-
2005-05-17
10/425,800
2003-04-29
US 6,893,842 B2
2005-05-17
-
-
Jeffrey Fredma | Sumesh Kaushal
2023-04-29
The invention provides TCCV-1 or TCCV-2 from human, reagents related thereto including polynucleotides encoding TCCV-1 or TCCV-2, purified polypeptides, and specific antibodies. Methods of making and using these reagents, in particular, methods for screening compounds which modulate TCCV-1 or TCCV-2 activity are provided. Also provided are methods of diagnosis and kits.
Get notified when new applications in this technology area are published.
This U.S. Patent Application is a divisional of U.S. patent application Ser. No. 09/935,541, filed on Aug. 23, 2001 now U.S. Pat. No. 6,589,787, which is a divisional of U.S. patent application Ser. No. 09/404,650, filed Sep. 23, 1999 now U.S. Pat. No. 6,309,858. This U.S. patent application claim the benefit, under 35 USC §119(e), of U.S. Provisional Patent Application Ser. No. 60/102,222, filed Sep. 29, 1998, the disclosure of which is incorporated herein by reference.
The present invention relates to nucleic acid and amino acid sequences of human T-type calcium channel variants and the use of these sequences in diagnosis of disease states associated with pain and for use as targets for screening therapeutic compounds useful in the treatment of disease states associated with pain.
Voltage-gated calcium channels can be divided into high- and low-threshold types. The high-threshold channels include the dihydropyridine-sensitive L-type, the ω-conotoxin GVIA-sensitive N-type and ω-agatoxin IVA-sensitive P-type. Depending on the tissue, these channel subtypes consist of α1, α2δ, β and γ subunits. (Perez-Reyes and Schneider (1995) Kid. Int. 48:1111-1124.) To date, only one type of low-threshold calcium channel is known, the T-type calcium channel.
T-type calcium channels have hyperpolarized steady-state inactivation characteristics, a low threshold for inactivation, small single channel conductance and display rapid inactivation kinetics. (Ertel and Ertel (1997) Trends Pharmacol. Sci. 18:37-42.) The functional roles for T-type calcium channels in neurons include membrane depolarization, calcium entry and burst firing. (White et al. (1989) Proc. Natl. Acad. Sci. USA 86:6802-6806.) T-type calcium channels are found in many neurons of the central and peripheral nervous systems, including small and medium diameter neurons of the dorsal root ganglia (Scroggs and Fox (1992) J. Physiol. 445:639-658) and neurons in the thalamus. (Suzuki and Rogawski (1989) Proc. Natl. Acad. Sci. USA 86:7228-7232.) Calcium currents have been found to be important in several neurological and muscular functions, e.g., pain transmission, cardiac pacemaker activity, etc. Improper functioning of these channels has been implicated in arrythmias, chronic peripheral pain, improper pain transmission in the central nervous system, and epilepsy.
Anti-epileptic drugs are known to cause a reduction of the low-threshold calcium current (LTCC or T-type Ca2+ current) in thalamic neurons. (Coulter et al. (1989) Ann. Neurol. 25:582-593.) One such anti-epileptic compound, ethosuximide, has been shown to fully block T-type Ca2+ current in freshly dissected neurons from dorsal root ganglia (DRG neurons) of adult rats (Todorovic and Lingle (1998) J. Neurophysiol. 79:240-252), and may have limited efficacy in the treatment of abnormal, chronic pain syndromes that follow peripheral nerve damage.
Molecular cloning has revealed the cDNA and corresponding amino acid sequences of several different α1 subunits (α1A, α1B, α1C, α1D, α1E, α1G, α1H, α1I, and α1S). While the cloned α1 subunits identified thus far correspond to several of the calcium channels found in cells, they do not account for all types of calcium conductance found in native cells.
The present invention relates to the discovery of human T-type calcium channel α1I subunit variants that are useful in diagnosis of disease states associated with the peripheral nervous system and for screening compounds that may be used in the treatment of mammals for these disease states.
The invention is based on the discovery of human T-type calcium channel α1I subunit variants (TCCV-1 and TCCV-2), the polynucleotides encoding TCCV-1 or TCCV-2, and the use of these compositions in screening for compounds effective in treating disease states associated with peripheral pain, and the use of these compositions for diagnosis of these disease states. In particular, the present invention expression vectors, host cells, antibodies, diagnostic kits, and transgenic/knockout animals are provided.
The invention features an isolated polynucleotide encoding TCCV-1 or TCCV-2 polypeptides. The invention further provides an isolated polynucleotide, encoding a TCCV-1 or TCCV-2 polypeptide wherein the polynucleotide encodes an TCCV-1 or TCCV-2 polypeptide comprising the amino acid sequence of SEQ ID NO:2 or 4, respectively. In certain embodiments, the polynucleotide is detectably labeled or is complementary to the polynucleotide encoding a TCCV-1 or TCCV-2 polypeptide. The complementary polynucleotide can also be detectably labeled. In another embodiment, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO:1 or 3.
The present invention encompasses an expression vector comprising the polynucleotide encoding SEQ ID NO:2 or 4. Also contemplated is a host cell comprising the polynucleotide encoding SEQ ID NO:2 or 4. The host cell can be a prokaryotic or eukaryotic cell. The invention further comprises a method of producing a TCCV-1 or TCCV-2 polypeptide comprising: culturing the host cell comprising the expression vector comprising the polynucleotide encoding SEQ ID NO:2 or 4 under conditions suitable for expression of the polypeptide; and recovering the polypeptide from the host cell.
The present invention also contemplates a method of detecting a polynucleotide encoding a TCCV-1 or TCCV-2 polypeptide in a sample containing nucleic acid material, comprising the steps of: contacting the sample with a polynucleotide which is the complement of the polynucleotide encoding SEQ ID NO:2 or 4, wherein the complement is detectably labeled, under conditions suitable for formation of a hybridization complex; and detecting the complex, wherein the presence of the complex is indicative of the presence of the polynucleotide encoding the polypeptide in the sample.
The present invention provides a diagnostic test kit comprising: the polynucleotide comprising SEQ ID NO:1 or 3; and instructions for conducting the diagnostic test.
The present invention encompasses a method of screening for a compound that modulates TCCV-1 or TCCV-2 activity comprising: contacting TCCV-1 or TCCV-2, or fragment thereof with the compound; and detecting modulation of TCCV-1 or TCCV-2 activity. In certain embodiments, the TCCV-1 or TCCV-2 is expressed on a cell or tissue or immobilized on a solid support. The compound can be an antagonist or agonist of TCCV-1 or TCCV-2 activity. In a further embodiment, the compound is ethosuximide or an analog thereof.
The present invention provides an isolated TCCV-1 or TCCV-2 polypeptide or fragment thereof. In certain embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO:2 or 4. The polypeptide is recombinantly produced or synthetically produced. The present invention also provides an isolated antibody which specifically binds to the polypeptide of SEQ ID NO:2 or 4.
The present invention encompasses a transgenic nonhuman mammal comprising the polynucleotide encoding TCCV-1 or TCCV-2 polypeptide. The transgenic nonhuman mammal can also comprise the polynucleotide which is the complement of the polynucleotide encoding TCCV-1 or TCCV-2 which is capable of hybridizing to a polynucleotide encoding TCCV-1 or TCCV-2, thereby reducing expression of TCCV-1 or TCCV-2.
FIGS. 1A-1F show the amino acid alignment between TCCV-1 (SEQ ID NO:2), TCCV-2 (SEQ ID NO:4), and rat T-type Calcium Channel subunit α1I (GenBank Accession No. AAD17796; SEQ ID NO:5). Residues that differ between the rat and human sequences are indicated in bold.
FIGS. 2A-2C show the splicing differences between the 3′ ends of TCCV-1 (nucleotides 5148 through 6015 of SEQ ID NO:1) or TCCV-2 (nucleotides 5148 through 6054 of SEQ ID NO:3), and GenBank Accession No. AF086827 (nucleotides 4927 through 5847 of SEQ ID NO:12). Downward pointing arrows indicate exon boundaries. Forward arrows indicate forward PCR primers (Primer Numbers 6352, 6344/88, 6495, and 6495/37). Reverse arrows indicate reverse or antisense PCR primers (Primer Number 6831). Nucleotide differences in the rat sequence which differ from the human PCR primer sequences are underlined.
FIG. 3 shows a 2.0% agarose gel of PCR products following 36 cycles of amplifications using various primers as shown in FIGS. 2A-2C on human brain cDNA. Lane 1 is a 100 bp ladder (Life Technologies, Bethesda, Md.); Lane 3 is the PCR, product following amplification with forward primer 6352 and reverse primer 6831; Lane 4 is the PCR product following amplification with forward primer 6344/88 and reverse primer 6831; Lane 5 is the PCR product following amplification with forward primer 6495 and reverse primer 6831; and Lane 6 is the result of amplification with forward primer 6495/37 and reverse primer 6831.
SEQ ID NO:1 is the polynucleotide sequence for TCCV-1. SEQ ID NO:2 is the putative encoded polypeptide.
SEQ ID NO:3 is the polynucleotide sequence for TCCV-2. SEQ ID NO:4 is the putative encoded polypeptide.
SEQ ID NO:5 is the amino acid sequence of GenBank Accession No. AAD17796.
SEQ ID NO:6 through SEQ ID NO:11 are PCR primers used in assembly of full length TCCV-1 and TCCV-2.
SEQ ID NO:12 is the nucleic acid sequence of GenBank Accession No. AF086827.
Before the present proteins, nucleotide sequences, and methods are described, it is to be understood that the present invention is not limited to the particular methodologies, protocols, cell lines, vectors, and reagents described, as these may vary. It is also understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not to limit the scope of the present invention.
The singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise.
All technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention pertains. The practice of the present invention will employ, unless otherwise indicated, conventional techniques of protein chemistry and biochemistry, molecular biology, microbiology and recombinant DNA technology, which are within the skill of the art. Such techniques are explained fully in the literature.
Although any machines, materials, and methods similar or equivalent to those described herein can be used to practice or test the present invention, the preferred machines, materials, and methods are now described. All patents, patent applications, and publications mentioned herein, whether supra or infra, are each incorporated by reference in its entirety.
Definitions
“TCCV” refers to the amino acid sequences of substantially purified TCCV-1 or TCCV-2 obtained from any species particularly mammalian species, including bovine, ovine, porcine, murine, equine, and preferably the human species, from any source, whether natural, synthetic, semi-synthetic, or recombinant.
“Agonist” refers to a molecule which, when bound to TCCV-1 or TCCV-2, or is within proximity of TCCV-1 or TCCV-2, modulates the activity of TCCV-1 or TCCV-2 by increasing or prolonging the duration of the effect of TCCV-1 or TCCV-2. Agonists can include proteins, nucleic acids, carbohydrates, organic compounds, inorganic compounds, or any other molecules which modulate the effect of TCCV-1 or TCCV-2.
An “allelic variant” as used herein, is an alternative form of the gene encoding TCCV-1 or TCCV-2. Allelic variants may result from at least one mutation in the nucleic acid sequence and may result in altered mRNAs or in a polypeptide whose structure or function may or may not be altered. Any given recombinant gene may have none, one, or several allelic forms. Common mutational changes which give rise to allelic variants are generally ascribed to natural deletions, additions, or substitutions of nucleotides. Each of these types of changes may occur alone, or in combination with the others, one or more times in a given sequence.
“Amplification” relates to the production of additional copies of a nucleic acid sequence. Amplification can be carried out using polymerase chain reaction (PCR) technologies or other methods well known in the art.
The term “analog” is used herein in the conventional pharmaceutical sense. In chemical terminology, an analog refers to a molecule that structurally resembles a referent molecule but which has been modified in a targeted and controlled manner to replace a certain substituent of the referent molecule with an alternate substituent other than hydrogen.
“Antagonist” refers to a molecule which, when bound to TCCV-1 or TCCV-2 or within close proximity, decreases the amount or the duration of the biological or immunological activity of TCCV-1 or TCCV-2. Antagonists may include proteins, nucleic acids, carbohydrates, antibodies, organic compounds, inorganic compounds, or any other molecules which exert an effect on TCCV-1 or TCCV-2 activity.
“Antibody” can be an intact molecule or fragments thereof, such as Fab, F(ab)2, and Fv fragments, which are capable of binding an epitopic determinant. The antibody can be polyclonal, monoclonal, or recombinantly produced.
The terms “antigenic determinant” or “epitopic determinant” refer to the fragment of a molecule that makes contact with a particular antibody.
The term “antisense” refers to any composition containing nucleic acids which is complementary to the “sense” strand of a specific nucleic acid molecule. Antisense molecules may be produced by any method including synthesis or transcription. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form duplexes and to block either transcription or translation. The designation “negative” can refer to the antisense strand, and the designation “positive” can refer to the sense strand.
A “coding sequence” is a polynucleotide sequence that is transcribed into mRNA and translated into a polypeptide. The boundaries of the coding sequence are determined by a translation start codon at the 5′-terminus and a translation stop codon at the 3′-terminus. A coding sequence can include, but is not limited to, mRNA, cDNA, synthetic DNA, and recombinant polynucleotide sequences. Also included is genomic DNA where the coding sequence is interrupted by introns.
“Complementary” and “complementarity” refer to the natural binding of polynucleotides to other polynucleotides by base pairing. For example, the sequence “5′ A-C-G-T 3′” will bind to the complementary sequence “3′ T-G-C-A 5′.” Complementarity between two single stranded molecules may be “partial,” such that only some of the nucleic acids bind, or it may be “complete,” such that total complementarity exists between the single stranded molecules.
A “composition comprising a given polynucleotide sequence” and a “composition comprising a given amino acid sequence” refer broadly to any composition containing the given polynucleotide or amino acid sequence.
The term “control elements” refers collectively to promoters, ribosome binding sites, polyadenylation signals, transcription termination sequences, upstream regulatory domains, enhancers, and the like, which collectively provide for the transcription and translation of a coding sequence in a host cell. Not all of these control sequences need always be present in a recombinant vector so long as the desired gene is capable of being transcribed and translated.
The phrase “correlates with expression of a polynucleotide” refers to the detection of the presence of nucleic acids, the same or related to a nucleic acid sequence encoding TCCV-1 or TCCV-2, e.g., by northern analysis or RT-PCR, is indicative of the presence of nucleic acids encoding TCCV-1 or TCCV-2 in a sample, and thereby is indicative of the expression of the transcript from the polynucleotide encoding TCCV-1 or TCCV-2.
The phrase “detectably labeled” as used herein means joining, either covalently or non-covalently to the polynucleotides, polypeptides, or antibodies of the present invention, a substance which provides for a detectable signal. A wide variety of labels and conjugation techniques are well known in the art. Suitable labels include radionuclides, e.g., 32P, 35S, 3H, enzymes, substrates, cofactors, inhibitors, fluorescent moieties, chemiluminescent moieties, magnetic particles, and the like.
The phrase “disease state” means any disease, condition, symptom, or indication.
The term “expression” as used herein intends both transcriptional and translational processes, i.e., the production of messenger RNA and/or the production of protein therefrom.
The term “hybridization complex” refers to a complex formed between two nucleic acid sequences by virtue of the formation of hydrogen bonds between complementary bases. A hybridization complex may be formed in solution (conditions calculated by performing, e.g., C0t or R0t) or formed between one nucleic acid sequence present in solution and another nucleic acid sequence immobilized on a solid support (e.g., paper, membranes, filters, chips, pins, glass slides, or any other appropriate substrate to which cells or their nucleic acids have been fixed.)
An “isolated polynucleotide” that encodes a particular polypeptide refers to a polynucleotide that is substantially free of other nucleic acid molecules that do not encode the subject polypeptide; however, the molecule may include functionally and/or structurally conservative mutations as defined herein.
The term “modulate” refers to a change in the activity of TCCV-1 or TCCV-2. For example, modulation may cause an increase or a decrease in protein activity, binding characteristics, or any other biological, functional, or immunological properties of TCCV-1 or TCCV-2. The ability to modulate the activity of TCCV-1 or TCCV-2 can be exploited in assays to screen for organic, inorganic, or biological compounds which affect the above properties of TCCV-1 or TCCV-2.
“Nucleic acid” and “nucleic acid sequence” refer to a nucleotide, oligonucleotide, polynucleotide, or any fragment thereof. These phrases also refer to DNA or RNA of genomic or synthetic origin which may be single stranded or double stranded and may represent the sense of the antisense strand, a peptide nucleic acid (PNA), or any DNA-like or RNA-like material. In this context, “fragments” refer to those nucleic acids which, when translated, would produce polypeptides retaining some functional characteristic, e.g., antigenicity, or structural domain, e.g., ion channel domain, characteristic of the full-length polypeptide.
The terms “operably associated” and “operably linked” refer to functionally related but heterologous nucleic acid sequences. A promoter is operably associated or operably linked with a coding sequence if the promoter controls the translation or expression of the encoded polypeptide. While operably associated or operably linked nucleic acid sequences can be contiguous and in the same reading frame, certain genetic elements, e.g., repressor genes, are not contiguously linked to the sequence encoding the polypeptide but still bind to operator sequences that control expression of the polypeptide.
An “oligonucleotide” refers to a nucleic acid molecule of at least about 6 to 50 nucleotides, preferably about 15 to 30 nucleotides, and more preferably 20 to 25 nucleotides, which can be used in PCR amplification or in a hybridization assay. “Oligonucleotide” is substantially equivalent to the terms “amplimer,” “primer,” “oligomer,” and “probe” as these terms are commonly defined in the art.
“Peptide nucleic acid” (PNA) refers to an antisense molecule or anti-gene agent which comprises an oligonucleotide of at least 5 nucleotides in length linked to a peptide backbone of amino acid residues ending in lysine. The terminal lysine confers solubility to the composition. PNAs preferentially bind complementary single stranded DNA or RNA and stop transcript elongation, and may be pegylated to extend their lifespan in the cell.
The phrases “percent identity” and “% identity” refers to the percentage of sequence similarity found by a comparison or alignment of two or more amino acid or nucleic acid sequences. Percent identity can be determined by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100. Readily available computer programs can be used to aid in the analysis, such as ALIGN, Dayhoff, M. O. in Atlas of Protein Sequence and Structure M. O. Dayhoff ed., 5 Suppl. 3:353-358, National Biomedical Research Foundation, Washington, D.C., which adapts the local homology algorithm of Smith and Waterman (1981) Advances in Appl. Math. 2:482-489, for peptide analysis. Programs for determining nucleotide sequence identity are available in the Wisconsin Sequence Analysis Package, Version 8 (Genetics Computer Group, Madison, Wis.) for example, the BLAST, BESTFIT, FASTA, and GAP programs, which also rely on the Smith and Waterman algorithm. These programs are readily utilized with the default parameters recommended by the manufacturer and described in the Wisconsin Sequence Analysis Package referred to above. Other programs for calculating identity or similarity between sequences are known in the art.
“Recombinant host cells,” “host cells,” “cells,” “cell lines,” “cell cultures,” and other such terms denoting cell lines cultured as unicellular entities refer to cells which can be, or have been, used as recipients for recombinant vectors or other transfer DNA, immaterial of the method by which the DNA is introduced into the cell or the subsequent disposition of the cell. The terms include the progeny of the original cell which has been transfected. Cells in primary culture as well as cells such as oocytes also can be used as recipients.
A “reporter gene” is a gene that, upon expression, confers a phenotype on a cell expressing the reporter gene, such that the cell can be identified under appropriate conditions. For example, the reporter gene may produce a polypeptide product that can be easily detected or measured in a routine assay. Suitable reporter genes known in the art which confer this characteristic include those that encode chloramphenicol acetyl transferase (CAT activity), β-galactosidase, luciferase, alkaline phosphatase, human growth hormone, fluorescent proteins, such as green fluorescent protein (GFP), and others. Indeed, any gene that encodes a protein or enzyme that can readily be measured, for example, by an immunoassay such as an enzyme-linked immunosorbent assay (ELISA) or by the enzymatic conversion of a substrate into a detectable product, and that is substantially not expressed in the host cells (specific expression with no background) can be used as a reporter gene to test for promoter activity. Other reporter genes for use herein include genes that allow selection of cells based on their ability to thrive in the presence or absence of a chemical or other agent that inhibits an essential cell function. Suitable markers, therefore, include genes coding for proteins which confer drug resistance or sensitivity thereto, or change the antigenic characteristics of those cells expressing the reporter gene when the cells are grown in an appropriate selective medium. For example, reporter genes include: cytotoxic and drug resistance markers, whereby cells are selected by their ability to grow on media containing one or more of the cytotoxins or drugs; auxotrophic markers by which cells are selected by their ability to grow on defined media with or without particular nutrients or supplements; and metabolic markers by which cells are selected for, e.g., their ability to grow on defined media containing the appropriate sugar as the sole carbon source. These and other reporter genes are well known in the art.
A “change in the level of reporter gene product” is shown by comparing expression levels of the reporter gene product in a cell exposed to a candidate compound relative to the levels of reporter gene product expressed in a cell that is not exposed to the test compound and/or to a cell that is exposed to a control compound. The change in level can be determined quantitatively for example, by measurement using a spectrophotometer, spectrofluorometer, luminometer, and the like, and will generally represent a statistically significant increase or decrease in the level from background. However, such a change may also be noted without quantitative measurement simply by, e.g., visualization, such as when the reporter gene is one that confers the ability on cells to form colored colonies on chromogenic substrates.
The term “sample” is used in its broadest sense. A sample suspected of containing nucleic acids encoding TCCV-1 or TCCV-2, or fragments thereof, or TCCV-1 or TCCV-2 polypeptide may comprise a bodily fluid; an extract from a cell chromosome, organelle, or membrane isolated from a cell; an intact cell; genomic DNA, RNA, or cDNA, in solution or bound to a substrate; a tissue; a tissue print; etc.
“Stringent conditions” refers to conditions which permit hybridization between polynucleotides and the claimed polynucleotides. Stringent conditions can be defined by salt concentration, the concentration of organic solvent, e.g., formamide, temperature, and other conditions well known in the art.
“Subject” means mammals and non-mammals. Mammals means any member of the Mammalia class including, but not limited to, humans, non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, and, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice, and guinea pigs; and the like. Examples of non-mammals include, but are not limited to, birds, and the like. The term “subject” does not denote a particular age or sex.
The term “substantially purified,” when referring to a polypeptide, indicates that the polypeptide is present in the substantial absence of other similar biological macromolecules.
The term “transfection” refers to the insertion of an exogenous polynucleotide into a host cell, irrespective of the method used for the insertion, or the molecular form of the polynucleotide that is inserted. The insertion of a polynucleotide per se and the insertion of a plasmid or vector comprised of the exogenous polynucleotide are included. The exogenous polynucleotide may be directly transcribed and translated by the cell, maintained as a nonintegrated vector, for example, a plasmid, or alternatively, may be stably integrated into the host genome.
The term “transformed” refers to any known method for the insertion of foreign DNA or RNA sequences into a host prokaryotic cell. The term “transfected” refers to any known method for the insertion of foreign DNA or RNA sequences into a host eukaryotic cell. Such transformed or transfected cells include stably transformed or transfected cells in which the inserted DNA is rendered capable of replication in the host cell. They also include transiently expressing cells which express the inserted DNA or RNA for limited periods of time. The transformation or transfection procedure depends on the host cell being transformed. It can include packaging the polynucleotide in a virus as well as direct uptake of the polynucleotide, such as, for example, lipofection or microinjection. Transformation and transfection can result in incorporation of the inserted DNA into the genome of the host cell or the maintenance of the inserted DNA within the host cell in plasmid form. Methods of transformation are well known in the art and include, but are not limited to, viral infection, electroporation, lipofection, and calcium phosphate mediated direct uptake.
“Treating” or “treatment” of a disease state includes: 1) preventing the disease state, i.e. causing the clinical symptoms of the disease state not to develop in a subject that may be exposed to or predisposed to the disease state, but does not yet experience or display symptoms of the disease state; 2) inhibiting the disease state, i.e., arresting the development of the disease state or its clinical symptoms; 3) or relieving the disease state, i.e., causing temporary or permanent regression of the disease state or its clinical symptoms.
A “variant” of TCCV-1 or TCCV-2 polypeptides refers to an amino acid sequence that is altered by one or more amino acid residues. The variant may have “conservative” changes, wherein a substituted amino acid has similar structural or chemical properties (e.g., replacement of leucine with isoleucine.) More rarely, a variant may have “nonconservative” changes (e.g., replacement of glycine with tryptophan.) Analogous minor variations may also include amino acid deletion or insertions, or both. Guidance in determining which amino acid variations may be substituted, inserted, or deleted without abolishing biological function may be found using programs well known in the art, for example, LASERGENE software (DNASTAR).
The term “variant” when used in the context of a polynucleotide sequence, may encompass a polynucleotide sequence related to TCCV-1 or TCCV-2. This definition may include, for example “allelic” (as defined above), “splice,” “species,” “polymorphic,” or “degenerate” variants. A splice variant may have significant identity to a reference molecule, but will generally have a greater of less number polynucleotides due to alternate splicing of exons during mRNA processing. The corresponding polypeptide may possess additional functional domains or an absence of domains. Species variants are polynucleotide sequences that vary from one species to another. The resulting polypeptides generally will have significant amino acid identity to each other. A polymorphic variant is a variation in the polynucleotide sequence of a particular gene between individuals within a given species. Polymorphic variants may also encompass “single nucleotide polymorphisms” (SNPs) in which the polynucleotide sequence varies by one base. The presence of SNPs may be indicative of, for example, a certain population, a disease state, or a propensity for a disease state. A degenerate variant encompasses a multitude of polynucleotides which encode TCCV-1 or TCCV-2 polypeptides. The degenerate variants may occur naturally or may be produced synthetically. Synthetic degenerate variants are made in accordance with the standard triplet genetic code as applied to the polynucleotide sequence of naturally occurring TCCV-1 or TCCV-2, and all such variations are to be considered as being specifically disclosed.
A “vector” is a replicon in which another polynucleotide segment is attached, such as to bring about the replication and/or expression of the attached segment. The term includes expression vectors, cloning vectors, and the like.
The Invention
The present invention is based on the discovery of a human T-type calcium channel α1I subunit variant (TCCV-1 or TCCV-2), the polynucleotides encoding TCCV-1 or TCCV-2, and the use of these compositions for screening compounds useful in the treatment or prevention of pain, including, but not limited to peripheral pain; peripheral neuropathies; pain caused by trauma or toxic compounds; diabetic neuropathy; cancer pain, and the like.
The molecules of the present invention were isolated by homology searching of the GenBank database using the rat T-type calcium channel α1G subunit (see, e.g., Perez-Reyes et al. (1998) Nature 391:896-900; and GenBank Accession No. AF027984) and the human α1H subunit. (See, e.g., Cribbs et al. (1998) Circ. Res. 83:103-109; and GenBank Accession No. AF051946.) Two genomic clones (GenBank Accession No. AL022319 and AL008716) from human chromosome 22 were identified as being homologous to the two subunits.
Through PCR extension and use of sequence analysis software, TCCV-1 and TCCV-2 were assembled. TCCV-1 is a 6816 bp polynucleotide (SEQ ID NO:1) encoding a polypeptide of 2175 amino acid residues (SEQ ID NO:2). TCCV-2 is a 6855 bp polynucleotide (SEQ ID NO:3) encoding a polypeptide of 2188 amino acid residues (SEQ ID NO:4). FIGS. 1A-1F show an amino acid alignment between TCCV-1. TCCV-2, and the rat α1I subunit (GenBank Accession No. AAD17796; SEQ ID NO:5). The overall sequence identity between TCCV-1 and AAD17796 is approximately 77%, with 93% identity from residues 1 through 1823 of SEQ ID NO:2. A unique fragment of SEQ ID NO:2 from about residue 1811 through about residue 2175 is useful, e.g., as an immungenic polypeptide. The corresponding polynucleotide sequence from about nucleotide 5622 through about nucleotide 6716 of SEQ ID NO:1 is useful, e.g., as a hybridization probe. A unique fragment of SEQ ID NO:4 from about residue 1824 through about residue 2188 is useful, e.g., as an immunogenic polypeptide. The corresponding polynucleotide fragment from about nucleotide 5661 through about nucleotide 6755 is useful, e.g., as a hybridization probe.
PCR analysis was performed using forward primers spanning exons 31 and 32 of SEQ ID NO:1, 3, and 12 (Primer Number 6352 for SEQ ID NO:1 and 12, and Primer Number 6344/88 for SEQ ID NO:3) and exons 32 and 33 of SEQ ID NO:1, 3, and 12 (Primer Number 6495 for SEQ ID NO:1 and 3, and Primer Number 6495/37 for SEQ ID NO:12) in combination with a reverse primer (Primer Number 6831 for SEQ ID NO: 1, 3, and 12). The results are illustrated in FIG. 3. No PCR product was detected using forward Primer Number 6493/37 and reverse Primer Number 6831 (lane 6).
The invention also encompasses nucleic or amino acid variants of TCCV-1 or TCCV-2. A preferred variant is one which has at least about 80%, more preferably at least about 90%, and most preferably at least about 95% amino acid or nucleic acid identity to the corresponding TCCV-1 or TCCV-2 sequence, and which contains at least one functional or structural characteristic of TCCV-1 or TCCV-2.
Polynucleotides
Although nucleotide sequences which encode TCCV-1 or TCCV-2 and its variants are preferably capable of hybridizing to the nucleotide sequence of the naturally occurring TCCV-1 or TCCV-2 under appropriately selected conditions of stringency, it may be advantageous to produce nucleotide sequence encoding TCCV-1 or TCCV-2 or its derivatives possessing a substantially different codon usage, e.g., inclusion of non-naturally occurring codons. Codons may be selected to increase the rate at which expression of the peptide occurs in a particular prokaryotic or eukaryotic host in accordance with the frequency with which particular codons are utilized by the host. Other reasons for substantially altering the nucleotide sequence encoding TCCV-1 or TCCV-2 and its derivatives without altering the encoded amino acid include the production of RNA transcripts having more desirable properties, such as greater half-life or stability for improved translation, than transcripts produced from the naturally occurring sequence.
Also encompassed by the invention are polynucleotides that are capable of hybridizing to the claimed polynucleotide sequences, and, in particular, to those shown in SEQ ID NOs:1 and 3, under various conditions of stringency. (See, e.g., Wahi, G. M. and S. L. Berger (1987) Methods Enzymol. 152:399-401; Kimmel, A. R. (1987) Methods Enzymol. 152:507-511.) For example, stringent salt concentration will ordinarily be less that about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30° C., preferably at least about 37° C., and more preferably 42° C. Varying additional parameters such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred embodiment, hybridization will occur at 30° C. in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred embodiment, hybridization will occur at 37° C. in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 μg/ml denatured salmon sperm DNA (ssDNA). In a more preferred embodiment, hybridization will occur at 42° C. in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μg/ml denatured ssDNA. Useful variations of these conditions will be readily apparent to those skilled in the art.
The washing steps which follow hybridization can also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash step will ordinarily include temperature of at least about 25° C., more preferably of at least about 42° C., and most preferably of at least about 68° C. In a preferred embodiment, wash step will occur at 25° C. in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash step will occur at 42° C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a most preferred embodiment, the wash step will occur at 68° C., in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art.
In another embodiment, polynucleotide sequences encoding all or part of TCCV-1 or TCCV-2 may be synthesized using chemical methods well known in the art. (See, e.g., Caruthers, M. H. et al. (1980) Nucl. Acids Res. Symp. Ser. 7:215-223, Horn, T. et al. (1980) Nucl. Acids Res. Symp. Ser. 7:225-232.)
The present invention further covers recombinant polynucleotides and fragments having a DNA sequence identical to or highly homologous to the isolated polynucleotides of TCCV-1 or TCCV-2. In particular, the sequences will often be operably linked to. DNA segments which control transcription, translation, and DNA replication. Alternatively, recombinant clones derived from the genomic sequences, e.g., containing introns, will be useful for transgenic and knock-out studies, including transgenic cells, organisms, and knock-out animals, and for gene therapy. (See, e.g., Goodnow (1992) “Transgenic Animals” in Roitt (ed.) Encyclopedia of Immunology, Academic Press, San Diego, Calif., pp. 1502-1504; Travis (1992) Science 254:707-710; Capecchi (1989) Science 244:1288-1292; Robertson (ed.) (1987) Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, IRL Press, Oxford; Rosenberg (1992) J. Clinical Oncology 10:180-199; Hogan, et al. (eds.) (1994) Manipulating the Mouse Embryo: A Laboratory Manual, 2nd edition, Cold Spring Harbor Press, NY; Wei (1997) Ann. Rev. Pharmacol. Toxicol. 37:119-141; and Rajewsky, et al. (1996) J. Clin. Inves. 98:S51-S53.)
Examples of these techniques include: 1) Insertion of normal or mutant versions of DNA encoding TCCV-1 or TCCV-2 or homologous animal versions of these genes, by microinjection, retroviral infection, or other means well known to those skilled in the art, into appropriate fertilized embryos in order to produce a transgenic animal (see, e.g., Hogan, supra); and 2) homologous recombination (see, e.g., Capecchi, supra; and Zimmer and Gruss (1989) Nature 338:150-153) of mutant or normal, human or animal versions of these genes with the native gene locus in transgenic animals to alter the regulation of expression or the structure of TCCV-1 or TCCV-2.
The technique of homologous recombination is well known in the art. It replaces the native gene with the inserted gene and is thus useful for producing an animal that cannot express native receptor but does express, for example, an inserted mutant receptor, which has replaced the native receptor in the animal's genome by recombination, resulting in underexpression of the receptor.
Microinjection adds genes to the genome, but does not remove them, and so is useful for producing an animal which expresses its own and added receptors, resulting in overexpression of the receptor. One means available for producing a transgenic animal, with a mouse as an example, is as follows: Female mice are mated, and the resulting fertilized eggs are dissected out of their oviducts. The eggs are stored in an appropriate medium such as M2 medium (see, e.g., Hogan, supra). DNA or cDNA encoding TCCV-1 or TCCV-2 is purified from an appropriate vector by methods well known in the art. Inducible promoters may be fused with the coding region of the DNA to provide an experimental means to regulate expression of the trans-gene. Alternatively, or in addition, tissue specific regulatory elements may be fused with the coding region to permit tissue-specific expression of the trans-gene. The DNA, in an appropriately buffered solution, is put into a microinjection needle (which may be made from capillary tubing using a pipet puller) and the egg to be injected is put in a depression slide. The needle is inserted into the pronucleus of the egg, and the DNA solution is injected. The injected egg is then transferred into the oviduct of a pseudopregnant mouse (a mouse stimulated by the appropriate hormones to maintain pregnancy but which is not actually pregnant), where it proceeds to the uterus, implants, and develops to term. As noted above, microinjection is not the only method for inserting DNA into the egg cell, and is used here only for exemplary purposes.
Since the normal action of receptor-specific drugs is to activate or to inhibit the receptor, the transgenic animal model systems described above are useful for testing the biological activity of drugs directed against TCCV-1 or TCCV-2 even before such drugs become available. These animal model systems are useful for predicting or evaluating possible therapeutic applications of drugs which activate or inhibit TCCV-1 or TCCV-2 by inducing or inhibiting expression of the native or trans-gene and thus increasing or decreasing expression of normal or mutant TCCV-1 or TCCV-2 in the living animal. Thus, a model system is produced in which the biological activity of drugs directed against TCCV-1 or TCCV-2 are evaluated before such drugs become available.
The transgenic animals which over- or underproduce TCCV-1 or TCCV-2 indicate, by their physiological state, whether over- or underproduction of TCCV-1 or TCCV-2 is therapeutically useful. It is therefore useful to evaluate drug action based on the transgenic model system. One use is based on the fact that it is well known in the art that a drug such as an antidepressant acts by blocking neurotransmitter uptake, and thereby increases the amount of neurotransmitter in the synaptic cleft. The physiological result of this action is to stimulate the production of less receptor by the affected cells, leading eventually to underexpression. Therefore, an animal which underexpresses receptor is useful as a test system to investigate whether the actions of such drugs which result in under expression are in fact therapeutic. Another use is that if overexpression is found to lead to abnormalities, then a drug which down-regulates or acts as an antagonist to TCCV-1 or TCCV-2 is indicated as worth developing, and if a promising therapeutic application is uncovered by these animal model systems, activation or inhibition of TCCV-1 or TCCV-2 is achieved therapeutically either by producing agonist or antagonist drugs directed against TCCV-1 or TCCV-2 or by any method which increases or decreases the expression of TCCV-1 or TCCV-2 in man.
Polypeptides
The predicted sequence of TCCV-1 and TCCV-2 amino acid sequence is shown in SEQ ID NO:2 and SEQ ID NO:4, respectively. The peptide sequences allow preparation of peptides to generate antibodies to recognize such segments, and various different methods may be used to prepare such peptides. As used herein TCCV-1 or TCCV-2 shall encompass, when used in a protein context, a protein having an amino acid sequence shown in Table 2, or a significant fragment of such a protein. It also refers to a vertebrate, e.g., mammal, including human, derived polypeptide which exhibits similar biological function, e.g., antigenic, or interacts with TCCV-1 or TCCV-2 specific binding components, e.g., specific antibodies.
The term polypoptide, as used herein, includes a significant fragment or segment, and encompasses a stretch of amino acid residues of at least about 8 amino acids, generally at least 10 amino acids, more generally at least 12 amino acids, often at least 14 amino acids, more often at least 16 amino acids, typically at least 18 amino acids, more typically at least 20 amino acids, usually at least 22 amino acids, more usually at least 24 amino acids, preferably at least 26 amino acids, more preferably at least 28 amino acids, and, in particularly preferred embodiments, at least about 30 or more amino acids. The segments may have lengths of at least 37, 45, 53, 61, 70, 90,90, etc., and often will encompass a plurality of such matching sequences. The specific ends of such a segment will be at any combinations within the protein. Preferably the fragment will encompass structural domains or unique regions useful in generation of binding compositions with specificity for TCCV-1 or TCCV-2.
In another embodiment of the invention, natural, modified, or recombinant nucleic acid sequences encoding TCCV-1 or TCCV-2 may be ligated to a heterologous sequence to encode a fusion protein. For example, to screen peptide libraries for inhibitors of TCCV-1 or TCCV-2 activity, it may be useful to encode a chimeric TCCV-1 or TCCV-2 protein that can be recognized by a commercially available antibody. A fusion protein may also be engineered to contain a cleavage site located between the TCCV-1 or TCCV-2 encoding sequence and the heterologous protein sequence, so that TCCV-1 or TCCV-2 may be cleaved and purified away from the heterologous moiety.
The protein may be produced using chemical methods to synthesize the amino acid sequence of TCCV-1 or TCCV-2, or a fragment thereof. For example, peptide synthesis can be performed using various solid-phase techniques. (See, e.g., Roberge, J. Y. et al. (1995) Science 269:202-204.) Automated synthesis may be achieved, for example, using the ABI 431A peptide synthesizer (Perkin Elmer).
The newly synthesized peptide may be substantially purified by preparative high performance liquid chromatography. (See, e.g., Creighton, T. (1983) Proteins, Structures and Molecular Principles, W H Freeman and Co., New York, N.Y.) The composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; Creighton, supra.) Additionally, the amino acid sequence of TCCV-1 or TCCV-2, or any part thereof, may be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins, or any part thereof, to produce a variant polypeptide.
In order to express a biologically active TCCV-1 or TCCV-2, the nucleotide sequences encoding TCCV-1 or TCCV-2 or functional equivalents, may be inserted into appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods which are well known to those skilled in the art may be used to construct expression vectors containing sequences encoding TCCV-1 or TCCV-2 and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. (See, e.g., Sambrook, J. et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y.; and Ausubel, F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y.)
A variety of expression vector/host systems may be utilized to contain and express sequences encoding TCCV-1 or TCCV-2. These include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; insect cell systems infected with virus expression vectors (e.g., baculovirus) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids); or animal cell systems. The invention is not limited by the host cell employed.
The “control elements” or “regulatory sequences” are those non-translated regions of the vector, e.g., enhancers, promoters, 5′ and 3′ untranslated regions, which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or PSPORT1 plasmid (Gibco BRL) and the like may be used. The baculovirus polyhedrin promoter may be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO; and storage protein genes) or from plant viruses (e.g., viral promoters or leader sequences) may be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of the sequence encoding TCCV-1 or TCCV-2, vectors based on SV40 or EBV may be used with an appropriate selectable marker.
In bacterial systems, a number of expression vectors may be selected depending upon the use intended for TCCV-1 or TCCV-2. For example, when large quantities of TCCV-1 or TCCV-2 are needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified may be used. Such vectors include, but are not limited to, the multifunctional E. coli cloning and expression vectors such as the BLUESCRIPT phagemid (Stratagene), in which the sequence encoding TCCV-1 or TCCV-2 may be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of β-galactosidase so that a hybrid protein is produced; pIN vectors (Van Heeke, G. and S. M. Schuster (1989) J. Biol. Chem. 264:5503-5509); and the like. PGEX vectors (Promega, Madison, Wis.) may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. Proteins made in such systems may be designed to include heparin, thrombin, or factor XA protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
In the yeast, Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH may be used. (See, e.g., Ausubel et al., supra; and Grant et al. (1987) Methods Enzymol. 153:516-544.)
An insect system may also be used to express TCCV-1 or TCCV-2. For example, in one such system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. The sequences encoding TCCV-1 or TCCV-2 may be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of TCCV-1 or TCCV-2 will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses may then be used to infect, for example, S. frugiperda cells or Trichoplusia larvae in which TCCV-1 or TCCV-2 may be expressed (Engelhard, E. K. et al. (1994) Proc. Nat. Acad. Sci. 91:3224-3227).
In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, sequences encoding TCCV-1 or TCCV-2 may be ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence. Insertion in a non-essential E1 or E3 region of the viral genome may be used to obtain a viable virus which is capable of expressing TCCV-1 or TCCV-2 in infected host cells (Logan, J. and Shenk, T. (1984) Proc. Natl. Acad. Sci. 81:3655-3659). In addition, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, may be used to increase expression in mammalian host cells.
Human artificial chromosomes (HACs) may also be employed to deliver larger fragments of DNA than can be contained and expressed in a plasmid. HACs of 6 to 10M are constructed and delivered via conventional delivery methods (liposomes, polycationic amino polymers, or vesicles) for therapeutic purposes.
Specific initiation signals may also be used to achieve more efficient translation of sequences encoding TCCV-1 or TCCV-2. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding TCCV-1 or TCCV-2, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals including the ATG initiation codon should be provided. Furthermore, the initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons may be of various origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used, such as those described in the literature (Scharf, D. et al. (1994) Results Probl. Cell Differ. 20:125-162).
In addition, a host cell strain may be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed protein in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing which cleaves a “prepro” form of the protein may also be used to facilitate correct insertion, folding and/or function. Different host cells which have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and WI38), are available from the American Type Culture Collection (ATCC; Bethesda, Md.) and may be chosen to ensure the correct modification and processing of the foreign protein.
For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines, which stably express TCCV-1 or TCCV-2, may be transformed using expression vectors which may contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells may be allowed to grow for 1-2 days in an enriched media before they are switched to selective media. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced sequences. Resistant clones of stably transformed cells may be proliferated using tissue culture techniques appropriate to the cell type.
Any number of selection systems may be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler, M. et al. (1977) Cell 11:223-32) and adenine phosphoribosyltransferase (Lowy, I. et al. (1980) Cell 22:817-23) genes which can be employed in tk− or aprt− cells, respectively. Also, antimetabolite, antibiotic or herbicide resistance can be used as the basis for selection; for example, dhfr which confers resistance to methotrexate (Wigler, M. et al. (1980) Proc. Natl. Acad. Sci. 77:3567-70); npt, which confers resistance to the aminoglycosides neomycin and G-418 (Colbere-Garapin, F. et al (1981) J. Mol. Biol. 150:1-14). Additional selectable genes have been described, for example, trpB, which allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman, S. C. and R. C. Mulligan (1988) Proc. Natl. Acad. Sci. 85:8047-51). Recently, the use of visible markers has gained popularity with such markers as anthocyanins, .beta. glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, being widely used not only to identify transformants, but also to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes, Calif. et al. (1995) Methods Mol. Biol. 55:121-131).
Antibodies
Antibodies to TCCV-1 or TCCV-2 may be generated using methods that are well known in the art. Such antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, and fragments produced by a Fab expression library. Neutralizing antibodies, (i.e., those which inhibit dimer formation) are especially preferred for therapeutic use.
For the production of antibodies, various hosts including goats, rabbits, rats, mice, humans, and others, may be immunized by injection with TCCV-1 or TCCV-2 or any fragment or oligopeptide thereof which has immunogenic properties. Depending on the host species, various adjuvants may be used to increase immunological response. Such adjuvants include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. Among adjuvants used in humans, BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are especially preferable.
It is preferred that the oligopeptides, peptides, or fragments used to induce antibodies to TCCV-1 or TCCV-2 have an amino acid sequence consisting of at least five amino acids and more preferably at least 10 amino acids, and most preferably at least 15 amino acids. It is also preferable that they are identical to a portion of the amino acid sequence of the natural protein, and they may contain the entire amino acid sequence of a small, naturally occurring molecule. Short stretches of TCCV-1 or TCCV-2 amino acids may be fused with those of another protein such as keyhole limpet hemocyanin and antibody produced against the chimeric molecule.
Monoclonal antibodies to TCCV-1 or TCCV-2 may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler, G. et al. (1975) Nature 256:495-497; Kozbor, D. et al. (1985) J. Immunol. Methods 81:31-42; Cote, R. J. et al. (1983) Proc. Natl. Acad. Sci. 80:2026-2030; Cole, S. P. et al. (1984) Mol. Cell Biol. 62:109-120).
In addition, techniques developed for the production of “chimeric antibodies”, the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity can be used (Morrison, S. L. et al. (1984) Proc. Natl. Acad. Sci. 81:6851-6855; Neuberger, M. S. et al. (1984) Nature 312:604-608; Takeda, S. et al. (1985) Nature 314:452-454). Alternatively, techniques described for the production of single chain antibodies may be adapted, using methods known in the art, to produce TCCV-1 or TCCV-2-specific single chain antibodies. Antibodies with related specificity, but of distinct idiotypic composition, may be generated by chain shuffling from random combinatorial immunoglobulin libraries (Burton D. R. (1991) Proc. Natl. Acad. Sci. 88:11120-3).
Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi, R. et al. (1989) Proc. Natl. Acad. Sci. 86: 3833-3837; Winter, G. et al. (1991) Nature 349:293-299).
Antibody fragments which contain specific binding sites for TCCV-1 or TCCV-2 may also be generated. For example, such fragments include, but are not limited to, the F(ab′)2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab′)2 fragments. Alternatively, Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse, W. D. et al. (1989) Science 254:1275-1281).
Various immunoassays may be used for screening to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art. Such immunoassays typically involve the measurement of complex formation between TCCV-1 or TCCV-2 and its specific antibody. A two-site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive to two non-interfering TCCV-1 or TCCV-2 epitopes is preferred, but a competitive binding assay may also be employed (Maddox, supra).
Uses
The present invention provides various methods for determining whether a compound can modulate the activity of TCCV-1 or TCCV-2. The compound can be a substantially pure compound of synthetic origin combined in an aqueous medium, or the compound can be a naturally occurring material such that the assay medium is an extract of biological origin, such as, for example, a plant, animal, or microbial cell extract. The methods essentially entail contacting TCCV-1 or TCCV-2 or fragments thereof, with the compound under suitable conditions and subsequently determining if the compound modulates the activity of TCCV-1 or TCCV-2. The compounds of interest can function as agonists or antagonists of TCCV-1 or TCCV-2 activity. TCCV-1 or TCCV-2 or fragments thereof, can be expressed on a cell or tissue, naturally or recombinantly, or immobilized by attachment to a solid substrate, e.g., nitrocellulose or nylon membrane, glass, beads, etc. An example of a compound that may block a T-type calcium channel is ethosuximide and analogs thereof.
Transcription based assays that identify signals that modulate the activity of cell surface proteins, e.g., receptors, ion channels, etc., may be used to screen candidate compounds for their ability to stimulate reporter gene product expression and their potential to stimulate the expression of TCCV-1 or TCCV-2.
One method for identifying compounds that stimulate TCCV-1 or TCCV-2 promoter-controlled reporter gene expression comprises introducing into a cell a DNA construct that comprises TCCV-1 or TCCV-2 promoter operably linked to a reporter gene, mixing a test compound with the cell and measuring the level of expression of reporter gene product. A change in the level of expression of the reporter gene product indicates that the compound is capable of modulating the level of TCCV-1 or TCCV-2 expression. The reporter gene construct is preferably stably integrated into the chromosomal DNA of the cell, but is also functional for the purposes disclosed herein in the form of an extrachromosomal element. The cell may be a eukaryotic cell, or any cell that contains the elements needed to express a structural gene under the regulatory influence of a mammalian gene promoter.
Other transcription-based assays are well known in the art. (See, e.g., Zlokarnik, et al. (1998) Science 279:84-88; Siverman, supra; and Gonzalez and Negulescu, (1998) Curr. Opin. Biotechnol. 9:624-631.) These transcription based assays asses the intracellular transduction of an extracellular signal using recombinant cells that are modified by introduction of a reporter gene under the control of a regulatable promoter.
A two-hybrid system-based approach can also be employed for compound screening, small molecule identification, and drug discovery. The underlying premise of the two-hybrid system, originally described in yeast by Fields and Song (1989) Nature 340:245-246, provides a connection between a productive protein-protein or protein-compound interaction pair of interest and a measurable phenotypic change in yeast. A reporter cassette containing an up-stream activation sequence which is recognized by a DNA binding domain, is operationally linked to a reporter gene, which when expressed under the correct conditions will generate a phenotypic change. The original two-hybrid system has recently been modified for applicability in high-throughput compound screening. (See, e.g., Ho et al. (1996) Nature 382:822-826; Licitra and Liu (1996) Proc. Natl. Acad. Sci. USA 93:12817-12821; and Young et al. (1998) Nature Biotech. 16:946-950.)
Assays for identifying compounds that modulate ion channel activity are practiced by measuring the ion channel activity when a cell expressing the ion channel of interest, or fragments thereof, is exposed to a solution containing the test compound and a ion channel selective ion and comparing the measured ion channel activity to the native ion channel activity of the same cell or a substantially identical control cell in a solution not containing the test compound. Methods for practicing such assays are known to those of skill in the art. (See, e.g., Mishina et al. (1985) Nature 313:364-369; and Noda, et al. Nature 322:836-828.) Ion channel activity can be measured by methods such as electrophysiology (two electrode voltage clamp or single electrode whole cell patch clamp), guanidinium ion flux assays, toxin-binding assays, and Fluorometric Imaging Plate Reader (FLIPR) assays. (See, e.g., Sullivan, et al. (1999) Methods Mol. Biol. 114:125-133; Siegel and Isacoff (1997) Neuron 19:1-20; and Lopatin, et al. (1998) Trends Pharmacol. Sci. 19:395-398.) An “inhibitor” is defined generally as a compound, at a given concentration, that results in greater than 50% decrease in ion channel activity, preferably greater than 70% decrease in ion channel activity; more preferably greater than 90% decrease in ion channel activity.
The binding or interaction of the compound with a receptor or fragments thereof, can be measured directly by using radioactively labeled compound of interest (see, e.g., Wainscott et al. (1993) Mol. Pharmacol. 43:419-426; and Loric, et al. (1992) FEBS Lett. 312:203-207) or by the second messenger effect resulting from the interaction or binding of the candidate compound. (See, e.g., Lazereno and Birdsall (1993) Br. J. Pharmacol. 109:1120-1127.) Modulation in receptor signaling can be measured using a detectable assay, e.g., the FLIPR assay. (See, e.g., Coward, P. (1999) Anal. Biochem. 270:242-248; Sittampalam, supra; and Gonzalez and Negulescu, supra.) Activation of certain receptors, in particular, GPCRs, can be measured an 35S-GTPγS binding assay. (See, e.g., Lazareno (1999) Methods Mol. Biol. 106:231-245.)
Alternatively, the candidate compounds can be subjected to competition screening assays, in which a known ligand, preferably labeled with an analytically detectable reagent, most preferably radioactivity, is introduced with the drug to be tested and the capacity of the compound to inhibit or enhance the binding of the labeled ligand is measured. Compounds are screened for their increased affinity and selectivity for the specific receptor or fragments thereof.
Candidate compounds are useful in the treatment or prophylaxis of pain, including, but not limited to, peripheral pain; peripheral neuropathies; pain caused by trauma or toxic compounds; diabetic neuropathy; cancer pain, and the like.
The polynucleotides of the present invention can be used to design antisense oligonucleotides that inhibit translation of mRNA encoding the TCCV-1 or TCCV-2 of the present invention. Synthetic oligonucleotides, or other antisense chemical structures are designed to bind to mRNA encoding TCCV-1 or TCCV-2 and inhibit translation of mRNA and are useful to inhibit expression of TCCV-1 or TCCV-2. This invention provides a means to alter levels of expression of TCCV-1 or TCCV-2 by the use of a synthetic antisense oligonucleotide (SAO) which inhibits translation of mRNA encoding these receptors.
The SAO is designed to be capable of passing through cell membranes in order to enter the cytoplasm of the cell by virtue of physical and chemical properties of the SAO which render it capable of passing through cell membranes (e.g. by designing small, hydrophobic SAO chemical structures) or by virtue of specific transport systems in the cell which recognize and transport the SAO into the cell. In addition, the SAO can be designed for administration only to certain selected cell populations by targeting the SAO to be recognized by specific cellular uptake mechanisms which binds and takes up the SAO only within certain selected cell populations. For example, the SAO may be designed to bind to TCCV-1 or TCCV-2 which are found only in certain cell types.
The SAO is also designed to recognize and selectively bind to the target mRNA sequence, which may correspond to a sequence contained within the sequences of SEQ ID NO:1 or 3 by virtue of complementary base pairing to the mRNA. Finally, the SAO is designed to inactivate the target mRNA sequence by any of three mechanisms: 1) binding to the target mRNA and thus inducing degradation of the mRNA by intrinsic cellular mechanisms such as RNAse H digestion; 2) inhibiting translation of the mRNA target by interfering with the binding of translation-regulating factors or of ribosomes; or 3) inclusion of other chemical structures, such as ribozyme sequences or reactive chemical groups, which either degrade or chemically modify the target mRNA.
Synthetic antisense oligonucleotide drugs have been shown to be capable of the properties described above when directed against mRNA targets. (See, e.g., Cohen (1989) Trends in Pharm. Sci. 10:435; and Weintraub (1990) Sci. Am. 262:40-46.) In addition, coupling of ribozymes to antisense oligonucleotides is a promising strategy for inactivating target mRNA. (See, e.g., Sarver et al. (1990) Science 247:1222.)
Diagnostics and Kits
The present invention contemplates use TCCV-1 or TCCV-2 polynucleotides, polypeptides, and antibodies in a variety of diagnostic methods kits. Typically the kit will have a compartment containing either a defined TCCV-1 or TCCV-2 polypeptide, polynucleotide, or a reagent which recognizes one or the other, e.g., antigen fragments or antibodies. Additionally the kit will include the reagents needed to carry out the assay in a separate compartment as well as instructions for use and proper disposal.
A variety of protocols including ELISA, RIA, and FACS for measuring TCCV-1 or TCCV-2 are known in the art and provide a basis for diagnosing altered or abnormal levels of TCCV-1 or TCCV-2 expression. Normal or standard values for TCCV-1 or TCCV-2 expression are established by combining body fluids or cell extracts taken from normal mammalian subjects, preferably human, with antibody to TCCV-1 or TCCV-2 under conditions suitable for complex formation. The amount of standard complex formation may be quantified by various methods, but preferably by photometric, means. Quantities of TCCV-1 or TCCV-2 expressed in control and disease samples from biopsied tissues are compared with the standard values. Deviation between standard and subject values establishes the parameters for diagnosing disease.
In another embodiment of the invention, the polynucleotides encoding TCCV-1 or TCCV-2 may be used for diagnostic purposes. The polynucleotides which may be used include oligonucleotide sequences, complementary RNA and DNA molecules, and PNAs. The polynucleotides may be used to detect and quantitate gene expression in biopsied tissues in which expression of TCCV-1 or TCCV-2 may be correlated with disease. The diagnostic assay may be used to distinguish between absence, presence, and excess expression of TCCV-1 or TCCV-2, and to monitor regulation of TCCV-1 or TCCV-2 levels during therapeutic intervention.
In one aspect, hybridization with PCR probes which are capable of detecting polynucleotide sequences, including genomic sequences, encoding TCCV-1 or TCCV-2 or closely related molecules, may be used to identify nucleic acid sequences which encode TCCV-1 or TCCV-2. The specificity of the probe, whether it is made from a highly specific region, e.g., 10 unique nucleotides in the 5′ regulatory region, or a less specific region, e.g., especially in the 3′ coding region, and the stringency of the hybridization or amplification (maximal, high, intermediate, or low) will determine whether the probe identifies only naturally occurring sequences encoding TCCV-1 or TCCV-2, alleles, or related sequences.
Probes may also be used for the detection of related sequences, and should preferably contain at least 50% of the nucleotides from any of the TCCV-1 or TCCV-2 encoding sequences. The hybridization probes of the subject invention may be DNA or RNA and derived from the nucleotide sequence of SEQ ID NOs:1 or 3 or from genomic sequence including promoter, enhancer elements, and introns of the naturally occurring TCCV-1 or TCCV-2.
Means for producing specific hybridization probes for DNAs encoding TCCV-1 or TCCV-2 include the cloning of nucleic acid sequences encoding TCCV-1 or TCCV-2 or TCCV-1 or TCCV-2 derivatives into vectors for the production of mRNA probes. Such vectors are known in the art, commercially available, and may be used to synthesize RNA probes in vitro by means of the addition of the appropriate RNA polymerases and the appropriate labeled nucleotides. Hybridization probes may be labeled by a variety of reporter groups, for example, radionuclides such as 32P or 35S, or enzymatic labels, such as alkaline phosphatase coupled to the probe via avidin/biotin coupling systems, and the like.
Polynucleotide sequences encoding TCCV-1 or TCCV-2 may be used for the diagnosis of diseases, conditions, or disorders which are associated with expression of TCCV-1 or TCCV-2 including, but not limited to, pain; peripheral pain; peripheral neuropathies; pain caused by trauma or toxic compounds; diabetic neuropathy; cancer pain, and the like.
In order to provide a basis for the diagnosis of disease associated with expression of TCCV-1 or TCCV-2, a normal or standard profile for expression is established. This may be accomplished by combining body fluids or cell extracts taken from normal subjects, either animal or human, with a polynucleotide sequence, or a fragment thereof, which encodes TCCV-1 or TCCV-2, under conditions suitable for hybridization or amplification. Standard hybridization may be quantified by comparing the values obtained from normal subjects with those from an experiment where a known amount of a substantially purified polynucleotide is used. Standard values obtained from normal samples may be compared with values obtained from samples from subjects who are symptomatic for disease. Deviation between standard and subject values is used to establish the presence of disease.
Once a disease is established and a treatment protocol is initiated, hybridization assays may be repeated on a regular basis to evaluate whether the level of expression in the subject begins to approximate that which is observed in the normal subject. The results obtained from successive assays may be used to show the efficacy of treatment over a period ranging from several hours to several days to several months.
Additional diagnostic uses for oligonucleotides designed from the sequences encoding TCCV-1 or TCCV-2 may involve the use of PCR. Such oligomers may be chemically synthesized, generated enzymatically, or produced in vitro. Oligomers will preferably consist of two nucleotide sequences, one with sense orientation (5′ to 3′) and another with antisense (3′ to 5′), employed under optimized conditions for identification of a specific gene or condition. The same two oligomers, nested sets of oligomers, or even a degenerate pool of oligomers may be employed under less stringent conditions for detection and/or quantitation of closely related DNA or RNA sequences.
Methods which may also be used to quantitate the expression of TCCV-1 or TCCV-2 include radiolabeling or biotinylating nucleotides, coamplification of a control nucleic acid, and standard curves onto which the experimental results are interpolated. (See, e.g., Melby, P. C. et al. (1993) J. Immunol. Methods, 159:235-244; and Duplaa, C. et al. (1993) Anal. Biochem. 212:229-236.) The speed of quantitation of multiple samples may be accelerated by running the assay in an ELISA format where the oligomer of interest is presented in various dilutions and a spectrophotometric or colorimetric response gives rapid quantitation.
In another embodiment of the invention, the nucleic acid sequences which encode TCCV-1 or TCCV-2 can be used to generate hybridization probes which are useful for mapping the naturally occurring genomic sequence. Fragments of TCCV-1 and TCCV-2 have been used to map these genes to the appropriate mouse and human chromosomes. The sequences may be mapped to a particular chromosome, to a specific region of a chromosome or to artificial chromosome constructions, such as human artificial chromosomes (HACs), yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), bacterial P1 constructions, or single chromosome cDNA libraries. (See, e.g., Price, C. M. (1993) Blood Rev. 7:127-134, and Trask, B. J. (1991) Trends Genet. 7:149-154.)
Fluorescent in situ hybridization (FISH) may be correlated with other physical chromosome mapping techniques and genetic map data. (See, e.g., Verma et al. (1988) Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York, N.Y.) Examples of genetic map data can be found in various scientific journals or at Online Mendelian Inheritance in Man (OMIM). Correlation between the location of the gene encoding TCCV-1 or TCCV-2 on a physical chromosomal map and a specific disease, or predisposition to a specific disease, may help delimit the region of DNA associated with that genetic disease. The nucleotide sequences of the subject invention may be used to detect differences in gene sequences between normal, carrier, or affected individuals.
In situ hybridization of chromosomal preparations and physical mapping techniques such as linkage analysis using established chromosomal markers may be used for extending genetic maps. Often the placement of a gene on the chromosome of another mammalian species, such as mouse, may reveal associated markers even if the number or arm of a particular human chromosome is not known. New sequences can be assigned to chromosomal arms, or parts thereof, by physical mapping. This provides valuable information to investigators searching for disease genes using positional cloning or other gene discovery techniques. Once the disease or syndrome has been crudely localized by genetic linkage to a particular genomic region (see, e.g., Gatti, R. A. et al. (1988) Nature 336:577-580), any sequences mapping to that area may represent associated or regulatory genes for further investigation. The nucleotide sequence of the subject invention may also be used to detect differences in the chromosomal location due to translocation, inversion, etc. among normal, carrier, or affected individuals.
All patents, patent applications, and publications mentioned herein, whether supra or infra, are each incorporated by reference in its entirety. The broad scope of this invention is best understood with reference to the following examples, which are not intended to limit the invention to the specific embodiments described below.
Some of the standard methods are described or referenced, e.g., in Maniatis et al. (1982) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor Press; Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, (2d ed.), vols. 1-3, CSH Press, N.Y.; or Ausubel et al. (1987 and Supplements) Current Protocols in Molecular Biology, Greene/Wiley, New York; Innis et al. (eds.)(1990) PCR Protocols: A Guide to Methods and Applications Academic Press, N.Y. Methods for protein purification include such methods as ammonium sulfate precipitation, column chromatography, electrophoresis, centrifugation, crystallization, and others. See, e.g., Ausubel et al. (1987 and periodic supplements); Deutscher (1990) “Guide to Protein Purification” in Methods in Enzvmology, vol. 182, and other volumes in this series; and manufacturer's literature on use of protein purification products, e.g., Pharmacia, Piscataway, N. J., or Bio-Rad, Richmond, Calif. Combination with recombinant techniques allow fusion to appropriate segments, e.g., to a FLAG sequence or an equivalent which can be fused via a protease-removable sequence. See, e.g., Hochuli (1989) Chemische Industrie 12:69-70; Hochuli (1990) “Purification of Recombinant Proteins with Metal Chelate Absorbent” in Setlow (ed.) Genetic Engineering Principle and Methods 12:87-98, Plenum Press, N.Y.; and Crowe et al. (1992) OIAexpress: The High Level Expression & Protein Purification System QUIAGEN, Inc., Chatsworth, Calif.
Searching of GenBank databases with the human T-type calcium channel subunit α1H sequence (GenBank Accession No. AF051946; and Cribbs et al. (1998) Circ. Res. 83:103-109) revealed two genomic clones from human chromosome 22 with extensive homology to α1H. (GenBank Accesion Nos. AL022319 and AL008716.) BLAST results showed that these clones represented the same sequence, potentially a novel T-type Calcium channel as the α1G subunit was shown to be localized to human chromosome 17 and α1H to human chromosome 16. Additionally a further search of GenBank with the rat α1G sequence also revealed less extensive homology to the two clones above, as well as a human chromosome 17 genomic clone (GenBank Accession No. AC004590), which appeared to contain the entire human al G sequence within 34 exons.
Comparison of the deduced exon structure of α1G with the alignments from the α1H BLAST against GenBank Accession Nos. AL022319 and AL008716 allowed the identification of many potential exons, from approximately the beginning of domain I to the end of domain IV. Due to insufficient homology with rα1G or hα1H, several exons could not initially be identified, in particular, exons corresponding to the interdomain regions. Similarly, the amino- and carboxy-terminal exons could not be initially identified.
PCR primers based on GenBank Accession No. AL022319 sequence were designed to clone the region from domain I to domain IV:
| Sense | ||
| 5′ GGGCGCCATCAACTTTGACAACATC 3′; | (SEQ ID NO:6) | |
| and | ||
| Antisense | ||
| 5′ CTCACGAAGTACAGCGGCGACAC 3′ | (SEQ ID NO:7) |
A band at 4 kb was excised from low-melt agarose gel, melted at 65° C. for 5 min, and subsequently ligated into the pCR2.1 TOPO vector (Invitrogen, Mountain View, Calif.) following kit instructions. The ligated vector was transformed into E. coli DH5α competent cells (Life Technologies, Bethesda, Md.) according to the manufacturers protocol. Two of the resulting clones, KC-1 and KC-4 were fully sequenced.
BLAST comparison of these sequences with the novel human genomic sequences AL022319 and AL008716 revealed the true exon structure for this region of the gene. This sequence was not identical to that predicted by homology with the other T-channels. Additionally, KC-1 had 4 mutations and KC-4 had 8 mutations relative to the genomic sequences. Of note, none of the apparent mutations in the KC-1 sequence occurred between the unique AvrII and HindIII sites. Compensation for these mutations revealed a continuous reading frame, whose deduced amino acid sequence was homologous to the rα1G and hα1H amino acid sequences corresponding to exons 6 to 31 of the rα1G sequence. Additional homology comparisons revealed that genomic clone AL008716 only contained exons 2 to 25 and genomic clone AL022319 contained, at least, exons 5 to 31.
The sequence for exons 2-7 (using the rα1G numbering of exons) was assembled electronically from the genomic sequences and used to BLAST the GenBank databases. A new chromosome 22 genomic clone was found (GenBank Accession No. AL022312), which contained exon 2 near to its 3′ end. In cloning exon 1, a comparison of rα1G and hα1H exon 1 amino acid sequences was made, revealing a short region of amino acid homology at the 3′ end. The sequence of the last 30 amino acids from rα1G exon 1 was used as query in a TFASTA search of the GenBank databases. This search found a match in the new chromosome 22 genomic clone, AL022312, approximately 27 kb in the 5′ direction from exon 2. This potential exon 1 had a reading frame containing the matching homology, as well as additional homology, extending to a potential initiating methionine residue. The large potential intron between exons 1 and 2 had a typical splice sites, AT . . . AC, instead of the usual GT . . . AG. The first intron of rα1G also has a similar a typical splice site. Electronic splicing of exon 1 to the previously identified exons resulted in a sequence with a continuous open reading frame.
PCR primers, described below, were designed to amplify the region from about 190 bp 5′ of the likely start codon to about 120 bp 3′ of the unique AvrII site:
| Sense | ||
| 5′ CTGGGGCCTCAGCTGTTTCGTAATC 3′; | (SEQ ID NO:8) | |
| and | ||
| Antisense | ||
| 5′ GCGCTGGTCATAGCTCATCCTCCCTAGAGA 3′ | (SEQ ID NO:9) |
In order to identify the 3′ most exons, 16 kb of genomic clone AL022319 sequence, beginning near exon 26, was ran on the GENIE gene finder program, (www, esc, ucsc, edu/%7edku1p/egi-bin/genie, developed by Lawrence Berkeley National Laboratory) which predicted exons 29, 30, 31 as well as four new additional exons following exon 31. The last exon contained a stop codon in the reading frame and appeared to lack additional splice consensus sites. An additional analysis of 10 kb in the 3′ direction predicted no additional exons.
PCR primers, as described below, were designed to overlap the KC-1 sequence (about 200 bp 5′ of the HindIII site) and to include the coding region of the possible 3′ most exon, including about 100 bp of 3′ non-coding sequence:
| Sense | ||
| 5′ GCGCTTCTTCAAGGACCGATGG 3′; | (SEQ ID NO:10) | |
| Antisense | ||
| 5′ CCCAGGTGTGGACGAAGTATTGCT 3′ | (SEQ ID NO:11) |
To assemble full-length coding sequences for the two human α1I splice variants, the 3 kb KZ-2 EcoRI-AvrII fragment, the 2 kb KC-1 AvrII-HindIII fragment, either the 2 kb LD-1 or LE-1 HindIII-NotI fragment, and the 5.5 kb pClneo (Promega) mammalian cell expression vector EcoRI-NotI fragment were prepared and ligated together as above. Of the products of these clonings, isolate LF-1 (TCCV-1) contains the full-length short exon 32 form and isolate LG-1 (TCCV-2) contains the full length long exon 32 form of the human α1I subunit.
Patterns of splicing at the 3′ end of human and rat α1I subunit genes were investigated by PCR. Primers were designed to amplify the entire region as well as to amplify specific splice products. Primer locations were chosen, in part, to minimize differences in the rat and human sequences, so that a single primer set could be used to amplify from both templates. Primers 6066 and 6831 were designed to amplify the region from exon 31 to 35 containing the rat and human splice variations. (See FIGS. 2A-2C.)
Four forward primers (Primer Numbers 6352, 6344/88, 6495, and 6495/37) were designed from the human DNA sequences to examine specifically splicing at exon 32 and at exon 33 and to be used with reverse primer 6831. As shown in FIGS. 2A-2C, these primers were designed to span the splice sites, so that only one specific product could be amplified for each primer. The human intron sequence was considered in designing these primers to reduce the possibility of amplifying unspliced sequences.
Optimum PCR conditions were established, using plasmid templates containing the long and short forms of exon 32 and the rat and human forms of exon 33, for which the specific PCR product for each primer set was obtained only from the specific template: 94° C., 30 sec; 94° C., 10 sec, 62° C., 15 sec, 68° C., 1 min, 30 cycles; 68° C., 3 min. PCR reaction conditions were as follows: 1× ADVANTAGE cDNA PCR reaction buffer (Clontech), 0.2 mM dNTPs, 1×PCRx reagent (Life Technologies), 0.2 μM each primer, 0.2 μl 50× ADVANTAGE cDNA polymerase mix (Clontech) and 0.5 ng plasmid template in a 20 μl reaction.
To examine the presence of the various splice products in MARATHON-READY human brain cDNA (Clontech), 2.5 μl template was used in 25 μl reactions as above with 0.25 μl 50× ADVANTAGE cDNA polymerase mix (Clontech). Cycling conditions were identical, except that the annealing temperature was 63° C. for 36 or 42 cycles. Similar results were obtained at 36 or 42 cycles. The long form of exon 32 (TCCV-1) was somewhat more abundant (2 to 5 fold) than the short form (TCCV-2). In addition, only the “human” form of exon 33 was found. A PCR product corresponding to the rat α1I subunit was not detected in the human brain cDNA (See FIG. 3).
TSA201 cells were plated into wells of BIOCOAT poly-D-lysine coated 6 well dishes (Becton-Dickinson, Mountain View, Calif.) at a density of 3×105 cells/well two days prior to transfection or 7.5×105 cells/well one day prior to transfection. The medium was either the usual culture medium but without antibiotics, or, in some cases, a special low-calcium medium.
The vectors containing TCCV-1 or TCCV-2 were transfected into TSA201 cells using the LIPOFECTAMINE 2000 (Life Technologies, Bethesda, Md.) transfection kit and accompanying protocols. For each well of transfected cells, 4 μg of TCCV-1 or TCCV-2 plasmid DNA and 0.8 μg of pHook-1 DNA were combined in a tube with 250 μl of OPTI-MEM serum free medium (Life Technologies). An equal volume of diluted LIPOFECTAMINE 2000 reagent was added to each tube of diluted DNA and the mixtures were mixed and allowed to incubate at room temperature in the dark for 20 minutes. During the incubation, the medium on the cells was changed to 2.5 ml/well of DMEM with 0.1 mM MEM non-essential amino acids (Life Technologies), without serum and without antibiotics. The DNA/LIPOFECTAMINE 2000/OPTI-MEM mixture was added dropwise to cell wells while swirling the microtiter plate. The plate was returned to 37° C., 5% CO2 for 4 to 5 hours.
Cells were resuspended and plated immediately after stopping the transfection reaction. Medium was removed from the cell wells and replaced with 2 ml of Dulbecco's Phosphate Buffered Saline (Life Technologies) without calcium or magnesium. The dish was returned to the incubator for four minutes. Cell monolayers were rinsed from the surface of the wells by trituration with a 2 ml pipet, directing the stream at the surface of the well to dislodge the cells. The resuspended cells were plated at 1:20 dilution in either regular culture medium or low calcium medium in 35 mm dishes that had been pre-coated with poly-D-lysine.
Alternatively, following the 4-5 hour incubation described above, the medium was replaced with either regular culture medium or low calcium medium and the cells were incubated overnight at 37° C. The cells were subsequently resuspended and plated as described above.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.
1. An isolated TCCV-1 or TCCV-2 polypeptide wherein said polypeptide comprises the amino acid sequence of SEQ ID NO.2 or SEQ ID NO.4.
2. The polypeptide of claim 1, wherein said polypeptide is recombinantly produced.
3. The polypeptide of claim 1, wherein said polypeptide is synthetically produced.
4. The polypeptide of claim 1, wherein said polypeptide is recombinantly produced from a prokaryotic cell.
5. The polypeptide of claim 1, wherein said polypeptide is rocombinantly produced from a eukaryotic cell.
6. The polypeptide of claim 1, wherein said polypeptide comprises the amino acid sequence of SEQ ID NO. 2.
7. The polypeptide of claim 1, wherein said polypeptide comprises the amino acid sequence of SEQ ID NO. 4.