transfection of Clone 689 with a vector containing two rBPI21 genes and a third selective marker might yield expression levels at least 1.5 times those of Clone 689 based on increased gene dosage, assuming that gene dosage could be achieved. Clone 689 was thus sequentially transfected a third time. This cell line was transfected with the vector, pING1753, containing two copies of the rBPI21 gene and the his gene as a selective marker for selection of histidinol resistance. Subsequent to transfection and selection, a total of ˜500 triple-transfectant clones were screened at the 96 well level and 85 at the 24 well level with S-Sepharose. The top producers secreted up to 1.5 times higher levels (˜50 μg/ml) of rBPI21 as compared to Clone 689 when tested at the 24-well level, but only secreted ˜20–30% higher than Clone 689 in the initial shake flask tests which were performed in closed flasks. A top producing clone (341), was chosen for further study.
B. Production Under Open Flask Conditions
Subsequent to the surprising results as described in Example 3 above of increased expression in shake flasks when gas exchange was allowed, the shake flask tests were again performed, but this time with open flasks. Several triple transfectants were evaluated in open shake flask tests in Ex-Cell 301 medium supplemented with 2% FBS. The results indicated that the expression levels were considerably higher than those previously observed with closed flasks for Clone 341 (the triple transfectant obtained by transfecting Clone 689). In fact, in four separate tests, Clone 341consistently secreted higher levels (ranging from 107.6 μg/ml to 142.0 μg/ml) than Clone 689 (which ranged from 67.8 μg/ml to 93.4 μg/ml). Thus, expression levels of the triple transfectant, Clone 341, did approximate a 1.5 fold increase in expression at both the 24-well level and in open shake flasks.
C. Adaptation of Clone 341 to 1% FBS
Clone 341 was subsequently tested after adaptation to growth in Ex-Cell 301 medium supplemented with 1% FBS. The triple sequential transfectant had initially been selected in 4% FBS and then adapted to 2% FBS in Ex-Cell 301 medium. Next, Clone 341 was adapted to 1% FBS and re-tested in shake flask tests. The results for eight shake flask tests indicated that this clone maintained its high productivity for at least 33 passages over the 17 weeks in which it was tested with concentrations of rBPI21 ranging from 122.6 μg/ml to 144.8 μg/ml.
D. Subcloning of Clone 341 and the Development of Clone 83
Attempts to adapt Clone 341 to completely serum-free conditions were not initially successful. In addition, although the above expression levels were higher than those for the initial closed flask experiments and were slightly higher than those achieved with some subclones of Clone 689, to further improve expression levels and potentially select for a faster growing, higher producing clone, Clone 341 was subcloned. The cells were plated in Ex-Cell 301 medium containing 1% FBS at ˜30, 15, 7.5 and 3 cells/well. A total of 69 clones from wells with single colonies were transferred to 24 well plates and then to shake flasks where they were evaluated for productivity. Of these, the top 6 clones were ultimately kept for re-evaluation over 90 days where screening for rBPI21 production was periodically conducted. The results of the screening indicated that Clone 83 was identified as the top subclone, secreting in the range of 150–165 μg/ml (compared to ˜135 μg/ml for parent Clone 341) in shake flask tests.
E. Productivity and Stability of Clone 341 Subclone, Clone 83
The top 6 subclones were maintained and evaluated for productivity for an additional 8 weeks under full selection. The results demonstrated that Clone 83 had remained the best producer, secreting 180 and 195 μg/ml on two occasions and always outperforming the Clone 341 parent.
The stability of Clone 83 was examined by growing the subclone in Ex-Cell 301 medium in the presence and absence of selection. The cells were passaged twice each week and shake flask tests were set up weekly. The results demonstrated that Clone 83 maintained productivity at a stable range of ˜160 μg/ml in the presence of selection. However, while Clone 83 maintained productivity in the absence of selection through at least week 5, by week 7 rBPI21 levels had decreased in the absence of selection to ˜120 μg/ml. These results suggest that this subclone is stable for at least 5 weeks (10 passages, ˜30–35 generations) in the absence of selection. Other Clone 689 subclones were shown to be stable for longer periods of time in the absence of selection. Lower productivity without selection may be due to instability of the integrated DNA encoding histidinol-resistance. If this is the case, high productivity may be maintained by keeping histidinol in the medium during the early scale-up stages.
This example demonstrates that sequential transfections with a multiple transcription unit vector, that effectively increases the expressed amounts of a given transcription unit, even when an enhancer has been removed from the vector. This is shown through the development and characterization of an exemplary clone, Clone 338, transfected with an exemplary vector, pING1744, which contained two rBPI21 genes similar to Clone 51, but without the Ig enhancer. The resulting Clone, Clone 338, was then retransfected with a second two-gene (rBPI21) vector, pING1915, also without the Ig enhancer, and then characterized. Clone 58 resulted from the sequential transfection and when screened, demonstrated expression of rBPI21 at concentrations markedly higher than that of Clone 338, the single transfectant.
A. Transfection with pING1744: Clone 338
Clone 338 was developed by transfection of attached CHO-K1 cells with the vector pING1744, which contains two rBPI21 genes each under the control of the CMV promoter and light chain 3′ untranslated region with the gpt gene for selection of MPA-resistant transfectants, but without an Ig enhancer. pING1744 had been first digested at a unique XbaI site prior to transfection so as to place the selective marker gene between the two copies of the rBPI21 gene (FIG. 5).
Ex-Cell 301-adapted Clone 338 cells initially were grown in the presence of 2% FBS and produced up to ˜100 μg/ml in shake flask tests. The cells were subsequently adapted to Ex-Cell 301 medium supplemented with 1% FBS, retaining productivity of 80–100 μg/ml.
B. Stability of Clone 338 with Selection
Selection for mycophenolic acid is relatively poor in Ex-Cell 301 medium and maintenance of the high expression levels suggests that this clone is relatively stable. To further examine stability, cultures were grown in Ex-Cell 301 medium supplemented with 1% FBS and with or without selection. Cells were passaged twice each week and shake flask tests were set up weekly. Results showed that rBPI21 was expressed at ˜100 μg/ml in the presence and absence of selection through 7 weeks, although there was a slight decline in expression over this period of ˜20 μg/ml in the absence of selection. These results suggest that although the cells without selection expressed rBPI21 at slightly lower levels, this clone was stable for at least 7 weeks in the absence of selection. The study was discontinued at week 7.
C. Transfection with pING1915: Clone 58
To further optimize expression, Clone 338 adapted to Ex-Cell 301 medium with 1% FBS was re-transfected with pING1915 which is similar to pING1744 except that it contains the neo gene for selection of G418-resistant transfectants, but also lacks an Ig enhancer. A total of ˜600 transfectants were screened at the 96 well level and 250 were screened in 24 well plates with S-Sepharose. Results of this screen revealed a number of clones that secreted at 30–60 μg/ml. By comparison, the highest expression levels in 24 well plates for a single two-gene vector with an Ig enhancer generally was ˜15 μg/ml, the levels from a sequential transfection with two such two-gene vectors) was ˜30–35 μg/ml, and the levels from a third transfection with such two-gene vectors was up to ˜45 μg/ml under similar conditions.
The top 76 clones from the ˜600 transfectants screened, secreting from ˜20 to 64 μg/ml, were transferred to shake flasks and grown in Ex-Cell 301 medium supplemented initially with 4% FBS (to ensure a smooth transition to shake flask growth). Results of an initial shake flask test for two series of transfectants indicated that there were several clones that secreted above the levels of subclones of Clone 689 and Clone 341 (subclones 689.47 and 341.83 from previous sequential transfectants) at the time of the assay.
The top clones were maintained and adapted to Ex-Cell with 2% FBS and re-screened several more times. The results indicated that Clone 58 consistently secreted at levels equal to or better than subclones of Clones 689 and 341 (subclones 689.47 and 341.83), and at markedly higher levels than Clone 338, from which the respective subclones were derived. For example, Clone 338 was screened at secretion levels over a 7 week period from 80.8 μg/ml to 101.4 μg/ml, while a subclone of Clone 689 (689.47) secreted at 112.0 μg/ml to 134.8 μg/ml and a subclone of Clone 341 (341.83) was at 95.2 μg/ml to 121.4 μg/ml over the same period. Comparatively, Clone 58 secreted at 119 μg/ml to 134.4 μg/ml during this period of testing. Although all of the above tested sequential transfectants of Clone 338 secreted at higher levels than Clone 338, they did not secrete at twice the level although the number of transcription unit copies were effectively doubled through the sequential transfections. This could be due to either growth related differences, limitations in the medium and/or to an inability of the plasmid, pING1915, to generate transfectants that express at the same levels as pING1744, which had been used to generate Clone 338, in these experiments. Nevertheless, this example clearly demonstrates that sequential transfections with vectors containing multiple copies of a transcription unit in accordance with the present invention effectively increases expression levels to substantially higher amounts, even when an enhancer has been removed from the vector.
This example describes the construction of expression vectors that contain multiple copies of additional exemplary transcription units. Exemplary vector constructs are also described containing multiple copies of exemplary gene sequences encoding polypeptides of interest, for example, immunoglobulin gene sequences including light and/or heavy chain sequences.
A. Construction of Expression Vectors Comprising Mouse-Human Chimeric ING-1 Light Chain Gene
Vectors comprising sequences encoding mouse-human chimeric ING-1 light (SEQ ID NOS: 5 and 6) and heavy chains (SEQ ID NOS: 7 and 8) which incorporate the necessary elements for optimal expression in CHO-K1 cells have been constructed. These ING-1 vectors serve both as the starting point for construction of human engineered antibody genes and have been used to develop CHO-K1 cell lines expressing mouse-human chimeric ING-1. The expression vectors described below have a CMV promoter and a mouse kappa light chain 3′ un-translated region and transcription units encoding selective gene markers, and light and/or heavy chain sequences.
A mouse-human chimeric ING-1 light chain vector, pING1928, was constructed by digesting pING2207 (see, e.g., U.S. Pat. No. 5,576,184), comprising a mouse-human chimeric ING-1 light chain gene (SEQ ID NO: 5) fused to a mouse light chain 3′ untranslated region, with SalI plus HpaI and isolating the ˜2200 bp fragment comprising a light chain (FIG. 9). This fragment was ligated to a ˜6300 bp SalI-HpaI vector fragment from pING1732 (described in Example 1 above), placing the mouse-human chimeric ING-1 light chain gene (SEQ ID NO: 5) under control of the CMV promoter and mouse light chain 3′ untranslated region (FIG. 9). The sequence of the chimeric mouse-human ING-1 light chain is shown as SEQ ID NO: 5. Alternative light chain variable region gene may be cloned into the SalI HindIII sites of pING1928, including human engineered antibody variable region genes sequences as described below.
B. Construction of Expression Vectors Comprising Mouse-Human Chimeric ING-1 Heavy Chain Gene
A mouse-human chimeric ING-1 heavy chain vector (SEQ ID NOS: 7 and 8), pING1931, was constructed by digesting pING2225 (see, e.g., U.S. Pat. No. 5,576,184), comprising a mouse-human chimeric ING-1 heavy chain gene (SEQ ID NO: 7) with SalI plus NaeI and isolating the ˜1433 bp fragment comprising the heavy chain gene sequence (FIG. 10). This fragment was ligated to the ˜7352 bp vector fragment from pING1736 (described in Example 1 above, similar to pING1740 except that it contains the neo instead of the gpt gene) which had been digested with XhoI, treated with T4 DNA polymerase in the presence of deoxyribonucleotides to blunt end, and then with SalI placing the mouse-human chimeric ING-1 heavy chain gene (SEQ ID NO: 7) under control of the human CMV promoter and the mouse light chain 3′ untranslated region (FIG. 10). The sequence of the chimeric mouse-human ING-1 heavy chain is shown as SEQ ID NO: 7. Alternative heavy chain variable region genes may be cloned into the Sal-ApaI sites of pING1931, including human engineered antibody variable region genes as described below.
C. Construction of Mouse-Human Chimeric Light Plus Heavy Chain Expression Vectors Mouse-Human Chimeric (Two Gene Vectors)
Vectors comprising mouse-human chimeric ING-1 light chain plus heavy chain gene sequences (SEQ ID NOS: 5 and 7) were constructed using pING1928 and pING1931 (FIG. 11). pING1931 was digested with EcoRV and treated with calf intestinal alkaline phosphatase (CIAP). EcoRV cuts at a unique site adjacent (and counterclockwise on a circular map) to a unique NotI site. pING1928 was digested with NotI and HpaI, and then treated with T4 DNA polymerase in the presence of deoxyribonucleotides to blunt end. The ˜3720 bp fragment comprising a mouse-human chimeric light chain gene (SEQ ID NO: 5) was purified and ligated with EcoRV-digested pING1931 comprising a mouse-human chimeric heavy chain gene (SEQ ID NO: 7). Both possible orientations, represented by pING1932 and pING1932R, were obtained as shown in FIG. 11.
D. Construction of Expression Vectors Comprising Human Engineered ING-1 Light Chain Gene
Human engineering of antibody variable domains has been described by Studnicka [see, e.g., Studnicka et al. U.S. Pat. No. 5,766,886; Studnicka et al., Protein Engineering 7: 805–814 (1994)] as a method for reducing immunogenicity while maintaining binding activity of antibody molecules. According to the method, each variable region amino acid has been assigned a risk of substitution. Amino acid substitutions are distinguished by one of three risk categories: (1) low risk changes are those that have the greatest potential for reducing immunogenicity with the least chance of disrupting antigen binding or protein folding (2) moderate risk changes are those that would further reduce immunogenicity, but have a greater chance of affecting antigen binding or protein folding; (3) high risk residues are those that are important for binding (e.g., CDR loops) or for maintaining antibody structure and carry the highest risk that antigen binding or protein folding will be affected.
A human engineered ING-1 light chain vector, pING1933 (FIG. 12), was constructed by digesting pING1928 (FIG. 9), containing a mouse-human chimeric ING-1 light chain gene, with SalI plus NotI and isolating the ˜1518 bp fragment with a CMV promoter and separately digesting pING1928 with HindIII plus NotI and isolating the ˜6566 bp fragment comprising a human light chain constant region, a mouse light chain 3′ untranslated region and a neo gene for selection of G418-resistant transfectants. These fragments were ligated to a ˜400 bp PCR-generated SalI-HindIII fragment comprising an ING-1 light chain variable region human engineered with a total of 6 low risk amino acid substitutions (FIG. 13; SEQ ID NO: 9), placing the low risk human engineered ING-1 light chain gene under control of a CMV promoter and mouse light chain 3′ untranslated region. Low risk changes as well as low plus moderate risk changes in an ING-1 light chain variable region are shown in FIG. 13. For the light chain, a total of 6 low risk changes were made for a low risk variable region (SEQ ID NO: 10) as described, and separately a total of 10 low plus moderate risk changes were made for a low plus moderate risk variable region in the light chain (SEQ ID NO: 11 and 12). The vector pING1933 comprises a PCR-generated human engineered ING-1 light chain variable region with 6 low risk changes incorporated. A DNA fragment encoding a low risk modified light chain variable region was constructed using 6 overlapping oligonucleotides KL1 (SEQ ID NO: 13), KL2 (SEQ ID NO: 14), KL3 (SEQ ID NO: 15), KL4 (SEQ ID NO: 16), KL5 (SEQ ID NO: 17), and KL6 (SEQ ID NO: 18). These segments were annealed to each other, extended with DNA polymerase and then the assembled variable region amplified by PCR using 5′ forward primer KF (SEQ ID NO: 19) and 3′ reverse primer KR (SEQ ID NO: 20), digested with SalI and HindIII to yield a restriction fragment that was cloned directly into expression vector pING1928 to generate pING1933 as shown in FIG. 12. Another expression vector, pING1939, was constructed using a similar method and is like pING1933 except that pING1939 comprises an ING-1 light chain variable region human engineered with the low plus moderate risk changes as shown in FIG. 13 (SEQ ID NO: 11 and 12). The low plus moderate risk modified light chain variable region was constructed using 6 overlapping oligonucleotides, including 5 used in the construction of the low risk modified variable region described above: KL1 (SEQ ID NO: 13), KM2 (SEQ ID NO: 21), KL3 (SEQ ID NO: 15), KL4 (SEQ ID NO: 16), KL5 (SEQ ID NO: 17) and KL6 (SEQ ID NO: 18).
E. Construction of Expression Vectors Comprising Human Engineered ING-1 Heavy Chain Gene
A human engineered ING-1 heavy chain vector, pING1936 (FIG. 14), was constructed by digesting pING1931, containing mouse-human chimeric ING-1 heavy chain with SalI plus ApaI and isolating the ˜8344 bp fragment comprising a CMV promoter, heavy chain constant region, light chain 3′ untranslated region and a neo gene for selection of G418-resistant transfectants. This fragment was ligated to the ˜450 bp PCR-generated SalI-ApaI fragment comprising an ING-1 heavy chain variable region human engineered with a total of 13 low risk amino acid substitutions (FIG. 15; SEQ ID NO: 22), placing the low risk human engineered ING-1 heavy chain gene under control of a CMV promoter and mouse light chain 3′ untranslated region. Low risk changes as well as low plus moderate risk changes in an ING-1 heavy chain variable region are shown in FIG. 15. For the heavy chain, a total of 13 low risk changes were made for a low risk heavy chain variable region (SEQ ID NO: 23) as described, and separately a total of 20 low plus moderate risk changes were made for a low plus moderate risk variable region (SEQ ID NO: 24 and 25). The vector pING1936 separately attached contains a PCR-generated human engineered ING-1 heavy chain variable region with 13 low risk changes incorporated. A DNA fragment encoding the heavy chain variable region was constructed using 6 overlapping oligonucleotides GL1 (SEQ ID NO: 26), GL2 (SEQ ID NO: 27), GL3 (SEQ ID NO: 28), GL4 (SEQ ID NO: 29), GL5 (SEQ ID NO: 30), and GL6 (SEQ ID NO: 31). These segments were annealed to each other, extended with DNA polymerase and then the assembled variable region amplified by PCR using a 5′ forward primer GF (SEQ ID NO: 32) and a 3′ reverse primer GR (SEQ ID NO: 33), digested with SalI and ApaI to yield a restriction fragment that was cloned directly into expression vector pING1931 to generate pING1936 as shown in FIG. 14. Another expression vector, pING1942, was constructed using a similar method and is like pING1936 except that pING1942 comprises an ING-1 heavy chain variable region human engineered with the low plus moderate risk changes as shown in FIG. 15 (SEQ ID NO: 24 and 25). The low plus moderate risk modified heavy chain variable region was constructed using 6 overlapping oligonucleotides, including 2 used in the construction of the low risk modified variable region described above: GL1 (SEQ ID NO: 26), GM2 (SEQ ID NO: 34), GM3 (SEQ ID NO: 35), GM4 (SEQ ID NO: 36), GM5 (SEQ ID NO: 37), and GL6 (SEQ ID NO: 31).
F. Construction of Expression Vectors Comprising Human Engineered ING-1 Light Plus Heavy Chain Genes (Two Gene Vectors)
A vector pING1937, comprising human engineered ING-1 light plus heavy chain genes, was constructed using pING1933 and pING1936 (FIG. 16). pING1936 was digested with XbaI, treated with T4 polymerase and then digested with NotI. The ˜8780 bp restriction fragment was purified. pING1933 was digested with Nhel, then NotI and HpaI, and the ˜3716 bp fragment comprising a human engineered light chain gene was purified and ligated with the XbaI-NotI-digested pING1936 to generate pING1937, which has a neo gene for selection of G418-resistant transfectants. The variable region DNAs were re-sequenced before being used to construct light plus heavy chain expression vectors. The features of pING1937 are summarized in Table 1.
| TABLE 1 |
| Description of pING1937 vector. |
| Plasmid region | Start nt | End nt | Description |
| NotI-HindIII | 1 | 479 | = pUC12 2616–399 (includes pBR322 4291–4361, 2069– |
| 2354 and part of lac gene) | |||
| HindIII- | 479 | 643 | upstream region of Abelson murine leukemia virus 3′ |
| 1/2BamHI | LTR enhancer/promoter (= 4627–4804 of Reddy et al., | ||
| 1983 sequence; ref 8) | |||
| 1/2HincII-BamHI | 643 | 1414 | hCMV promoter (= −598 to 174 of Boshart et al., ref 1; |
| includes splice donor) | |||
| BamHI-SalI | 1414 | 1517 | SV40 16S splice acceptor (1654–1741 = SV40 1410–1497) |
| SalI-HindIII | 1517 | 1925 | ING-1 (heMab) light chain V region |
| HindIII-NSa | 1925 | 2263 | ING-1 light chain(heMab) C region (kappa) |
| NS-BamHI | 2263 | 3582 | LC genomic DNA including poly A site |
| BamHI- | 3582 | 3889 | upstream region of Abelson murine leukemia virus 3′ |
| 1/2BamHI | LTR enhancer/promoter | ||
| 1/2HincII-BamHI | 3889 | 4660 | hCMV promoter, including splice donor |
| BamHI-SalI | 4660 | 4763 | SV40 16S splice acceptor |
| SalI-ApaI | 4763 | 5206 | ING-1 (heMab) heavy chain V region |
| ApaI-XhoI | 5206 | 6198 | ING-1 heavy chain(heMab) C region (gamma-1) |
| XhoI-BamHI | 6198 | 7562 | LC genomic DNA including poly A site |
| BamHI-1/2BclI | 7562 | 7802 | SV40 polyadenylation (= SV40 2532–2774) |
| 1/2BstYI-NSa | 7802 | 8409 | SV40 small T intron (= SV40 4769–4099) |
| 1/2 SalI-NheI | 8409 | 9898 | bacterial neomycin phoshotransferase (neo) gene from |
| pSV2neo (coding region = 9545–8753) | |||
| NheI-PvuII | 9898 | 10242 | SV40 promoter (= SV40 5172–272) |
| PvuII-NotI | 10242 | 12496 | bacterial origin of replication and beta-lactamase |
| (ampicillin resistance) gene (= pBR322 2069–4290) | |||
| aNS - restriction site not identified. |
The vector, pING1959, which is similar to pING1937 except that it has a gpt gene for selection of mycophenolic acid-resistant transfectants, was constructed by ligating the ˜7696 bp HpaI-NotI fragment from pING1937 (comprising human engineered ING-1 light and heavy chain genes each fused to a CMV promoter and light chain 3′ untranslated region) with a ˜4441 bp HpaI-NotI fragment from pING4144 (described in Example 1 above) comprising a gene encoding gpt as shown in FIG. 17.
The vector, pING1957, which is similar to pING1937 and pING1959 except that it has a his gene for selection of histidinol-resistant transfectants, was constructed by ligating the ˜7696 bp HpaI-NotI fragment from pING1937 (as described above) with a ˜4639 bp HpaI-NotI fragment from pING4152 (described in Example 1 above) comprising a his gene as shown in FIG. 18.
Another vector pING1944 was constructed by similar methods used in the construction of pING1937 described above, and is similar to pING1937 except that pING1944 was constructed using pING1939 in place of pING1933 and using pING1942 in place of pING1936. The resulting vector, pING1944 comprises light chain and heavy chain variable regions (SEQ ID NOS: 11, 12, 24, 25) with both the low plus moderate risk substitutions as shown in FIGS. 13 and 15. Thus, expression vectors for both low risk ING-1 (pING1937) and low plus moderate risk ING-1 (pING1944) were prepared.
G. Construction of Expression Vectors Comprising Two Copies of Human Engineered ING-1 Light and Heavy Chain Genes (Four Gene Vectors)
A human engineered ING-1 heavy plus light chain vector, pING1937, was treated with NotI, T4 DNA polymerase in the presence of deoxyribonucleotides to blunt end and allowed to self-close, destroying the NotI site and generating the vector pING1963 lacking a NotI site as shown in FIG. 19. The vector pING1937 was then digested with NheI and EcoRV and the ˜9905 bp fragment was purified and ligated with the ˜10,298 bp NheI-HpaI fragment from pING1963 to generate the vector pING1964 as shown in FIG. 20 which comprises four ING-1 genes (a four gene vector). pING1964 has two copies of human engineered ING-1 light chain genes and two copies of ING-1 heavy chain genes, with each of the four genes under control of a CMV promoter and light chain 3′ untranslated region and a neo gene for selection of G418-resistant transfectants. A vector, pING1965, which is similar to pING1964 except that it contains a gpt gene for selection of mycophenolic acid-resistant transfectants was constructed by ligating the 1933 bp HpaI-SfiI fragment from pING1959 with the ˜17,935 bp HpaI-SfiI fragment from pING1964 as shown in FIG. 21.
Digestion of pING1964 or pING1965 at the unique NotI site yields a linear restriction fragment containing four transcription units: two copies of human engineered ING-1 light plus heavy chain genes configured so that a selective marker gene, neo, or gpt, respectively, is positioned between the two identical light and heavy chain transcription units. Viewed as linear NotI-digested DNA, the order of elements within the vector(s) is as follows: CMV promoter, light chain gene, light chain 3′ untranslated region, CMV promoter, heavy chain gene, light chain 3′ untranslated region, neo (pING1964) or gpt (pING1965) genes, bla (Ampr) gene, CMV promoter, light chain gene, light chain 3′ untranslated region, CMV promoter, heavy chain gene, light chain 3′ untranslated region, (FIG. 22).
This example describes the development and characterization of additional clones and cell lines transfected with additional exemplary vectors according to the present invention. The development and characterization of immunoglobulin producing cell lines is described from transfections, for example, with two gene vectors as described in Example 6.
A. pING1932 and pING1932R
The expression vectors, pING1932 and pING1932R described in Example 6 were transfected into Ex-Cell 301-adapted CHO-K1 cells. CHO-K1 cells adapted to suspension growth in Ex-Cell 301 medium were typically electroporated with 40 μg of linearized vector. Both pING1932 and pING1932R contain a unique NotI site. In preparation of DNA for transfection, digestion at NotI results in linear DNA such that light and heavy chain genes, under the control of a CMV promoter and light chain 3′ untranslated region, are separated by the selective marker gene when inserted into the CHO chromosome. With pING1932, the heavy and light chains are oriented in the same direction, whereas in pING1932R, they are oriented in opposite directions.
The cells were plated in 96 well plates containing Ex-Cell 301 medium supplemented with 2% FBS and G418. A total of 155 and 168 clones were screened in 96 well plates for pING1932 and pING1932R, respectively. The top 22 clones for each transfection were transferred to 24 well plates containing Ex-Cell 301 medium without FBS.
A productivity test was performed in 24 well plates in Ex-Cell 301 medium with or without 2% FBS. Cells were grown to extinction and culture supernatants tested for levels of secreted antibody by an immunoglobulin ELISA assay for IgG. The results demonstrated that the pING1932 transfectants generally secreted higher levels of immunoglobulin polypeptide than the pING1932R transfectants. Interestingly, in some cases, the levels of secreted immunoglobulin polypeptides were higher in the medium without FBS than in those supplemented with FBS. The top transfectants from each group secreted in the range from about 7 μg/ml IgG to more than about 30 μg/ml IgG.
The top 7 clones from the pING1932 transfection (including, for example, Clones 27, 40 and 82) and the top clone from the pING1932R transfection (Clone 168R) were transferred to shake flasks containing Ex-Cell 301 medium. As soon as the cells were adapted to suspension growth, a shake flask test was performed with these clones in Ex-Cell 301 medium with and without 2% FBS. The cells were grown for up to 10 days in 125 ml Erlenmeyer flasks containing 25 ml media. The flasks were sealed for the most of the incubation period and the levels of immunoglobulin polypeptide in the culture medium were determined by IgG ELISA at the end of the incubation period. The results of the initial shake flask test demonstrated that the top clone (Clone 40) secreted up to ˜66 μg/ml. In many cases, there was little difference in productivity between cultures grown with and without FBS.
The initial shake flask test was performed with flasks that were not opened regularly during the incubation period. Because introducing a gas exchange step at least every other day was found to significantly influence the productivity of certain rBPI21-producing CHO-K1 clones as described in Examples 3 and 4 above, this approach was evaluated with Clones 27, 40, 82 and 168R. Cells were seeded at 1.5×105 cells/ml into duplicate 125 ml Ehrlenmeyer flasks in 25 ml Ex-Cell 301 medium supplemented with 1% FBS and incubated at 37° C., 100 RPM. One set of flasks remained sealed for the duration of the incubation, while the other set was opened every day for cell counts and aeration. The results demonstrated that cells grown in flasks that were periodically opened expressed immunoglobulin polypeptide at a higher level (for example, from about 50 μg/ml to about 116 μg/ml) than those in which the flasks remained closed (for example, from about 35 μg/ml to about 81 μg/ml). These results also corresponded to those obtained in the first shake flask test (for example, from about 45 μg/ml to about 66 μg/ml), although the conditions were slightly different (1% FBS in the second test vs. 2% FBS in the first test).
The cultures that were opened periodically were also examined for growth and productivity at various times. The results of this analysis for Clones 27 and 40 indicated that the cells produced mouse-human chimeric antibody during both the log and the stationary phases.
B. pING1937
The expression vector pING1937, comprising one copy each of the human engineered ING-1 low risk light and heavy chain genes and the neo (G418-resistant) gene, was linearized by digested with XbaI followed by transfection into serum-free adapted CHO-K1 cells in Ex-Cell 301 medium. G418-resistant transfectants were selected and screened for immunoglobulin polypeptide expression. Clone 146 was selected as one of the top transfectants and produced up to about 60 mg/ml in shake flasks and about 200 mg/L in a fermentor.
This example describes a further increase in expression and production of polypeptides, for example, immunoglobulins, through a second transfection of an exemplary cell line with a second multi-transcription unit vector.
Two additional vectors (as described in Example 6) were employed that were identical to pING1937 each comprising two transcription units, with a low risk human engineered ING-1 light chain gene and a low risk human engineered heavy chain gene, except that they have either a his gene encoding histidinol resistance (pING1957) or a gpt gene encoding mycophenolic acid resistance (pING1959). The development of an ING-1 immunoglobulin producing CHO cell line, Clone 259, is described. Clone 259 was developed by transfecting Clone 146 cells (as described in Example 7) with the his expression vector pING1957. The development of another ING-1 immunoglobulin producing CHO cell line, Clone 373, is also described. Clone 373 was developed by transfecting a subclone of Clone 146, Clone 146.3 cells, with the gpt expression vector pING1959.
A. Transfection of Clone 146 with pING1957 and Development of Clone 259
Clone 146 was transfected with pING1957 in serum-free medium (Ex-Cell 301). First, 650 clones were screened from 2 transfections in 96 well plates. Then, 142 clones were selected from the 96 well plates and then screened from 24 well plates. Finally, 31 clones were selected from the 24 well plates and screened in shake flasks. The results for top producers in Ex-Cell 301 media without FBS of antibody as measured by HPLC demonstrated that the top producers expressed antibody at greater than 2 times higher levels than Clone 146. For example, the top producer, Clone 146.2-259, expressed 172 μg/ml and 192 μg/ml in two different tests.
Clone 146.2-259 was subcloned in Ex-Cell 301 medium and screened in a 24 well format. The top subclones were further selected based on shake flask productivity in Ex-Cell 301 serum-free medium. Shake flask results for top producers in Ex-Cell 301 without FBS of expression of immunoglobulin polypeptide as measured by HPLC demonstrated that the top Clone 259 subclones expressed antibody at about 1.5 to 2 times higher levels (e.g., from about 229 μg/ml to about 271 μg/ml) than the parent Clone 259 (e.g., about 116 μg/ml).
B. Transfection of Subclone of Clone 146, Clone 146.3, with pING1959 and Development of Clone 373
Clone 146, the initial pING1937 G418-resistant transfectant was also subjected to subcloning in Ex-Cell medium and one subclone, 146.3, secreted ˜121 μg/ml compared to ˜65 μg/ml for Clone 146 in Ex-Cell medium.
Since Clone 146.3 secreted at a relatively high level for a single transfection, it was therefore subjected to transfection with pING1959. Serum-free medium (Ex-Cell 301) adapted Clone 146.3 cells were transfected with pING1959 (same as pING1937 except for mycophenolic acid resistance as described in Example 6), plated in Ham's F12 with 5% FBS/mycophenolic acid and xanthene for selection. First, 520 clones were screened from 2 transfections in 96 well plates. Then 106 clones were selected from 24 well plates and screened. Finally, 26 clones were selected from the 24 well plates and screened in shake flasks. The sequential transfection of Clone 146.3 with pING1959 resulted in the selection of Clone 373 which expressed ˜225 and ˜257 μg/ml immunoglobulin polypeptide as determined by the shake flask results in Ex-Cell 301 medium.
This example describes a further increase in expression and production by a third sequential transfection of an exemplary cell line with a third multi-transcription unit vector, resulting in clones and cell lines that express increased levels of polypeptide production, for example, immunoglobulin production.
Clone 373 as described in Example 8 was chosen for additional studies and was further subjected to another sequential transfection using pING1957 (same as pING1937 except for histidinol resistance) in serum-free medium (Ex-Cell 301) and plated in Ex-Cell 301 supplemented with FBS and histidinol. Once the clones were selected, they were maintained with G418, MPA/xanthine/histidinol.
First, 160 clones were screened from 2 transfections in 96 well plates. Then, 48 clones were selected from the 96 well plates and screened in 24 well plates. Finally, 12 clones were selected from the 24 well plates and screened in shake flasks. Results for shake flask tests in Ex-Cell 301 yielded 8 top producing clones.
The top producing clones displayed an expression level ranging from about 310 to about 370 μg/ml, including Clone 132 which had an expression level of about 317 μg/ml.
The expression vectors, pING1959 (FIG. 17) and pING1965 (FIG. 21) containing one copy of each of the human engineered ING-1 light and heavy chain genes (pING1959, two gene vector) or two copies of each of the human engineered ING-1 light and heavy chain genes (pING1965, four gene vector) were transfected into CHO-K1 cells. CHO-K1 cells adapted to suspension growth in Ex-Cell 301 medium were electroporated with 40 μg of each linearized vector. After a recovery period of 2 days without selective agent, cells were plated in 96 well plates containing Ham's F12 medium supplemented with 5% FBS, mycophenolic acid and xanthine. A total of 300 and 255 clones were screened in 96 well plates for transfections with pING1959 and pING1965, respectively. For the pING1959 transfections, the top 18 clones were transferred to 24 well plates containing Ex-Cell 301 medium supplemented with 1% FBS. For the pING1965 transfections, the top 40 clones, were transferred to 24 well plates containing Ex-Cell 301 medium supplemented with 1% FBS. All 18 clones from the pING1959 transfection were next transferred to shake flasks containing Ex-Cell 301 medium supplemented with 1% FBS and evaluated for productivity. The top two producers, Clones 53 and 157 secreted ˜116 and ˜133 μg/ml, respectively in the presence of 1% FBS. In ExCell 301 medium without FBS supplementation Clones 53 and 157 secreted ˜117 and ˜121 μg/ml, respectively. For the pING1965 transfection, the top 8 clones were transferred to shake flasks and evaluated for productivity. The top producer, Clone 17, secreted ˜216 μg/ml in ExCell 301 medium supplemented with 1% FBS and ˜214 μg/ml in ExCell 301 medium without FBS supplementation. Accordingly, a cell line transfected with a four gene vector (pING1965) with two copies of each of the human engineered light and heavy chain genes did produce approximately twice as much immunoglobulin polypeptides as cell lines transfected with a two gene vector (pING1959) with one copy of each of the human engineered ING-1 light and heavy chain genes.
Vectors constructed according to Example 6 encoding human engineered ING-1 light and heavy chain genes, for example, pING1937 (low risk human engineered ING-1) and pING1944 (low plus moderate risk human engineered ING-1) were linearized by XbaI and used to transfect serum-free adapted CHO-K1 followed by selection of G418-resistant transfectants. Protein was purified from shake flask culture supernatants by passage over a protein A column. To evaluate the binding activity of the produced immunoglobulin polypeptides, competition binding assays with the human carcinoma cell line HT-29 were performed. This colorectal carcinoma cell line expresses a molecule known as Ep-CAM on its surface. Ep-CAM is recognized by immunoglobulin polypeptides having the antigen binding specificity of the mouse-human chimeric ING-1 antibody produced by cell line HB 9812 as deposited with the ATCC.
HTG29 cells were grown to confluency (˜2×105 cells/well) in 96 well plates. Mouse-human chimeric ING-1 was labeled with Na125I (Iodo-gen®, Pierce). The competition conditions included in a 100 μl assay volume, 0.1 nM labeled mouse-human chimeric ING-1, 2-fold serial dilutions of unlabeled immunoglobulin polypeptides, for example, as produced by cells transfected with pING1937 and pING1944. The labeled and unlabeled immunoglobulin polypeptides were incubated with HT-29 cells at 4° C. for 5 hours followed by washing. Labeled cells were removed with NaOH and counted. Data analysis was performed using Ligand [Munson and Redbard, Analytical Biochem. 107:220–239 (1980)].
Results for competition binding assays using immunoglobulin polypeptides obtained from transfection with the pING1937 (low risk) vector are shown in FIG. 23. The affinities for the mouse-human chimeric ING-1, containing an un-modified ING-1 murine variable domain, and the human engineered ING-1, with its variable domain modified at low risk positions, showed very similar affinities (2–5 nM) (FIG. 23).
Human engineered ING-1 modified at the low risk plus moderate risk positions was also evaluated using competition binding assays. Results with the human engineered ING-1 purified from pING1944 transfected cell culture supernatant are shown in FIG. 24. No differences in binding between the mouse-human chimeric and the human engineered (low risk) ING-1 were observed. The human engineered (low plus moderate risk) ING-1 obtained from transfection with the vector pING1944 showed a reduced competition binding activity as shown in FIG. 24.
To examine the contribution of the light and heavy chain moderate risk changes on ING-1 binding activity, immunoglobulin polypeptides were expressed from vectors constructed with either the combination of a low risk light chain with a low plus moderate risk heavy chain or a low risk heavy chain with a low plus moderate risk light chain. Vectors containing both modified ING-1 light chain plus heavy chain were used to transfect serum-free medium-adapted CHO-K1 cells. Approximately 100 clones were screened in microtiter plates to select the top 8 to 10 clones for shake flask evaluation. For production purposes, the best producers were grown in shake flasks and modified ING-1 IgG's were purified on a protein A column followed by concentration determination by A280.
Competition binding assays, employing iodinated human engineered (low risk) ING-1 and Ep-CAM-expressing HT-29 cells, were used to characterize modified ING-1 immunoglobulin polypeptides. Exemplary results are shown in FIG. 25. Moderate risk changes made to the light chain appeared to have the greatest impact on binding of the modified ING-1 antibodies tested. Moderate risk changes made to the heavy chain also appeared to affect binding, but to a lesser extent than the light chain changes. The results suggested that the effects observed with individual chains were additive.
Moderate risk changes include changes involving prolines (see, e.g., FIGS. 13 and 15). The moderate risk ING-1 light chain has 3 prolines introduced within Framework 1 (amino acids 1–59 (SEQ ID NO: 12)), and the moderate risk ING-1 heavy chain has 1 proline removed within framework 1 (amino acids 1–57 (SEQ ID NO: 25)). To examine the effects of proline changes in greater detail, low risk human engineered ING-1 light chain variable regions were constructed with prolines substituted in the low risk human engineered variable regions either one at a time (e.g. Proline 1 (P1) (SEQ ID NOS: 38 and 39), Proline 2 (P2) (SEQ ID NOS: 40 and 41), Proline 3 (P3) (SEQ ID NOS: 42 and 43) or combinations of prolines P1P2 (SEQ ID NOS: 44 and 45), PIP3 (SEQ ID NOS: 46 and 47), P2P3 (SEQ ID NOS: 48 and 49) of the light chain. As is shown in FIG. 13, the total of 3 amino acid positions in the low risk light chain that were changed to proline are within Framework 1. Therefore, all combinations of prolines were incorporated by using two overlapping oligonucleotides. KL1 (SEQ ID NO: 13) remained unchanged, and was as described in Example 6 for the construction of the low risk ING-1 light chain vector pING1933. The second oligonucleotide used was one of 6 variations of the oligonucleotide KM2 (SEQ ID NO: 21) described in Example 6 for the construction of the low plus moderate risk ING-1 light chain vector pING1939. The variation of KM2 chosen depended upon which combinations of prolines were to be introduced into the low risk ING-1 light chain sequence. A low risk light chain variable region was further with the first moderate risk proline (P1) substituted for the alanine at position 8 of the low risk ING-1 light chain (SEQ ID NO: 39). A low risk variable region was modified with the second moderate risk proline (P2) substituted for the leucine at position 15 of the low risk ING-1 light chain [SEQ ID NO: 41]. A low risk variable region was modified with the third moderate risk proline (P3) substituted for the serine at position 18 (SEQ ID NO: 43). By employing one of 6 variations of the KM2 oligonculeotide (SEQ ID NO: 21), each proline residue was first changed separately using the oligonucleotide P1 (SEQ ID NO: 50), P2 (SEQ ID NO: 51), P3 (SEQ ID NO: 52), and then in pairs using the oligonucleotide PIP2 (SEQ ID NO: 53), P1P3 (SEQ ID NO: 54) or P2P3 (SEQ ID NO: 55). The cloning strategy employed to construct expression vectors encoding various ING-1 light chains with different combinations of moderate risk proline residues incorporated into the low risk human engineered ING-1 light chain is shown in FIG. 26A. Subsequent to annealing the modified KM2 variant with the unmodified KL1 oligonucleotide, the annealling reaction was extended with DNA polymerase followed by amplification by PCR employing ING-1 light chain forward primer KF and reverse primer KBsr (SEQ ID NO: 56). The resultant product was then digested with SalI and BsrF1, followed by purification of the resultant 130 base pair fragment corresponding to low risk ING-1 light chain framework 1 region modified by the introduction of proline residues at one of three positions or in various combinations. The vector pING1939 was then digested with SalI and HpaI followed by purification of the large linear vector fragment. The vector pING1939 in a separate reaction was digested with BsrF1 and HpaI followed by purification of the 2 kb fragment.
A three way ligation was performed in which the HpaI end of the pING1939 linear vector first ligates with the HpaI end of the 2 kb fragment comprising the ING-1 light chain minus the framework 1 region. The full length ING-1 light chain is re-constructed when the BsrF1 end of the 130 bp proline modified fragment ligates to the BsrF1 end of the 2 kb fragment comprising the ING-1 light chain minus the framework 1 region. The vector was then closed when the SalI end of the 130 bp proline modified framework 1 region fragment ligates to the SalI end of the pING1939 linear vector. These light chains, modified at various proline positions, were then expressed with the low risk heavy chain.
Competition binding assays, again employing iodinated human engineered (low risk) ING-1 and Ep-CAM-expressing HT-29 cells, were used to determine the effect of prolines on binding activity. Results for modified ING-1 with a low risk heavy chain in combination with a light chain modified at P1, P2, P1P2, or P1P3 are shown in FIG. 26B. When compared with each other, changes at any one or a combination of two, of the tested prolines, have a similar effect. Changing all three positions to prolines has the greatest effect.
Competition binding assays with Ep-CAM-expressing cells such as HT-29 cells as described in Example 11 above require the use of isotopes and the maintenance and growth of cells for each assay, with the potential variability as with any cell-based assay. A direct binding ELISA assay with soluble Ep-CAM was also developed and used to evaluate the binding activity of immunoglobulin polypeptides produced by transfected cells according to the invention. For these assays, soluble human Ep-CAM (SEQ ID NOS: 57 and 58) was cloned and expressed. Immunoglobulin polypeptides used included human engineered (low risk) ING-1 from either 2 L or 500 L fermentor runs and soluble sEp-CAM from shake flasks or 2 L fermentors purified by ING-1 affinity chromatography.
Soluble Ep-CAM has previously been expressed in insect cells for expression in and secretion from CHO-K1 cells, truncated Ep-CAM (sEp-CAM) was cloned into an expression vector with the CMV promoter and the neo gene encoding for G418-resistance. The cloning strategy is outlined in FIG. 27. The vector pING1736 (described in Example 6 above) was digested with XhoI, followed by treatment with T4 DNA polymerase to blunt end. The blunt-ended linear vector was then digested with SalI and the large fragment was isolated. The Ep-CAM gene was obtained from HT-29 mRNA using a RT PCR reaction which incorporated a 5′ SalI site, a 3′ SmaI site, and truncated the Ep-CAM gene by introducing a stop codon at amino acid position 266 (SEQ ID NO: 57 or 58). Without that stop codon the Ep-CAM sequence comprises 314 amino acids as shown in (SEQ ID NOS: 59 and 60). For the RT PCR, two primers were used, an Ep-CAM forward primer (SEQ ID NO: 61) and an Ep-CAM reverse primer (SEQ ID NO: 62). The RT PCR reaction was digested with SmaI and SalI and the resultant ˜800 base pair fragment was purified and ligated with the digested pING1736 large fragment to produce vector pING1954.
Serum-free medium adapted CHO-K1 cells were then transfected with linearized pING1954. Transfectants were then selected in Ex-Cell 301 with 2% FBS. Screening was performed in 24 well plates, and shake flask formats by direct ELISA. Detection was performed with ING-1 followed by peroxidase-labeled goat anti-human IgG. 150 clones, adapted to grow without FBS were transferred to 24 well plates. The cells were grown to extinction and 50 μl supernatant was used to pre-coat the Immulon II plates. The top 6 clones were then transferred to shake flasks. The productivity for Clone 51 was subsequently estimated to be about 20 to 35 mg/L in both shake flasks and 2 liter fermentors.
Western blot analysis was employed to confirm that ELISA signal corresponded to specific proteins. Multiple bands were subsequently observed with the Ep-CAM supernatant. These multimers are also observed with purified Ep-CAM and were not an artifact of running crude culture supernatant, and therefore did not adversely impact the use of supernatants in an ELISA-based direct binding assay. Moreover, the lack of detection on a reduced gel is consistent with the non-linear nature of the known Ep-CAM epitope structure recognized by immunoglobulin polypeptides with antigen binding like ING-1.
Immulon II plates were precoated with the sEp-CAM antigen to immobilize it to the microplate. In preparation for pre-coating, the sEp-CAM antigen was first diluted in PBS coating. sEp-CAM test concentrations ranging from 0.25 to 20 μg/ml were added at 50 μl/well and incubated at 4° C. overnight. The plates were then washed 3 times with PBS-0.05% Tween. The plates were blocked by adding in PBS-0.05% Tween 1% BSA followed by a 30 minute incubation at 37° C.
Dilutions of immunoglobulin polypeptides were prepared in PBS-0.05% Tween, 1% BSA solution. two- or three-fold serial dilutions were prepared and added (100 μl/well) in duplicate or triplicate. After a 90 minute incubation at 37° C., the microplate was washed 3 times with PBS-0.05% Tween. For signal development, goat anti-human IgG (gamma- or Fc-specific) secondary antibody conjugated to peroxidase was added to each well and incubated for 60 minutes at 37° C. followed by addition of OPD at 0.4 mg/ml in citrate buffer plus 0.012% H2O2. After 5–10 minutes at room temperature, the assay was stopped by the addition of 100 μl 1M H2SO4 and the plates were read at 490 nm. Both goat anti-human IgG (gamma-specific) and goat anti-human IgG (Fc-specific) antibodies have been employed. Results of the direct binding ELISA for human engineered (low risk) ING-1 on soluble Ep-CAM is shown in FIG. 28.
This example describes the construction of expression vectors that comprise multiple copies of additional exemplary transcription units. Exemplary vector constructs are also described comprising multiple copies of exemplary gene sequences encoding polypeptides of interest, for example additional immunoglobulin gene sequences including light and/or heavy chain sequences.
To facilitate cloning of additional genes into exemplary expression vectors useful according to the invention, modular expression vectors containing a multicloning site between a CMV promoter and a light chain 3′ untranslated region were constructed. A polylinker, assembled from two complementary DNA oligonucleotides (pING1736 polylinker 5′TCGACGAATTCATCGATGGTACC3′ (SEQ ID NO. 63) and 3′GCTTAAGTAGCTACCATGG5′ (SEQ ID NO: 64)) (pING1732 polylinker 5′TCGACGAATTCATCGATGATATC3′ (SEQ ID NO 65)) and 3′GCTTAAGTAGCTACTATAG5′ (SEQ ID NO: 66)) which when annealed form a duplex insert containing several unique sites (SalI, EcoRI, ClaI, EcoRV for pING1732 and SalI, EcoRI, ClaI, KpnI for pING1736) and overhangs for cloning into two separate vectors, pING1732 and pING1736, each containing a neo gene for selection of G418-resistant clones. Both pING1732 and pING1736 were first digested with XhoI, treated with T4 polymerase and then the linear vectors digested a second time with SalI. The purified linear vectors and the polylinker inserts were purified and ligated. As shown in FIGS. 29 and 30, the two resultant vectors, pING1732-RIClaRV and pING1736-RIClaKpnI, are designed with several unique restriction sites between the 3′ end of the promoter/splice region and the 5′ end of the polyadenylation region and useful for expression of any inserted gene encoding a polypeptide of interest.
Light and heavy chains from a humanized antibody against CD18 (see, U.S. Pat. Nos. 5,985,279 and 5,997,867) were cloned as shown in FIGS. 31 and 32 into pING1732-RIClaRV and pING1736-RIClaKpnI, respectively, by PCR from a vector having light and heavy chain genes. A new light chain vector, designated pING2050, was prepared as outlined in FIG. 3, and was constructed by first digesting the vector pING1732-RIClaRV with XhoI and EcoRI followed by purification of the linear vector. A gene encoding an anti-CD18 light chain (designated LDP-1 LC in FIG. 31; SEQ ID NOS: 67 and 68), was then amplified by PCR from a vector having that gene employing a forward primer LDP5PrFwd (5′TGTATTGAATTCACCATGGGATGGAGCTG 3′; SEQ ID NO: 69) and a reverse primer LDPLC3PrXhoRev (sequence=5′GATAACTCGAGCTAACACTCTCCCCTGTTG 3′ (SEQ ID NO: 70)). The resultant PCR product was then purified, digested with the restriction enzymes EcoRI and XhoI, and ligated with the pING1732-RIClaRV made linear by digestion with EcoRI and XhoI. The resulting light chain vector was designated pING2050 as shown in FIG. 31.
A new heavy chain vector, designated pING2051, was prepared as outlined in FIG. 32. The vector pING1736-RIClaKpnI was first digested with XhoI and EcoRI followed by purification of the linear vector. A gene encoding an anti-CD18 heavy chain (designated LDP-1 HC in FIG. 32; SEQ ID NOS. 71 and 72) was then amplified by PCR from a vector having that gene employing a forward primer LDP 5PrFwd (5′TGTATTGAATTCACCATGGGATGGAGCTG3′; SEQ ID NO. 73) and a reverse primer LDPLX3PrXhoRev (5′CTTATCTCGAGTCATTTACCCGGAGACA GG3′ (SEQ ID NO: 74)). The resultant PCR product was then purified, digested with the restriction enzymes EcoRI and XhoI, and ligated with the pING1736-RIClaKpnI made linear by digestion with EcoRI and XhoI. The resulting heavy chain vector was designated pING2051 as shown in FIG. 32. The DNA sequences of the light and heavy chain genes in pING2050 and pING2051, respectively, were verified by DNA sequence analysis. The light and heavy chain DNA and amino acid sequences are shown in FIGS. 33 (SEQ ID NOS: 64 and 70) and 34 (SEQ ID NOS: 68 and 72), respectively.
The ping2052 a vector comprising anti-CD18 light plus heavy chain genes and a neo gene encoding resistance to G418 was constructed as shown in FIG. 35. The vector pING2050 was first digested with the restriction enzymes HpaI and NheI, and the large linear vector fragment purified. The vector pING2051 was digested with XbaI, blunt ended by treatment with T4 polymerase, digested with NheI, followed by purification of the large linear vector fragment. Both the pING2050 and pING2051 digested and purified vectors were then ligated to form a light plus heavy chain expression vector pING2052, which contains a neo gene encoding resistance to G418. As shown in FIG. 35, the pING2052 vector contains several unique restriction sites for generation of linear DNA in preparation for transfection. The features of pING2052 are summarized in Table 2.
| TABLE 2 |
| Description of pING2052 vector. |
| Plasmid region | Start nt | End nt | Description |
| NotI-HindIII | 1 | 479 | = pUC12 2616–399 (includes pBR322 4291–4361, 2069– |
| 2354 and part of lac gene) | |||
| HindIII- | 479 | 643 | upstream region of Abelson murine leukemia virus 3′ |
| 1/2BamHI | LTR enhancer/promoter (= 4627–4804 of Reddy et al., | ||
| (Sau3AI) | 1983 sequence; ref 5) | ||
| 1/2HincII-BamHI | 643 | 1414 | hCMV promoter (= −598 to 174 of Boshart et al., ref 1; |
| includes splice donor) | |||
| BamHI-EcoRI | 1414 | 1523 | SV40 16S splice acceptor (1421–1509 = SV40 1410–1497) |
| EcoRI-XhoI | 1523 | 2234 | LDP-01 light chain gene |
| XhoI-BamHI | 2234 | 3598 | LC genomic DNA including poly A site |
| BamHI-1/2HpaI | 3598 | 3741 | portion of SV40 polyadenylation (= SV40 2532–2668) |
| (XbaI-HindIII) | |||
| HindIII- | 3741 | 3905 | upstream region of Abelson murine leukemia virus 3′ |
| 1/2BamHI | LTR enhancer/promoter (= 4627–4804 of Reddy et al., | ||
| (Sau3AI) | 1983 sequence; ref 5) | ||
| 1/2HincII-BamHI | 3905 | 4676 | hCMV promoter, including splice donor |
| BamHI-EcoRI | 4676 | 4785 | SV40 16S splice acceptor |
| EcoRI-XhoI | 4785 | 6206 | LDP-01 heavy chain gene |
| XhoI-BamHI | 6206 | 7570 | LC genomic DNA including poly A site |
| BamHI-1/2BclI | 7570 | 7808 | SV40 polyadenylation (= SV40 2532–2774) |
| (Sau3AI) | |||
| 1/2BstYI(Sau3AI)- | 7808 | 8415 | SV40 small T intron (= SV40 4769–4099) |
| NSa | |||
| 1/2 SalI-NheI | 8415 | 9927 | bacterial neomycin phoshotransferase (neo) gene from |
| pSV2neo (coding region = 9583–8761) | |||
| NheI-PvuII | 9927 | 10250 | SV40 promoter (= SV40 5172–272) |
| PvuII-NotI | 10250 | 12504 | bacterial origin of replication and beta-lactamase |
| (ampicillin resistance) gene (= pBR322 2069–4290) | |||
| aNS - restriction site not identified. |
A second anti-CD18 light plus heavy chain expression vector, pING2057, containing a his gene for selection of histidinol-resistant transfectants, was also constructed by exchanging the neo gene in pING2052 with a his gene from pING1957 (described in Example 6 and FIG. 18). The vector pING2052 was first digested with the restriction enzymes HpaI and NotI followed by purification of the large linear vector fragment. The vector pING1957 was then digested with HpaI and NotI followed by purification of the smaller his gene fragment. The linear vector pING2052 and his gene fragments were then ligated to form a light plus heavy chain expression vector pING2057 as shown in FIG. 36, which contains a his gene for selection of histidinol-resistant transfectants. The features of pING2057 are summarized in Table 3.
| TABLE 3 |
| Description of pING2057 vector. |
| Plasmid region | Start nt | End nt | Description |
| NotI-HindIII | 1 | 479 | = pUC12 2616–399 (includes pBR322 4291–4361, 2069– |
| 2354 and part of lac gene) | |||
| HindIII- | 479 | 643 | upstream region of Abelson murine leukemia virus 3′ |
| 1/2BamHI | LTR enhancer/promoter (= 4627–4804 of Reddy et al., | ||
| (Sau3AI) | 1983 sequence; ref 5) | ||
| 1/2HincII-BamHI | 643 | 1414 | hCMV promoter (= −598 to 174 of Boshart et al., ref 1; |
| includes splice donor) | |||
| BamHI-EcoRI | 1414 | 1523 | SV40 16S splice acceptor (1421–1509 = SV40 1410–1497) |
| EcoRI-XhoI | 1523 | 2234 | LDP-01 light chain gene |
| XhoI-BamHI | 2234 | 3598 | LC genomic DNA including poly A site |
| BamHI-1/2HpaI | 3598 | 3741 | Part of SV40 polyadenylation (= SV40 2532–2668) |
| (XbaI-HindIII) | |||
| HindIII- | 3741 | 3905 | upstream region of Abelson murine leukemia virus 3′ |
| 1/2BamHI | LTR enhancer/promoter (= 4627–4804 of Reddy et al., | ||
| (Sau3AI) | 1983 sequence; ref 5) | ||
| 1/2HincII-BamHI | 3905 | 4676 | hCMV promoter, including splice donor |
| BamHI-EcoRI | 4676 | 4785 | SV40 16S splice acceptor |
| EcoRI-XhoI | 4785 | 6206 | LDP-01 heavy chain gene |
| XhoI-BamHI | 6206 | 7570 | LC genomic DNA including poly A site |
| BamHI-1/2BclI | 7570 | 7808 | SV40 polyadenylation (= SV40 2532–2774) |
| (Sau3AI) | |||
| 1/2BstYI | 7808 | 8415 | SV40 small T intron (= SV40 4769–4099) |
| (Sau3AI)-NSa | |||
| 1/2 SalI-StuI | 8415 | 9790 | bacterial histidine (his) gene from pSV2his (coding |
| region = 9760–8458) | |||
| StuI-PvuII | 9790 | 10113 | SV40 promoter (= SV40 5172–272) |
| PvuII-NotI | 10113 | 12342 | bacterial origin of replication and beta-lactamase |
| (ampicillin resistance) gene (= pBR322 2069–4290) | |||
| aNS - restriction site not identified. |
This example describes the development and characterization of additional clones and cell lines transfected with additional exemplary vectors according to the present invention, the development and characterization of additional immunoglobulin producing cell lines is described from transfections with vectors, including multigene vectors, as described in Example 13.
Cell lines were developed by electroporation of Ex-Cell 301—adapted CHO-K1 cells. Prior to transfection, the anti-CD18 light plus heavy chain neo vector, pING2052, was linearized with XbaI as shown in FIG. 37. Forty μg of linearized DNA typically was used in conjunction with ˜1×107 cells for transfection by electroporation. At least 3 electroporations were performed on any given day (for a total of ˜120 μg DNA used with ˜3×107 cells). Following a 2 day recovery period in non-selective Ex-Cell 301 medium supplemented with 2% FBS and 50 μg/ml gentamicin, the cells were plated at ˜4000 cells/well (200 μL/well) in 96 well plates in Ex-Cell 301 medium supplemented with Glutamine/Penicillin/Streptomycin, 1% FBS and with 0.8 mg/mL G418 sulfate; Geneticin® (Invitrogen, Carlsbad, Calif. ______) for transfectants with neo vectors. The plates were incubated at 37° C. in a CO2 incubator. Starting at days 10–12, the 96 well plates were scanned for wells containing single clones and the supernatants were sampled and screened by ELISA.
For the ELISA, culture supernatants from 96 or 24 well plates or from shake flasks were pipetted into 96 well dilution plates containing PBS, 1% BSA and 0.05% Tween 20 and stored overnight at 4° C. The supernatants were assayed for levels of immunoglobulin polypeptides by ELISA using Immulon 4 plates precoated overnight at 4° C. with an anti-Human IgG gamma coating antibody (Anti-Human IgG, Fd Fragment, Catalog No. 411411 or Anti-Human IgG, J Chain, Catalog No. 401441, Calbiochem, San Diego, Calif.). Following a blocking step with PBS containing 1% BSA and 0.05% Tween 20, the diluted supernatants were added to the plates. After incubation at room temperature for 1 hour on a plate shaker, the plates were washed three times with PBS supplemented with 0.05% Tween. A biotinylated anti-Human Kappa-specific secondary antibody (Pierce, Rockford, Ill., Product No. 31780) was added and the plates were incubated for 30 minutes at room temperature on a plate shaker. After additional washes, Extravidin (Sigma Chemical Co., St. Louis, Mo.) was added and the plates incubated for 30 minutes. Detection was performed with a KPL/ABTS system (KPL, Gaithersburg, Md.). After color development, the reaction was stopped by adding an equal volume of KPL stop buffer. Plates were read at 405 nm and concentrations were calculated using a program with a 4 parameter curve fit.
A total of 3–4 ELISAs were performed over ˜7 days for any given transfection. Clones secreting immunoglobulin polypeptides above an established level were transferred to 24 well plates and when confluent, replica 24 well plates were prepared. Screening was performed by ELISA on the original 24 well plate cultures once they reached extinction at ˜14 days post plating. The top-producing clones in 24 well plates were transferred to 6 well plates and then to shake flasks. CHO-K1 transfectants were inoculated into 25 mL Ex-Cell 301 medium in 125 mL shake flasks at ˜1–2×105 cells per mL, depending on the assay. Ex-Cell 301 media was supplemented with Glutamine/Penicillin/Streptomycin as described above. Selective agents generally were not incorporated into media used for the shake flask tests except in cases in which maintenance cultures were allowed to incubate to extinction. The cells were incubated at 37° C., 100 RPM until viability was 20% (usually ˜14 days). For growth and productivity experiments, viable cell density was determined either by hemocytometer and/or with the Guava flow cytometer (Guava Technologies, Inc., Burlingame, Calif. 94010) every 2 to 4 days. For studies in which the viable cell density was not determined, the flasks were opened and swirled in the biosafety hood every 2 to 3 days to provide some gas exchange. At the end of the incubation period, cells were removed by centrifugation and supernatants were assayed for immunoglobulin polypeptide concentration by ELISA. The highest producers identified by ELISA also were assayed by Protein A HPLC. For the Protein A HPLC, concentrations of immunoglobulin polypeptides in samples from transfectants were determined using a Shimadzu LC-10A HPLC System (Torrance, Calif.) and a Perceptive Biosystems' Protein A column (Albertville, Minn.; Poros A affinity, 20 μm, A/M, 4.6×100 mm, Catalog number 1-5022-26). HPLC Buffer A was phosphate buffered saline (PBS) at pH 7.2 and HPLC Buffer B was 0.1 M glycine/2% acetic acid, pH 3.0. The flow rate of the column was 4.0 ml/minute and the gradient was as follows: 100% A at 0–3 minutes; 100% B at 3.1–5 minutes; and 100% A at 5.1–8 minutes, with detection at 280 nm.
Three independent sets of transfections each consisting of three electroporations were performed using the neo vector, pING2052. A total of 3564 clones were screened from the 96 well plates. Of these clones, 471 were transferred from 96 well to 24 well plates and extinct cultures were screened by ELISA. The top 80 clones were transferred to shake flasks and extinct cultures were screened by ELISA and for some of the top clones, by Protein A HPLC. The results for the top 8 clones demonstrated that Clone 128D12 appeared to be the highest producer in Ex-Cell 301 medium with 14 day (extinct) shake flask productivities (determined by HPLC) of 134, 89, 157, and 127 μg/mL. Productivities determined by ELISA appeared to be up to ˜2-fold higher than those obtained by HPLC.
Six of the top clones were evaluated in a growth and productivity test in 125 mL shake flasks. The cultures were inoculated at 1×105 cells/mL in Ex-Cell 301 medium and incubated for 13 days. The results as shown in FIG. 38 demonstrated that Clone 128D12 was an optimal clone with respect to both growth and productivity. Cells containing only the neo selective marker were grown in the presence of a maintenance level of G418.
This example describes a further increase in expression and production of polypeptides, including additional immunoglobulins, through a second transfection of an exemplary cell line with a second multi-transcription unit vector.
The top-producing clone, Clone 128D12, selected from transfections with pING2052, the anti-CD18 light plus heavy chain neo vector as described in Example 13 above, were re-transfected with the pING2057 his vector also described in Example 13 above. For example, Clone 128D12 was re-transfected with pING2057 in two sets of transfections (3 electroporations per set). In preparation for transfection, vector pING2057 was made linear by digestion with XbaI. A total of 1101 clones from 96 well plates were screened by ELISA. The top 218 clones were transferred to 24 well plates and extinct replica cultures were screened by ELISA. The top 8 clones expressed immunoglobulin polypeptides at levels up to ˜3-fold higher than Clone 128D12 at the 24 well stage of screening. The top 120 clones were transferred to shake flasks. The top 10 clones secreted up to ˜290 μg/mL in extinct shake flask cultures in Ex-Cell 301 medium. Cells containing both neo and his selective markers were grown in the presence of a maintenance levels of geneticin and histidinol.
Clones 264E2, 254G12, 257G8, 262E8, 259B6, and 253E10 secreted from 250–290 μg/ml in shake flasks, with Clone 264E2 selected as a top producer. Clone 264E2, in several shake flash tests in Ex-Cell 301 medium produced ˜1.5 to greater than 2 times as much immunoglobulin POLYPEPTIDE as Clone 128D12 as measured by Protein A-HPLC.
This example describes the use of a number of additional cell culture media. A number of chemically-defined and/or animal-product free media have been designed for high protein production in CHO cells and are commercially available. Four such media were utilized for culture of transfectants, including ProCHO3, ProCHO4 and ProCHO5, produced by BioWhittaker, now known as Cambrex (Catalog No. 12-762Q, 12-029Q, and 12-766Q, respectively) and HyQ-PFCHO, produced by HyClone (Catalog No. SH30359.02). Each of these media was supplemented with Glutamine/Penicillin/Streptomycin and selective agents (e.g., G418 Geneticin® and/or histidinol). Shake flask tests were performed in the absence of selective agents. Titers were determined by Protein A HPLC on Day 14 or when culture viability dropped below 20%.
Clones 264E2 and 254G12, both Clone 128D12 re-transfectants, were passaged directly into these media and after a period of adaptation, production was assessed in shake flask tests. The cells readily adapted to all of these media where they grew quickly and to high cell densities (3–4 million cells/mL). The results of four Clone 254G12 or five Clone 264E2 sequential shake flask tests in ProCHO4 and ProCHO5 as shown in FIG. 39 demonstrate that Clone 264E2 expressed at up to ˜400 μg/ml in ProCHO4 and ProCHO5 while Clone 254G12 expressed up to ˜340 μg/ml in each of these media. The titers in HyQ and ProCHO3 media were lower than those in the other commercial media. For instance, in ProCHO3, Clone 264E2 produced 321 μg/mL and Clone 254G12 produced 252 μg/mL whereas in HyQ, Clone 264E2 produced 146 μg/mL and Clone 254G12 produced 140 μg/mL. A variety of cell culture media is useful for transfectants, including clones and cell lines obtained as described herein.
This example describes the construction of expression vectors that contain multiple copies of additional exemplary transcription units. Exemplary vector constructs are also described containing multiple copies of exemplary gene sequences encoding polypeptides of interest, for example, polypeptides with complement inhibitory activities including chimeric or fusion proteins with such activities. Several modular expression vectors that contain a multicloning site between a CMV promoter and a light chain 3′ untranslated region were constructed as described in Example 13 and utilized for the construction of additional expression vectors encoding complement inhibitory proteins. These expression vectors, pING1732-RIClaRV and pING1736-RIClaKpnI, are shown in FIGS. 29 and 30. A vector containing a CAB2.1 gene (see FIG. 1 of U.S. Pat. No. 6,316,253; SEQ ID NOS: 76 and 77) was cloned by PCR into the multiple cloning site of the neo (G418-resistance) expression vectors pING1732-RIClaRV and pING1736-RIClaKpnI as shown in FIGS. 40 and 41 respectively. The resulting CAB2.1—containing vectors were designated pING2053 as shown in FIG. 40 and pING2054 as shown in FIG. 41. As shown in FIG. 40, pING2053 was constructed by first digesting the vector pING1732-RIClaRV with the restriction enzyme ClaI followed by digestion with the restriction enzyme EcoRI. Next, the gene encoding CAB2.1 was then amplified by PCR employing a forward primer CAB2RI5PrFwd (5′GTTAAGAATTCCACCATG GAGCCTCCCGG3′ (SEQ ID NO: 78) and a reverse primer CAB2Cla3PrRev 3′GAAGTCCATGATGGGCAACTTAGCTAAATCT5′ (SEQ ID NO: 79). The resultant PCR product was then purified, digested with the restriction enzymes EcoRI and ClaI, and ligated with the pING1732-RIClaRV made linear by digestion with EcoRI and ClaI to form a CAB2.1 vector, pING2053, comprising a CAB2.1 gene (SEQ ID NO: 76).
An additional CAB2.1 single gene expression vector, designated pING2054, was prepared as shown in FIG. 41. The vector pING1736-RIClaKpnI was first digested with KpnI and EcoRI followed by purification of the linear vector. A gene encoding CAB2.1 was then amplified by PCR employing the forward primer CAB2RI5PrFwd as described above (SEQ ID NO: 78) and the reverse primer CAB2.1 Kpn3PrRev (3′GAAGTCCATCATGGGCAACTCCATGGAATCT5′ SEQ ID NO: 80). The resultant PCR product was then purified, digested with the restriction enzymes EcoRI and KpnI, and ligated with the pING1736-RIClaKpnI made linear by digestion with EcoRI and KpnI. This additional vector comprising CAB2.1 gene (SEQ ID NO: 76) was designated pING2054 as shown in FIG. 41. The features of pING2054 are summarized in Table 4.
| TABLE 4 |
| Description of pING2054. |
| Plasmid region | Start nt | End nt | Description |
| NotI-HindIII | 1 | 16 | Part of multilinker site |
| HindIII- | 16 | 179 | upstream region of Abelson murine leukemia virus 3′ |
| 1/2BamHI | LTR enhancer/promoter (= 4627–4804 of Reddy et al., | ||
| (Sau3AI) | (1983) sequence) | ||
| 1/2HincII-BamHI | 179 | 951 | hCMV promoter (= −598 to 174 of Boshart et al., Cell |
| 41:521–530 (1985) includes splice donor) | |||
| BamHI-EcoRI | 951 | 1060 | SV40 16S splice acceptor (= SV40 1410–1497) |
| EcoRI-KpnI | 1060 | 2910 | CAB2.1 gene |
| XhoI-BamHI | 2910 | 4275 | LC genomic DNA including poly A site |
| BamHI-1/2BclI | 4275 | 4512 | SV40 polyadenylation (= SV40 2532–2774) |
| (Sau3AI) | |||
| 1/2BstYI(Sau3AI)- | 4512 | 5123 | SV40 small T intron ( = SV40 4769–4099) |
| NSa | |||
| 1/2 SalI-NheI | 5123 | 6611 | bacterial neomycin phoshotransferase (neo) gene from |
| pSV2neo (coding region = 9583–8761) | |||
| NheI-PvuII | 6611 | 6951 | SV40 promoter (= SV40 5172–272) |
| PvuII-NotI | 6951 | 9910 | bacterial origin of replication and beta-lactamase |
| (ampicillin resistance) gene (= pBR322 2069–4290) | |||
| aNS - restriction site not identified. |
An additional vector with two copies of a CAB 2.1 gene, designated pING2055, with a neo gene for selection of G418-resistant transfectants was constructed as shown in FIG. 42. The vector pING2053 was first digested with the restriction enzyme HpaI blunt-end ligated to XbaI linkers and the linkers were trimmed with XbaI. The DNA was then digested with BglII and the large linear vector fragment comprising a CAB2.1 gene was purified. The vector pING2054 was digested with XbaI and BglII followed by purification of the large linear vector fragment with a CAB2.1 gene. Both the pING2053 and pING2054 digested and purified fragments were then ligated to form the two-gene expression vector pING2055 as shown in FIG. 42. The features of pING2055 are summarized in Table 5.
| TABLE 5 |
| Description of pING2055. |
| Plasmid region | Start nt | End nt | Description |
| NotI-HindIII | 1 | 479 | = pUC12 2616–399 (includes pBR322 4291–4361, 2069– |
| 2354 and part of lac gene) | |||
| HindIII- | 479 | 643 | upstream region of Abelson murine leukemia virus 3′ |
| 1/2BamHI | LTR enhancer/promoter (= 4627–4804 of Reddy et al., | ||
| (Sau3AI) | Proc Natl. Acad. Sci (USA) 80: 3623–3627 (1983) | ||
| 1/2HincII-BamHI | 643 | 1414 | hCMV promoter (= −598 to 174 of Boshart et al., Cell |
| 41: 521–530 (1985) includes splice donor) | |||
| BamHI-EcoRI | 1414 | 1523 | SV40 16S splice acceptor (1421–1509 = SV40 1410–1497) |
| EcoRI-ClaI | 1523 | 3369 | CAB2.1 gene |
| ClaI-BamHI | 3369 | 4744 | LC genomic DNA including poly A site |
| BamHI-1/2HpaI | 4745 | 4889 | portion of SV40 polyadenylation (= SV40 2532–2668) |
| (XbaI-HindIII) | |||
| HindIII- | 4889 | 5053 | upstream region of Abelson murine leukemia virus 3′ |
| 1/2BamHI | LTR enhancer/promoter (= 4627–4804 of Reddy et al., | ||
| (Sau3AI) | Proc Natl. Acad. Sci (USA) 80: 3623–3627 (1983) | ||
| 1/2HincII-BamHI | 5053 | 5825 | hCMV promoter, including splice donor |
| BamHI-EcoRI | 5825 | 5934 | SV40 16S splice acceptor |
| EcoRI-XhoI | 5933 | 7779 | CAB2.1 gene |
| XhoI-BamHI | 7779 | 9149 | LC genomic DNA including poly A site |
| BamHI-1/2BclI | 9149 | 9386 | SV40 polyadenylation (= SV40 2532–2774) |
| (Sau3AI) | |||
| 1/2BstYI(Sau3AI)- | 9386 | 9997 | SV40 small T intron (= SV40 4769–4099) |
| NSa | |||
| 1/2 SalI-NheI | 9997 | 11485 | bacterial neomycin phoshotransferase (neo) gene from |
| pSV2neo (coding region = 9583–8761) | |||
| NheI-PvuII | 11485 | 11831 | SV40 promoter (= SV40 5172–272) |
| PvuII-NotI | 11831 | 14059 | bacterial origin of replication and beta-lactamase |
| (ampicillin resistance) gene (= pBR322 2069–4290) | |||
| aNS - restriction site not identified. |
Another vector with two copies of a CAB2.1 gene, designated pING2056 was also constructed as shown in FIG. 43. ping 2056 which has the same structure as the neo two-gene vector pING2055, except that it encodes a his gene for histinol-resistance to facilitate multiple transfections. The features of pING2056 are summarized in Table 6.
| TABLE 6 |
| Description of pING2056. |
| Plasmid region | Start nt | End nt | Description |
| NotI-HindIII | 1 | 479 | = pUC12 2616–399 (includes pBR322 4291–4361, 2069– |
| 2354 and part of lac gene) | |||
| HindIII- | 479 | 643 | upstream region of Abelson murine leukemia virus 3′ |
| 1/2BamHI | LTR enhancer/promoter (= 4627–4804 of Reddy et al., | ||
| (Sau3AI) | Proc Natl. Acad. Sci (USA) 80: 3623–3627 (1983) | ||
| 1/2HincII-BamHI | 643 | 1414 | hCMV promoter (= −598 to 174 of Boshart et al., cell |
| 41: 521–530 (1985); includes splice donor) | |||
| BamHI-EcoRI | 1414 | 1523 | SV40 165 splice acceptor (1421–1509 = SV40 1410–1497) |
| EcoRI-XhoI | 1523 | 3369 | CAB2.1 gene |
| XhoI-BamHI | 3369 | 4745 | LC genomic DNA including poly A site |
| BamHI-1/2HpaI | 4745 | 4890 | Part of SV40 polyadenylation (= SV40 2532–2668) |
| (XbaI-HindIII) | |||
| HindIII- | 4890 | 5053 | upstream region of Abelson murine leukemia virus 3′ |
| 1/2BamHI | LTR enhancer/promoter (= 4627–4804 of Reddy et al., | ||
| (Sau3AI) | Proc Natl. Acad. Sci (USA) 80: 3623–3627 (1983) | ||
| 1/2HincII-BamHI | 5053 | 5825 | hCMV promoter, including splice donor |
| BamHI-EcoRI | 5825 | 5934 | SV40 16S splice acceptor |
| EcoRI-XhoI | 5933 | 7779 | CAB2.1 gene |
| XhoI-BamHI | 7779 | 9149 | LC genomic DNA including poly A site |
| BamHI-1/2BclI | 9149 | 9386 | SV40 polyadenylation (= SV40 2532–2774) |
| (Sau3AI) | |||
| 1/2BstYI | 9386 | 9997 | SV40 small T intron (= SV40 4769–4099) |
| (Sau3AI)-NSa | |||
| 1/2 SalI-StuI | 9997 | 11368 | bacterial histidine (his) gene from pSV2his (coding |
| region = 9760–8458) | |||
| StuI-PvuII | 11368 | 11694 | SV40 promoter (= SV40 5172–272) |
| PvuII-NotI | 11694 | 13920 | bacterial origin of replication and beta-lactamase |
| (ampicillin resistance) gene (= pBR322 2069–4290) | |||
| aNS - restriction site not identified. |
This example describes the development and characterization of clones and cell lines transfected with additional exemplary vectors according to the present invention. The development and characterization of polypeptide-producing cell lines is described from transfections with vectors, including multigene vectors, as described in Example 17.
Transfections were performed first with a single gene (pING2054) and a two gene (pING2055) neo vector. Cell lines were developed by electroporation of Ex-Cell 301-adapted CHO-K1 cells by the procedure of [Andreason, et al., BioTechniques 6: 650 (1988)]. CHO-K1 cells were obtained from ATCC (CCL61).
Prior to transfection, 40 μg of either the single-gene neo vector pING2054 or the two-gene neo vector pING2055 was digested with XbaI yielding a linearized DNA structure shown in FIG. 44A and B respectively. Forty μg of linearized DNA typically was used in conjunction with ˜1×107 cells for each transfection. Generally, one to three electroporations were performed on any given day. Following a 2 day recovery period in non-selective Ex-Cell 301 medium supplemented with 2% FBS, the cells were plated at ˜4000 cells/well in 96 well plates in Ex-Cell 301 medium supplemented with Glutamine-Pen-Strep, 1% FBS and with 0.8 mg/ml G418 (Geneticin®, Invitrogen). The plates were incubated at 37 C in a CO2 incubator.
Starting at days 10–12, the 96 well plates for either the single gene neo vector pING2054 or the two gene neo vector pING2055 transfections, were scanned for single clone colonies that were then sampled and screened by ELISA. A total of 3–4 ELISAs was performed over ˜7 days. ELISAs were performed by removing culture supernatants from the 96 well plates (same for 24 well plates and shake flasks) and pipetting into 96 well dilution plates containing PBS and 1% BSA and stored overnight at 4 C. The supernatants were assayed for expressed polypeptide levels by ELISA using Immulon 4 plates precoated overnight at 4 C with GB24, a mouse anti-DAF monoclonal antibody, diluted to 2 μg/ml in PBS. Following two washes with wash buffer (PBS+0.1% Tween 20) and a blocking step with PBS containing 0.05% Tween and 1% BSA, the diluted supernatants were added to the PBS−1% BSA buffer in the plates and incubated at 37 C for 1 hour. The plates then were washed three times with PBS supplemented with 0.05% Tween and 0.5 μg/mL of a rabbit anti-Human CAB2.1 secondary antibody was added and incubated for 1 hour at 37 C. After three washes, a 1:15,000 dilution of horse radish peroxidase-conjugated goat anti-rabbit IgG (Pierce) was added and incubated for 1 hour. Detection was performed with the TMB system (KPL). After color development, the reaction was stopped by adding an equal volume of 1N H2SO4 and plates read at 450nm.
Clones secreting polypeptides above an established baseline level, as determined by ELISA, were transferred from the 96 well plates to 24 well plates and replica plates prepared. Screening was performed by ELISA on extinct 24 well plate cultures as described above for 96 well plates. The top-producing clones in 24 well plates were then transferred to shake flasks. Shake flask experiments were performed by inoculating into 25 ml Ex-Cell 301 at ˜1–2×105 cells per ml, depending on the assay. Ex-Cell 301 medium was supplemented as described above. Selective agents generally were not incorporated into media used for the shake flask tests except in cases in which maintenance cultures were allowed to incubate to extinction. The cells were incubated at 37 C, 100 RPM until viability was 20% (usually ˜14 days). For growth and productivity experiments, viable cell density was determined either by hemocytometer and/or with the Guava Personal Flow Cytometer every 2 to 4 days. For studies in which the viable cell density was not determined, the flasks were opened for a few seconds in the biosafety hood every 2 to 3 days to provide some gas exchange. At the end of the experiment, cells were removed by centrifugation and filtration and the supernatants were assayed for CAB2.1 concentration either by ELISA as described above or by reverse-phase HPLC.
Specifically, for the transfections with pING2054, two independent sets of transfections were performed, one consisting of a single electroporation and the other consisting of two. A total of thirty eight 96 well plates were prepared from each of these transfections. Multiple colonies were observed in a number of wells following the 10–12 day incubation. 528 wells containing single colonies were screened by ELISA as described above. Wells with multiple colonies were triturated, pooled, labeled with a FITC conjugated mouse anti-human CD46 monoclonal antibody and subjected to Fluorescence activated cell sorting (FACS) analysis using a FACS Vantage SE-Diva (BD Biosciences, ______). FACS sorted clones were re-plated in 96 well plates and 223 individual clones were screened by ELISA.
The top 125 pING2054 transfectants from the 96 well format, of which 29 were from the FACS sorted pool, were transferred to 24 well plates and extinct cultures were screened by ELISA as described above. The results demonstrated that the top transfectants produced between ˜9 to ˜16 μg/ml in 24 well plates (including, for example, Clones 3G8, 13A5, and 19A6). The top 30 of these clones, of which 4 were from the FACS sorted pool, were transferred to shake flasks and grown in ExCell 301 (without FBS) to ˜20% viability as described above. Extinct cultures were screened by ELISA. The top three producing clones, based on shake flask tests, included Clones 3G8, 13A5, and 19A6. Clone 3G8 appeared to be the highest producer in Ex-Cell 301 medium with 14 day (extinct) shake flask productivities (determined by HPLC) of 107, 86, and 116 μg/mL.
To select further for high expression, Clone 3G8 was subcloned. Cells were plated at in 96 well plates 5, 3, and 1 cells/well in Excell 301 medium. A total of 417 subclones were screened at the 96 well plate level as described above, with the top subclones secreting up to ˜14 μg/ml (including, for example, 3G8- G5-F1, 3G8-G13-C12, and 3G8-G10-H4). The top 60 subclones were next screened in 24 well plates, with the top producers secreting ˜48 μg/ml (including, for example, 3G8-G5-F1, 3G8-G13-C-12, 3G8-G5E8, and 3G8-GA11). Twelve clones were selected and transferred to shake flask in ExCell medium without FBS. The cells were grown to extinction and the culture supernatant was assayed by reverse phase HPLC. Clone G5F1 appeared to be the highest producing clone in Ex-Cell 301 medium with 14 day (extinct) shake flask productivities (determined by HPLC) of 184, 194 and 182 μg/ml. This level was almost 2-fold higher than observed with the parent, Clone 3G8. Clone G5F1 was evaluated in a growth and productivity test in a 125 mL shake flask. The culture was inoculated at 1×105 cells/mL and incubated for 12–13 days. The results as shown in FIG. 45 demonstrate that Clone G5F1 was satisfactory with respect to both growth and productivity, maintaining a viability of 49% at Day 12 and ˜175 μg/ml at Day 13.
Transfections and clonal development using pING2055, were performed as described for Clone 3G8, transfected with pING2054. Specifically, two independent sets of transfections each consisting of three electroporations were performed using pING2055 prepared as described above. A total of 3374 individual clones were screened from the 96 well plates. The top 263 clones were transferred to 24 well plates and extinct cultures were screened by ELISA. The results demonstrated that the top transfectants produced between ˜9 to ˜37 μg/ml in 24 well plates (including, for example, 44C8, 11C8, 122B10, 176C6, 156B8, and 134G3). The top 85 of these clones were transferred to shake flasks and extinct cultures were screened by ELISA or RP-HPLC as described above. Clones 156B8 and 176C6 appeared to be the highest producers in Ex-Cell 301 medium with 14 day (extinct) shake flask productivities (determined by HPLC) up to ˜140 μg/ml for both.
This example describes the further increase in expression and production of polypeptides, including polypeptides with complement inhibitory activities, through a second transfection of an exemplary cell line with a multi-transcription unit vector.
The top CAB2.1-producing clones developed with the single-gene neo vector (Clone 3G8) and the two-gene neo vector (Clones 156B8 and 176C6) were re-transfected with the CAB2.1 two-gene histidinol vector, pING2056. Specifically, Clone 3G8, transfected with a neo single gene vector pING2054, was re-transfected the with a his two gene vector pING2056 linearized to position the histinol-resistant selective marker gene between the two CAB2.1 genes as shown in FIG. 44 for the neo vector. Cells were transfected as described above. A total of 387 clones were screened in 96 well plates in ExCell 301 medium and 120 clones were selected for screening in 24 well plates. Twenty of the top producing clones, secreting up to a ˜68 μg/ml, were selected to be transferred to shake flasks in ExCell medium without FBS. Cells were grown to extinction and culture supernatants assayed by reverse phase HPLC. The top producing clones secreted in the range of ˜142 to ˜218 μg/ml (including, for example, 3G8-217B4, 3G8-206C3, 3G8-196E3, 3G8-190C7, 3G8-185E9, 3G8-178G2, 3G8-190E5). For example, for these top producing clones, Clone 217B4 consistently secreted more than ˜200 μg/ml, and Clone 206C3 secreted up to ˜199 μg/ml, Clone 185E9 secreted up to ˜177 μg/ml.
The top re-transfectants of Clone 3G8, clones 217B4, 206C3, and 185E9, were subcloned. Specifically, Clones 217B4, 206C3 and 185E9 were subcloned by plating at 1, 3 or 5 cells/well in Ex-Cell 301 medium. A total of 282 individual subclones of Clone 217B4, 301 of Clone 206C3 and 308 of Clone 185E9 were screened in 96 well plates as described above for the development of clone 3G8. Of these, 59 subclones of Clone 217B4, 55 subclones of Clone 206C3 and 52 subclones of Clone 185E9 were transferred to 24 well plates and extinct cultures screened by ELISA as described above for the development of Clone 3G8. The top producing 217B4 subclones secreted in the range of ˜35 to ˜57 μg/ml. The top producing 206C3 subclones secreted in the range of ˜31 to ˜40 μg/ml and the top producing 185E9 subclones secreted from ˜17 to ˜61 μg/ml. Of these, the top 20, 16 and 16 clones for 217B4, 206C3 and 185E9 respectively, were transferred to shake flasks. Extinct cultures were screened by ELISA as previously described and in some cases by RP-HPLC. The top 217B4 subclones, including clones B3B8, B5B10, B4E11, B6E3, B7C4, B7B7, and B9B4, secreted between ˜170 to ˜216 μg/ml in shake flasks. The top 206C3 subclones including clones C2B7, C2D10, C4F1, C7H7, and C9A2, secreted in the range ˜147 to ˜188 μg/ml in shake flasks. The top 185E9 subclones, including clones E7E9, E3C11, E10H5, and E2D5, secreted in the range of ˜163 to ˜210 μg/ml in shake flasks. These subclones did not produce higher levels of CAB2.1 than their parent clones in Ex-Cell 301 medium and their titers remained similar to those of their parental clones.
To further evaluate expression in Ex-Cell 301 media, Clone 217B4, Clone 206C3, Subclones C2B7 and C7H7of Clone 206C3 and Subclones B6E3 and B5B10 of Clone 217B4 were evaluated in shake flask test in which growth and productivity were measured over the course of the study. For this study, cells grown in Ex-Cell 301 were inoculated at 1×105 cells/ml. The cells were grown as described for the development of Clone 3G8. The growth and productivity for the re-transfectants of Clone 3G8, Clones 217B4 and 206C3, were measured. At 2 weeks the cells were still viable (1×106 cells/ml for Clone 206C3 and 4×105 cells/ml for Clone 217B4) and supported a titer of ˜150 μg/ml. The growth and productivity results for the Clone 206C3 Subclones C2B7 and C7H7 were also measured. The results are similar to those for the parent Clone 206C3 with a measurable decrease in cell viability at 2 weeks and productivity at or just below ˜150 μg/ml. Growth and productivity results for Clone 217B4 Subclones B6E3 and B5B110 were also measured. When compared to Clone 206C3 and its subclones C2B7 and C7H7, these results demonstrate in productivities at two weeks, of ˜200 μg/ml for B6E3 and above ˜150 μg/ml for B5B10.
In view of the current problems and limitations in the art, there are many advantages of the present invention over the art, increased polypeptide production, production efficiency, greater control and regulation over the quantities of polypeptide expressed, increased stability of cell lines, and decreased costs for materials, reagents, and other resources. Thus, the present invention solves many of the problems previously existing in the art. One way in which the present invention solves these problems and is advantageous compared to the prior art is through the disclosed methods of vector construction that, when linearized, avoid homologous recombination of multiple copies of transcription units by separating the transcription unit DNA sequences with at least one selective marker gene. While the above examples demonstrate the use of two and four transcription unit vectors, the present invention contemplates use of all multiple transcription unit vectors, including three, four, five, six, and so on copies of transcription unit DNA sequences. Such vectors are constructed with at least one selective marker gene separating the transcription units in a manner which results in the avoidance or nullification of homologous recombination. All such permutations of multiple transcription unit copies are contemplated by this invention as one skilled in the art would recognize through this disclosure. A second way in which the present invention solves the problems of the prior art is through the disclosed methods to further increase expression through sequential transfections with multiple-transcription unit constructs. This leads to clones which can produce substantially increased levels of proteins and polypeptides, while still maintaining viability and stability in growth medium, thus, solving many problems in the art.
All patents, patent applications, literature publications and test methods cited herein are hereby incorporated by reference. The reader's attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.
All the features disclosed in this specification (including any accompanying claims, abstract, and drawings) may be replaced by alternative features serving the same, equivalent or similar purpose, unless expressly stated otherwise. Thus, unless expressly stated otherwise, each feature disclosed is only one example of a generic series of equivalent or similar features.
Although the present invention has been described in considerable detail with reference to certain preferred versions thereof, other versions are possible. Many variations of the present invention will suggest themselves to those skilled in the art in light of the above detailed disclosure. All such modifications are within the full intended scope of the appended claims. Therefore, the spirit and scope of the appended claims should not be limited to the description of the preferred embodiments contained herein.
1. A method of producing a recombinant polypeptide comprising:
(a) culturing cells which have been transformed or transfected with a vector or segment thereof comprising multiple copies of a transcription unit separated by at least one selective marker gene, wherein the transcription unit encodes a polypeptide, under selective conditions; and
(b) expressing said polypeptide from the multiple copies of the transcription unit,
wherein the vector or segment thereof is linearized such that the selective marker gene is positioned between at least two transcription unit copies, as [(transcription unit)x-selective marker gene-(transcription unit)x], and wherein x is 1–4.
2. A method of producing a recombinant polypeptide from multiple copies of a transcription unit comprising the following steps:
(a) transfecting or transforming cells with a vector or segment thereof comprising multiple copies of a transcription unit separated by at least one selective marker gene wherein the transcription unit encodes a polypeptide;
(b) culturing cells from step (a) under selective conditions of at least one of the selective marker gene(s) thereby selecting for cells transfected or transformed with the vector or segment thereof;
(c) optionally repeating steps (a) and (b) on the cells to sequentially transfect or transform the cells with an additional vector or segment thereof from step (a) wherein each additional vector or segment thereof comprises a different selective marker gene; and
(d) expressing the polypeptide from the multiple copies of the transcription unit,
wherein the vector or segment thereof is linearized such that the selective marker gene is positioned between at least two transcription unit copies, as [(transcription unit)x-selective marker gene-(transcription unit)x], and wherein x is 1–4.
3. The method of claim 1 or 2 wherein the cells have been transformed or transfected sequentially with an additional vector or segment thereof, and wherein each additional vector or segment thereof comprises a different selective marker gene.
4. The method of claim 1 or 2 wherein the number of multiple copies of the transcription unit is at least two and not more than eight.
5. The method of claim 1 or 2 wherein the number of multiple copies of the transcription unit is two.
6. The method of claim 1 or 2 wherein the expression vector is linearized with a restriction enzyme, such that the selective marker gene is positioned between at least two transcription unit copies, as [(transcription unit)x-selective marker gene-(transcription unit)x], and wherein x is 1–4.
7. The method of claim 1 or 2 wherein each transcription unit is under the control of a promoter and 3′ untranslated region.
8. The method of claim 1 or 2 wherein each transcription unit is under the control of a promoter and 3′ untranslated region, and wherein the promoter is an SV40, HSV, bovine growth hormone, thymidine kinase, MPSV, mouse beta globin, human EF1, MSV-LTR, RSV, MMTV-LTR, CMV, MLV, Chinese hamster elongation factor, or mouse Abelson LTR promoter.
9. The method of claim 1 or 2 wherein each transcription unit is under the control of a promoter and 3′ untranslated region, and wherein the expression vector further comprises multiple enhancers.
10. The method of claim 1 or 2 and wherein the transcription unit encodes two different subunits of a multimeric protein.
11. The method of claim 1 or 2 wherein the transcription unit encodes immunoglobulin light and heavy chain polypeptides.
12. The method of claim 1 or 2 wherein the transcription unit encodes at least the variable regions of immunoglobulin light and heavy chain polypeptides.
13. The method of claim 1 or 2 wherein the transcription unit encodes a BPI protein product.
14. The method of claim 1 or 2 wherein the transcription unit encodes a BPI protein product that is a BPI fragment, BPI analog, BPI variant, or BPI-derived peptide.
15. The method of claim 1 or 2 wherein the multiple copies of the transcription unit are in a direct repeat orientation.
16. The method of claim 1 or 2 wherein the multiple copies of the transcription unit are in an inverted repeat orientation.
17. The method of claim 1 or 2 wherein the transcription unit is a bi-cistronic or poly-cistronic unit.
18. The method of claim 1 or 2 wherein the transcription unit comprises an internal ribosome entry site.
19. The method of claim 1 or 2 wherein the multiple copies of the transcription unit are between 25% and 100% identical.
20. The method of claim 1 or 2 wherein the multiple copies of the transcription unit are 25% identical.
21. The method of claim 1 or 2 wherein the multiple copies of the transcription unit are at least 70%, at least 80%, or at least 90% identical.
22. The method of claim 1 or 2 wherein the multiple copies of the transcription unit are 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical.
23. The method of claim 1 or 2 wherein the multiple copies of the transcription unit are 100% identical.
24. The method of claim 1 or 2 wherein the selective marker gene is a gpt, res, neo, his, DHFR, GS, adenosine deaminase (ADA), thymidine kinase (TK), adenine phosphoribosyl transferase (APRT), zeocin resistance, hygromycin resistance or puromycin resistance gene.
25. The method of claim 1 or 2, wherein the selective marker gene is an amplifiable selective marker gene.
26. The method of claim 1 or 2 wherein the expression vector or segment thereof comprising at least two copies of a transcription unit separated by at least one selective marker gene is integrated into the cell chromosome.
27. The method of claim 1 or 2 wherein the cell is transformed or transfected by at least one and not more than six expression vectors or segments thereof.
28. The method of claim 1 or 2 wherein the cells are eukaryotic cells.
29. The method of claim 1 or 2 wherein the cells are plant, insect, mammalian or yeast cells.
30. The method of claim 1 or 2 wherein the cells are Chinese hamster ovary (CHO) cells or CHO-K1 cells.
31. The method of claim 1 or 2 wherein the cells are from a DHFR+ CHO-K1 cell line, a DHFR− DUKX-B11 (DXB11) cell line or DG-44 cell line.
32. The method of claim 1 or 2 wherein the cells are in an attached state.
33. The method of claim 1 or 2 wherein the cells are in a suspension state.
34. The method of claim 1 or 2 wherein the polypeptide is accumulated in an intracellular compartment.
35. The method of claim 1 or 2 wherein the polypeptide is secreted from the cells into the culture supernatant.
36. The method of claim 1 or 2 wherein the polypeptide is isolated.
37. A method of producing a recombinant polypeptide comprising:
(a) culturing cells which have been transformed or transfected with a vector or segment thereof comprising multiple copies of a transcription unit each separated by a selective marker gene, wherein the transcription unit encodes a polypeptide, under selective conditions; and
(b) expressing said polypeptide from the multiple copies of the transcription unit,
wherein the vector or segment thereof is linearized such that the selective marker gene is positioned between at least two transcription unit copies, as [(transcription unit)x-selective marker gene-(transcription unit)x], and wherein x is 1–4.
38. The method of claim 37 wherein the cells have been transformed or transfected sequentially with an additional vector or segment thereof, and wherein each additional vector or segment thereof comprises a different selective marker gene.
39. The method of claim 37 wherein the number of multiple copies of the transcription unit is at least two and not more than eight.
40. The method of claim 37 wherein the number of multiple copies of the transcription unit is two.
41. The method of claim 37 wherein the expression vector is linearized with a restriction enzyme, such that the selective marker gene is positioned between at least two transcription unit copies, as [(transcription unit)x-selective marker gene-(transcription unit)x], and wherein x is 1–4.
42. The method of claim 37 wherein each transcription unit is under the control of a promoter and 3′ untranslated region.
43. The method of claim 37 wherein each transcription unit is under the control of a promoter and 3′ untranslated region, and wherein the promoter is an SV40, HSV, bovine growth hormone, thymidine kinase, MPSV, mouse beta globin, human EF1, MSV-LTR, RSV, MMTV-LTR, CMV, MLV, Chinese hamster elongation factor, or mouse Abelson LTR promoter.
44. The method of claim 37 wherein each transcription unit is under the control of a promoter and 3′ untranslated region, and wherein the expression vector further comprises multiple enhancers.
45. The method of claim 37 and wherein the transcription unit encodes two different subunits of a multimeric protein.
46. The method of claim 37 wherein the transcription unit encodes immunoglobulin light and heavy chain polypeptides.
47. The method of claim 37 wherein the transcription unit encodes at least the variable regions of immunoglobulin light and heavy chain polypeptides.
48. The method of claim 37 wherein the transcription unit encodes a BPI protein product.
49. The method of claim 37 wherein the transcription unit encodes a BPI protein product that is a BPI fragment, BPI analog, BPI variant, or BPI-derived peptide.
50. The method of claim 37 wherein the multiple copies of the transcription unit are in a direct repeat orientation.
51. The method of claim 37 wherein the multiple copies of the transcription unit are in an inverted repeat orientation.
52. The method of claim 37 wherein the transcription unit is a bi-cistronic or poly-cistronic unit.
53. The method of claim 37 wherein the transcription unit comprises an internal ribosome entry site.
54. The method of claim 37 wherein the multiple copies of the transcription unit are between 25% and 100% identical.
55. The method of claim 37 wherein the multiple copies of the transcription unit are 25% identical.
56. The method of claim 37 wherein the multiple copies of the transcription unit are at least 70%, at least 80%, or at least 90% identical.
57. The method of claim 37 wherein the multiple copies of the transcription unit are 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.
58. The method of claim 37 wherein the multiple copies of the transcription unit are 100% identical.
59. The method of claim 37 wherein the selective marker gene is a gpt, res, neo, his, DHFR, GS, adenosine deaminase (ADA), thymidine kinase (TK), adenine phosphoribosyl transferase (APRT), zeocin resistance, hygromycin resistance or puromycin resistance gene.
60. The method of claim 37 wherein the selective marker gene is an amplifiable selective marker gene.
61. The method of claim 37 wherein the expression vector or segment thereof comprising at least two copies of a transcription unit separated by at least one selective marker gene is integrated into the cell chromosome.
62. The method of claim 37 wherein the cell is transformed or transfected by at least one and not more than six expression vectors or segments thereof.
63. The method of claim 37 wherein the cells are eukaryotic cells.
64. The method of claim 37 wherein the cells are plant, insect, mammalian or yeast cells.
65. The method of claim 37 wherein the cells are Chinese hamster ovary (CHO) cells or CHO-K1 cells.
66. The method of claim 37 wherein the cells are from a DHFR+ CHO-K1 cell line, a DHFR− DUKX-B11 (DXB11) cell line or DG-44 cell line.
67. The method of claim 37 wherein the cells are in an attached state.
68. The method of claim 37 wherein the cells are in a suspension state.
69. The method of claim 37 wherein the polypeptide is accumulated in an intracellular compartment.
70. The method of claim 37 wherein the polypeptide is secreted from the cells into the culture supernatant.
71. The method of claim 37 wherein the polypeptide is isolated.