-
2010-09-21
10/408,168
2003-04-03
US 7,799,523 B2
2010-09-21
-
-
Jehanne S Sitton
2025-05-24
Compositions and methods are provided for determining in a subject a risk for having, or presence of, altered bone mineral density such as osteoporosis or osteopenia or other conditions characterized by decreased or increased bone density. Specifically, the invention relates to determination of a sclerostin gene region nucleotide polymorphism (SRP) in DNA of the sclerostin gene region of human chromosome 17. In certain embodiments, SRPs that indicate an increased risk for altered bone mineral density occur as gender-associated polymorphisms. Isolated polynucleotides comprising representative SRPs are also provided.
Get notified when new applications in this technology area are published.
C12Q1/68 IPC
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids
C12P19/34 IPC
Preparation of compounds containing saccharide radicals; Preparation of nitrogen-containing carbohydrates; N-glycosides; Nucleotides Polynucleotides, e.g. nucleic acids, oligoribonucleotides
C07H21/02 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
C07H21/04 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
This application claims the benefit of U.S. Provisional Patent Application No. 60/370,088, filed Apr. 3, 2002, which is incorporated herein by reference in its entirety.
1. Field of the Invention
The present invention relates to the field of molecular biology, and more particularly, the detection of nucleotide polymorphisms including single nucleotide polymorphisms, and still more particularly nucleotide polymorphisms associated with osteoporosis.
2. Description of the Related Art
Two or three distinct phases of changes to bone mass occur over the life of an individual (see Riggs, West J. Med. 154:63-77, 1991). The first phase occurs in both men and women, and proceeds to attainment of a peak bone mass. This first phase is achieved through linear growth of the endochondral growth plates, and radial growth due to a rate of periosteal apposition. The second phase begins around age 30 for trabecular bone (flat bones such as the vertebrae and pelvis) and about age 40 for cortical bone (e.g., long bones found in the limbs) and continues to old age. This phase is characterized by slow bone loss, and occurs in both men and women. In women, a third phase of bone loss also occurs, most likely due to postmenopausal estrogen deficiencies. During this phase alone, women may lose an additional 10% of bone mass from the cortical bone and 25% from the trabecular compartment (see Riggs, supra).
Loss of bone mineral content can be caused by a wide variety of conditions including, for instance, osteoporosis, osteopenia, bone dysplasia and bone fracture, and may result in significant medical problems. For example, osteoporosis is a debilitating disease in humans characterized by marked decreases in skeletal bone mass and mineral density, structural deterioration of bone including degradation of bone microarchitecture and corresponding increases in bone fragility and susceptibility to fracture in afflicted individuals. Osteoporosis in humans is preceded by clinical osteopenia (bone mineral density that is greater than one standard deviation but less than 2.5 standard deviations below the mean value for young adult bone), a condition found in approximately 25 million people in the United States. Another 7-8 million patients in the United States have been diagnosed with clinical osteoporosis (defined as bone mineral content greater than 2.5 standard deviations below that of mature young adult bone). Osteoporosis is one of the most expensive diseases for the health care system, costing tens of billions of dollars annually in the United States. In addition to health care-related costs, long-term residential care and lost working days add to the financial and social costs of this disease. Worldwide approximately 75 million people are at risk for osteoporosis. See, e.g., Eisman, 1999 Endocrine Rev. 20:788; Giguere et al., 2000 Clin. Genet. 57:161; Zmuda et al., 1999 Genetic Epidemiol. 16:356; Uitterlinden, 1999 European Calcified Tissue Society on the World Wide Web at ectsoc.orq/reviews/005uitt.htm.
The frequency of osteoporosis in the human population increases with age, and among Caucasians is predominant in women (who comprise 80% of the osteoporosis patient pool in the United States). The increased fragility and susceptibility to fracture of skeletal bone in the aged is aggravated by the greater risk of accidental falls in this population. More than 1.5 million osteoporosis-related bone fractures are reported in the United States each year. Fractured hips, wrists, and vertebrae are among the most common injuries associated with osteoporosis. Hip fractures in particular are extremely uncomfortable and expensive for the patient, and for women correlate with high rates of mortality and morbidity.
Although osteoporosis has been defined as an increase in the risk of fracture due to decreased bone mass, none of the presently available treatments for skeletal disorders can substantially increase the bone density of adults. There is a strong perception among all physicians that drugs are needed which could increase bone density in adults, particularly in the bones of the wrist, spinal column and hip that are at risk in osteopenia and osteoporosis.
Current strategies for the prevention of osteoporosis may offer some benefit to individuals but cannot ensure resolution of the disease. These strategies include moderating physical activity (particularly in weight-bearing activities) with the onset of advanced age, including adequate calcium in the diet, and avoiding consumption of products containing alcohol or tobacco. For patients presenting with clinical osteopenia or osteoporosis, all current therapeutic drugs and strategies are directed to reducing further loss of bone mass by inhibiting the process of bone absorption, a natural component of the bone remodeling process that occurs constitutively.
For example, estrogen is now being prescribed to retard bone loss. There is, however, some controversy over whether there is any long term benefit to patients and whether there is any effect at all on patients over 75 years old. Moreover, use of estrogen is believed to increase the risk of breast and endometrial cancer.
High doses of dietary calcium, with or without vitamin D has also been suggested for postmenopausal women. However, high doses of calcium can often have unpleasant gastrointestinal side effects, and serum and urinary calcium levels must be continuously monitored (see Khosla and Rigss, Mayo Clin. Proc. 70:978-982, 1995).
Other therapeutics which have been suggested include calcitonin, bisphosphonates, anabolic steroids and sodium fluoride. Such therapeutics however, have undesirable side effects (e.g., calcitonin and steroids may cause nausea and provoke an immune reaction, bisphosphonates and sodium fluoride may inhibit repair of fractures, even though bone density increases modestly) that may prevent their usage (see Khosla and Rigss, supra).
No currently practiced therapeutic strategy involves a drug that stimulates or enhances the growth of new bone mass. Further the present invention provides methods for determining whether someone is susceptible to osteoporosis. Further, the present invention provides other, related advantages.
Summary of the Invention It is an aspect of the present invention to provide a method for determining a risk for or presence of altered bone mineral density in a subject, comprising determining a presence or absence of at least one sclerostin gene region nucleotide polymorphism in a biological sample from a subject, the sample comprising DNA having a sequence that corresponds to at least 50 consecutive nucleotides that are present in SEQ ID NO:1, wherein the presence of at least one sclerostin gene region nucleotide polymorphism at a position that corresponds to a non-coding region of SEQ ID NO:1 indicates an increased risk of altered bone mineral density. In one embodiment the invention provides a method for determining a risk for or presence of altered bone mineral density in a subject, comprising determining a presence or absence of at least one sclerostin gene region nucleotide polymorphism in a biological sample from a subject, said sample comprising DNA having a sequence that corresponds to at least 50 consecutive nucleotides that are present in SEQ ID NO:1; and determining gender of the subject, wherein the presence of at least one gender-associated sclerostin gene region nucleotide polymorphism indicates an increased risk of altered bone mineral density. In another embodiment the invention provides a method for determining a risk for or presence of altered bone mineral density in a subject, comprising determining a presence or absence of at least one sclerostin gene region nucleotide polymorphism in a biological sample from a subject, said sample comprising DNA having a sequence that corresponds to at least 50 consecutive nucleotides that are present in SEQ ID NO:1, wherein the presence of at least one sclerostin gene region nucleotide polymorphism in the sample indicates an increased risk of altered bone mineral density, and wherein the polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from position 4103, 17966, 18293, 58083, 74235 and 91068.
In another embodiment there is provided a method for determining a risk for or presence of altered bone mineral density in a subject, comprising determining a presence or absence of at least one sclerostin gene region nucleotide polymorphism in a biological sample from a female subject, said sample comprising DNA having a sequence that corresponds to at least 50 consecutive nucleotides that are present in SEQ ID NO:1, wherein the presence of at least one sclerostin gene region nucleotide polymorphism in the sample indicates an increased risk of decreased bone mineral density, and wherein the polymorphism is located at a nucleotide that corresponds to a GGA trinucleotide insertion between positions 10565 and 10566 in SEQ ID NO:1. In another embodiment the invention provides a method for determining a risk for or presence of altered bone mineral density in a subject, comprising determining a presence or absence of at least one sclerostin gene region nucleotide polymorphism in a biological sample from a male subject, said sample comprising DNA having a sequence that corresponds to at least 50 consecutive nucleotides that are present in SEQ ID NO:1, wherein the presence of at least one sclerostin gene region nucleotide polymorphism in the sample indicates an increased risk of increased bone mineral density, and wherein the polymorphism is located at a nucleotide that corresponds to position 91068 in SEQ ID NO:1. In a further embodiment the polymorphism at position 91068 comprises an A91068G substitution.
Turning to another embodiment of the present invention, there is provided a method for determining a risk for or presence of altered bone mineral density in a subject, comprising determining a presence or absence of at least one sclerostin gene region nucleotide polymorphism in a biological sample from a subject, said sample comprising DNA having a sequence that corresponds to at least 50 consecutive nucleotides that are present in SEQ ID NO:1, wherein the presence of at least one sclerostin gene region nucleotide polymorphism in the sample indicates an increased risk of altered bone mineral density, and wherein the polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is not between positions 10354 and 16757.
In another embodiment the invention provides a method for determining a risk for or presence of altered bone mineral density in a subject, comprising determining a presence or absence of at least one sclerostin gene region nucleotide polymorphism in a biological sample from a subject, said sample comprising DNA having a sequence that corresponds to at least 50 consecutive nucleotides that are present in SEQ ID NO:1, wherein the presence of at least one sclerostin gene region nucleotide polymorphism in the sample indicates an increased risk of altered bone mineral density, and wherein the polymorphism is not located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from the group consisting of position 10357 and a trinucleotide insertion between positions 10565 and 10566.
In still another embodiment the invention provides method for determining a risk for or presence of altered bone mineral density in a first subject suspected of having or being at risk for having altered bone mineral density, comprising determining a presence or absence of at least one sclerostin gene region nucleotide polymorphism that is associated with altered bone mineral density in each of a first and a second biological sample comprising DNA having a sequence that corresponds to at least 50 consecutive nucleotides that are present in SEQ ID NO:1, said first biological sample being obtained from said first subject and said second sample being obtained from a second subject known to be free of a risk or presence of altered bone mineral density, wherein the presence of at least one sclerostin gene region nucleotide polymorphism that is associated with altered bone mineral density in said first biological sample and the absence of said sclerostin gene region nucleotide polymorphism at a corresponding nucleotide in said second biological sample indicates an increased risk of altered bone mineral density, and wherein the polymorphism is not located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from the group consisting of position 10357 and a trinucleotide insertion between positions 10565 and 10566.
According to another embodiment of the invention there is provided a method for determining a risk for or presence of altered bone mineral density in a first subject suspected of having or being at risk for having altered bone mineral density, comprising determining a presence or absence of at least one sclerostin gene region nucleotide polymorphism that is associated with altered bone mineral density in each of a first and a second biological sample comprising DNA having a sequence that corresponds to at least 50 consecutive nucleotides that are present in SEQ ID NO:1, said first biological sample being obtained from said first subject and said second sample being obtained from a second subject known to be free of a risk or presence of altered bone mineral density, wherein the presence of at least one sclerostin gene region nucleotide polymorphism that is associated with altered bone mineral density in said first biological sample and the absence of said sclerostin gene region nucleotide polymorphism at a corresponding nucleotide in said second biological sample indicates an increased risk of altered bone mineral density, and wherein the polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is not between positions 10354 and 16757. According to certain further embodiments of the above described methods, at least one sclerostin gene region nucleotide polymorphism is selected from a single nucleotide substitution at a nucleotide position in SEQ ID NO:1 that is selected from C4103G, C17966G, A18293G, T58083C, A74235G and A91068G
In certain other further embodiments of the above described methods, the presence in a sample from a female subject of at least one sclerostin gene region nucleotide polymorphism that is a GGA trinucleotide insertion between nucleotide positions 10565 and 10566 in SEQ ID NO:1 indicates an increased risk of decreased bone mineral density. In certain other further embodiments of the above described methods the step of determining comprises contacting at least one biological sample with at least one oligonucleotide primer having a nucleotide sequence that is complementary to a portion of a nucleic acid molecule having the sequence set forth in SEQ ID NO:1, under conditions and for a time sufficient to allow hybridization of said primer to the DNA. In certain further embodiments the method comprises detecting hybridization and extension of the oligonucleotide primer to produce a product, and therefrom determining the presence or absence of at least one sclerostin gene region nucleotide polymorphism. In certain other further embodiments of methods described above, the step of determining comprises contacting each of said first and second biological samples with an oligonucleotide primer having a nucleotide sequence that is complementary to a sequence present in the DNA of said first sample and present in the DNA of said second sample, under conditions and for a time sufficient to allow hybridization of said primer to the DNA; and detecting hybridization and extension of the primer to the DNA of the first sample to produce a first product and hybridization and extension of the primer to the DNA of the second sample to produce a second product distinguishable from said first product, and therefrom determining the presence or absence of at least one sclerostin gene region nucleotide polymorphism. According to certain further embodiments the DNA in the sample is amplified. According to certain other further embodiments the DNA in the first sample is amplified and the DNA in the second sample is amplified. According to certain other further embodiments the oligonucleotide primer comprises a nucleic acid molecule which comprises a nucleotide sequence set forth in a sequence selected from SEQ ID NOS:2, 3, 5, 6, 8, 9, 11, 12, 14, 15, 17, 18, 23, 24, 26, 27, 29 and 30.
Turning to another aspect, the present invention provides an isolated polynucleotide comprising a sclerostin gene region polymorphism, the polynucleotide comprising a nucleotide sequence selected from (a) the sequence set forth in SEQ ID NO:1 and containing at least one sclerostin gene region nucleotide polymorphism, wherein said polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is selected from position 4103, 10357, 10566, 17966, 18293, 58083, 74235 and 91068, (b) the sequence set forth in SEQ ID NO:1 and containing a single nucleotide substitution at a position corresponding to a nucleotide position in SEQ ID NO:1 that is selected from C4103G, C10357T, C17966G, A18293G, T58083C, A74235G and A91068G, (c) the sequence set forth in SEQ ID NO:1 and containing a GGA trinucleotide insertion between nucleotide positions 10565 and 10566 in SEQ ID NO:1, (d) the sequence set forth in any one of SEQ ID NOS:4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 32 and 33, and (e) a sequence that is fully complementary to any sequence of (a)-(d).
In another embodiment the invention provides an isolated polynucleotide of at least 25 nucleotides comprising a polynucleotide sequence that corresponds to a portion of the nucleic acid sequence set forth in SEQ ID NO:1 in which at least one sclerostin gene region nucleotide polymorphism is present, wherein the polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is not between positions 10354 and 16757. In a further embodiment the sclerostin gene region nucleotide polymorphism is selected from (a) a single nucleotide substitution at a position corresponding to a nucleotide position in SEQ ID NO:1 that is selected from C4103G, C10357T, C17966G, A18293G, T58083C, A74235G and A91068G, and (b) a GGA trinucleotide insertion at a position corresponding to a nucleotide position in SEQ ID NO:1 that is between nucleotide positions 10565 and 10566. In another embodiment then invention provides an isolated polynucleotide comprising a nucleotide sequence selected from SEQ ID NOS:2, 3, 5, 6, 8, 9, 11, 12, 14, 15, 17, 18, 23, 24, 26, 27, 29 and 30. In certain embodiments the invention provides an immobilized polynucleotide, comprising any of the above described polynucleotides coupled to a solid support, and in certain other embodiments the invention provides a nucleic acid array comprising a plurality of such isolated nucleic acid molecules immobilized on a solid support. In another embodiment there is provided a kit for identifying a sclerostin gene region polymorphism, comprising any of the above-described isolated polynucleotides and an ancillary reagent.
In another embodiment the invention provides a method of stratifying human subjects according to sclerostin gene region polymorphisms, comprising determining presence or absence of at least one sclerostin gene region polymorphism in a biological sample obtained from each of a plurality of subjects, wherein (i) presence or absence of a sclerostin gene region polymorphism indicates altered bone mineral density, and (ii) the polymorphism is located at a nucleotide that corresponds to a nucleotide position of SEQ ID NO:1 that is not between positions 10354 and 16757, and therefrom stratifying said subjects. In a further embodiment the sclerostin gene region polymorphism is selected from (a) a single nucleotide substitution at a position corresponding to a nucleotide position in SEQ ID NO:1 that is selected from C4103G, C10357T, C17966G, A18293G, T58083C, A74235G and A91068G, and (b) a GGA trinucleotide insertion at a position corresponding to a nucleotide position in SEQ ID NO:1 that is between nucleotide positions 10565 and 10566. In certain further embodiments the method comprises determining gender of each subject, wherein the presence of at least one gender-associated sclerostin gene region nucleotide polymorphism indicates an increased risk of altered bone mineral density, and in certain still further embodiments the gender-associated sclerostin gene region nucleotide polymorphism is selected from (a) a GGA trinucleotide insertion at a position corresponding to a nucleotide position in SEQ ID NO:1 that is between nucleotide positions 10565 and 10566, presence of which in a female subject indicates an increased risk of decreased bone mineral density, and (b) an A-to-G substitution at a position corresponding to nucleotide position 91068 in SEQ ID NO:1, presence of which in a male subject indicates an increased risk of increased bone mineral density.
Accordingly, the present invention provides nucleotide sequences that are associated with polymorphisms in the SOST gene region. Sequences associated with these nucleotide polymorphisms include SEQ ID NOs: 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 32 and 33 as identified herein. As described in greater detail below, diseases and/or conditions associated with bone density can be detected and/or predicted by the methods of the current invention using nucleotide sequences disclosed herein. Exemplary diseases and/or conditions include without limitation, osteopenia, osteoporosis and gum diseases.
These and other aspects of the present invention will become evident upon reference to the following detailed description and attached drawings. In addition, various references are set forth herein which describe in more detail certain aspects of this invention, and are therefore incorporated by reference in their entireties as if fully set forth herein.
FIG. 1 shows that the effect of the genotypes associated with bone density strongly increase with age.
SEQ ID NO:1 sets forth the DNA sequence of the SOST gene region, including the SOST gene body and extended flanking sequence.
SEQ ID NO:2 sets forth the DNA sequence for the forward primer used in the detection of the SRP1 polymorphism.
SEQ ID NO:3 sets forth the DNA sequence for the reverse primer used in the detection of the SRP1 polymorphism.
SEQ ID NO:4 sets forth the DNA sequence corresponding to the SRP1 polymorphism.
SEQ ID NO:5 sets forth the DNA sequence for the forward primer used in the detection of the SRP2 polymorphism.
SEQ ID NO:6 sets forth the DNA sequence for the reverse primer used in the detection of the SRP2 polymorphism.
SEQ ID NO:7 sets forth the DNA sequence corresponding to the SRP2 polymorphism.
SEQ ID NO:8 sets forth the DNA sequence for the forward primer used in the detection of the SRP3 polymorphism.
SEQ ID NO:9 sets forth the DNA sequence for the reverse primer used in the detection of the SRP3 polymorphism.
SEQ ID NO:10 sets forth the DNA sequence corresponding to the SRP3 polymorphism.
SEQ ID NO:11 sets forth the DNA sequence for the forward primer used in the detection of the alternative SRP2+SRP3 polymorphism.
SEQ ID NO:12 sets forth the DNA sequence for the reverse primer used in the detection of the alternative SRP2+SRP3 polymorphism.
SEQ ID NO:13 sets forth the DNA sequence corresponding to the alternative SRP2+SRP3 polymorphism.
SEQ ID NO:14 sets forth the DNA sequence for the forward primer used in the detection of the SRP5 polymorphism.
SEQ ID NO:15 sets forth the DNA sequence for the reverse primer used in the detection of the SRP5 polymorphism.
SEQ ID NO:16 sets forth the DNA sequence corresponding to the SRP5 polymorphism.
SEQ ID NO:17 sets forth the DNA sequence for the forward primer used in the detection of the SRP6 polymorphism.
SEQ ID NO:18 sets forth the DNA sequence for the reverse primer used in the detection of the SRP6 polymorphism.
SEQ ID NO:19 sets forth the DNA sequence corresponding to the SRP6 polymorphism.
SEQ ID NO:20 sets forth the DNA sequence for the forward primer used in the detection of the alternate SRP5+SRP6 polymorphism.
SEQ ID NO:21 sets forth the DNA sequence for the reverse primer used in the detection of the alternate SRP5+SRP6 polymorphism.
SEQ ID NO:22 sets forth the DNA sequence corresponding to the alternate SRP5+SRP6 polymorphism.
SEQ ID NO:23 sets forth the DNA sequence for the forward primer used in the detection of the SRP7 polymorphism.
SEQ ID NO:24 sets forth the DNA sequence for the reverse primer used in the detection of the SRP7 polymorphism.
SEQ ID NO:25 sets forth the DNA sequence corresponding to the SRP7 polymorphism.
SEQ ID NO:26 sets forth the DNA sequence for the forward primer used in the detection of the SRP8 polymorphism.
SEQ ID NO:27 sets forth the DNA sequence for the reverse primer used in the detection of the SRP8 polymorphism.
SEQ ID NO:28 sets forth the DNA sequence corresponding to the SRP8 polymorphism.
SEQ ID NO:29 sets forth the DNA sequence for the forward primer used in the detection of the SRP9 polymorphism.
SEQ ID NO:30 sets forth the DNA sequence for the reverse primer used in the detection of the SRP9 polymorphism.
SEQ ID NO:31 sets forth the DNA sequence corresponding to the SRP9 polymorphism.
SEQ ID NO:32 is an alternative sequence for the SRP3 polymorphism.
SEQ ID NO:33 is an alternative sequence for the SRP2+SRP3 polymorphism.
SEQ ID NO:34 presents the human chromosome 17 sequence set forth in EMBL Acc. No. AC003098.
The present invention relates to the unexpected discovery of specific nucleotide polymorphisms in the sclerostin gene region of human chromosome 17. More specifically, the invention relates to the surprising determination of sclerostin gene region nucleotide polymorphisms (SRP) in non-protein coding regions of the sclerostin gene region, including SRP the presence of which in a DNA sample from a subject correlates with an increased likelihood that the subject has, or is at risk for having, altered (e.g., increased or decreased in a statistically significant manner relative to a control subject) bone mineral density. The invention is thus directed generally to compositions and methods for diagnosing the risk or presence of altered bone mineral density (BMD) in a subject, and to compositions and methods for the identification of agents that may be suitable for treating diseases, disorders or other conditions associated with altered BMD (i.e., BMD that is increased or decreased in a statistically significant manner relative to normal control BMD levels). The invention may be useful for pharmacogenomic purposes, for example to stratify patient populations according to the suitability of particular therapeutic agents for use in such populations.
As also discussed above, “altered bone mineral density” may refer to any condition or state, including those that accompany a disease, where any structure or activity that is directly or indirectly related to formation and/or maintenance of bone mass has been changed in a statistically significant manner. Altered BMD may have its origin in cells and tissues (or their products) that are proximately involved in bone formation and maintenance as well as in cells and tissues (or their products) acting from distal sites to regulate bone formation or maintenance, in direct interactions between genes and/or gene products of such cells and tissues, or in structural or functional changes that occur as the result of interactions between intermediates that may be formed as the result of such interactions, including metabolites, catabolites, substrates, precursors, cofactors and the like.
According to the present invention, determination or detection of one or more sclerostin gene region polymorphisms provide a novel and useful parameter for diagnosing the risk or presence of altered BMD in a subject, and for identifying agents that may be suitable for treating altered BMD. As discussed above and in, e.g., U.S. Pat. Nos. 6,395,511, 6,489,445, and 6,495,736, a number of conditions are associated with alterations in BMD. Further, detection of an appropriate parameter can provide preclinical evidence for a risk of or predisposition to a disease or disorder that is characterized by altered BMD. In particular, and according to non-limiting theory, in certain embodiments the invention contemplates determining in a subject at a relatively early age an increased risk, predisposition, likelihood or the like of the occurrence of altered BMD in the subject, even where such altered BMD may not manifest itself until the subject has attained a relatively advanced age, which may be an age greater than 30, 35, 40, 45, 50, 55, 60, 65 or more years.
A “sclerostin gene region” includes the area of human chromosome 17 that contains the polynucleotide sequence set forth in SEQ ID NO:1. According to the present invention there are provided compositions and methods that derive from the unexpected identification of nucleotide polymorphisms in the genomic DNA of the sclerostin gene region. In particular, there are provided a number of such sclerostin gene region nucleotide polymorphisms (SRPs), which include polymorphisms in non-coding regions of SEQ ID NO:1 (e.g., segments or portions of SEQ ID NO:1 that are comprised of polynucleotide sequences which do not encode the amino acid sequences that comprise a sclerostin polypeptide, such as the sclerostin polypeptides described in U.S. Pat. No. 6,489,445 and referred to therein as “Beer” proteins). As described in greater detail herein, the occurrence of certain SRPs in a sample from a subject can be correlated with (e.g., shown with statistical significance to indicate) an increased risk for altered BMD in the subject. Expressly excluded from certain preferred embodiments of the invention are sclerostin gene region nucleotide polymorphisms that are located at a nucleotide that corresponds to a nucleotide position that is between positions 10354 and 16757 of SEQ ID NO:1. Expressly excluded from certain other preferred embodiments of the invention are sclerostin gene region nucleotide polymorphisms that are located at a nucleotide that corresponds to nucleotide position 10357 of SEQ ID NO:1, or that corresponds to a trinucleotide insertion between positions 10565 and 10566 of SEQ ID NO:1. Also excluded from certain preferred embodiments of the invention are sclerostin gene region nucleotide polymorphisms that are located at a nucleotide that corresponds to position 6136, 6140 and/or 9047 of EMBL Accession No. AC003098 [SEQ ID NO:34] (see, e.g., WO 01/98491), and to nucleotide positions 15095, 15091 and 12184 of SEQ ID NO:1.
Determination of a sclerostin gene region polymorphism may involve strong but not necessarily absolute nucleotide sequence conservation when corresponding portions of sclerostin gene region DNA in a sample from a subject suspected of having or being at risk for having altered BMD, and sclerostin gene region DNA in a sample from a subject known to be free of such risk, are compared, as discussed herein. The invention provides compositions and methods that include the use of nucleic acid molecules, or portions thereof, having nucleotide sequences that are found in the human DNA sequence set forth in SEQ ID NO:1 and fragments of SEQ ID NO:1 that are suitable for use as oligonucleotide primers in nucleic acid primer extension or amplification techniques, as hybridization probes for the detection of complementary nucleotide sequences in a sample or for any number of additional uses that are well known to those familiar with the art. According to the various embodiments described herein, DNA may be nuclear DNA, including chromosomal and non-chromosomal DNA, which in preferred embodiments comprises all or a portion of a sclerostin gene region.
Nucleic acid sequences within the scope of the invention include isolated DNA and RNA sequences that specifically hybridize under conditions of moderate or high stringency to DNA nucleotide sequences such as those found in SEQ ID NO:1, including specific DNA sequences disclosed herein or fragments thereof, and their complements. As used herein, conditions of moderate stringency, as known to those having ordinary skill in the art, and as defined by Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory Press (1989), include use of a prewashing solution for the nitrocellulose filters 5×SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of 50% formamide, 6×SSC at 42° C. (or other similar hybridization solution), and washing conditions of about 50-60° C., 0.5×SSC, 0.1% SDS. Conditions of high stringency are defined as hybridization conditions as above, and with washing at 60-68° C., 0.2×SSC, 0.1% SDS. In other embodiments, hybridization to a DNA nucleotide sequence may be at normal stringency, which is approximately 25-30° C. below Tm of the native duplex (e.g., 5×SSPE, 0.5% SDS, 5×Denhardt's solution, 50% formamide, at 42° C. or equivalent conditions), at low stringency hybridizations, which utilize conditions approximately 40° C. below Tm, or at high stringency hybridizations, which utilize conditions approximately 10° C. below Tm. The skilled artisan will recognize that the temperature, salt concentration, and chaotrope composition of hybridization and wash solutions may be adjusted as necessary according to factors such as the length and nucleotide base composition of the probe. (See also, e.g., Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing, 1987.) As also known to those having ordinary skill in the art, variations in stringency of hybridization conditions may be achieved by altering the time, temperature and/or concentration of the solutions used for prehybridization, hybridization and wash steps, and suitable conditions may also depend in part on the particular nucleotide sequences of the probe used, and of the blotted, proband nucleic acid sample. Accordingly, it will be appreciated that suitably stringent conditions can be readily selected without undue experimentation where a desired selectivity of the probe is identified, based on its ability to hybridize to one or more certain proband sequences while not hybridizing to certain other proband sequences.
An “isolated nucleic acid molecule” refers to a polynucleotide molecule in the form of a separate fragment or as a component of a larger nucleic acid construct, that has been separated from its source cell (including the chromosome it normally resides in) at least once, preferably in a substantially pure form. Isolated nucleic acids may be nucleic acids having particular disclosed nucleotide sequences or may be regions, portions or fragments thereof. Those having ordinary skill in the art are able to prepare isolated nucleic acids having the complete nucleotide sequence, or the sequence of any portion of a particular isolated nucleic acid molecule, when provided with the appropriate nucleic acid sequence information as disclosed herein. Nucleic acid molecules may be comprised of a wide variety of nucleotides, including DNA, RNA, nucleotide analogues such as phosphorothioates or peptide nucleic acids, or other analogues with which those skilled in the art will be familiar, or some combination of these.
In one embodiment, known DNA sequences derived from SEQ ID NO:1 may be utilized to design oligonucleotide primers or hybridization probes suitable for screening genomic libraries. Preferably, such oligonucleotide primers or probes are 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31-35, 36-40, 41-50, 51-60, 61-75 or more bases in length and have sequences that, under the hybridization conditions selected, hybridize to complementary DNA sequences lacking nucleotide substitutions, insertions, duplications or deletions (“polymorphisms” or “mutations”) relative to the corresponding region of the DNA sequence of SEQ ID NO:1.
Portions of a polymorphic DNA sequence (or of an oligonucleotide primer or probe) and the DNA sequence of SEQ ID NO:1 are regarded as “corresponding” nucleic acid sequences, regions, fragments or the like, based on the convention for numbering DNA nucleic acid positions according to SEQ ID NO:1, wherein a candidate polymorphic DNA sequence (or primer or probe) is aligned with the DNA sequence of SEQ ID NO:1 such that at least 70%, preferably at least 80% and more preferably at least 90% of the nucleotides in a given sequence of at least 18-20 consecutive nucleotides of a sequence are identical. In certain preferred embodiments, a polymorphic DNA sequence is greater than 95% identical to a corresponding DNA sequence that is present in SEQ ID NO:1. In certain particularly preferred embodiments, an oligonucleotide primer or probe, or a region of a polymorphic DNA sequence that lacks any polymorphisms, is identical to a corresponding portion of SEQ ID NO:1. Those oligonucleotide probes having sequences that are identical in corresponding regions of SEQ ID NO:1 may be identified and selected following hybridization target DNA sequence analysis, to verify the absence of mutations in the target DNA sequence.
DNA containing one or more sclerostin gene region polymorphisms may be isolated from genomic DNA, typically by first generating an appropriate DNA library through techniques for constructing libraries that are known in the art (see Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, 1989) or purchased from commercial sources (e.g., Clontech, Palo Alto, Calif.). Briefly, genomic DNA libraries can be constructed in chromosomal vectors, such as YACs (yeast artificial chromosomes), bacteriophage vectors, such as pBeloBAC11, λEMBL3, λgt10, cosmids, or plasmids. Alternatively, isolated DNA may be prepared by preferentially amplifying sclerostin gene region DNA sequences present in biological samples using, for example, DNA amplification methodologies such as PCR or other amplification techniques that are well known in the art, with suitable oligonucleotide primers complementary to such DNA sequences as disclosed herein. To facilitate hybridization detection, the oligonucleotide may be conveniently labeled, generally at the 5′ end, with a reporter molecule, such as a radionuclide, e.g., 32P, enzymatic label, protein label, fluorescent label, biotin or other suitable labeling moieties known in the art.
Such libraries are then generally plated as phage or colonies, depending upon the vector used. Subsequently, a plate replica to which the colonies or phage have been transferred, such as a nitrocellulose or nylon membrane or the like, is probed to identify candidate clones that contain the polymorphic sclerostin gene region DNA sequence. Such candidates may be verified as containing such polymorphisms by any of various means including, for example, DNA sequence analysis or hybridization with a second, non-overlapping probe selected as described above to hybridize with target DNA sequences lacking nucleotide substitutions, deletions, duplications or insertions relative to the corresponding portion of the DNA sequence of SEQ ID NO:1.
Once a library is identified as containing DNA having at least one scleorstin gene region polymorphism, the polymorphic DNA can be isolated by amplification. Briefly, when using genomic library DNA as a template, amplification primers are designed based upon a DNA sequence that has been determined (e.g., SEQ ID NO:1) and primer “walking” is used to select primers that anneal to DNA regions within such sequences. The primers preferably have a GC content of about 50% and contain restriction sites to facilitate cloning. Primers typically do not have self-complementary sequences, nor do they contain complementary sequences at their 3′ end (to prevent primer-dimer formation). The primers are annealed to genomic DNA and sufficient amplification cycles are performed to yield a product readily visualized by gel electrophoresis and staining. The amplified fragment is purified and inserted into a vector, such as λgt10 or pBS(M13+), and propagated. Confirmation of the nature of the fragment is obtained by DNA sequence analysis.
Oligonucleotide primers or probes as described above for use in isolating polymorphic sclerostin gene region DNA from genomic DNA may also be useful in the present invention for determining the presence of a sclerostin gene region nucleotide polymorphism by any of a variety of techniques well known in the art for determining the amount of specific nucleic acid target sequences present in a sample based on specific hybridization of a primer to the target sequence. Optionally, in certain of these techniques, hybridization precedes nucleotide polymerase catalyzed extension of the primer using the strand containing the target sequence as a template, and/or ligation of oligonucleotides hybridized to adjacent target sequences, and embodiments of the invention using primer extension are particularly preferred. For examples of references on such quantitative detection techniques, including those that may be used to detect nucleotide insertions, substitutions, duplications or deletions in a portion of a sclerostin gene region DNA sequence site near an oligonucleotide primer target hybridization site that corresponds to a portion of the DNA sequence of SEQ ID NO:1, and further including those that involve primer extension, see, for example, Kuppuswamy et al. (Proc. Nat. Acad. Sci. USA 88:1143, 1991), Botstein et al. (Am. J. Hum. Gen. 32:314, 1980), Gibbs et al. (Nucl. Ac. Res. 17:2437, 1989), Newton et al. (Nucl. Ac. Res. 17:2503, 1989), Syvanen et al., (Genomics 8:684, 1990), Grossman et al. (Nucl. Ac. Res. 22:4527, 1994), and Saiki et al. (Proc. Nat. Acad. Sci. 86:6230, 1989), all of which are hereby incorporated by reference.
A particularly useful method for this purpose is the primer extension assay disclosed by Krook et al. (Hum. Molec. Genet. 1:391, 1995) which teaches modification of primer extension reactions to detect multiple nucleotide substitutions, insertions, deletions or other mutations. Other examples of useful techniques for quantifying the presence of specific nucleic acid target sequences in a sample include but need not be limited to labeled probe hybridization to the target nucleic acid sequences with or without first partially separating target nucleic acids from other nucleic acids present in the sample.
Examples of other useful techniques for determining the amount of specific nucleic acid target sequences (e.g., a target sequence containing a polymorphism such as a sclerostin gene region polymorphism as provided herein) present in a sample based on specific hybridization of a primer to the target sequence include specific amplification of target nucleic acid sequences and quantification of amplification products, including but not limited to polymerase chain reaction (PCR, Gibbs et al., Nucl. Ac. Res. 17:2437, 1989), transcriptional amplification systems, strand displacement amplification and self-sustained sequence replication (3SR, Gingeras et al., J. Infect. Dis. 164:1066, 1991), the cited references for which are hereby incorporated in their entireties. Examples of other useful techniques include ligase chain reaction (e.g., Landegren et al., Science 241:1077, 1988; Nickerson et al., Proc. Natl. Acad. Sci. USA 87:8923 1990; Barany, Proc. Natl. Acad. Sci. USA 88:189, 1991; Wu et al., Genomics 4:560, 1989), single stranded conformational polymorphism analysis, Q-beta replicase assay, restriction fragment length polymorphism (RFLP, Botstein et al., Am. J. Hum. Gen. 32:314, 1980) analysis, cycled probe technology and solid-phase DNA-binding assays such as those disclosed in U.S. Pat. No. 6,340,566, as well as other suitable methods that will be known to those familiar with the art.
Sequence length or molecular mass of polynucleotides, for example, primer extension assay products containing sclerostin gene region polymorphisms, may be determined using any known method for characterizing the size of nucleic acid sequences with which those skilled in the art are familiar. In a preferred embodiment, such products are characterized by capillary electrophoresis. In another preferred embodiment, primer extension products are characterized by mass spectrometry (MS), which may further include matrix assisted laser desorption ionization/time of flight (MALDI-TOF) analysis or other MS techniques known to those having skill in the art. See, for example, U.S. Pat. No. 5,622,824, U.S. Pat. No. 5,605,798 and U.S. Pat. No. 5,547,835. In another preferred embodiment, primer extension products are characterized by liquid or gas chromatography, which may further include high performance liquid chromatography (HPLC), gas chromatography-mass spectrometry (GC-MS) or other well known chromatographic methodologies.
Also contemplated according to the compositions and methods of the present invention are uses of the isolated nucleic acid molecules described herein as immobilized polynucleotides, which may include a polynucleotide that is covalently or non-covalently coupled to a solid support. Coupling chemistries and selection of support materials are well known in the art, and such supports may include supports made of glass, silica, metal, plastic, fiber, resin, polymers and the like, including for example cellulose, nitrocellulose, polyacetate, polycarbonate, polystyrene, polyester, polyvinyldifluorobenzene, nylon, carbon fiber or any other suitable solid material for the intended use and with which those skilled in the art will be familiar. In certain related embodiments one or a plurality of the nucleic acid molecules described herein may be provided as an array immobilized on a solid support, which includes any of a number of well known configurations for spatially arranging such polynucleotides in an identifiable (e.g., addressable) fashion. The skilled artisan will be familiar with various compositions and methods for making and using arrays of such solid-phase immobilized nucleic acid arrays. In certain other related embodiments the invention contemplates a kit for identifying a scloerostin gene region polymorphism as provided herein, which kit comprises an isolated polynucleotide as described herein (including solid phase immobilized nucleic acid molecules) and an ancillary reagent such as appropriate buffers, wash solutions, indicators, detection media and the like, depending on the particular assay configuration to be practiced.
As used herein, DNA sequence variability refers to the DNA sequence variation between one DNA sequence and a second DNA sequence. Either the first or the second DNA sequence may be a reference or control sequence such as a wild type sequence. Thus, DNA sequence variability is, for example, the differences in the DNA sequence between the reference or control sequence and another sequence of interest. As used herein, differences between two DNA sequences of interest may be identified by hybridization under conditions which permit base pairing between the two strands. When the hybrid formed between the two strands contains mismatches, then the two DNA sequences contain one or more differences in their base sequences.
As referred to herein, a nucleotide polymorphism represents a change in the DNA sequence from a normal sequence or wild type sequence to a mutated or different sequence. Nucleotide polymorphisms of the current invention can include genetic mutations, single base pair mutations, DNA mismatches, DNA insertions, DNA deletions, DNA transversions, frameshift mutations, damaged DNA, DNA duplications and or other alterations in a normal or wild type DNA sequence. As referred to herein, a single nucleotide polymorphism (SNP) refers to a nucleotide polymorphism which is a single nucleotide variation in the genetic sequence of an organism relative to a standard sequence. It is estimated that the average human will have a SNP every 1000 base pairs (there are ca. 3 billion base pairs in the human genome). Many SNPs are nonconsequential; however, some may render the organism prone to disease.
In one embodiment, the present invention provides nucleotide sequences that are associated with SOST gene region polymorphisms (SRP). Sequences associated with these nucleotide polymorphisms include SEQ ID NOs: 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 32 and 33 as identified herein.
In another embodiment of the invention, diseases and/or conditions associated with bone density can be detected and/or predicted by the methods of the current invention using nucleotide sequences as identified herein. Exemplary diseases and/or conditions include without limitation, osteopenia, osteoporosis and gum diseases.
As described herein, the present invention provides compositions and methods related to novel polymorphic sclerostin gene region DNA sequences that may differ from known DNA sequences at one or more nucleotide positions as disclosed herein, for example, the SRPs 1-3 and 5-9 described in the Examples and Sequence Listing, and the DNA sequences of SEQ ID NOS:4, 7, 10, 13, 16, 19, 22, 25, 28, and 31-33. Details for obtaining SEQ ID NO:1 are provided below in the Examples. Those having ordinary skill in the art can also readily obtain other isolated sclerostin gene region DNA sequences using well known methodologies including those provided herein and in the cited references, and further including the use of the oligonucleotide primers provided in the Examples. Databases (e.g., GenBank, EMBL) and methods for nucleic acid sequence analysis are also well known in the art, for example, similarity between two sequences may be readily determined using well known computer programs such as the BLAST algorithm (Altschul, J. Mol. Biol. 219:555-565, 1991; Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-10919, 1992), which is available at the NCBI website (on the World Wide Web at ncbi.nlm.nih.gov/cgi-bin/BLAST). Default parameters may be used. Examples of other useful computer algorithms are those used in programs such as Align and FASTA, which may be accessed, for example, at the Genestream internet website of the Institut de Genetique Humaine, Montpellier, France (on the World Wide Web at igh.cnrs.fr/home.eng.html) and used with default parameters.
In another particularly preferred embodiment of the invention, sclerostin gene region DNA in a biological sample containing DNA is first amplified by methodologies well known in the art and described herein, such that the amplification products may be used as templates in a method for determining the presence or absence of at least one sclerostin gene region nucleotide in the sample.
Biological samples containing DNA which comprises a sclerostin gene region may comprise any tissue or cell preparation in which genomic DNA may be present. In preferred embodiments such samples comprise DNA having a nucleotide sequence that corresponds to at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 101-200 or more consecutive nucleotides that are present in SEQ ID NO:1, and in other preferred embodiments such samples may comprise DNA having a nucleotide sequence that corresponds to at least 200-500, 501-1,000, 1,000-5,000, 5,001-10,000 or more consecutive nucleotides that are present in SEQ ID NO:1. Biological samples may be provided by obtaining a blood sample, biopsy specimen, tissue explant, organ culture or any other tissue or cell preparation from a subject or a biological source. The subject or biological source may be a human or non-human animal, a primary cell culture or culture adapted cell line including but not limited to genetically engineered cell lines that may contain chromosomally integrated or episomal recombinant nucleic acid sequences, immortalized or immortalizable cell lines, somatic cell hybrid cell lines, differentiated or differentiatable cell lines, transformed cell lines and the like. In certain preferred embodiments of the invention, the subject or biological source may be suspected of having or being at risk for having altered BMD, and in certain preferred embodiments of the invention the subject or biological source may be known to be free of a risk or presence of such a condition.
In certain other preferred embodiments where it is desirable to determine whether or not a subject or biological source falls within clinical parameters indicative of altered BMD, signs and symptoms of altered BMD that are accepted by those skilled in the art may be used to so designate a subject or biological source, for example clinical signs referred to in Jouanny et al. (1995 Arthritis Rheum. 38:61), Melton (1997 Fourth International Symposium: Osteoporosis; National Osteoporosis Foundation, Washington, D.C., p. 23), Consensus Development Conference: Diagnosis, prophylaxis and treatment of osteoporosis (1993 Am. J. Med. 94:646-650), Eisman (2000 Endocr. Rev. 20:788) and references cited therein, or other means known in the art for diagnosing conditions, diseases or disorders associated with altered BMD such as those described herein.
The present invention also provides compositions and methods that are useful in pharmacogenomics, for the classification and/or stratification of a subject or a patient population, for instance correlation of one or more traits in a subject with indicators of the responsiveness to, or efficacy of, a particular therapeutic treatment. In certain embodiments of the invention, determination of the presence of at least one sclerostin gene region nucleotide polymorphism in a biological sample from a subject is combined with identification of the subject's gender to determine the risk for, or presence of, altered BMD in the subject. According to such embodiments, and without wishing to be bound by theory, certain sclerostin gene region nucleotide polymorphisms described herein can be correlated with an increased risk for altered BMD as a factor of the subject's gender, and may therefore be referred to as “gender-associated” sclerostin gene region nucleotide polymorphisms. For instance, and as described in greater detail in the Examples, the presence of the sclerostin gene region nucleotide polymorphism SRP3 in female subjects indicated a presence, or risk of having, increased BMD. As also described in the Examples, the presence of the sclerostin gene region nucleotide polymorphism SRP9 in male subjects indicated a presence, or risk of having, decreased BMD. Accordingly, and without wishing to be bound by theory, the invention contemplates gender-specific associations and/or correlations of particular sclerostin gene region nucleotide polymorphisms with altered BMD.
As described herein, determination of at least one sclerostin gene region nucleotide polymorphism may be used to stratify a patient population that includes individuals suspected of having or being at risk for having altered BMD. Accordingly, in another preferred embodiment of the invention, determination of one or more such polymorphisms in a biological sample containing DNA from such subjects may provide a useful correlative indicator for that subject. A subject so classified on the basis of one or more particular sclerostin gene region nucleotide polymorphisms may then be monitored using BMD clinical parameters referred to above, such that correlation between polymorphisms and any particular clinical score used to evaluate BMD may be monitored. For example, stratification of a patient population according to sclerostin gene region polymorphisms (SRPs) disclosed herein may provide a useful marker with which to correlate the efficacy of any candidate therapeutic agent being used in subjects having altered BMD. In a further preferred embodiment of this aspect of the invention, determination of one or more SRPs in concert with determination of a subject's gender may also be useful, as discussed in greater detail herein. These and related advantages will be appreciated by those familiar with the art.
The following Examples are provided by way of illustration and not limitation.
Natural variants in the human SOST gene region were identified by sequencing ˜90 kb of genomic DNA from a panel of 90 ethnically diverse individuals from the NIGMS Human Variation Collection, panel HD01-HD09. Eight polymorphisms (SRP1-3 and SRP5-9) spanning a total of ˜87 kb were chosen to genotype 1,927 men and women aged 55-80 years from a large population-based prospective cohort study of elderly Dutch Caucasians (Eur. J. Epidem., 1991, 7:403-422). Genomic DNA was obtained from peripheral blood of each individual by conventional methods. For each polymorphism genotyping assay, 10 ng of genomic DNA were used in a polymerase chain reaction (PCR) with oligonucleotide primers located on either side of the polymorphism.
Genomic DNA was extracted from samples of peripheral venous blood according to standard procedures. Polymorphism-containing regions were amplified from genomic DNA with the polymerase chain reaction (PCR). Each PCR was carried out in a 10 μl reaction volume containing 5 ng of genomic-DNA, 1.5 mM magnesium chloride, 0.2 mM deoxy-NTP, 2 pmol of each primer (see below), 0.2 units of Taq polymerase (Promega) and 10×PCR buffer (Promega) containing 20 mM Tris-HCl (pH 8.0), 100 mM KCl, 0.1 mM EDTA, 1 mM DDT, 50% glycerol, 0.5% Nonidet®-P40 and 0.5% Tween®20. The reactions were performed in a 384-wells thermocycler (MJ Research Tetrad) with different cycling protocols for each amplicon (37 cycles, Tm=53° C. for SRPs 8 and 9, Tm=55° C. for SRPs 1, 2-3 and 7, Tm=60° C. for SRPs 5-6). The genotypes were detected by the Single Base Extension (SBE) procedure using SBE primers of different lengths (Table 1). The SBE reactions were performed according to details provided by the manufacturer (ABI Prism® SNaPsho™ Multiplex Kit) with slight modifications. The genotypes thus generated were analyzed with the software program called Genotyper 3.7 (Applied Biosystems) and also checked by eye. To confirm the accuracy of the genotyping, 150 randomly selected samples were genotyped for a second time with the same method. No discrepancies were found.
| TABLE 1 | |
| SOST REGION POLYMORPHISMS (SRP) AND PRIMERS FOR SBE GENOTYPING |
| Position No. | ||||
| SRP# | SEQ ID NO: 1 | PCR primers (5′-3′) | SBE primers (5′-3′) | |
| SRP1 | C4103Ga | Fd CTTTCCACAGGCTCGTCT | (T) 4GAAGGTAGCGCCACCTGCTG | |
| (SEQ ID NO: 2) | (SEQ ID NO: 35) | |||
| Rv CTCTCAACCGGAAATGTCT | ||||
| (SEQ ID NO: 3) | ||||
| SRP2 | C10357Ta | Fd AGGTGGGGCTATAAGCATCCATCC | (T) 10TTGTGAGAAGCTGGCCCTCC | |
| (SEQ ID NO: 11) | (SEQ ID NO: 36) | |||
| Rv GTCCTTTCCCACCTGCCTCAACTT | ||||
| (SEQ ID NO: 12) | ||||
| SRP3 | 10565insGGAa | (T) 16ATGATGGATGATGGAAAGGA | ||
| (SEQ ID NO: 37) | ||||
| SRP5 | C17966Ga | Fd TAAGGTGGGATGCTCAACTCG | (T) 22TAGTGGTAGTTAAACTGACAA | |
| (SEQ ID NO: 20) | (SEQ ID NO: 38) | |||
| Rv CAGGAGAATCACTTGAATCCG | ||||
| (SEQ ID NO: 21) | ||||
| SRP6 | A18293Ga | (T) 28AAGTTGCAGTAAGCCGAGAT | ||
| (SEQ ID NO: 39) | ||||
| SRP7 | T58083Cb | Fd CCCTACCTTACTGTCCGCCTCTCA | (T) 34TTTAGTATAAAAGCTGGCTC | |
| (SEQ ID NO: 23) | (SEQ ID NO: 40) | |||
| Rv GTGCTACCTCTCGGGAAAACATAA | ||||
| (SEQ ID NO: 24) | ||||
| SRP8 | A74235Gb | Fd GAGCAACCGGCGTATCC | (T) 40TTTATAGTTCTTTCCTAGAC | |
| (SEQ ID NO: 26) | (SEQ ID NO: 41) | |||
| Rv GGGGTTTCTTTCTGGCTCTCA | ||||
| (SEQ ID NO: 27) | ||||
| SRP9 | A91068Gb | Fd CCAGCAATGTTGAGGAAT | (T) 46CTGCTCAGCAAGCAGTTCCA | |
| (SEQ ID NO: 29) | (SEQ ID NO: 42) | |||
| Rv CGCAGGAAGGTGTGGAGA | ||||
| (SEQ ID NO: 30) | ||||
In the case of SRP2 and 3, and SRP5 and 6, the polymorphisms were close enough together that the primary PCR could be performed using primers flanking the pair of polymorphisms. In general, primers were designed to amplify fragments of 150-500 base pairs (bp) in length. Specific alleles at each site were determined by a single-base extension (SBE) assay, using the Applied Biosystems (ABI, Foster City, Calif.) SNAPshot™ kit reagents and oligonucleotide design protocol according to the supplier's recommendations. Products of the SBE were pooled, then resolved and detected on a capillary electrophoresis instrument (ABI 3100). Standard statistical methods were used to determine whether particular alleles were associated with high or low bone density.
The SRP1 polymorphism was identified using the SRP1 forward and reverse primer pair (SEQ ID NOs:2 and 3). The amplicon generated using this primer pair is disclosed in SEQ ID NO:4. This sequence identifies the SRP1 polymorphism at nucleotide position 4103 of SEQ ID NO:1. This specific polymorpism involves the substitution of a C to a G.
The SRP2 polymorphism was identified using the SRP2 forward and reverse primer pair (SEQ ID NOs:5 and 6). The amplicon generated using this primer pair is disclosed in SEQ ID NO:7. This sequence identifies the SRP2 polymorphism at nucleotide position 10357 of SEQ ID NO:1. This specific polymorpism involves the substitution of a C to a T.
The SRP3 polymorphism was identified using the SRP3 forward and reverse primer pair (SEQ ID NOs:8 and 9). The amplicon generated using this primer pair is disclosed in SEQ ID NOs:10 and 32. This sequence identifies the SRP3 polymorphism at nucleotide position 10566 of SEQ ID NO:1. This specific polymorpism involves either the inclusion (or deletion) of nucleotides GGA as a trinucleotide insertion (or deletion) between positions 10565 and 10566 of SEQ ID NO:1.
The SRP5 polymorphism was identified using the SRP5 forward and reverse primer pair (SEQ ID NOs:14 and 15). The amplicon generated using this primer pair is disclosed in SEQ ID NO:16. This sequence identifies the SRP5 polymorphism at nucleotide position 17966 of SEQ ID NO:1. This specific polymorpism involves the substitution of a C to a G.
The SRP6 polymorphism was identified using the SRP6 forward and reverse primer pair (SEQ ID NOs:17 and 18). The amplicon generated using this primer pair is disclosed in SEQ ID NO:19. This sequence identifies the SRP6 polymorphism at nucleotide position 18293 of SEQ ID NO:1. This specific polymorpism involves the substitution of an A to a G.
The SRP7 polymorphism was identified using the SRP7 forward and reverse primer pair (SEQ ID NOs:23 and 24). The amplicon generated using this primer pair is disclosed in SEQ ID NO:25. This sequence identifies the SRP7 polymorphism at nucleotide position 58083 of SEQ ID NO:1. This specific polymorpism involves the substitution of a T to a C.
The SRP8 polymorphism was identified using the SRP8 forward and reverse primer pair (SEQ ID NOs:26 and 27). The amplicon generated using this primer pair is disclosed in SEQ ID NO:28. This sequence identifies the SRP8 polymorphism at nucleotide position 74235 of SEQ ID NO:1. This specific polymorpism involves the substitution of an A to a G.
The SRP9 polymorphism was identified using the SRP9 forward and reverse primer pair (SEQ ID NOs:29 and 30). The amplicon generated using this primer pair is disclosed in SEQ ID NO:31. This sequence identifies the SRP9 polymorphism at nucleotide position 91068 of SEQ ID NO:1. This specific polymorpism involves the substitution of an A to a G.
Osteoporosis has a strong genetic component but the genes involved are poorly defined. The association between the gene encoding sclerostin (SOST) and bone mineral density (BMD) was examined in order to ascertain whether SOST can be considered an osteoporosis candidate gene. Sclerostin is an important regulator of bone density, and mutations in SOST result in sclerosteosis (see, e.g., NCBI Online Mendelian Inheritance in Man database of human genes and genetic disorders, on the World Wide Web at ncbi.nlm.nih.gov/omim, MIM 269500; 17q12-q21), a rare recessive sclerosing bone dysplasia. As described in Example 1, >90 kb of the SOST gene region in 90 ethnically diverse individuals was sequenced, and a set of 8 polymorphisms thus found was used to genotype 1927 men and women (55-80 years) from a large population-based prospective cohort study of elderly Dutch Caucasians. Subjects were participants of the Rotterdam Study, a population based cohort study of 7983 subjects aged 55 years and over and who live in the Ommoort district of Rotterdam, The Netherlands. The study was designed to document the occurrence of diseases in the elderly in relation to several potential determinants (Hofman et al., 1991 Eur. J. Epidemiol. 7:403). Genotype effects on BMD and on risk of vertebral and non-vertebral fractures (n=270) were analyzed during 7 years of follow-up.
Height and weight were measured at the initial examination, with the subject in a standing position with indoor clothing without shoes. BMD (in grams per square centimeter) was determined by dual-energy x-ray absorptiometry (DPX-L densitometer, Lunar, Madison, Wis.) at the femoral neck (FN) and lumbar spine (LS) (vertebrae L2, L3, L4), as described by Burger et al., 1994 Bone Miner. 25:1-13. Dietary intake of calcium (in milligrams per day) during the preceding year was assessed by a food frequency questionnaire and adjusted for energy intake. Age at menopause and current use of cigarettes were assessed by a questionnaire.
Non-vertebral fractures, including hip, wrist and other fractures were recorded by general practitioners (GPs), who covered 80% of the population. Research physicians confirmed follow-up information by checking GPs' patient records and collected the data for the remaining 20% of the population. For 600 women and 519 men, lateral radiographs of the spine from the fourth thoracic to the fifth lumbar vertebra were measured at follow-up and examined for the presence of prevalent vertebral fractures by morphometric analysis, as described by Burger et al., 1997 J. Bone Miner. Res. 12:152.
Subjects were grouped according to genotype for each polymorphism separately. Allele frequencies and Hardy-Weinberg equilibrium (HWE) were analyzed with a chi-square test. BMD and other relevant clinical variables of the three genotype groups were compared according to an allele dose effect. Allele dose was defined as the number of copies of a certain allele in the genotype. In case of a consistent trend reflected as an allele-dose effect, linear regression analysis was performed to quantify the association. In case of a dominant or a recessive effect of the test allele, analysis of (co)variance AN(C)OVA was performed to test for differences between two genotype groups. For dominant alleles test-allele carriers were compared to non-carriers, while for recessive effects homozygous subjects for the test allele were compared to heterozygous carriers combined with non-carriers. Multiple linear regression was used to adjust bone-density values for possible confounding factors such as age and anthropometric variables. To estimate the risk of non-vertebral and vertebral fractures, odds ratios (with 95 percent confidence intervals) were calculated by multivariate logistic regression analysis.
No SOST gene coding polymorphisms were found, but 3 variants within 8 kb upstream of the coding sequence were identified, in addition to 3 variants within a far downstream 52 kb interval recently found to be deleted in van Buchem disease, a monogenic bone disorder very similar to sclerosteosis. A 3 bp GGA-insertion in the SCL promoter region (SRP3; allele frequency 39%) was shown to be associated with decreased BMD in women at the femoral neck (p=0.05) and at the lumbar spine (p=0.01) with evidence for an allele-dose effect. Genotype differences were found to strongly increase with age (FIG. 1). In addition, a G-substitution in the van Buchem deletion region (SRP9; allele frequency 41%) was found to be associated with increased BMD in men at femoral neck (p=0.006) and at lumbar spine (p=0.01) with evidence for an allele-dose effect. In both cases differences between extreme genotypes amounted to 0.2 SD and no genotype effects on fracture risk were observed. Variants in the SOST gene region were thus shown to be associated with BMD differences and were found to be modified as a function of gender (SRP3 and 9) and of age (SRP3).
From the foregoing it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.
1. A method for determining an increased risk for decreased bone mineral density in a human female subject aged 71-80 years, comprising:
detecting the presence of a sclerostin gene region nucleotide polymorphism in a biological sample from a female subject, said sample comprising DNA comprising at least 50 consecutive nucleotides that are present in SEQ ID NO: 1, wherein the polymorphism is a GGA trinucleotide insertion between positions 10565 and 10566 in SEQ ID NO: 1 or the complement thereof, wherein the presence of said polymorphism indicates an increased risk of decreased bone mineral density in female subjects aged 71-80 years.
2. The method of claim 1, wherein the detecting step comprises:
contacting the biological sample with at least one oligonucleotide primer selected from the group consisting of SEQ ID NO: 8 and SEQ ID NO: 9, under conditions and for a time sufficient to allow hybridization of said primer to the DNA.
3. The method of claim 1, wherein the biological sample is selected from the group consisting of blood, biopsy specimen, tissue explant, organ culture and tissue sample.
4. The method of claim 2, further comprising:
detecting hybridization and extension of the oligonucleotide primer to produce a product, and therefrom determining the presence the polymorphism.
5. The method of 1, wherein the DNA in the sample is amplified.
6. The method of claim 1, further comprising diagnosing the subject as having an increased risk of osteoporosis.
7. The method of claim 1, further comprising monitoring bone mineral density clinical parameters of the subject.
8. The method of claim 1, further comprising treating said female subject with an agent for treating decreased bone mineral density.
9. The method of claim 8 wherein the agent is selected from the group consisting of estrogen, calcium, vitamin D, calcitonin, bisphosphonates, anabolic steroids and sodium fluoride.