Patent application title:

Cytoplasmic polyhedrosis virus polyhedrin protein complex

Publication number:

-

Publication date:
Application number:

10/415,096

Filed date:

2001-10-30

✅ Patent granted

Patent number:

US 7,432,347 B2

Grant date:

2008-10-07

PCT filing:

WO; PCT/JP01/09494; 20011030

PCT publication:

WO; WO02/36785; 20020510

Examiner:

David J Steadman

Adjusted expiration:

2022-09-10

Abstract:

To provide a useful objective protein coated with a protective protein, a protein complex that is produced in cells and has a structure that the objective protein is occluded with the viral occlusion body protein. A protein complex having the structure that the objective protein is occluded with the viral occlusion body protein, produced in insect cells or plant cells, preferably produced by incorporation of the objective protein in the crystalline form during crystallization of polyhedron derived from polyhedrosis virus, preferably a protein complex in which the polyhedrin contributes to improvement of stability, or protection, or improvement of preservability, or combination thereof, of the objective protein.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07K14/00 IPC

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof

C12P21/06 IPC

Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products

C12N7/00 IPC

Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof

C12N5/06 IPC

Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor Animal cells or tissues; Human cells or tissues

Description

FIELD OF THE INVENTION

This invention relates to protein complex and the method for producing various proteins, such as enzymes proteins, fluorescent proteins, and antibody, occluded with a viral occlusion body protein, in a pure state, preferably as crystalline forms, by utilizing cells, such as insect cells or plant cells.

BACKGROUND OF THE INVENTION

For occlusion of one protein with an another protein, an application of a solution of the protein onto a surface of the crystalline protein may be considered possible method, though in practical, it is extremely difficult to coat the crystalline protein with the solution of the protein without causing any dissolution. Coating for protection of useful proteins such as enzymes has rarely been performed.

Protection of proteins has conventionally known by attainment of a polymer, such as a polysaccharide or polyethylene glycol, covalently bonded to the protein. The method consists of reaction of the protein with the polymer to bind the functional groups in the protein, such as amino and carboxyl groups, under milder reaction conditions, where the binding site cannot be controlled. Therefore the method to protecting the protein cannot be applied to any kind of proteins.

Generally speaking, for preservation purpose of proteins, storage at lower temperatures and adding or mixing of a substance such as a polysaccharide and polyethylene glycol which is expected to stabilize the protein structure are performed. In any method, the protein to be protected will be dissolved together with the substance added and lose its stability when changes occur in the environment, especially when water comes in contact or temperature increases, or in case of dew condensation. Proteins will lose its function when degraded or ingested by microorganisms.

Polymeric proteins such as certain enzymes and antibody completely lose their functions when a part of the molecule is degraded by protease. They lose their functions quickly even when kept frozen due to weaker maintenance of their higer-order configuration.

To investigate the stability of an objective protein protected, it is necessary to isolate the protein and to check its individual function.

AS crystallization of a protein, smaller size crystals are generally obtained in research for the crystallization conditions, for example, by addition of a suitable metallic salt to a concentrated protein solution. There is no rule in crystallization, and therefore a number of crystallization conditions should be examined for each type of proteins to be crystallized.

DISCLOSURE OF THE INVENTION

In order to put useful proteins including enzymes to practical use, it is serious to maintain the function of individual proteins active. In general, proteins lose their functions such as catalytic activity when stored or allowed to stand at room temperature.

Therefore, for storage with the function maintained, proteins must be stored or kept at a low temperature, for example, in a refrigerator. A technique to maintain the function of proteins active is the means that can solve the subject matter to make the protein preservable and improve the stability; it is the subject matter to find a technique that can maintain the function of a protein at room temperature in a more stable way than with the conventional techniques for preservation of proteins.

It is an object of the invention to provide an useful objective protein, such as an enzyme, with its function maintained active as the result of improvement of stability, or protection, or improvement of preservability, or combination thereof.

It is an another object of the invention to maintain the function of an useful protein such as an enzyme for a long time by keeping in an aqueous solution. A technique required for this purpose is to coat the useful protein with a protective protein. The coating technique can protect the useful protein from the environmental influence, namely the technique can avoid the situation that may let the protein lose its function, such as dissolution of the protein in water, degradation or ingestion by microorganisms, etc.

It is an object of the invention to provide an useful protein, such as an enzyme, that has been coated with a protective protein. Proteins are biologically functional polymers having various chromophores or light-absorbing molecules, and thus their optical characteristics and electronic characteristics are expected to be useful. For making practical use of these characteristics, crystalline proteins rather than dried amorphous proteins are required.

Therefore it is the subject matter to produce such crystaline proteins. A technieque required first to solve the subject is the one that can provide such crystalline proteins. In general, crystallization of a protein is very difficult; then to produce easily crystalline proteins and to produce homogeneous crystals are the subjects to be solved by the technique.

It is an object of the invention to prepare the useful proteinsuch as an enzyme in the crystal form, more in detail, to produce the useful protein in the crystalline form by using theprotein produced in the crystalline form in cells as the protective protein for coating of the objective protein.

It is an another object of the invention to provide a method for easy production of the useful protein in the crystalline form by making use of the gene manipulation.

The technique to make use of the protein crystallized in cells is very effective in practical development of the protein as a novel material.

Cytoplasmic polyhedrosis virus forms polyhedra consisting of polyhedrin in the infected cells in the later stage of infection, and many virions are occluded in the polyhedra. It has been demonstrated that virions enter specifically into the polyhedra because of the specific relation between the viral occlusion body protein of virions and polyhedrin (J. Virol. 75, 988-995 (2001)).

It is an object of the invention to occlude the objective polymeric protein into the polyhedra and to improve the occlusion efficiency.

For this purpose, the gene coding for the viral occlusion body protein of cytoplasmic polyhedrosis virus is shortened to increase the size (molecular weight) of the protein that can be occluded in polyhedra and to occlude the objective protein efficiently in polyhedra.

To investigate a period that the function of the objective protein can be maintained by occlusion of the objective protein in polyhedra, an isolation of the objective protein from polyhedra was necessary. It is an object of the invention to make it possible to check at any time the function of the objective protein by occlusion of a protein that produces fluorescence or emission, such as a green fluorescent protein, together with the objective protein.

The subject matter of the invention is the protein complex produced in cells, more in detail, the protein complex produced in the form of particulates, with the objective protein occluded with the viral occlusion body protein.

The viral occlusion body protein contributes to improvement of stability, or protection, or improvement of preservability of the objective protein, or combination thereof, and therefore the invention relates to the protein complex produced in cells, more in detail, the protein complex produced in the form of particulates, with the objective protein occluded with the viral occlusion body protein where the viral occlusion body protein contributes to improvement of stability, or protection, or improvement of preservability of the objective protein, or combination thereof.

The protein complex is produced by incorporation of the objective protein in the crystal form during crystallization of the viral occlusion body protein, and therefore the invention relates to the protein complex produced in cells, more in detail the protein complex produced in the form of particulates, with the objective protein occluded with the viral occlusion body protein by incorporation of the objective protein in the crystal form during crystallization of the viral occlusion body protein, preferably the protein complex where the viral occlusion body protein contributes to improvement of stability, or protection, or improvement of preservability of the objective protein, or combination thereof.

The viral occlusion body protein is polyhedrin derived from polyhedrosis virus, and therefore the invention relates to the protein complex produced in cells with the objective protein occluded with polyhedrin, preferably the protein complex produced by incorporation of the objective protein in the crystalline form during crystallization of polyhedron derived from polyhedrosis virus, more in detail, the protein complex produced in the form of particulates, preferably the protein complex where polyhedrin contributes to improvement of stability, or protection, or improvement of preservability of the objective protein, or combination thereof.

The cells are those of insects or plants, and therefore the invention relates to the protein complex produced in cells of insects or plants with the objective protein occluded with polyhedrin, preferably the protein complex produced by incorporation of the objective protein in the crystal form during crystallization of polyhedrin derived from polyhedrosis virus, more in detail the protein complex produced in the form of particulates, preferably the protein complex where polyhedrin contributes to improvement of stability, or protection, or improvement of preservability of the objective protein, or combination thereof.

The objective protein is selected from a group consisting of enzymes, antigens, proteins bound to a biological material such as a different protein, proteins with photochemical characteristics, and functional proteins that donate or accept electrons, and therefore the invention relates to the protein complex produced in cells (in cells of insects or plants) with the objective protein occluded with polyhedrin, preferably the protein complex produced by incorporation of the objective protein, selected from a group consisting of enzymes, antigens, antibodies, proteins bound to a biological material such as a different protein, proteins with photochemical characteristics, and functional proteins that donate or accept electrons, in the crystal form during crystallization of polyhedrin derived from polyhedrosis virus, more in detail the protein complex produced in the form of particulates, preferably the protein complex where polyhedrin contributes to improvement of stability, or protection, or improvement of preservability of the objective protein, or combination thereof.

Another subject matter of the invention is the method for preparing a protein complex produced in cells with the objective protein occluded with the viral occlusion body protein.

Cells are those of insects or plants, and therefore the invention relates to the method for preparing a protein complex produced in cells of insects or plants with the objective protein occluded with the viral occlusion body protein.

After infection of cells with the virus vector integrated with the objective protein DNA together with the virus vector integrated with the viral occlusion body protein DNA, the cells are incubated to produce a protein complex with the objective protein occluded with the viral occlusion body protein, and therefore the invention relates to a method for preparing a protein complex with the objective protein occluded with the viral occlusion body protein in cells of insects or plants infected with the virus vector integrated with the objective protein DNA together with the virus vector integrated with the viral occlusion body protein DNA, and incubated to produce in the cells a protein complex with the objective protein occluded with the viral occlusion body protein.

The objective protein is selected from a group consisting of enzymes, antigens, proteins bound to a biological material such as a different protein, proteins with photochemical characteristics, and functional proteins that donate or accept electrons, and therefore the invention relates to a method for producing a protein complex with the objective protein, selected from a group consisting of enzymes, antigens, proteins bound to a biological material such as a different protein, proteins with photochemical characteristics, and functional proteins that donate or accept electrons, occluded with the viral occlusion body protein in cells of insects or plants, in more detail in the cells infected with the virus vector integrated with the objective protein DNA together with the virus vector integrated with the viral occlusion body protein DNA, and incubated to produce in the cells a protein complex with the objective protein occluded with the viral occlusion body protein.

In addition, the subject matter of the invention is a method for preparing a protein where a protein complex produced by one of the above-mentioned methods is collected so that an objective protein sample with high purity is obtained.

The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a microscopic picture of a crystal of the protein complex of the invention. FIG. 2 is a microscopic picture of the polyhedra formed in plant cells. FIG. 3 is a microscopic-picture illustrating dissolution of polyhedra under alkaline conditions. FIG. 4 is a graph showing the change in fluorescence of the protein complex crystal obtained in the Reference Example 2 with pH. FIG. 5 shows the vector p1G121-CP (Kin) for expression of polyhedrin. FIG. 6 shows the vector p1G121-VP3/GFP for expression of the VP3/GFP chimeric protein. FIG. 7 shows determination of fluorescence of the VP3/GFP chimeric protein contained in the polyhedra in plants.

BEST EMBODIMENTS OF THE INVENTION

<Objective Protein>

The objective protein occluded with the viral occlusion body protein is a so-called functional protein, preferably being in crystalline form.

The objective protein is exemplified by enzymes, antigens, antibodies, functional proteins with photochemical characteristics such as emission of fluorescence, high refractive index, photoelectric effects, and functional proteins that donate or accept electrons in electron transfer reaction, oxidation-reduction reaction, etc. More in detail, fluorescent proteins that emit fluorescence on irradiation of ultraviolet, enzymes having biologically catalytic action, antibodies, and physiologically active proteins including interferon and interleukin are the examples.

<Viral Occlusion Body Protein>

The viral occlusion body protein is, more in detail, the viral occlusion body protein encoded by virus which is polyhedrin encoded by insect cytoplasmic polyhedrosis virus. The viral occlusion body protein encoded by insect cytoplasmic polyhedrosis virus is exemplified by the viral occlusion body protein encoded by Bombyx mori polyhedrosis virus, BmCPV, (cytoplasmic polyhedrin).

The cytoplasmic polyhedrosis virus is classified under Cypovirus, Reoviridae. The virus is characterized in that it infects columnar cells of midgut epithelial cells of insects and produces large protein crystals called polyhedra in the cytoplasm of the infected cells. Polyhedra occlude many virions. Polyhedra consist of polyhedrin that is encoded by virus, expressed in the later stage of viral infection, and crystallized. One of the functions of polyhedra is to protect the infectivity of the virus itself from the outer environment in horizontal transmission of a viral disease. Namely, polyhedra are not dissolved at all in non-ionic or ionic surfactantsor an acidic or neutral solution. Even under irradiation of ultraviolet light, the occluded virus are kept unaffected. Because polyhedra are not dissolved by bacterial putrefaction, the virus in polyhedra are protected.

Another function of polyhedra is to bring the virus exactly to the objective site (cells in which virus can infect and proliferate). Namely, polyhedra ingested by an insect is dissolved by the strong alkaline digestive fluid of the insect, so that virions are released to infect the insect.

The viral genome is made of double-stranded RNA having ten segments (Segment 1 to Segment 10, designated as S1 to S10, respectively). Polyhedrin, a protein that constitutes of polyhedra, is encoded in the smallest segment S1O, having the molecular weight of 30 kDa. A virion of BmCPV comprises of five different proteins, VP1 (151 kDa), VP2 (142 kDa), VP3 (130 kDa), VP4 (67 kDa), and VP5 (33 kDa), respectively. A labeling experiment of BmCPV with isotope 125I has demonstrated that VP1 and VP3 are the proteins constituting of the outer layer of the virus(Lewandowski et.al., (1972) J. Virol. 10, 1053-1070) The result of an in vitro translation experiment using rabbit reticulocytes has suggested that the proteins constituting the outer layer of the virus, VP1 and VP3, are encoded in S1 and S4, respectively(McCrae nd Mertens(1983) in Double-Starnded RNA Viruses, Elsevier Biomedicals, 35-41).

Anaysis of S4 coding for VP3, a protein constituting the outer layer or BmCPV, revealed that S4 is composed of 3,259 bases, and has a large open reading frame (ORF) having the start codon at the 14th and 16th bases and the stop codon (TAA) at the 1,057 amino acid residues and the molecular weight of VP3 is estimated to be about 130 kDa.

The method for preparation of the virus vector integrated with the cytoplasmic polyhdrin molecule and the virus vector integrated with the functional protein molecule is illustrated for the case where Bombyx mori cytoplasmic polyhedrosis virus is used as the cytoplasmic polyhedrosis virus.

The virus vector integrated with the cytoplamic polyhedrin is prepared by, for Example, integration of the polyhedrin gene in the baculovirus vector derived from Autographa californica nucleopolyhedrovirus according to a prior art method[J. Gen. Virol., Vol. 74, pp. 99-102].

The virus vector integrated with the functional protein molecule is prepared by, for example, preparation of a chimeric gene coding for the fusion protein with the functional protein bound to the C-terminal of VP3, a protein constituting the outer layer of BombyxMori cytoplasmic polyhedrosis virus (BmCPV), followed by introduction into thabove-mentioned baculovirus vector derived from Autographa californica nucleopolyhedrovirus.

Then the two different virus vectors thus formed are allowed to infect insect tissue cells by inoculation of insect cells with the suspensions of the two different virus vectors at the same time, followed by keeping at room temperature for 0.5 to 3 hours to let virus adsorb sufficiently on cells, by removing of the virus suspension, by adding a culture medium containing fetal bovine calf serum, and by incubating at 20 to 300C for 2 to 10 days.

Then infected cells are separated from the culture and homogenized with cooling, and the solid matter containing polyhedra is collected by filtration or centrifugation from the homogenate to give the desired protein-embedded crystal. The protein-embedded crystal thus obtained can be purified, if necessary, by fractionation by the sucrose density gradient method and by washing with a buffer, etc.

In this manner, a protein-embedded crystal containing micro crystals of functional proteins is obtained at the weight ratio of 1/10 to 1/1000 of the cytoplasmic polyhedrin crystal.

In this procedure, the amino acid sequence of VP3, a protein constituting the outer layer of the cytoplasmic polyhedrosis virus, is inserted into the N-terminal or C-terminal of the functional protein, and the fusion protein is expressed by the baculovirus vector, where the fusion protein is occluded in the polyhedra when insect cells are infected together with the virus expressing the polyhedra of cytoplasmic polyhdrosis virus. Therefore it is necessary to ligate the cDNA coding for a constitutive protein of cytoplasmic polyhedrosis virus to a foreign protein gene so that the foreign protein expressed by baculovirus vector, namely the functional protein, may be integrated at the N-terminal or the C-terminal of the constitutive protein of cytoplasmic polyhedrosis virus. In this process, it is important to make in-frame the open reading frame coding for the constitutive protein and that for the protein of the foreign protein gene. In this way, a recombinant baculovirus is prepared that expresses a fusion protein consisting of a constitutive protein of cytoplasmic polyhedrosis virus and a foreign protein.

<Protein Complex in which the Objective Protein is Occluded with the Viral Occlusion Body Protein>

This is a protein-embedded crystal where the objective protein is dispersed in the viral occlusion body protein (cytoplasmic polyhedron crystal). This is produced as particulates by incorporation of the objective protein, preferably in the crystalline form, during crystallization of the viral occlusion body protein in cells. FIG. 1 is a microscopic picture of an example of the protein-embedded crystal of the invention, indicating that micro crystals of the functional protein are dispersed in the cytoplasmic polyhedrin crystal.

<Cells for Production of a Protein Complex>

Cells used for production of a protein complex are not particularly specified as far as they are susceptible to viral infection.

Cells may be insects or insect cells, or plants or plant cells.

<Protein-embedded Crystal Produced in an Insect>

A protein-embedded crystal can be produced by, for example, separate preparation of a virus vector integrated with the polyhedron molecule and a virus vector integrated with a functional protein, simultaneous infection of insect tissue cells with the two virus vectors to produce polyhedra in the insect cells infected with the two viruses, and separation of the polyhedra as crystals. Namely, simultaneous infection with the cytoplasmic polyhedrosis virus and the virus coding for the functional protein can produce at a stroke polyhedrin crystals dispersed with micro crystals of the functional protein.

Insects used for infection with the two different virus vectors are not specified as far as the cells are susceptible to viral infection, and those of Lepidoptera, particularly those classified under Geometridae, Salurniidae, Bombycidae, Arctiidae, and Noetuidae are generally used. Usually Bombyx mori L, Antheraea assamensis Helfer, Peridroma sp., Leucania unipunctata Howorth, and the like are used because of their easiness in availability and handling.

A VP3/GFP chimeric gene that lacks the restriction enzyme site Xbal at the region between the 1358th and the 2711th of S4 coding for VP3 (VP3(Xbal)/GFP) was prepared. Then the gene was introduced into the baculovirus vector derived from Autographa californica nucleopolyhedrovirus (AcNPV), and the VP3(Xbal)-GFP fusion protein was expressed in IPLB-Sf21-AE (Sf21) derived from cells of an insect Spodoptera frugiperda. For production of cubic polyhedra, the recombinant AcNPV (AcCP-H) integrated with the cytoplasmic polyhedrin gene was used at the same time to inoculate the Sf21 cells (Mori et al. (1993) J. Gen. Virol. 74, 99-102). Polyhedra was purified from the Sf21 cells infected with the two different viruses, and it was examined under green fluorescence whether the fusion protein was occluded in the polyhedra and released on dissolution of the polyhedra under alkaline conditions. The fusion protein consisting of VP3(Xbal) and GFP was released when polyhedra was dissolved, as was the fusion protein consisting of VP3 and GFP, indicating that the fusion protein had been incorporated specifically in the polyhedra. This demonstrated that VP3 can be shortened in the procedure for incorporation of the objective protein in particulates called polyhedra and in the procedure for preparation of particulates with the objective protein occluded with a protein called polyhedrin.

<Production of Various Functional Protein Crystals in Pure State>

Cytoplasmic polyhedrin crystals in protein-embedded crystals are soluble in an alkaline solution, whereas functional protein micro crystals occluded therein are stable to alkali. Therefore various functional protein crystals can be produced in the pure state by making use of such protein-embedded crystals.

This invention provides a method for production of pure, functional protein crystals characterized in that insect cells are infected with the virus vector integrated with a functional protein DNA together with the virus vector integrated with the cytoplasmic polyhedrin DNA of the cytoplasmic polyhedrosis virus and then cultured to produce protein-embedded crystals consisting of cytoplasmic polyhedrin crystals with the functional protein crystals occluded, followed by dissolution of the protein-embedded crystals in an alkaline aqueous solution and isolation and harvesting of the functional protein crystal from the solution.

In the concrete, when an alkali, for example a sodium hydroxide solution, is added to the polyhedra containing a functional protein to pH 8.0, preferably to pH 8.5 to 11 .0, the protein-embedded crystals are dissolved but only the cytoplasmic polyhedrin is precipitated when the solution is made neutral again. Therefore when the precipitates and the cell debris are removed by centrifugation or filtration, a solution containing only the functional protein is obtained.

The buffer to be used is a buffer used for usual gene manipulation, such as acetate buffer or phosphate buffer. The treatment is made at room temperature, namely in the range of 5 to 30 CC, and warming is permitted if necessary as far as it does not damage the functional protein, and gentle stirring or shaking is also permitted if necessary to promote dissolution. Then the buffer containing only the functional protein is treated with a conventional technique for harvesting of protein crystals from the solution, such as concentration, freeze-drying, or fractional salting-out, so that the functional protein crystals are recovered in the pure state from the above-mentioned solution.

The invention is explained by the protein-embedded crystals produced in plants as an example.

Protein-embedded crystals produced in plants of the invention consist of two different crystals, the viral occlusion body protein crystals and the objective protein micro crystals, and the objective protein micro crystals are dispersed in the viral occlusion body protein crystals.

Analysis based on the database of the amino acid sequence of VP3, one of the outer layer proteins of Bombyx marl cytoplasmic polyhedrosis virus (BmCPV), revealed that the protein shows a high homology with the virus capsid protein of Oryzavirus classified under Reoviridae and with that of plant reovirus classified under Fijivirus [Ikeda et al., (2001) Journal of Virology 75, 988-995]. This allowed us to expect that the virus capsid protein of BmCPV or polyhedrin, when expressed in plants, will be processed into a protein having a function similar to that in insect cells.

<Expression of VP3IGFP Polyhedra in Plants>

Then the green fluorescent protein (GFP) as a functional protein was ligated to the C-terminal of VP3 for preparation of a chimeric gene coding for the fusion protein consisting of VP3 and GFP (VP3/GFP). By using the plasmid pAcVP3/GFP containing the VP3/GFP-chimeric gene and the plant expression vector Ti plasmid pIG 121, the Ti plasmid vector pIG 121-VP3/GFP having the VP3/GFP chimeric gene downstream of the CaMV 35S promoter was constructed in 3 steps. Separately, the polyhedrin gene was excised as the Kpn I-Sac I region from pBS(KS)-H and inserted downstream of the GaMy 35S promoter of pIG 121 to construct the vector pIG 121-H. Into the plant (potato or belladonna) where expression had been confirmed after introduction of pIG 121-H by the method of agrobacterium, pIG 121-VP3/GFP was introduced to obtain a transformed plant having both genes. It was confirmed with the Western blot analysis that polyhedrin and the GFP protein had been produced, and formation of polyhedra was confirmed by microscopic examination (FIG. 2). Under the microscope, the plant tissue was treated with an alkali, and it was observed along time that polyhedra was dissolved in a very short time; thus the characteristic of polyhedra that it is dissolved under alkaline conditions could be confirmed (FIG. 3). It was also observed that green fluorescence due to the VP3/GFP chimeric protein released from polyhedra was emitted, though not so evidently as with Bombyx mon cells because of interference by natural fluorescence of the plant itself. Thus we have developed a method for incorporation of the objective protein into particulates called polyhedra in a transgenic plant containing the expression system of the polyhedrin gene and the VP3/GFP chimeric gene, and a method for production of particulates containing the objective protein occluded with a protein called polyhedrin.

<Detection and Purification of Interacting Protein by Making Use of Recombinant Polyhedra>

The function and the integrity of cells are based on the interaction among various polymeric substances (between a protein and a different protein, between DNA and a protein). For detection of these interacting substances, the far-western blot analysis and the two-hybrid system method have been developed. With these methods, the interacting molecules are detected indirectly based on the reaction with an antibody or the activity of the reporter gene, and therefore it is generally difficult to detect and purify in one step the interacting protein as it is in cells. The method of the invention making use of the recombinant polyhedra aims to remove such restriction.

Now we assume a pair of proteins A and B that interact with each other. A recombinant polyhedra is produced by using the gene coding for the protein A and isolated. A part of the protein A synthesized is bound to the surface of polyhedra. The polyhedra is mixed in the cell extract containing the protein B that interacts with the protein A and allowed to react for a suitable time, followed by separation of polyhedra by centrifugation. Thus the protein B bound to the protein A on the surface of polyhedra can be purified in one step from many coexisting proteins. This procedure is able to detect and purify the protein B as it has been extracted from cells, because the procedure requires no operations such as electrophoresis, blotting on the membrane, and the like. If the protein A is a protein taking part in gene expression, the procedure can be utilized as an improved south-western blotting to detect the interaction between DNA and the protein by using a genome DNA fragment as the protein B.

Particulates with the objective protein occluded are produced in plants according to the above-mentioned procedure, and the particulates are collected so that the objective protein of a high purity can be recovered.

For stabilization of an unstable functional protein crystal by occlusion in a stable protein crystal, cytoplasmic polyhedrosis virus, which infects the columnar cells of the insect midgut epithelium and produces large protein crystals called polyhedra in the cytoplasm of the infected cells, can be used to form protein-embedded crystals with various functional proteins dispersed and occluded in the above-mentioned polyhedrosis virus protein crystals.

By incorporation of a particular protein in polyhedra derived from cytoplasmic polyhedrosis virus (cytoplasmic polyhedra), it is able to bind a biological material such as a different protein to the protein, and the biological material bound to cytoplasmic polyhedra can be recovered.

A common practice for recovery of a particular protein alone is that a specific antibody to the protein is prepared first and the protein is recovered as a precipitate or the like by making use of the antigen-antibody reaction between the protein and the antibody. However with this method the protein to be isolated must be obtained in a highly purified state, and moreover, the antibody to the protein must be prepared. On the other hand, when a particular protein is incorporated in cytoplasmic polyhedra and then added to a crude sample such as a cell extract, the protein distributed on the surface of cytoplasmic polyhedra is bound to the biological material present 24 in the crude sample. Cytoplasmic polyhedra can be harvested easily by centrifugation or the like, and therefore the biological material bound to cytoplasmic polyhedra can be recovered. A particular protein can be incorporated in polyhedra by using the gene coding for the protein if any. Therefore the function of a protein encoded by an unknown gene that has been obtained during genome analysis can be investigated.

For preparation of protein crystals required for X-ray analysis, a crystal-like protein is incorporated in cytoplasmic polyhedra. Then the polyhedra is subjected to X-ray analysis, and the blank cytoplasmic polyhedra which contains no foreign material is also subjected to X-ray analysis. The analytical data of the protein incorporated in cytoplasmic polyhedra is obtained by comparison of the results of two analyses.

Incorporation of a crystal-like protein in cytoplasmic polyhedra can produce crystals of the protein by using the resultant cytoplasmic polyhedra as the nucleus.

The stereochemical configuration of a protein is investigated with the X-ray analysis. For this analysis, crystals of the protein are needed. However for crystallization of a protein it is required to obtain a highly-purified protein and to find crystallization conditions appropriate for the properties of the protein. Generally this process requires about a half year or a longer time. It is not infrequent that certain proteins cannot be crystallized. However because a crystal-like protein can be incorporated in 2-2 cytoplasmic polyhedra, the protein incorporated in cytoplasmic polyhedra can directly be analyzed with X-ray or crystals can be grown with the cytoplasmic polyhedra as the nucleus. In the latter case the cytoplasmic polyhedra is an important tool for preparation of crystals of a protein, because protein will be crystallized easily in the presence of a nucleus.

If a protein is incorporated in cytoplasmic polyhedra after fusion with a green fluorescent protein, the state of the protein in the polyhedra can easily be examined for example by use of emission. Whether the objective protein has been incorporated in cytoplasmic polyhedra is examined by collection of polyhedra, dissolution of polyhedra in an alkaline solution (pH 11), and isolation of the protein incorporated. However, if a protein is incorporated together with an emitting protein such as a green fluorescent protein in cytoplasmic polyhedra, incorporation of the objective protein can be confirmed by use of the emission of cytoplasmic polyhedra. For practical use of a useful protein such as an enzyme, maintenance of the function of the protein has been an important problem. Namely, a protein, when stored or allowed to stand at room temperature, generally loses its function, for example the catalytic activity of an enzyme, and therefore for storage of a protein with its function maintained, it should be stored or allowed to stand at a low temperature for example in a refrigerator. The technique for maintenance of the function is the mean that can solve the subject of improvement of preservability and stability of the protein, and it is the subject matter that a protein can be stored at room temperature with the function of the protein maintained more persistently than with the conventional means for storage of proteins.

This invention can provide a useful protein such as an enzyme with its function maintained by improvement of stability, or protection, or improvement of preservability of the protein, or combination thereof.

It is another subject matter that a useful protein such as an enzyme is stored in the form of an aqueous solution so that the function may be maintained for a long time. This requires a technique for coating the useful protein with a protective protein. The coating technique is able to avoid influence of the outer environment on the useful protein, that is, the situation that makes the useful protein lose its function, for example, dissolution of the protein in moisture, or degradation or ingestion by microorganisms.

This invention can provide a useful objective protein such as an enzyme that is coated with a protective protein.

Proteins are functional biological polymers which may have various chromophores or light-absorbing molecules, and their optical characteristics and electronic characteristics are expected to be practically useful. For such practical application, not amorphous dry proteins but crystal-like proteins are needed, and therefore production of crystal-like proteins is a subject matter. For this, a technique to provide crystal-like proteins is required. In general, crystallization of a protein is extremely difficult, and the subject matter that is to be solved with the technique is to produce readily crystal-like proteins and to prepare homogeneous crystals.

This invention can provide a useful objective protein such as an enzyme as a crystal, more in detail, the invention can e provide a useful objective protein such as an enzyme as a crystal by using the protein produced as crystals in cells as the protective protein for coating of the objective protein.

This invention can provide also a method for easy preparation of a useful objective protein such as an enzyme as a crystal by making use of the gene manipulation.

The technique that utilizes the protein produced as crystals in cells is very effective for development of use of a protein as a novel material. However there is a risk of contamination of polyhedra by baculovirus when polyhedra is prepared in insect cells and when the objective protein is incorporated in polyhedra by using the baculovirus vector, the baculovirus expression vector system, as have been so far. Also when polyhedra is purified from insect cells, there is a risk of contamination of the sample by baculovirus. When a large amount of polyhedra that has incorporated the objective protein is necessary, it is required to proliferate much insect cells by some means and to infect the cells with the recombinant baculovirus vector, which entails enormous costs.

Because it is possible to allow plants to produce polyhedra, the above-mentioned risk of viral contamination and the problem in cost can be solved by incorporation of the objective protein in plant polyhedra.

The viral occlusion body protein of virus such as cytoplasmic polyhedrosis virus (polyhedrin) in this invention produces particulates called polyhedra as a result of crystallization in cells. During the process of crystallization, the objective protein that is occluded in the particulates is also incorporated as crystals. Therefore the objective protein incorporated in the particulates can be used as the nucleus for crystallization necessary for production of crystals of the objective protein.

The details of the invention are illustrated in the Examples. The invention is not restricted at all by the Examples.

EXAMPLES

<<Virus and Cells>>

The H strain of Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) forms cubic polyhedra in cytoplasm. The recombinant virus (AcC P-H) constructed to express only the polyhedrin of the H strain was used. Insect cells used were subcultures of IPLB-Sf21-AE derived from Spodoptera Frugiperda (Sf21) in the TC-100 (GIBCO BRL) medium containing 10% fetal bovine calf serum.

(1) Synthesis of cDNA

The double stranded RNA was extracted from BmCPV, and the fourth segment (abbreviated as S4 hereinafter) was isolated by using a low temperature melting agarose gel [manufactured by FMC Co., trade name “GTG”]. Then two different primers were synthesized according to the prior art method [“Virology”, Vol.181, pp.749-755 (1991)], with the Sequence No.3 in the sequence list (the 5th to 12th from the left terminal is the Not1 site) for the (+) strand and Sequence No.4 in the sequence list (the 5th to 10th from the left terminal is the BamH1 site) for the (−) strand based on the terminal sequences of S4. Then these primers were used for preparation of cDNA of S4 with the Timesever cDNA Synthesis Kit (manufactured by Amasham Pharmacia Biotech Co.), followed by PCR-amplification by using Ex Taq polymerase (manufactured by Takara Co.). The amplified PCR product was digested with a restriction enzyme that restricts selectively at the Not1 site (called Not1 restriction enzyme hereinafter) and a restriction enzyme that restricts selectively at the BamH1 site (called BamH1 restriction enzyme hereinafter).

(2) Construction of Recombinant Baculovirus (I)

The segments obtained by digestion of cDNA of S4 with the restriction enzymes Not1 and BamH1 were integrated in the Not1-BamH1 site of the baculovirus transfer vector pVL1392 (manufactured by PHARMINGEN Co.) to construct the recombinant transfer vector pAcVP3. Then pAcVP3 was digested with restriction enzymes that restrict selectively at the site Bglll on the 2964th and the site Sail on the 2999th, respectively, of the nucleotide sequence of S4, followed by integration at the Bglll-Sall site of the vector pEGFPN2 (manufactured by CLONTECH Co.) that expresses a fusion protein with the green fluorescent protein (abbreviated as GFP hereinafter).

This vector was then digested with the restriction enzyme Not1 followed by integration at the Not1 site of the baculovirus transfer vector (pVL1392), to construct the recombinant transfer vector (pAcVP3/GFP). Separately, pEGFPN2 was digested with the restriction enzyme BamH1 and the restriction enzyme Not1 , followed by integration at theBamH1-Not1 site of the baculovirus transfer vector (pVL1392) 2 (manufactured by PHARMINGEN Co.), to construct the recombinant transfer vector (pAcGFP) that expresses only GFP. These 3 different recombinant transfer vectors thus constructed, 5 μg each, were used for transfection of cultured insect cells Sf21 together with 0.5 μg of filamentous Baculogold Baculovirus DNA (manufactured by PHARMINGEN Co.) according to the lipofectin method. Then plaque purification was performed to give respective recombinant viruses, AcVP3, AcVP3/GFP, and AcGFP.

(3) Construction of Recombinant Baculovirus (2)

The segments obtained by digestion of cDNA of S4 with the restriction enzymes Not1 and BamH1 were integrated into the Not1-BamH1 site of the baculovirus transfer vector pVL1392 (manufactured by PHARMINGEN Co.) to construct the recombinant transfer vector pAcVP3. Then pAcVP3 was digested with the restriction enzyme Xbal (present at the region from 1,358th to 1,363rd and from 2711th to 2,716th of the nucleotide sequence of S4), and the recombinant transfer vector pAcVP3(Xbal) was constructed by self-ligation. This vector pAcVP3(Xbal) was then digested with the restriction enzymes Bglll and Sall (present in the region from the 2,964th to 2,999th of the nucleotide sequence of S4), followed by integration at the Bglll -Sall site of the vector pEGFPN2 that expresses a fusion protein with green fluorescent protein; GFP) (manufactured by CLONTECH). Digestion with Not1 and integration at the not1 site of the baculovirus transfer vector pVL1392 were performed to construct the recombinant transfer vector pAcVP3(Xbal)/GFP. The recombinant transfer vector thus constructed, 5p g, was used for transfection of cultured insect cells Sf21 together with 0.5 p g of filamentous Baculogold Baculovirus DNA (manufactured by PHARMINGEN Co.) according to the lipofectin method. Then plaque purification was performed to give the recombinant virus AcVP3(Xbal)/GFP.

<<Expression of the Recombinant Protein in Sf21 Cells >>

The recombinant virus was allowed to infect Sf21 cells at 20 p.fu./cell (1×106 cells/35 mm Petri-dish). Double infection with two different viruses, for example with AcVP3/GFP and AcCP-H or with AcVP3(Xbal)/GFP and AcCP-H, was performed at 10 p.f.u./cell. After virus was allowed to adsorb to cells at room temperature for I hour, the virus solution was removed, and 2 ml of TC-100 containing 10% fetal bovine calf serum was added, followed by incubation at 27° C. for 4 days. The infected cells were used for Western blotting or measurement of fluorescence.

<<Purification of Polyhedra>>

The BmCPV H-strain-derived recombinant baculovirus AcCP-H that produces cubic polyhedra (Mori et al. (1993) J. Gen. Virol. 74, 99-102) and AcVP3/GFP or AcVP3(Xbal)/GFP were allowed to infect Sf21 cells (1×108 cells), and cubic polyhedra was harvested from the infected cells on the 4th day. After washing with PBS (20 mM NaH2PO4, 20 mM Na2HPO4, 150 mM NaCl, pH7.2), polyhedra was homogenized in ice with a homogenizer. The homogenate was washed with 1% Tween 20, and polyhedra was harvested by centrifugation. Then centrifugation with the sucrose density gradient from I 0.5M to 2.2M at 50,000×g for 45 minutes was performed to separate the fraction of polyhedra. The separated sample was washed with PBS, followed by centrifugation at 50,000×g for 10 minutes, to collect purified polyhedra.

<<Expression of GFP-VP3 Fusion Protein>>

Polyhedra was purified from cells double-infected with AcVP3/GFP and AcCP-H or with AcVP3(Xbal)/GFP and AcCP-H, and suspended in the acetate buffer (pH4.0) to deactivate GFP without dissolving polyhedra. Then green fluorescence was measured which became dissolved from polyhedra when pH was elevated. Green fluorescence showed no change at pH 10.0 or a lower pH, but polyhedra was dissolved and green fluorescence was confirmed when pH exceeded 10.0 (FIG. 4). This suggested that the VP3-GFP fusion protein was occluded in polyhedra and dissolved when polyhedra was dissolved. Also polyhedra purified from cells double-infected with AcVP3(Xbal)/GFP and AcCP-H was suspended in the acetate buffer (pH4.0) to deactivate GFP without dissolving polyhedra, and green fluorescence from polyhedra was measured while pH was elevated. Green fluorescence showed no change at pH 10.0 or a lower pH, but polyhedra was dissolved and green fluorescence was confirmed again when pH exceeded 10.0 (FIG. 4).

Namely, it has been demonstrated that polyhedrin of BmCPV and VP3 identify each other through their specific interaction, that the VP3-GFP fusion protein (one of the Examples of objective proteins of this invention) is occluded in particulates called polyhedra, and that even when VP3 has lost its latter half or more (VP3(Xbal)), VP3(Xbal)/GFP is efficiently occluded in polyhedra.

Reference Example 1

cDNA synthesized in (1) was cloned in the plasmid pBluescript11 [manufactured by Stratagene Co.], and the deletion mutants for each of 5 clones obtained were formed by using the Deletion Kit for kilo-sequence (manufactured by Takara Co.).

The ABIPRISM terminator cycle sequencing kit and the 373A automated sequencer manufactured by PE Applied Biosystems Co. were used for analysis of the nucleotide sequence; it was demonstrated that S4 of BmCPV is 3,259-bases long as shown in the Sequence No.1 in the sequence list, which contains a large open reading frame (ORF) having a start codon from the 14th to 16th (ATG) and the stop codon from the 3,185th to 3,187th (TAA). This ORF consists of 1,057 amino acid residues (Sequence No.2), of which molecular weight was estimated to be about 130 kDa. Western blot analysis revealed that there is a band corresponding to about 130 kDa also in purified VP3 of virion. The SDS-PAGE of non-infected cells, AcNPV-infected cells and AcVP3-infected cells showed a new band corresponding to the molecular weight of about 130 kDa, and the western blot analysis showed that the antibody reacted. Thus VP3 was confirmed to have been encoded in S4.

Reference Example 2

It is known that GFP is stable at a pH between 5 and 12, and polyhedra is dissolved at a pH exceeding 10.0. Then fluorescence from GFP was measured before and after dissolution of polyhedra to determine whether VP3 was occluded in polyhedra. Polyhedra, after purification, was suspended in 1 ml each of distilled water, 50 mM acetate buffer (pH4.0), and 5 mM carbonate-bicarbonate buffer (pH 11.0). The pH of the suspension in the acetate buffer was gradually elevated by addition of the 5 mol/m3 NaOH solution, and the suspension was incubated at 30° C. for 30 minutes when pH became 6.0, 10.0, and 12.5, and the fluorescence of GFP was excited at 475 nm and measured at 51O nm by the fluorometer (manufactured by Hitachi Seisakusho, Product code F-2000). The result is illustrated in the graph in FIG. 4.

Single infection with AcVP3/GFP and double infection with AcVP3/GFP and AcCP-H were performed in 35-mm Petri dishes, and emission of fluorescence from GEP was confirmed with the Olympus photomicroscope on the 4th day after infection.

Reference Example 3

When cells double-infected with AcVP3/GFP and AcCP-H were examined microscopically, an intense green fluorescence was confirmed along the border of polyhedra of BmCPV. However green fluorescence was noted all over the cytoplasm in cells infected with AcVP3/GFP alone. Therefore, it was supposed that there might be some interaction between polyhedrin of BmCPV and VP3, though it was still unknown whether VP3 was occluded in polyhedra of BmCPV.

Then polyhedra was purified from cells double-infected with AcVP3/GFP and AcCP-H, and suspended in the acetate buffer (pH4.0) to deactivate GFP without dissolving polyhedra, and green fluorescence was measured that was dissolved from polyhedra by elevating pH. Green fluorescence was not noted at pH 10.0 or a lower pH whereas polyhedra was dissolved and green fluorescence was confirmed when pH exceeded 10.0. In contrast, no green fluorescence was detected in a similar measurement after double infection with AcGFP and AcCP-H. These results suggested that the VP3-GFP fusion protein was occluded in polyhedra and became dissolved along with dissolution of polyhedra. Namely, it has been demonstrated that polyhedrin of BmCPV and VP3 identify each other through their specific interaction, and the VP3-GFP fusion protein is occluded in particulates called polyhedra.

Virus and Cells

The H strain of Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) forms cubic polyhedra in cytoplasm. The recombinant virus AcCP-H constructed to express only the polyhedrin of the H strain was used. Insect cells used were subcultures of IPLB-Sf21-AE derived from Spodoptera Frugiperda (Sf21) in the TC-100 (GIBCO BRL) medium containing 10% fetal bovine calf serum.

Synthesis of cDNA

The double-stranded RNA was extracted from BmCPV, and the fourth segment (S4) was isolated by using a low temperature melting agarose gel (FMC). Then two different primers were synthesized based on the terminal sequences of S4 reported by Kuchino et al. [Kuchino et al. (1991) Virology, 181, 749-755];

  • 5′GATCGCGGCCGCAGTAATTTCCACCATG3′ (SEQ ID NO:3)(the region underlined is the Not1 site) for the (+) strand and
  • 5′GATCGGATCCGGCTAACGTTTCC3′ (SEQ ID NO:4)(the region underlined is the BamH1 site) for the (−) strand. Then these primers were used for preparation of cDNA of S4 with the Timesever cDNA Synthesis Kit (Amasham Pharmacia Biotech). The cDNA thus synthesized was amplified by PCR using Ex Taq polymerase (TAKARA). The amplified PCR product was digested with the restriction enzymes Not1 and BamH1. The fragments were integrated into the Not1-BamH1 site of pBlueScript II (SK+) (STRATAGENE), and then transformed by using E.coli JMIO9(TOYOBO), and 5 clones were used for analysis of nucleotide sequence.
    Analysis of Nucleotide Sequence

Deletion mutants for each of 5 clones having the full length of S4 were obtained by using the Deletion Kit for kilo-sequence (TAKARA). The nucleotide sequence was analyzed by using the ABIPRISM terminator cycle sequencing kit (PE Applied Biosystems) and the 373A automated sequencer of PE Applied Biosystems.

Experimental Example 2

Confirmation of Formation of Polyhedra by Plants

For demonstration of formation of polyhedra within plant cells as a result of expression of the polyhedrin gene, the GUS gene of the plasmid vector pIG121was exchanged with the polyhedrin gene to prepare pIG121-CP(FIG. 5). First, PIG121was digested with the restriction enzyme Sa11 to remove the GUS gene, and the polyhedron gene of BmCPV was inserted instead. By making use of the fact that the resultant plasmid has two different antibiotics (kanamycin and hygromycin)-resistant genes, it is possible to confirm selection of transformed cells, mRNA, expression of polyhedrin, and formation of polyhedra. However, as described below, it was necessary to insert additionally the VP3/GFP chimeric gene into the transformed plant cells integrated with the polyhedrin gene, and for easier screening, the major part of the kanamycin-resistant gene was removed by digestion with the restriction enzyme Sph1 to prepare the plasmid pIG121-CP (Km), which was used. The resultant transformed plant was hygromycin-resistant and kanamycin-sensitive. This transformed plant was found to have formed cubic polyhedra similar to that formed in insect cells by using the baculovirus vector.

Expression of VP3-GFP in Plants

By exchange of the VP3-GFP chimeric gene with the GUS gene of pIG121, pIG121-VP3/GFP was prepared (FIG. 6). Namely, pIG121 was digested with the restriction enzyme Sail to remove the GUS gene, and the VP3-GFP chimeric gene was inserted instead. By making use of the fact that the resultant plasmid has two different antibiotics (kanamycin and hygromycin)-resistant genes, it is possible to confirm selection of transformed cells, mRNA, expression of the chimeric protein, and ability of GFP to emit green fluorescence. When the resultant transformed plant cells were irradiated with ultraviolet light, emission of green fluorescence was confirmed.

Expression of Both Polyhedrin Gene and VP3/GFP Chimeric Gene

Into the transformed plant cells integrated with the polyhedron gene by using the plasmid pIG121-CP (Kin), pIG121-VP3/GFP was additionally introduced. The transformed plant integrated with the polyhedrin gene alone was hygromycin-resistant but kanamycin-sensitive. As a result of subsequent introduction of pIG121-VP3/GFP, the transformed plant became sensitive also to hygromycin. Through this two-step screening, the transformed plant cells having both the polyhedrin gene and the VP3/GFP chimeric gene was finally obtained.

Host Plants Used for Transformation

Potato (Family Solanaceae) cultured under aseptic conditions was used in the experiment, but the plant is not restricted to this plant. The above-mentioned vector is for agrobacterium, and the promoter used was CaMV35S. Dicotyledons such as plants belonging to the family Solanaceae are generally used as the hosts into which genes can be introduced, but monocotyledons may be used.

Experimental Example 3

Purification of Polyhedra

Transformed plant cells having both the polyhedrin gene and the VP3/GFP chimeric gene were homogenized to release polyhedra from cells. The homogenate was washed with 1% Tween 20, and polyhedra was harvested by centrifugation. Then centrifugation at 50,000×g for 45 minutes with the sucrose density gradient from I 0.5M to 2.2 M was performed to separate the fraction of polyhedra. The fraction was washed with PBS, and centrifuged at 15,000×g for 10 minutes, to give purified polyhedra.

Measurement of Fluorescence of VP3/GFP

It is known that GFP is stable at a pH between 5 and 12, and polyhedra is dissolved at a pH exceeding 10.0. Then fluorescence from GFP was measured before and after dissolution of polyhedra to determine whether VP3 was occluded in polyhedra. Polyhedra, after purification, was suspended in I ml each of distilled water, 50 mM acetate buffer (pH4.0), and 5 mM carbonate-bicarbonate buffer (pH 1.0). The pH of the suspension in the acetate buffer was gradually elevated by addition of the 5N-NaOH solution, and the suspension was incubated at 300C for 30 minutes when pH became 6.0, 10.0, and 12.5. Then the fluorescence from GFP was excited at 475 nm and measured at 510 nm with the F-2000 Fluorescence Spectrophotometer (HITACHI). The amount of protein was determined with the Lowry's method and fluorescency per mg of the protein was calculated.

Results of Measurement of Fluorescence of VP3/GFP

Formation of polyhedra from the transformed plant cells into which the polyhedrin gene and the VP3/GFP chimeric gene had been introduced was confirmed. Thus it was confirmed that polyhedrin was expressed and it formed the structure polyhedra in plant cells as well as in insect cells, as was previously analogized from the homology between BmCPV and other plant viruses. Then polyhedra was purified from the plant tissue, and when the purified polyhedra was suspended in water, green fluorescence was noted (FIG. 7). This indicates that VP3/GFP is expressed also in plant cells as in insect cells, and exhibits its properties as a functional protein. This indicates also that a part of VP3/GFP is exposed on the surface of polyhedra.

Purified polyhedra was suspended in the acetate buffer (pH4.0) so that VP3/GFP exposed on the surface of polyhedra might become unable to emit green fluorescence, and then green fluorescence that became dissolved from polyhedra with gradual increase of pH was measured. At pH 10.0 or a lower pH, no change was noted in green fluorescence, though at a pH exceeding 10.0, polyhedra was dissolved and an intense green fluorescence was noted (FIG. 7). This indicated that the VP3-GFP fusion protein was occluded in polyhedra and became dissolved along with dissolution of polyhedra. That is, also in plant cells, polyhedrin of BmCPV and VP3 identify each other through their specific interaction, and therefore the VP3-GFP fusion protein (one of the Examples of the objective proteins of the invention) was occluded in particulates called polyhedra.

INDUSTRIAL APPLICABILITY

This invention provides protein-embedded crystals where various unstable functional proteins in the form of micro crystals are occluded in the stable cytoplasmic polyhedrin crystals. Therefore this invention makes it possible to store extremely unstable enzymes over a long time and to control expression of the function of a functional protein in a stage-specific manner. In addition, a functional protein incorporated in particulates can be used as a nucleus for crystallization of a protein, a process necessary for analysis of the higher-order structure of the protein, because the particulates are crystal-like. Furthermore, crystallized proteins are expected to be used as device materials including electronic materials and optical materials based on their physical properties.

As explained in detail, the invention that has been applied for patent provides a method for occlusion of a objective protein with the viral occlusion body protein in plants, and a method for preparing particulates where an objective protein is occuluded with the viral occlusion body protein in plants. The invention makes it possible to produce a large amount of particulates that have incorporated an objective protein without any virus occluded. Incorporation into particulates makes it kpossible to store extremely unstable enzymes over an extended period of time and to control expression of the function of a functional protein in a stage-specific manner. In addition, an objective protein incorporated in particulates to crystallization of the protein, a process necessary for analysis of the higher-order structure of the protein, because the particulates are crystal-like.

Claims

The invention claimed is:

1. A protein complex having a structure that a heterologous target protein is occluded with a viral occlusion body protein encoded by nucleic acids of cytoplasmic polyhedrosis virus (CPV), wherein the target protein is fused to the C-terminus of SEQ ID NO:2, and wherein the target protein is occluded within the Bombyx mori CPV strain H polyhedrin.

2. The protein complex according to claim 1, wherein the occlusion body protein contributes to improvement of stability or protection, or improvement of preservability, or a combination thereof, of the target protein.

3. The protein complex according to claim 1 or 2, wherein the complex is produced in particulates.

4. The protein complex according to claim 1 or 2, wherein the complex is produced by incorporation of the target protein in a crystalline form during crystallization of the occlusion body protein.

5. The protein complex according to claim 1 or 2, wherein the protein complex is produced in insect cells.

6. The protein complex according to claim 1 or 2, wherein the target protein is selected from the group consisting of: proteins that fluoresce due to ultraviolet light, enzymes, immune antibody proteins, proteins having chromophores, and proteins having light absorbing groups.

7. A method for producing in cells a protein complex according to claim 1 having a structure that a heterologous target protein is occluded with the viral occlusion body protein encoded by nucleic acids of cytoplasmic polyhedrosis virus, comprising providing in the cells the target protein fused to the C-terminus of SEQ ID NO:2, and wherein the target protein is occluded within the Bombyx mori CPV strain H polyhedrin, wherein the providing step comprises:

transforming the cells with a virus vector that has been integrated with a DNA encoding the target protein together with a virus vector that has been integrated with a DNA encoding the viral occlusion body protein, and

culturing the transformed cells so as to produce the protein complex.

8. The method according to claim 7, wherein the protein complex is produced in insect cells.

9. The method according to claim 7 or 8, wherein the target protein is selected from the group consisting of proteins that fluoresce due to ultraviolet light, enzymes, immune antibody proteins, proteins having chromophores, and proteins having light absorbing groups.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class:

Recent applications for this Assignee: