Patent application title:

Increase in the vitamin E content in organisms due to an increase in the tyrosine aminotransferase activity

Publication number:

-

Publication date:
Application number:

10/471,243

Filed date:

2002-03-07

✅ Patent granted

Patent number:

US 7,348,167 B2

Grant date:

2008-03-25

PCT filing:

WO; PCT/EP02/02492; 20020307

PCT publication:

WO; WO02/072848; 20020919

Examiner:

Rebecca E. Prouty | Kagnew Gebreyesus

Adjusted expiration:

2023-02-02

Abstract:

The present invention relates to a process for producing vitamin E by growing organisms, in particular plants, which have an increased tyrosine aminotransferase activity in comparison with the wild type, and to the genetically modified organisms, in particular plants, themselves.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12P7/26 IPC

Preparation of oxygen-containing organic compounds containing a carbonyl group Ketones

C12N9/10 IPC

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Transferases (2.)

C12N15/74 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora

Description

FIELD OF THE INVENTION

The present invention relates to a process for the production of vitamin E by growing organisms, in particular plants, which have an increased tyrosine aminotransferase activity over the wild type, and to the genetically modified organisms, in particular plants, themselves.

BACKGROUND OF THE INVENTION

The naturally occurring eight compounds with vitamin E activity are derivatives of 6-chromanol (Ullmann's Encyclopedia of Industrial Chemistry, Vol. A 27 (1996), VCH Verlagsgesellschaft, Chapter 4., 478-488, Vitamin E). The tocopherol group (1a-d) has a saturated side chain, while the tocotrienol group (2a-d) has an unsaturated side chain:

  • 1a, α-tocopherol: R1=R2=R3=CH3
  • 1b, β-tocopherol: R1=R3=CH3, R2=H
  • 1c, γ-tocopherol: R1=H, R2=R3=CH3
  • 1d, δ-tocopherol: R1=R2=H, R3=CH3

  • 2a, α-tocotrienol: R1=R2=R3=CH3
  • 2b, β-tocotrienol: R1=R3=CH3, R2=H
  • 3c, γ-tocotrienol: R1=H, R2=R3=CH3
  • 4d, δ-tocotrienol: R1=R2=H, R3=CH3

Within the present invention, vitamin E is understood to include all of the abovementioned tocopherols and tocotrienols with vitamin E activity.

These compounds with vitamin E activity are important natural lipid-soluble and solid antioxidants. Vitamin E deficiency leads to pathophysiological situations in humans and animals. Vitamin E compounds are thus of great economic value as additives in the food-and-feed sector, in pharmaceutical formulations and in cosmetic applications.

An economical process for the production of vitamin E compounds and of foods and feeds with an increased vitamin E content are therefore of great importance.

Particularly economical processes are biotechnological processes which exploit natural vitamin E-producing organisms or vitamin E-producing organisms which have been optimized by genetic modification.

FIG. 62 shows a biosynthesis scheme of α-tocopherol in higher plants.

In higher plants, tyrosine is formed starting from chorismate via prephenate and arogenate. The aromatic amino acid tyrosine is converted into hydroxyphenylpyruvate by the enzyme tyrosine aminotransferase, and hydroxyphenylpyruvate is converted into homogentisic acid by dioxygenation.

Homogentisic acid is subsequently bound to phytyl pyrophosphate (PPP) or geranylgeranyl pyrophosphate in order to form the precursors of α-tocopherol and α-tocotrienol, namely 2-methyl-6-phytylhydroquinone and 2-methyl-6-geranylgeranylhydroquinone. Methylation steps with S-adenosylmethionine as methyl group donor first lead to 2,3-dimethyl-6-phytylquinone, subsequent cyclization leads to γ-tocopherol and further methylation leads to α-tocopherol.

Experiments to increase the metabolite flux in order to increase the tocopherol or tocotrienol content in transgenic organisms by overexpressing individual biosynthesis genes are known.

WO 97/27285 describes a modification of the tocopherol content by increased expression or by downregulation of the enzyme p-hydroxyphenylpyruvate dioxygenase (HPPD).

WO 99/04622 and D. DellaPenna et al., Science 1998, 282, 2098-2100 describe gene sequences encoding a γ-tocopherol methyltransferase from Synechocystis PCC6803 and Arabidopsis thaliana and their incorporation into transgenic plants which have a modified vitamin E content.

WO 99/23231 shows that the expression of a geranylgeranyl reductase in transgenic plants results in an increased tocopherol biosynthesis.

WO 00/08169 describes gene sequences encoding a 1-deoxy-D-xylose-5-phosphate synthase and a geranylgeranyl-pyrophosphate oxidoreductase and their incorporation into transgenic plants which have a modified vitamin E content.

WO 00/68393 and WO 00/63391 describe gene sequences encoding a phytyl/prenyl transferase and their incorporation into transgenic plants which have a modified vitamin E content.

WO 00/61771 postulates that the combination of a sterol metabolism gene in combination with a tocopherol metabolism gene can lead to an increased tocopherol content in transgenic plants.

Arabidopsis thaliana genes which are inducible by the phytotoxin coronatine are disclosed in a PhD thesis by A. Lopoukhina (Characterization of coronatine regulated genes from Arabidopsis thaliana, PhD thesis at the Ruhr-Universität Bochum, Department of Plant Physiology, 1999) and in a poster contribution by H. Holländer-Czytko et al. at the “Botanikertagung 2000”, Jena, 17-22.9.2000. In one of these genes, the derived amino acid sequence shows approximately 35% homology with known tyrosine aminotransferases. A low degree of enzyme activity of a tyrosine aminotransferase was detected by heterologous expression of the putative tyrosine aminotransferase gene in E. coli. It is disclosed that the treatment of plants with coronatine and the wounding of plants lead to an accumulation of the putative tyrosine aminotransferase-specific mRNA, the putative tyrosine aminotransferase and the measurable enzyme activity. Page 72 et seq. of the PhD thesis furthermore disclose that the wounding of plants is known to lead to the formation of reactive oxygen species which are scavenged by antioxidative compounds such as tocopherol, carotenoids or rosmaric acid.

While all of these methods, with the exception of the last-mentioned prior art, give rise to genetically modified organisms, in particular plants, which, as a rule, have a modified vitamin E content, they have the disadvantage that the level of the vitamin E content in the prior-art genetically modified organisms is as yet unsatisfactory.

It was therefore an object of the present invention to provide a further process for the production of vitamin E by growing organisms, or to provide further transgenic organisms which produce vitamin E, which have optimized characteristics such as, for example, a higher vitamin E content, and which do not exhibit the above-described disadvantage of the prior art.

We have found that this object is achieved by a process for the production of vitamin E wherein organisms are grown which have an increased tyrosine aminotransferase activity over the wild type.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the plasmid pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT.

FIG. 2 shows the plasmid pSUN2-USPP-rbcS-RnTATase-nosT.

FIG. 3 shows the plasmid pSUN2-USPP-AtTATase1-nosT.

FIG. 4 shows the plasmid pSUN2-USPP-AtTATase3-nosT.

FIG. 5 shows the plasmid pSUN2-USPP-AtTATase5-nosT.

FIG. 6 shows the plasmid pSUN2-USPP-AtTATase6-nosT.

FIG. 7 shows the plasmid pSUN2-LeB4-NtGGPPOR-nosT.

FIG. 8 shows the plasmid pSUN2-USPP-AtHPPD-ocsT.

FIG. 9 shows the plasmid pSUN2-USPP-AtHPT-ocsT.

FIG. 10 shows the plasmid pSUN2-LeB4-IPP-SynMT1-nosT.

FIG. 11 shows the plasmid pSUN2-LeB4-IPP-SynCyc-nosT.

FIG. 12 shows the plasmid pSUN2-SBPP-AtγTMT-35ST.

FIG. 13 shows the plasmid pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT-USPP-rbcS-RnTATase-nosT.

FIG. 14 shows the plasmid pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT-USPP-AtTATase1-nosT.

FIG. 15 shows the plasmid pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT-USPP-AtTATase3-nosT.

FIG. 16 shows the plasmid pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT-USPP-AtTATase5-nosT.

FIG. 17 shows the plasmid pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT-USPP-AtTATase6-nosT.

FIG. 18 shows the plasmid pSUN2-LeB4-NtGGPPOR-nosT-USPP-rbcS-RnTATase1-nosT.

FIG. 19 shows the plasmid pSUN2-LeB4-NtGGPPOR-nosT-USPP-AtTATase1-nosT.

FIG. 20 shows the plasmid pSUN2-LeB4-NtGGPPOR-nosT-USPP-AtTATase3-nosT.

FIG. 21 shows the plasmid pSUN2-LeB4-NtGGPPOR-nosT-USPP-AtTATase5-nosT.

FIG. 22 shows the plasmid pSUN2-LeB4-NtGGPPOR-nosT-USPP-AtTATase6-nosT.

FIG. 23 shows the plasmid pSUN2-USPP-AtHPPD-ocsT-USPP-rbcS-RnTATase1-nosT.

FIG. 24 shows the plasmid pSUN2-USPP-AtHPPD-ocsT-USPP-AtTATase1-nosT.

FIG. 25 shows the plasmid pSUN2-USPP-AtHPPD-ocsT-USPP-AtTATase3-nosT.

FIG. 26 shows the plasmid pSUN2-USPP-AtHPPD-ocsT-USPP-AtTATase5-nosT.

FIG. 27 shows the plasmid pSUN2-USPP-AtHPPD-ocsT-USPP-AtTATase6-nosT.

FIG. 28 shows the plasmid pSUN2-USPP-AtHPT-ocsT-USPP-rbcS-RnTATase1-nosT.

FIG. 29 shows the plasmid pSUN2-USPP-AtHPT-ocsT-USPP-AtTATase1-nosT.

FIG. 30 shows the plasmid pSUN2-USPP-AtHPT-ocsT-USPP-AtTATase3-nosT.

FIG. 31 shows the plasmid pSUN2-USPP-AtHPT-ocsT-USPP-AtTATase5-nosT.

FIG. 32 shows the plasmid pSUN2-USPP-AtHPT-ocsT-USPP-AtTATase6-nosT.

FIG. 33 shows the plasmid pSUN2-LeB4-IPP-SynMT1-nosT-USPP-rbcS-RnTATase1-nosT.

FIG. 34 shows the plasmid pSUN2-LeB4-IPP-SynMT1-nosT-USPP-AtTATase1-nosT.

FIG. 35 shows the plasmid pSUN2-LeB4-IPP-SynMT1-nosT-USPP-AtTATase3-nosT.

FIG. 36 shows the plasmid pSUN2-LeB4-IPP-SynMT1-nosT-USPP-AtTATase5-nosT.

FIG. 37 shows the plasmid pSUN2-LeB4-IPP-SynMT1-nosT-USPP-AtTATase6-nosT

FIG. 38 shows the plasmid pSUN2-LeB4-IPP-SynCyc-nosT-USPP-rbcS-RnTATase1-nosT.

FIG. 39 shows the plasmid pSUN2-LeB4-IPP-SynCyc-nosT-USPP-AtTATase1-nosT.

FIG. 40 shows the plasmid pSUN2-LeB4-IPP-SynCyc-nosT-USPP-AtTATase3-nosT.

FIG. 41 shows the plasmid pSUN2-LeB4-IPP-SynCyc-nosT-USPP-AtTATase5-nosT.

FIG. 42 shows the plasmid pSUN2-LeB4-IPP-SynCyc-nosT-USPP-AtTATase6-nosT.

FIG. 43 shows the plasmid pSUN2-SBPP-AtγTMT-35ST-USPP-rbcS-RnTATase1-nosT.

FIG. 44 shows the plasmid pSUN2-SBPP-AtγTMT-35ST-USPP-AtTATase1-nosT.

FIG. 45 shows the plasmid pSUN2-SBPP-AtγTMT-35ST-USPP-AtTATase3-nosT.

FIG. 46 shows the plasmid pSUN2-SBPP-AtγTMT-35ST-USPP-AtTATase5-nosT.

FIG. 47 shows the plasmid pSUN2-SBPP-AtγTMT-35ST-USPP-AtTATase6-nosT.

FIG. 48 shows the plasmid pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT-LeB4-NtGGPPOR-nosT.

FIG. 49 shows the plasmid pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT-USPP-AtHPPD-ocsT.

FIG. 50 shows the plasmid pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT-USPP-AtHPPD-ocsT.

FIG. 51 shows the plasmid pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT-LeB4-IPP-SynMT1-nosT.

FIG. 52 shows the plasmid pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT-LeB4-IPP-SynCyc1-nosT.

FIG. 53 shows the plasmid pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT-USPP-AtγTMT-35ST.

FIG. 54 shows the plasmid pSUN2-LeB4-NtGGPPOR-nosT-USPP-AtHPPD-ocsT.

FIG. 55 shows the plasmid pSUN2-LeB4-NtGGPPOR-nosT-USPP-AtHPT-ocsT.

FIG. 56 shows the plasmid pSUN2-SBPP-AtγTMT-35ST-USPP-AtHPPD-ocsT-LeB4-SynMT1-nosT.

FIG. 57 shows the plasmid pSUN2-USPP-AtHPPD-ocsT-LeB4-SynMT1-nosT.

FIG. 58 shows the plasmid pSUN2-LeB4-NtGGPPOR-nosT-USPP-AtHPPD-ocsT-USPP-AtHPT-ocsT.

FIG. 59 shows the plasmid pSUN2-SBPP-AtγTMT-35ST-LeB4-IPP-SynCyc-nosT-LeB4-IPP-SynMT1-nosT.

FIG. 60 shows the plasmid pBinAR-IPP-Tp-10/tyrosine aminotransferase (also termed pBinAR-35SP-IPP-RnTATase-ocsT).

FIG. 61 shows the plasmid pPTVkan-IPPTP11-TATaseRN-nosT (also termed pPTVkan-LeB4-IPP-RnTATase-nosT).

FIG. 62 shows a biosynthesis scheme of α-tocopherol in higher plants.

FIG. 63 shows a graphic representation of the result of the overexpression of the Rattus norvegicus tyrosine aminotransferase in Nicotiana tabacum (see Example 80) in comparison with the wild type. The data shown are the vitamin E contents (sum of all 8 isomers) in young leaf material. The description of the axes indicates the individual transgenic lines. The data shown for the wild-type plants (wt) corresponds to the mean +/−SD of 4 replications.

DETAILED DESCRIPTION OF THE INVENTION

Tyrosine aminotransferase activity is understood as meaning the enzyme activity of a tyrosine aminotransferase.

A tyrosine aminotransferase is understood as meaning a protein which has the enzymatic activity of converting tyrosine into 4-hydroxyphenylpyruvate.

Accordingly, tyrosine aminotransferase activity is understood as meaning the amount of tyrosine converted, or the amount of 4-hydroxyphenylpyruvate formed, by the protein tyrosine aminotransferase within a specific time.

Thus, in the case of an increased tyrosine aminotransferase activity over the wild type, the amount of tyrosine converted, or the amount of 4-hydroxyphenylpyruvate formed, by the protein tyrosine aminotransferase within a specific time is thus increased over the wild type.

This increase in the tyrosine aminotransferase activity preferably amounts to at least 5%, more preferably to at least 20%, more preferably to at least 50%, more preferably to at least 100%, particularly preferably to at least 300%, more particularly preferably to at least 500%, especially to at least 600%, of the tyrosine aminotransferase activity of the wild type.

A wild type is understood as meaning the corresponding non-genetically-modified starting organism. Preferably, and in particular in cases in which the organism or the wild type cannot be assigned unambiguously, the term wild type for increasing the tyrosine aminotransferase activity, increasing the hydroxyphenylpyruvate dioxygenase activity described hereinbelow, increasing the homogentisate phytyltransferase activity described hereinbelow, increasing the geranylgeranyl-pyrophosphate oxidoreductase activity described hereinbelow, increasing the 2-methyl-6-phytylhydroquinone methyltransferase activity described hereinbelow, increasing the tocopherol cyclase activity described hereinbelow, increasing the γ-tocopherol methyltransferase activity described hereinbelow, reducing the homogentisate dioxygenase activity described hereinbelow, reducing the maleylacetoacetate isomerase activity described hereinbelow and reducing the fumarylacetoacetate hydrolase activity described hereinbelow, and for increasing the vitamin E content, is understood as meaning a reference organism. This reference organism is preferably Brassica napus cv Westar.

The tyrosine aminotransferase activity can be increased in various ways, for example by eliminating inhibiting regulatory mechanisms at the translation and protein level or by increasing the gene expression of a nucleic acid encoding a tyrosine aminotransferase over the wild type, for example by inducing the tyrosine aminotransferase gene by phytotoxins such as, for example, coronatine, or by introducing nucleic acids encoding a tyrosine aminotransferase.

An increase in the gene expression of a nucleic acid encoding a tyrosine aminotransferase is also understood as meaning, in accordance with the invention, the manipulation of the expression of the endogenous tyrosine aminotransferases of the organisms, in particular plants. This can be achieved, for example, by modifying the promoter DNA sequence for genes encoding tyrosine aminotransferases. Such a modification which entails a modified or, preferably, increased expression rate of at least one endogenous tyrosine aminotransferase gene can be effected by deletion or insertion of DNA sequences.

As described above, it is possible to modify the expression of at least one endogenous tyrosine aminotransferase by applying exogenous stimuli. This can be effected by specific physiological conditions, i.e. by applying foreign substances.

Moreover, a modified, or increased, expression of at least one endogenous tyrosine aminotransferase gene can be achieved by a regulatory protein which does not occur in the untransformed organism interacting with the promoter of these genes.

Such a regulator can constitute a chimeric protein which is composed of a DNA binding domain and a transcription activator domain, as described, for example, in WO 96/06166.

In a preferred embodiment, the tyrosine aminotransferase activity is increased over the wild type by increasing the gene expression of a nucleic acid encoding a tyrosine aminotransferase.

In a further preferred embodiment, the gene expression of a nucleic acid encoding a tyrosine aminotransferase is increased by introducing, into the organism, nucleic acids encoding a tyrosine aminotransferase.

In principle, any tyrosine aminotransferase gene, i.e. any nucleic acid encoding a tyrosine aminotransferase, can be used for this purpose. In the case of genomic tyrosine aminotransferase nucleic acid sequences from eukaryotic sources, which comprise introns, it is preferred to use nucleic acid sequences which have already been processed, such as the corresponding cDNAs, in the event that the host organism is not capable, or cannot be made capable, of expressing the tyrosine aminotransferase in question.

All of the nucleic acids mentioned in the description can be, for example, a RNA, DNA or cDNA sequence.

Examples of nucleic acids encoding a tyrosine aminotransferase, or examples of tyrosine aminotransferases, are

the six putative tyrosine aminotransferases TAT I to TAT VI from Arabidopsis thaliana TATI: CAA23026 (nucleic acid: SEQ. ID. NO. 5, protein: SEQ. ID. NO. 6), TAT II: CAA23025, TAT III: AAD23027 (nucleic acid: SEQ. ID. NO. 7, protein: SEQ. ID. NO. 8), TAT IV: CAA16881, TAT V: AAD21706 (nucleic acid: SEQ. ID. NO. 9, protein: SEQ. ID. NO. 10), TAT VI: (nucleic acid: SEQ. ID. NO. 11, protein: SEQ. ID. NO. 12)

the Rattus norvegicus tyrosine aminotransferase (nucleic acid: SEQ. ID. NO. 1, protein: SEQ. ID. NO. 2),

a variant of the Rattus norvegicus tyrosine aminotransferase (nucleic acid: SEQ. ID. NO. 3, protein: SEQ. ID. NO. 4),

the human tyrosine aminotransferase (Accession No. XP008081),

the Trypanosoma rangeli tyrosine aminotransferase (Accession No. AF1653231),

the Trypanosoma cruzi tyrosine aminotransferase (Accession No. AI 622965) or

the Rhizobium meliloti tyrosine aminotransferase (Accession No. L05065).

It is preferred to use nucleic acids which encode proteins comprising the amino sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by amino acid substitution, insertion or deletion which has at least 20% identity, preferably at least 33% identity, more preferably at least 35% identity, more preferably at least 50% identity, more particularly preferably at least 70% identity, most preferably at least 90% identity, at the amino acid level with the sequence SEQ. ID. NO. 2 and which have the enzymatic characteristic of a tyrosine aminotransferase.

Sequence SEQ. ID. NO. 2 constitutes the amino acid sequence of the Rattus norvegicus tyrosine aminotransferase.

In the description, the term “substitution” is to be understood as meaning the exchange of one or more amino acids for one or ore amino acids. Exchanges which are preferably carried out are those known as conservative exchanges, in which the replaced amino acid has a similar characteristic to the original amino acid, for example the exchange of Glu for Asp, Gln for Asn, Val for Ile, Leu for Ile, Ser for Thr.

Deletion is the replacement of an amino acid by a direct bond. Preferred positions for deletions are the termini of the polypeptide and the linkages between the individual protein domains.

Insertions are introductions of amino acids into the polypeptide chain, a direct bond formally being replaced by one or more amino acids.

Identity between two proteins is understood as meaning the identity of the amino acids over the entire protein length in each case, in particular the identity which is calculated by alignment with the aid of the Lasergene Software by DNASTAR, Inc. Madison, Wis. (USA) using the Clustal Method (Higgins D G, Sharp P M. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5(2):151-1) with the parameters set as follows:

Multiple alignment parameter:
Gap penalty 10
Gap length penalty 10
Pairwise alignment parameter:
K-tuple 1
Gap penalty 3
Window 5
Diagonals saved 5

A protein with at least 20% identity at the amino acid level with the sequence SEQ. ID. NO. 2, accordingly, is to be understood as meaning a protein which upon alignment of its sequence with the sequence SEQ. ID. NO. 2, in particular using the above program algorithm with the above parameter set, has at least 20% identity.

In accordance with the above program algorithm with the above parameter set, the known tyrosine aminotransferases have the following amino acid sequence identity [%] with SEQ. ID. NO. 2 (Rattus norvegicus tyrosine aminotransferases):

CAA23026 (TAT I) 26.8%
CAA23025 (TAT II) 22.3%
AAD23027 (TAT III) 28.3%
CAA16881 (TAT IV) 29.8%
AAD21706 (TAT V) 30.0%
TAT VI K19.P17.14 33.3%
AF165323_1 (Trypanosoma rangeli) 33.3%
XP_008081 (human) 91.6%

In a further preferred embodiment, nucleic acids which encode proteins comprising the amino acid sequence of the Rattus norvegicus tyrosine aminotransferase SEQ. ID. NO. 2 or the amino acid sequence of human tyrosine aminotransferase (Accession No. XP008081) are introduced into organisms.

Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence in accordance with the genetic code.

Codons which are preferably used for this purpose are those which are used frequently in accordance with the organism-specific codon usage. The codon usage can be determined readily with the aid of computer evaluations of other, known genes of the organisms in question.

If, for example, the protein is to be expressed in a plant, it is frequently advantageous to use the codon usage of the plant in the backtranslation.

In an especially preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 1 is introduced into the organism.

Sequence SEQ. ID. NO. 1 constitutes the cDNA of the Rattus norvegicus tyrosine aminotransferase (Accession No. NM012668).

In a preferred embodiment, the organisms which are grown additionally have an increased activity of at least one of the activities selected from the group consisting of hydroxyphenylpyruvate dioxygenase activity, homogentisate phytyltransferase activity, geranylgeranyl-pyrophosphate oxidoreductase activity, 2-methyl-6-phytylhydroquinone methyltransferase activity, tocopherol cyclase activity and γ-tocopherol methyltransferase activity over the wild type.

Hydroxyphenylpyruvate dioxygenase activity is understood as meaning the enzyme activity of a hydroxyphenylpyruvate dioxygenase.

A hydroxyphenylpyruvate dioxygenase is understood as meaning a protein which has the enzymatic activity to convert hydroxyphenylpyruvate into homogentisate.

Accordingly, hydroxyphenylpyruvate dioxygenase activity is understood as meaning the amount of hydroxyphenylpyruvate converted, or the amount of homogentisate produced, by the protein hydroxyphenylpyruvate dioxygenase within a certain time.

Thus, in a hydroxyphenylpyruvate dioxygenase activity which is increased over the wild type, the amount of hydroxyphenylpyruvate converted, or the amount of homogentisate produced, by the protein hydroxyphenylpyruvate dioxygenase within a certain time is increased in comparison with the wild type.

This increase in the hydroxyphenylpyruvate dioxygenase activity preferably amounts to at least 5%, more preferably to at least 20%, more preferably to at least 50%, more preferably to at least 100%, more preferably to at least 300%, even more preferably to at least 500%, in particular to at least 600% of the hydroxyphenylpyruvate dioxygenase activity of the wild type.

Homogentisate phytyltransferase activity is understood as meaning the enzyme activity of a homogentisate phytyltransferase.

A homogentisate phytyltransferase is understood as meaning a protein which has the enzymatic activity to convert homogentisate and phytyl pyrophosphate into 2-methyl-6-phytylhydroquinone.

Accordingly, homogentisate phytyltransferase activity is understood as meaning the amount of homogentisate or phytyl phyrophosphate converted, or the amount of 2-methyl-6-phytylhydroquinone produced, by the protein homogentisate phytyltransferase within a certain time.

Thus, in a homogentisate phytyltransferase activity which is increased over the wild type, the amount of homogentisate or phytyl pyrophosphate converted, or the amount of 2-methyl-6-phytylhydroquinone produced, by the protein homogentisate phytyltransferase within a certain time is increased in comparison with the wild type.

This increase in the homogentisate phytyltransferase activity preferably amounts to at least 5%, more preferably to at least 20%, more preferably to at least 50%, more preferably to at least 100%, more preferably to at least 300%, even more preferably to at least 500%, in particular to at least 600% of the homogentisate phytyltransferase activity of the wild type.

Geranylgeranyl-pyrophosphate oxidoreductase activity is understood as meaning the enzyme activity of a geranylgeranyl-pyrophosphate oxidoreductase.

A geranylgeranyl-pyrophosphate oxidoreductase is understood as meaning a protein which has the enzymatic activity to convert geranylgeranyl pyrophosphate into phytyl pyrophosphate.

Accordingly, geranylgeranyl-pyrophosphate oxidoreductase activity is understood as meaning the amount of geranylgeranyl pyrophosphate converted, or the amount of phytyl pyrophosphate produced, by the protein geranylgeranyl-pyrophosphate oxidoreductase within a certain time.

Thus, in a geranylgeranyl-pyrophosphate oxidoreductase activity which is increased over the wild type, the amount of geranylgeranyl pyrophosphate converted, or the amount of phytyl pyrophosphate produced, by the protein geranylgeranyl-pyrophosphate oxidoreductase within a certain time is increased in comparison with the wild type.

This increase in the geranylgeranyl-pyrophosphate oxidoreductase activity preferably amounts to at least 5%, more preferably to at least 20%, more preferably to at least 50%, more preferably to at least 100%, more preferably to at least 300%, even more preferably to at least 500%, in particular to at least 600% of the geranylgeranyl-pyrophosphate oxidoreductase activity of the wild type.

2-Methyl-6-phytylhydroquinone methyltransferase activity is understood as meaning the enzyme activity of a 2-methyl-6-phytylhydroquinone methyltransferase.

A 2-methyl-6-phytylhydroquinone methyltransferase is understood as meaning a protein which has the enzymatic activity to convert 2-methyl-6-phytylhydroquinone into 2,3-dimethyl-6-phytyl-hydroquinol.

Accordingly, 2-methyl-6-phytylhydroquinone methyltransferase activity is understood as meaning the amount of 2-methyl-6-phytylhydroquinol converted, or the amount of 2,3-dimethyl-6-phytylhydroquinol produced, by the protein 2-methyl-6-phytyl-hydroquinone methyltransferase within a certain time.

Thus, in a 2-methyl-6-phytylhydroquinone methyltransferase activity which is increased over the wild type, the amount of 2-methyl-6-phytylhydroquinone converted, or the amount of 2,3-dimethyl-6-phytylhydroquinone produced, by the protein 2-methyl-6-phytylhydroquinone methyltransferase within a certain time is increased in comparison with the wild type.

This increase in the 2-methyl-6-phytylhydroquinone methyltransferase activity preferably amounts to at least 5%, more preferably to at least 20%, more preferably to at least 50%, more preferably to at least 100%, more preferably to at least 300%, even more preferably to at least 500%, in particular to at least 600% of the 2-methyl-6-phytylhydroquinone methyltransferase activity of the wild type.

Tocopherol cyclase activity is understood as meaning the enzyme activity of a tocopherol cyclase.

A tocopherol cyclase is understood as meaning a protein which has the enzymatic activity to convert 2,3-dimethyl-6-phytylhydroquinone into γ-tocopherol.

Accordingly, tocopherol cyclase activity is understood as meaning the amount of 2,3-dimethyl-6-phytylhydroquinone converted, or the amount of γ-tocopherol produced, by the protein tocopherol cyclase within a certain time.

Thus, in a tocopherol cyclase activity which is increased over the wild type, the amount of 2,3-dimethyl-6-phytylhydroquinone converted, or the amount of γ-tocopherol produced, by the protein tocopherol cyclase within a certain time is increased in comparison with the wild type.

This increase in the tocopherol cyclase activity preferably amounts to at least 5%, more preferably to at least 20%, more preferably to at least 50%, more preferably to at least 100%, more preferably to at least 300%, even more preferably to at least 500%, in particular to at least 600% of the tocopherol cyclase activity of the wild type.

γ-Tocopherol methyltransferase activity is understood as meaning the enzyme activity of a γ-tocopherol methyltransferase.

A γ-tocopherol methyltransferase is understood as meaning a protein which has the enzymatic activity to convert γ-tocopherol into α-tocopherol.

Accordingly, γ-tocopherol methyltransferase activity is understood as meaning the amount of γ-tocopherol converted, or the amount of α-tocopherol produced, by the protein γ-tocopherol methyltransferase within a certain time.

Thus, in a γ-tocopherol methyltransferase activity which is increased over the wild type, the amount of γ-tocopherol converted, or the amount of α-tocopherol produced, by the protein γ-tocopherol methyltransferase within a certain time is increased in comparison with the wild type.

This increase in the γ-tocopherol methyltransferase activity preferably amounts to at least 5%, more preferably to at least 20%, more preferably to at least 50%, more preferably to at least 100%, more preferably to at least 300%, even more preferably to at least 500%, in particular to at least 600% of the γ-tocopherol methyltransferase activity of the wild type.

The increase in at least one of the activities selected from the group consisting of hydroxyphenylpyruvate dioxygenase activity, homogentisate phytyltransferase activity, geranylgeranyl-pyrophosphate oxidoreductase activity, 2-methyl-6-phytylhydroquinone methyltransferase activity, tocopherol cyclase activity and γ-tocopherol methyltransferase activity can be effected independently of one another by various routes, for example by eliminating inhibiting regulatory mechanisms at the expression level and the protein level, or by increasing the gene expression of the nucleic acids in question, that is to say increasing the gene expression of at least one nucleic acid selected from the group of the nucleic acids encoding a hydroxyphenylpyruvate dioxygenase, nucleic acids encoding a homogentisate phytyltransferase, nucleic acids encoding a geranylgeranyl-pyrophosphate oxidoreductase, nucleic acids encoding a 2-methyl-6-phytylhydroquinone methyltransferase, nucleic acids encoding a tocopherol cyclase and nucleic acids encoding a γ-tocopherol methyltransferase over the wild type.

Increasing the gene expression of the nucleic acid in question over the wild type can also be effected by various routes, for example by inducing the relevant genes by activators, that is to say by inducing the hydroxyphenylpyruvate dioxygenase gene, the homogentisate phytyltransferase gene, the geranylgeranyl-pyrophosphate oxidoreductase gene, the 2-methyl-6-phytylhydroquinone methyltransferase gene, the tocopherol cyclase gene or the γ-tocopherol methyltransferase gene by activators or by introducing one or more gene copies of the relevant nucleic acids into the organism, that is to say by introducing at least one of the nucleic acids selected from the group consisting of nucleic acids encoding a hydroxyphenylpyruvate dioxygenase, nucleic acids encoding a homogentisate phytyltransferase, nucleic acids encoding a geranylgeranyl-pyrophosphate oxidoreductase, nucleic acids encoding a 2-methyl-6-phytylhydroquinone methyltransferase, nucleic acids encoding a tocopherol cyclase and nucleic acids encoding a γ-tocopherol methyltransferase.

Increasing the gene expression of a nucleic acid encoding a hydroxyphenylpyruvate dioxygenase, homogentisate phytyltransferase, geranylgeranyl-pyrophosphate oxidoreductase, 2-methyl-6-phytylhydroquinone methyltransferase, tocopherol cyclase or γ-tocopherol methyltransferase is also understood as meaning, in accordance with the invention, the manipulation of the expression of the endogenous hydroxyphenylpyruvate dioxygenases, homogentisate phytyltransferases, geranylgeranyl-pyrophosphate oxidoreductases, 2-methyl-6-phytylhydroquinone methyltransferases, tocopherol cyclases or γ-tocopherol methyltransferases of the organism itself, in particular the plants themselves.

This can be brought about for example by modifying the promoter DNA sequence for genes encoding hydroxyphenylpyruvate dioxygenase, homogentisate phytyltransferase, geranylgeranyl-pyrophosphate oxidoreductase, 2-methyl-6-phytylhydroquinone methyltransferase, tocopherol cyclase or γ-tocopherol methyltransferase. Such a modification, which results in an increased expression rate of the relevant gene, can be effected for example by deletion or insertion of DNA sequences.

As described hereinabove, it is possible to modify the expression of the endogenous hydroxyphenylpyruvate dioxygenase, homogentisate phytyltransferase, geranylgeranyl-pyrophosphate oxidoreductase, 2-methyl-6-phytylhydroquinone methyltransferase, tocopherol cyclase or γ-tocopherol methyltransferase by the application of exogenous stimuli. This can be effected by specific physiological conditions, i.e. by applying exogenous substances.

Moreover, a modified, or increased, expression of endogenous hydroxyphenylpyruvate dioxygenase, homogentisate phytyltransferase, geranylgeranyl-pyrophosphate oxidoreductase, 2-methyl-6-phytylhydroquinone methyltransferase, tocopherol cyclase or γ-tocopherol methyltransferase genes can be achieved by a regulatory protein which does not occur in the untransformed organism interacting with the promoter of these genes.

Such a regulator can constitute a chimeric protein which is composed of a DNA binding domain and a transcription activator domain, as described, for example, in WO 96/06166.

In a preferred embodiment, the increase in gene expression of a nucleic acid encoding a hydroxyphenylpyruvate dioxygenase, hereinbelow also termed HPPD, is effected by introducing, into the organism, at least one nucleic acid encoding an HPPD.

In principle, any HPPD gene, that is to say any nucleic acid which encodes an HPPD, can be used for this purpose.

In the case of genomic HPPD nucleic acid sequences from eukaryotic sources, which comprise introns, it is preferred to use nucleic acid sequences which have already been processed, such as the corresponding cDNAs, in the event that the host organism is not capable, or cannot be made capable, of expressing the HPPD in question.

Examples of HPPD genes are nucleic acids encoding an Arabidopsis thaliana HPPD (nucleic acid: Seq. ID. No. 13, protein: Seq. ID. No. 14) or a barley HPPD (WO 99/04021).

In this preferred embodiment, at least one further HPPD gene is thus present in the transgenic organisms according to the invention compared with the wild type. In this preferred embodiment, the organism, accordingly, has at least one exogenous nucleic acid encoding an HPPD or at least two endogenous nucleic acids encoding an HPPD.

Nucleic acids which are preferably used in the above-described preferred embodiment are nucleic acids which encode proteins comprising the amino acid sequence SEQ. ID. NO. 14 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which have at least 30% identity, preferably at least 50% identity, more preferably at least 70% identity, more preferably at least 90% identity, most preferably at least 95% identity with the sequence SEQ. ID. NO. 14 at the amino acid level and which have the enzymatic property of an HPPD.

The sequence SEQ. ID. NO. 14 constitutes the amino acid sequence of the Arabidopsis thaliana HPPD.

Accordingly, a protein which has at least 30% identity with the sequence SEQ. ID. NO. 14 at the amino acid level is understood as meaning a protein which, upon alignment of its sequence with the sequence SEQ. ID. NO. 14, in particular using the above program algorithm with the above parameter set, has at least 30% identity.

Further examples of HPPD and HPPD genes can be found easily from a variety of organisms whose genomic sequence is known by homology comparisons of the amino acid sequences or of the corresponding backtranslated nucleic acid sequences from databases with SEQ ID. NO. 14.

For example, the barley HPPD has 57.5% identity with the Arabidopsis thaliana HPPD (SEQ. ID. No. 14).

Further examples of HPPD and HPPD genes can furthermore be found easily, for example starting from the sequence SEQ. ID. No. 13 in various organisms whose genomic sequence is not known, using hybridization and PCR techniques in a manner known per se.

In a further especially preferred embodiment, the hydroxyphenylpyruvate dioxygenase activity is increased by introducing, into organisms, nucleic acids which encode proteins comprising the amino acid sequence of the Arabidopsis thaliana HPPD (SEQ. ID. NO. 14).

Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence in accordance with the genetic code.

Codons which are preferably used for this purpose are those which are used frequently in accordance with the organism-specific codon usage. The codon usage can be determined readily with the aid of computer evaluations of other, known genes of the organisms in question.

If, for example, the protein is to be expressed in plants, it is frequently advantageous to use the codon usage of the plant in the backtranslation.

In an especially preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 13 is introduced into the organism.

The sequence SEQ. ID. NO. 13 constitutes the genomic DNA of A. thaliana which encodes the HPPD of the sequence SEQ. ID. NO. 14.

Furthermore, all of the abovementioned HPPD genes can be synthesized chemically, in a manner known per se, from the nucleotide units such as, for example, by fragment condensation of individual overlapping complementary nucleic acid units of the double helix. The chemical synthesis of oligonucleotides can be carried out for example in the known manner by the phosphoamidite method (Voet, Voet, 2nd Edition, Wiley Press New York, pages 896-897). The addition of synthetic oligonucleotides and the filling-in of gaps with the aid of the Klenow fragment of the DNA polymerase and ligation reactions and general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

In a preferred embodiment, the increase in gene expression of a nucleic acid encoding a homogentisate phytyltransferase, hereinbelow also termed HPT, is effected by introducing, into the organism, at least one nucleic acid encoding an HPT.

In principle, any HPT gene, that is to say any nucleic acid which encodes an HPT, can be used for this purpose.

In the case of genomic HPT nucleic acid sequences from eukaryotic sources, which comprise introns, it is preferred to use nucleic acid sequences which have already been processed, such as the corresponding cDNAs, in the event that the host organism is not capable, or cannot be made capable, of expressing the HPT in question.

Examples of HPT genes are nucleic acids encoding an Arabidopsis thaliana HPT (nucleic acid: Seq. ID. No. 15, protein: Seq. ID. No. 16) or nucleic acids encoding a Glycine max, Helianthus annuus, Nicotiana tabacum, Physcomitrella patens, Brassica napus, Oryza sativa, Hordeum vulgaris or Synechocystis sp. PCC6803 HPT.

In this preferred embodiment, at least one further HPT gene is thus present in the transgenic organisms according to the invention compared with the wild type. In this preferred embodiment, the organism, accordingly, has at least one exogenous nucleic acid encoding an HPT or at least two endogenous nucleic acids encoding an HPT.

Nucleic acids which are preferably used in the above-described preferred embodiment are nucleic acids which encode proteins comprising the amino acid sequence SEQ. ID. NO. 16 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which have at least 30% identity, preferably at least 50% identity, more preferably at least 70% identity, more preferably at least 90% identity, most preferably at least 95% identity with the sequence SEQ. ID. NO. 16 at the amino acid level and which have the enzymatic property of an HPT.

The sequence SEQ. ID. NO. 16 constitutes the amino acid sequence of the Arabidopsis thaliana HPT.

Accordingly, a protein which has at least 30% identity with the sequence SEQ. ID. NO. 16 at the amino acid level is understood as meaning a protein which, upon alignment of its sequence with the sequence SEQ. ID. NO. 16, in particular using the above program algorithm with the above parameter set, has at least 30% identity.

Further examples of HPT and HPT genes can be found easily from a variety of organisms whose genomic sequence is known by homology comparisons of the amino acid sequences or of the corresponding backtranslated nucleic acid sequences from databases with SEQ ID. NO. 16.

For example, the Synechocystis sp. PCC6803 HPT has 40.9% identity with the Arabidopsis thaliana HPT (Seq. ID. No. 16).

Further examples of HPT and HPT genes can furthermore be found easily, for example starting from the sequence SEQ. ID. No. 15 in various organisms whose genomic sequence is not known, using hybridization and PCR techniques in a manner known per se.

In a further especially preferred embodiment, the homogentisate phytyltransferase activity is increased by introducing, into organisms, nucleic acids which encode proteins comprising the amino acid sequence of the Arabidopsis thaliana HPT (SEQ. ID. NO. 16).

Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence in accordance with the genetic code.

Codons which are preferably used for this purpose are those which are used frequently in accordance with the organism-specific codon usage. The codon usage can be determined readily with the aid of computer evaluations of other, known genes of the organisms in question.

If, for example, the protein is to be expressed in plants, it is frequently advantageous to use the codon usage of the plant in the backtranslation.

In an especially preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 15 is introduced into the organism.

The sequence SEQ. ID. NO. 15 constitutes the genomic DNA of A. thaliana which encodes the HPT of the sequence SEQ. ID. NO. 16.

Furthermore, all of the abovementioned HPT genes can be synthesized chemically, in a manner known per se, from the nucleotide units such as, for example, by fragment condensation of individual overlapping complementary nucleic acid units of the double helix. The chemical synthesis of oligonucleotides can be carried out for example in the known manner by the phosphoamidite method (Voet, Voet, 2nd Edition, Wiley Press New York, pages 896-897). The addition of synthetic oligonucleotides and the filling-in of gaps with the aid of the Klenow fragment of the DNA polymerase and ligation reactions and general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

In a preferred embodiment, the increase in gene expression of a nucleic acid encoding a geranylgeranyl-pyrophosphate oxidoreductase, hereinbelow also termed GGPPOR, is effected by introducing, into the organism, at least one nucleic acid encoding a GGPPOR.

In principle, any GGPPOR gene, that is to say any nucleic acid which encodes a GGPPOR, can be used for this purpose.

In the case of genomic GGPPOR nucleic acid sequences from eukaryotic sources, which comprise introns, it is preferred to use nucleic acid sequences which have already been processed, such as the corresponding cDNAs, in the event that the host organism is not capable, or cannot be made capable, of expressing the GGPPOR in question.

Examples of GGPPOR genes are nucleic acids encoding a Nicotiana tabacum GGPPOR (nucleic acid: Seq. ID. No. 17, protein: Seq. ID. No. 18) or nucleic acids encoding an Arabidopsis thaliana, Glycine max, Helianthus annuus, Physcomitrella patens, Brassica napus, Oryza sativa, Hordeum vulgaris or Synechocystis sp. PCC6803 GGPPOR.

In this preferred embodiment, at least one further GGPPOR gene is thus present in the transgenic organisms according to the invention compared with the wild type. In this preferred embodiment, the organism, accordingly, has at least one exogenous nucleic acid encoding a GGPPOR or at least two endogenous nucleic acids encoding a GGPPOR.

Nucleic acids which are preferably used in the above-described preferred embodiment are nucleic acids which encode proteins comprising the amino acid sequence SEQ. ID. NO. 18 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which have at least 30% identity, preferably at least 50% identity, more preferably at least 70% identity, more preferably at least 90% identity, most preferably at least 95% identity with the sequence SEQ. ID. NO. 18 at the amino acid level and which have the enzymatic property of a GGPPOR.

The sequence SEQ. ID. NO. 18 constitutes the amino acid sequence of the Nicotiana tabacum GGPPOR.

Accordingly, a protein which has at least 30% identity with the sequence SEQ. ID. NO. 18 at the amino acid level is understood as meaning a protein which, upon alignment of its sequence with the sequence SEQ. ID. NO. 18, in particular using the above program algorithm with the above parameter set, has at least 30% identity.

Further examples of GGPPOR and GGPPOR genes can be found easily from a variety of organisms whose genomic sequence is known by homology comparisons of the amino acid sequences or of the corresponding backtranslated nucleic acid sequences from databases with SEQ ID. NO. 18.

For example, the Arabidopsis thaliana GGPPOR has 80% identity with the Nicotiana tabacum GGPPOR (SEQ. ID. No. 18).

Further examples of GGPPOR and GGPPOR genes can furthermore be found easily, for example starting from the sequence SEQ. ID. No. 17 in various organisms whose genomic sequence is not known, using hybridization and PCR techniques in a manner known per se.

In a further especially preferred embodiment, the geranylgeranyl-pyrophosphate oxidoreductase activity is increased by introducing, into organisms, nucleic acids which encode proteins comprising the amino acid sequence of the Nicotiana tabacum GGPPOR (SEQ. ID. NO. 18).

Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence in accordance with the genetic code.

Codons which are preferably used for this purpose are those which are used frequently in accordance with the organism-specific codon usage. The codon usage can be determined readily with the aid of computer evaluations of other, known genes of the organisms in question.

If, for example, the protein is to be expressed in plants, it is frequently advantageous to use the codon usage of the plant in the backtranslation.

In an especially preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 17 is introduced into the organism.

The sequence SEQ. ID. NO. 17 constitutes the genomic DNA of Nicotiana tabacum which encodes the GGPPOR of the sequence SEQ. ID. NO. 18.

Furthermore, all of the abovementioned GGPPOR genes can be synthesized chemically, in a manner known per se, from the nucleotide units such as, for example, by fragment condensation of individual overlapping complementary nucleic acid units of the double helix. The chemical synthesis of oligonucleotides can be carried out for example in the known manner by the phosphoamidite method (Voet, Voet, 2nd Edition, Wiley Press New York, pages 896-897). The addition of synthetic oligonucleotides and the filling-in of gaps with the aid of the Klenow fragment of the DNA polymerase and ligation reactions and general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

In a preferred embodiment, the increase in gene expression of a nucleic acid encoding a 2-methyl-6-phytylhydroquinone methyltransferase, hereinbelow also termed MT1, is effected by introducing, into the organism, at least one nucleic acid encoding an MT1.

In principle, any MT1 gene, that is to say any nucleic acid which encodes an MT1, can be used for this purpose.

In the case of genomic MT1 nucleic acid sequences from eukaryotic sources, which comprise introns, it is preferred to use nucleic acid sequences which have already been processed, such as the corresponding cDNAs, in the event that the host organism is not capable, or cannot be made capable, of expressing the MT1 in question.

Examples of MT1 genes are nucleic acids encoding a Synechocystis sp. PCC6803 MT1 (nucleic acid: Seq. ID. No. 19, protein: Seq. ID. No. 20).

In this preferred embodiment, at least one further MT1 gene is thus present in the transgenic organisms according to the invention compared with the wild type. In this preferred embodiment, the organism, accordingly, has at least one exogenous nucleic acid encoding an MT1 or at least two endogenous nucleic acids encoding an MT1.

Nucleic acids which are preferably used in the above-described preferred embodiment are nucleic acids which encode proteins comprising the amino acid sequence SEQ. ID. NO. 20 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which have at least 30% identity, preferably at least 50% identity, more preferably at least 70% identity, more preferably at least 90% identity, most preferably at least 95% identity with the sequence SEQ. ID. NO. 20 at the amino acid level and which have the enzymatic property of an MT1.

The sequence SEQ. ID. NO. 20 constitutes the amino acid sequence of the Synechocystis sp. PCC6803 MT1.

Accordingly, a protein which has at least 30% identity with the sequence SEQ. ID. NO. 20 at the amino acid level is understood as meaning a protein which, upon alignment of its sequence with the sequence SEQ. ID. NO. 20, in particular using the above program algorithm with the above parameter set, has at least 30% identity.

Further examples of MT1 and MT1 genes can be found easily from a variety of organisms whose genomic sequence is known by homology comparisons of the amino acid sequences or of the corresponding backtranslated nucleic acid sequences from databases with SEQ ID. NO. 20.

Further examples of MT1 and MT1 genes can furthermore be found easily, for example starting from the sequence SEQ. ID. No. 19 in various organisms whose genomic sequence is not known, using hybridization and PCR techniques in a manner known per se.

In a further especially preferred embodiment, the 2-methyl-6-phytylhydroquinone methyltransferase activity is increased by introducing, into organisms, nucleic acids which encode proteins comprising the amino acid sequence of the Synechocystis sp. PCC6803 MT1 (SEQ. ID. NO. 20).

Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence in accordance with the genetic code.

Codons which are preferably used for this purpose are those which are used frequently in accordance with the organism-specific codon usage. The codon usage can be determined readily with the aid of computer evaluations of other, known genes of the organisms in question.

If, for example, the protein is to be expressed in plants, it is frequently advantageous to use the codon usage of the plant in the backtranslation.

In an especially preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 19 is introduced into the organism.

The sequence SEQ. ID. NO. 19 constitutes the genomic DNA from Synechocystis sp. PCC6803, which encodes the MT1 of the sequence SEQ. ID. NO. 20.

Furthermore, all of the abovementioned MT1 genes can be synthesized chemically, in a manner known per se, from the nucleotide units such as, for example, by fragment condensation of individual overlapping complementary nucleic acid units of the double helix. The chemical synthesis of oligonucleotides can be carried out for example in the known manner by the phosphoamidite method (Voet, Voet, 2nd Edition, Wiley Press New York, pages 896-897). The addition of synthetic oligonucleotides and the filling-in of gaps with the aid of the Klenow fragment of the DNA polymerase and ligation reactions and general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

In a preferred embodiment, the increase in gene expression of a nucleic acid encoding a tocopherol cyclase, hereinbelow also termed CYC, is effected by introducing, into the organism, at least one nucleic acid encoding a CYC.

In principle, any CYC gene, that is to say any nucleic acid which encodes a CYC, can be used for this purpose.

In the case of genomic CYC nucleic acid sequences from eukaryotic sources, which comprise introns, it is preferred to use nucleic acid sequences which have already been processed, such as the corresponding cDNAs, in the event that the host organism is not capable, or cannot be made capable, of expressing the CYC in question.

Examples of CYC genes are nucleic acids encoding a Synechocystis sp. PCC6803 CYC (nucleic acid: Seq. ID. No. 21, protein: Seq. ID. No. 22) or nucleic acids encoding a Glycine max, Helianthus annuus, Nicotiana tabacum, Physcomitrella patens, Brassica napus, Oryza sativa, Arabidopsis thaliana or Hordeum vulgaris CYC.

In this preferred embodiment, at least one further CYC gene is thus present in the transgenic organisms according to the invention compared with the wild type. In this preferred embodiment, the organism, accordingly, has at least one exogenous nucleic acid encoding a CYC or at least two endogenous nucleic acids encoding a CYC.

Nucleic acids which are preferably used in the above-described preferred embodiment are nucleic acids which encode proteins comprising the amino acid sequence SEQ. ID. NO. 22 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which have at least 30% identity, preferably at least 50% identity, more preferably at least 70% identity, more preferably at least 90% identity, most preferably at least 95% identity with the sequence SEQ. ID. NO. 22 at the amino acid level and which have the enzymatic property of a CYC.

The sequence SEQ. ID. NO. 22 constitutes the amino acid sequence of the Synechocystis sp. PCC6803 CYC.

Accordingly, a protein which has at least 30% identity with the sequence SEQ. ID. No. 22 at the amino acid level is understood as meaning a protein which, upon alignment of its sequence with the sequence SEQ. ID. NO. 22, in particular using the above program algorithm with the above parameter set, has at least 30% identity.

Further examples of CYC and CYC genes can be found easily from a variety of organisms whose genomic sequence is known by homology comparisons of the amino acid sequences or of the corresponding backtranslated nucleic acid sequences from databases with SEQ ID. NO. 22.

For example, the Arabidopsis thaliana CYC has 29.1% identity with the Synechocystis sp. PCC6803 CYC (SEQ. ID. No. 22).

Further examples of CYC and CYC genes can furthermore be found easily, for example starting from the sequence SEQ. ID. No. 21 in various organisms whose genomic sequence is not known, using hybridization and PCR techniques in a manner known per se.

In a further especially preferred embodiment, the tocopherol cyclase activity is increased by introducing, into organisms, nucleic acids which encode proteins comprising the amino acid sequence of the Synechocystis sp. PCC6803 CYC (SEQ. ID. NO. 22).

Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence in accordance with the genetic code.

Codons which are preferably used for this purpose are those which are used frequently in accordance with the organism-specific codon usage. The codon usage can be determined readily with the aid of computer evaluations of other, known genes of the organisms in question.

If, for example, the protein is to be expressed in plants, it is frequently advantageous to use the codon usage of the plant in the backtranslation.

In an especially preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 21 is introduced into the organism.

The sequence SEQ. ID. NO. 21 constitutes the genomic DNA of Synechocystis sp. PCC6803 which encodes the CYC of the sequence SEQ. ID. NO. 22.

Furthermore, all of the abovementioned CYC genes can be synthesized chemically, in a manner known per se, from the nucleotide units such as, for example, by fragment condensation of individual overlapping complementary nucleic acid units of the double helix. The chemical synthesis of oligonucleotides can be carried out for example in the known manner by the phosphoamidite method (Voet, Voet, 2nd Edition, Wiley Press New York, pages 896-897). The addition of synthetic oligonucleotides and the filling-in of gaps with the aid of the Klenow fragment of the DNA polymerase and ligation reactions and general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

In a preferred embodiment, the increase in gene expression of a nucleic acid encoding a γ-tocopherol methyltransferase, hereinbelow also termed γ-TMT, is effected by introducing, into the organism, at least one nucleic acid encoding a γ-TMT.

In principle, any γ-TMT gene, that is to say any nucleic acid which encodes a γ-TMT, can be used for this purpose.

In the case of genomic γ-TMT nucleic acid sequences from eukaryotic sources, which comprise introns, it is preferred to use nucleic acid sequences which have already been processed, such as the corresponding cDNAs, in the event that the host organism is not capable, or cannot be made capable, of expressing the γ-TMT in question.

Examples of γ-TMT genes are nucleic acids encoding an Arabidopsis thaliana γ-TMT (nucleic acid: Seq. ID. No. 23, protein: Seq. ID. No. 24) or nucleic acids encoding a Glycine max, Helianthus annuus, Nicotiana tabacum, Physcomitrella patens, Brassica napus, Oryza sativa, Hordeum vulgaris or Synechocystis sp. PCC6803 γ-TMT.

In this preferred embodiment, at least one further γ-TMT gene is thus present in the transgenic organisms according to the invention compared with the wild type. In this preferred embodiment, the organism, accordingly, has at least one exogenous nucleic acid encoding a γ-TMT or at least two endogenous nucleic acids encoding a γ-TMT.

Nucleic acids which are preferably used in the above-described preferred embodiment are nucleic acids which encode proteins comprising the amino acid sequence SEQ. ID. NO. 24 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids which have at least 30% identity, preferably at least 50% identity, more preferably at least 70% identity, more preferably at least 90% identity, most preferably at least 95% identity with the sequence SEQ. ID. NO. 24 at the amino acid level and which have the enzymatic property of a γ-TMT.

The sequence SEQ. ID. NO. 24 constitutes the amino acid sequence of the Arabidopsis thaliana γ-TMT.

Accordingly, a protein which has at least 30% identity with the sequence SEQ. ID. NO. 24 at the amino acid level is understood as meaning a protein which, upon alignment of its sequence with the sequence SEQ. ID. No. 24, in particular using the above program algorithm with the above parameter set, has at least 30% identity.

Further examples of γ-TMT and γ-TMT genes can be found easily from a variety of organisms whose genomic sequence is known by homology comparisons of the amino acid sequences or of the corresponding backtranslated nucleic acid sequences from databases with SEQ ID. NO. 24.

For example, the Synechocystis sp. PCC6803 γ-TMT has 26.7% identity with the Arabidopsis thaliana γ-TMT (SEQ. ID. No. 24).

Further examples of γ-TMT and γ-TMT genes can furthermore be found easily, for example starting from the sequence SEQ. ID. No. 23 in various organisms whose genomic sequence is not known, using hybridization and PCR techniques in a manner known per se.

In a further especially preferred embodiment, the γ-tocopherol methyltransferase activity is increased by introducing, into organisms, nucleic acids which encode proteins comprising the amino acid sequence of the Arabidopsis thaliana γ-TMT (SEQ. ID. NO. 24).

Suitable nucleic acid sequences can be obtained, for example, by backtranslating the polypeptide sequence in accordance with the genetic code.

Codons which are preferably used for this purpose are those which are used frequently in accordance with the organism-specific codon usage. The codon usage can be determined readily with the aid of computer evaluations of other, known genes of the organisms in question.

If, for example, the protein is to be expressed in plants, it is frequently advantageous to use the codon usage of the plant in the backtranslation.

In an especially preferred embodiment, a nucleic acid comprising the sequence SEQ. ID. NO. 23 is introduced into the organism.

The sequence SEQ. ID. NO. 23 constitutes the genomic DNA of A. thaliana which encodes the γ-TMT of the sequence SEQ. ID. NO. 24.

Furthermore, all of the abovementioned γ-TMT genes can be synthesized chemically, in a manner known per se, from the nucleotide units such as, for example, by fragment condensation of individual overlapping complementary nucleic acid units of the double helix. The chemical synthesis of oligonucleotides can be carried out for example in the known manner by the phosphoamidite method (Voet, Voet, 2nd Edition, Wiley Press New York, pages 896-897). The addition of synthetic oligonucleotides and the filling-in of gaps with the aid of the Klenow fragment of the DNA polymerase and ligation reactions and general cloning methods are described in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

In a further preferred embodiment of the process, the organisms additionally have a reduced activity of at least one of the activities selected from the group consisting of homogentisate dioxygenase activity, maleylacetoacetate isomerase activity and fumarylacetoacetate hydrolase activity which is reduced in comparison with the wild type.

A reduced activity is understood as meaning both the reduced and the complete elimination of the activity. Accordingly, a reduced activity also encompasses a quantitative reduction of the protein in question in the organism down to a complete absence of the protein in question, which can be tested, for example, by a lacking detectability of the enzyme activity in question or by a lacking immunological detectability of the proteins in question.

Homogentisate dioxygenase activity is understood as meaning the enzyme activity of a homogentisate dioxygenase.

A homogentisate dioxygenase is understood as meaning a protein which has the enzymatic activity of converting homogentisate into maleylacetoacetate.

Accordingly, homogentisate dioxygenase activity is understood as meaning the amount of homogentisate converted, or the amount of maleylacetoacetate produced, by the protein homogentisate dioxygenase in a specific time.

Thus, a reduced homogentisate dioxygenase activity in comparison with the wild type is understood as meaning the amount of homogentisate converted, or the amount of maleylacetoacetate produced, by the protein homogentisate dioxygenase within a certain time compared with the wild type.

Preferably, this reduction in the homogentisate dioxygenase activity amounts to at least 5%, more preferably to at least 20%, more preferably to at least 50%, more preferably to 100%. Especially preferred is the complete elimination of the homogentisate dioxygenase activity.

Maleylacetoacetate isomerase activity is understood as meaning the enzyme activity of a maleylacetoacetate isomerase.

A maleylacetoacetate isomerase is understood as meaning a protein which has the enzymatic activity of converting maleyl acetoacetate into fumarylacetoacetate.

Accordingly, maleylacetoacetate isomerase activity is understood as meaning the amount of maleylacetoacetate converted, or the amount of fumarylacetoacetate produced, by the protein maleylacetoacetate isomerase in a specific time.

Thus, a reduced maleylacetoacetate isomerase activity in comparison with the wild type is understood as meaning the amount of maleylacetoacetate converted, or the amount of fumarylacetoacetate produced, by the protein maleylacetoacetate isomerase within a certain time compared with the wild type.

Preferably, this reduction in the maleylacetoacetate isomerase activity amounts to at least 5%, more preferably to at least 20%, more preferably to at least 50%, more preferably to 100%. Especially preferred is the complete elimination of the maleylacetoacetate isomerase activity.

Fumarylacetoacetate hydrolase activity is understood as meaning the enzyme activity of a fumarylacetoacetate hydrolase.

A fumarylacetoacetate hydrolase is understood as meaning a protein which has the enzymatic activity of converting fumarylacetoacetate into fumarate.

Accordingly, fumarylacetoacetate hydrolase activity is understood as meaning the amount of fumarylacetoacetate converted, or the amount of fumerate produced, by the protein fumarylacetoacetate hydrolase in a specific time.

Thus, a reduced fumarylacetoacetate hydrolase activity in comparison with the wild type is understood as meaning the amount of fumarylacetoacetate converted, or the amount of fumarate produced, by the protein fumarylacetoacetate hydrolase within a certain time compared with the wild type.

Preferably, this reduction in the fumarylacetoacetate hydrolase activity amounts to at least 5%, more preferably to at least 20%, more preferably to at least 50%, more preferably to 100%. Especially preferred is the complete elimination of the fumarylacetoacetate hydrolase activity.

Homogentisate dioxygenase is hereinbelow also termed HGD, maleylacetoacetate isomerase is hereinbelow also termed MAAI, and fumarylacetoacetate hydrolase is hereinbelow also termed FAAH.

There exist many different ways of reducing the HGD, MAAI and/or FAAH activities in the desired manner.

One possible method encompasses the use of at least one nucleic acid sequence, hereinbelow also termed anti-HGD, anti-MAAI or anti-FAAH, which can be transcribed into an antisense nucleic acid sequence which is capable of inhibiting the HGD, MAAI and/or FAAH activity, for example by inhibiting the expression of endogenous HGD, MAAI and/or FAAH.

In accordance with a preferred embodiment, these anti-HGD, anti-MAAI or anti-FAAH nucleic acid sequences can comprise the encoding nucleic acid sequences of HGD, MAAI and/or FAAH or functionally equivalent fragments of the respective sequences in antisense orientation.

The antisense strategy can advantageously be combined with a ribozyme method. Ribozymes are catalytically active RNA sequences which, coupled to the antisense sequences, catalytically cleave the target sequences (Tanner N K. FEMS Microbiol Rev. 1999; 23(3):257-75). This can increase the efficacy of an antisense strategy.

Further methods of reducing the HGD, MAAI and/or FAAH expression, in particular in plants as organisms, comprise the overexpression of homologous HGD, MAAI and/or FAAH nucleic acid sequences which lead to cosuppression (Jorgensen et al., Plant Mol. Biol. 1996, 31(5):957-973) or the induction of the specific RNA degradation by the plant with the aid of a viral expression system (amplicon) (Angell, SM et al., Plant J. 1999, 20(3):357-362). These methods are also termed post-transcriptional gene silencing (PTGS).

Further methods are the introduction of nonsense mutations into the endogen by introducing RNA/DNA oligonucleotides into the plant (Zhu et al., Nat. Biotechnol. 2000, 18(5):555-558) or the generation of knock-out mutants with the aid of, for example, T-DNA mutagenesis (Koncz et al., Plant Mol. Biol. 1992, 20(5):963-976) or homologous recombination (Hohn, B. and Puchta, H, Proc. Natl. Acad. Sci. USA. 1999, 96:8321-8323.). Furthermore, gene overexpression or gene repression with specific DNA-binding factors, for example with the abovementioned factors of the zinc-finger transcription factor type is also possible. Furthermore, it is possible to introduce, into a cell, factors which inhibit the target protein itself. The protein-binding factors can be, for example, aptamers (Famulok M, and Mayer G. Curr Top Microbiol Immunol. 1999; 243:123-36).

A further method of reducing at least one of the above-described activities is the use of RNA which contains a region with duplex structure and, within this region, contains a nucleic acid sequence which is identical to part of the target sequence to be reduced. A detailed description of this method, also referred to as RNAi technology, is disclosed in WO 99/32619.

In a preferred embodiment, the additional reduction of at least one of the activities selected from the group consisting of HGD, MAAI and FAAH activity is effected by reducing the gene expression of at least one nucleic acid selected from the group consisting of the nucleic acids encoding a homogentisate dioxygenase, nucleic acids encoding a maleylacetoacetate isomerase and nucleic acids encoding a fumarylacetoacetate hydrolase in comparison with the wild type.

A reduction of the gene expression of at least one nucleic acid selected from the group consisting of the nucleic acids encoding a homogentisate dioxygenase, nucleic acids encoding a maleylacetoacetate isomerase and nucleic acids encoding a fumarylacetoacetate hydrolase in comparison with the wild type can be achieved as described above, preferably by using the following methods:

  • a) introducing antisense nucleic acid sequences;
  • b) introducing antisense nucleic acid sequences in combination with a ribozyme method
  • c) introducing nucleic acid sequences which encode homologous HGDs, MAAIs and/or FAAHs and which lead to cosuppression
  • d) introduction of expression constructs and viral nucleic acid sequences which bring about the degradation of HGDs, MAAIs and/or FAAHs;
  • e) introduction of nonsense mutants of endogenous nucleic acid sequences encoding HGDs, MAAIs and/or FAAHs;
  • f) introduction of knock-out mutants;
  • g) introduction of nucleic acid sequences suitable for homologous recombination;
  • h) introduction of RNA which contains a region with duplex structure and within this region contains a nucleic acid sequence which is identical to part of the endogenous target nucleic acid sequence.

A combined application of the above-described methods is also feasible.

In an especially preferred embodiment of the process, the organisms have a reduced homogentisate dioxygenase activity.

This is especially preferably achieved by introducing, into the organism, an RNA which contains a region with duplex structure and, within this region, contains a nucleic acid sequence which is identical to part of the endogenous nucleic acid encoding a homogentisate dioxygenase. A detailed description of this method, also referred to as RNAi technology, is disclosed in WO 99/32619.

Depending on the organism used, a different part-fragment of the endogenous nucleic acid encoding a homogentisate dioxygenase is to be used, accordingly.

For example, SEQ. ID. No. 25 constitutes a part-fragment of the HGD-encoding nucleic acid from Brassica napus which, integrated into a suitable RNAi construct, reduces the HGD activity in Brassica napus.

In further preferred embodiments of the process according to the invention, vitamin E is produced by growing organisms, in particular plants, which, in comparison with the wild type, show

an increased tyrosine aminotransferase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased homogentisate phytyltransferase activity,

an increased tyrosine aminotransferase activity and an increased geranylgeranyl-pyrophosphate oxidoreductase activity,

an increased tyrosine aminotransferase activity and an increased 2-methyl-6-phytylhydroquinone methyltransferase activity,

an increased tyrosine aminotransferase activity and an increased tocopherol cyclase activity,

an increased tyrosine aminotransferase activity and an increased γ-tocopherol methyltransferase activity,

an increased tyrosine aminotransferase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and a reduced maleylacetoacetate isomerase activity,

an increased tyrosine aminotransferase activity and a reduced fumarylacetoacetate hydrolase activity,

an increased tyrosine aminotransferase activity, an increased hydroxyphenylpyruvate dioxygenase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased homogentisate phytyltransferase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased geranylgeranyl-pyrophosphate oxidoreductase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased 2-methyl-6-phytylhydroquinone methyltransferase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased tocopherol cyclase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased γ-tocopherol methyltransferase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and a homogentisate phytyltransferase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and an increased geranylgeranyl-pyrophosphate oxidoreductase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and a 2-methyl-6-phytylhydroquinone methyltransferase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and an increased tocopherol cyclase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and an increased γ-tocopherol methyltransferase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and an increased homogentisate phytyltransferase activity and an increased geranylgeranyl-pyrophosphate oxidoreductase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and an increased homogentisate phytyltransferase activity and an increased 2-methyl-6-phytylhydroquinone methyltransferase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and an increased homogentisate phytyltransferase activity and an increased tocopherol cyclase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and an increased homogentisate phytyltransferase activity and an increased γ-tocopherol methyltransferase and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and an increased homogentisate phytyltransferase activity and an increased geranylgeranyl-pyrophosphate oxidoreductase activity and an increased 2-methyl-6-phytylhydroquinone methyltransferase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and an increased homogentisate phytyltransferase activity and an increased geranylgeranyl-pyrophosphate oxidoreductase activity, an increased tocopherol cyclase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity, an increased homogentisate phytyltransferase activity and an increased geranylgeranyl-pyrophosphate oxidoreductase activity and an increased γ-tocopherol methyltransferase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and an increased homogentisate phytyltransferase activity and an increased geranylgeranyl-pyrophosphate oxidoreductase activity and an increased 2-methyl-6-phytylhydroquinone methyltransferase activity and an increased tocopherol cyclase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and an increased homogentisate phytyltransferase activity and an increased geranylgeranyl-pyrophosphate oxidoreductase activity, and an increased 2-methyl-6-phytylhydroquinone methyltransferase activity and an increased γ-tocopherol methyltransferase activity and a reduced homogentisate dioxygenase activity,

an increased tyrosine aminotransferase activity and an increased hydroxyphenylpyruvate dioxygenase activity and an increased homogentisate phytyltransferase activity and an increased geranylgeranyl-pyrophosphate oxidoreductase activity and an increased 2-methyl-6-phytylhydroquinone methyltransferase activity and an increased tocopherol cyclase activity, and an increased γ-tocopherol methyltransferase and a reduced homogentisate dioxygenase activity.

Organisms are understood as meaning, in accordance with the invention, prokaryotic organisms or eukaryotic organisms such as, for example, bacteria, yeast, algae, mosses, fungi or plants, which, as the wild type or owing to genetic modification, are capable of producing vitamin E. Preferred organisms are photosynthetically active organisms such as, for example, cyanobacteria, mosses, algae or plants, who as wild type are already capable of producing vitamin E.

Especially Preferred Organisms are Plants.

Preferred plants are Tagetes, sunflower, Arabidopsis, tobacco, red pepper, soybean, tomato, eggplant, capsicum, carrot, potato, maize, lettuces and cabbage species, cereals, alfalfa, oats, barley, rye, wheat, triticale, sorghum and millet, rice, lucerne, flax, cotton, hemp, Brassicaceae such as, for example, oilseed rape or canola, sugar beet, sugar cane, nut and grapevine species, or woody species such as, for example, aspen or yew.

Especially preferred are Arabidopsis thaliana, Tagetes erecta, Brassica napus, Nicotiana tabacum, sunflower, canola, potato or soybean.

In the process according to the invention for the production of vitamin E, the step in which the genetically modified organisms, hereinbelow also termed transgenic organisms, are grown is preferably followed by harvesting the organisms and isolating vitamin E from the organisms.

The organisms are harvested in a manner known per se to suit the organism in question. Microorganisms such as bacteria, mosses, yeasts and fungi or plant cells, which can be grown by fermentation in liquid media, can be separated, for example, by centrifugation, decanting or filtration. Plants are grown on media in a manner known per se and harvested in a suitable fashion.

Vitamin E is isolated from the harvested biomass in a manner known per se, for example by extraction and, if appropriate, further chemical or physical purification processes such as, for example, precipitation methods, crystallography, thermal separation methods, such as rectification methods, or physical separation methods such as, for example, chromatography.

Vitamin E is isolated from oil-containing plants, for example, preferably by chemical conversion and distillation from vegetable oils or from the steam distillates obtained in the deodorization of vegetable oils (deodorizer condensates).

Further methods of isolating vitamin E from deodorizer condensates are described, for example, in DE 31 26 110 A1, EP 171 009 A2, GB 2 145 079, EP 333 472 A2 and WO 94/05650.

The transgenic organisms, in particular plants, are preferably generated by transformation of the starting organisms, in particular plants, with a nucleic acid construct comprising the above-described nucleic acids encoding a tyrosine aminotransferase which are linked operably to one or more regulatory signals which ensure the transcription and translation in organisms.

Preferably, the nucleic acid constructs according to the invention additionally comprise one, two or three nucleic acids selected from the group consisting of nucleic acids encoding a hydroxyphenylpyruvate dioxygenase, nucleic acids encoding a homogentisate phytyltransferase, nucleic acids encoding a geranylgeranyl-pyrophosphate oxidoreductase, nucleic acids encoding a 2-methyl-6-phytylhydroquinone methyltransferase, nucleic acids encoding a tocopherol cyclase and nucleic acids encoding a γ-tocopherol methyltransferase which are linked operably to one or more regulatory signals which ensure the transcription and translation in organisms.

In a further preferred embodiment, the above-described nucleic acid constructs additionally comprise, in operable linkage, an RNA which has a region with duplex structure and within this region has a nucleic acid sequence which is identical to part of a nucleic acid encoding a homogentisate dioxygenase.

In plants, in particular, it is technically difficult to increase or to reduce more than four activities with one nucleic acid construct. This is why it is preferred to use combinations of nucleic acid constructs in order to increase or reduce the activities, in particular to increase or reduce more than four activities, in the organism.

However, it is also possible to hybridize genetically modified organisms which already comprise modified activities. For example, hybridizing genetically modified organisms which comprise in each case two modified activities makes it possible to generate organisms with four modified activities. The same can also be achieved by introducing, into the organism, a combination of two nucleic acid constructs, each of which modifies 2 activities.

In a preferred embodiment, the preferred genetically modified organisms are generated by introducing combinations of nucleic acid constructs.

Accordingly, the invention relates in particular to a combination of nucleic acid constructs, where the combination encompasses a nucleic acid construct comprising the above-described nucleic acids encoding a tyrosine aminotransferase in operable linkage with one or more regulatory signals which ensure the transcription and translation in organisms, and

  • a) at least one further nucleic acid construct selected from the group consisting of A to F
  • A nucleic acid construct comprising nucleic acids encoding a hydroxyphenylpyruvate dioxygenase which are linked operably to one or more regulatory signals which ensure the transcription and translation in organisms,
  • B nucleic acid construct comprising nucleic acids encoding a homogentisate phytyltransferase which are linked operably to one or more regulatory signals which ensure the transcription and translation in organisms,
  • C nucleic acid construct comprising nucleic acids encoding a geranylgeranyl-pyrophosphate oxidoreductase which are linked operably to one or more regulatory signals which ensure the transcription and translation in organisms,
  • D nucleic acid construct comprising nucleic acids encoding a 2-methyl-6-phytylhydroquinone methyltransferase which are linked operably to one or more regulatory signals which ensure the transcription and translation in organisms,
  • E nucleic acid construct comprising nucleic acids encoding a tocopherol cyclase which are linked operably to one or more regulatory signals which ensure the transcription and translation in organisms, and
  • F nucleic acid construct comprising nucleic acids encoding a γ-tocopherol methyltransferase which are linked operably to one or more regulatory signals which ensure the transcription and translation in organisms,
    or
  • b) at least one further nucleic acid construct comprising two, three or four nucleic acid constructs selected from the group consisting of the nucleic acid constructs A to F.

These nucleic acid constructs in which the encoding nucleic acid sequences are linked operably to one or more regulatory signals which ensure the transcription and translation in organisms, in particular in plants, are also termed expression cassettes hereinbelow.

Accordingly, the invention furthermore relates to nucleic acid constructs, in particular nucleic acid constructs which act as expression cassettes, comprising a nucleic acid encoding a tyrosine aminotransferase which is linked operably to one or more regulatory signals which ensure the transcription and translation in organisms, in particular in plants.

The regulatory signals preferably comprise one or more promoters which ensure the transcription and translation in organisms, in particular in plants.

The expression cassettes comprise regulatory signals, i.e. regulatory nucleic acid sequences, which govern the expression of the coding sequence in the host cell. In accordance with a preferred embodiment, an expression cassette comprises upstream, i.e. at the 5′-end of the coding sequence, a promoter and downstream, i.e. at the 3′-end, a polyadenylation signal and, if appropriate, further regulatory elements which are linked operably to the interposed coding sequence for at least one of the above-described genes. Operable linkage is understood as meaning the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can, upon expression of the coding sequence, fulfill its function as intended.

When using plants as the organism, the nucleic acid constructs and expression cassettes according to the invention preferably comprise a nucleic acid encoding a plastid transit peptide which ensures localization in plastids.

The following text will describe examples of the preferred nucleic acid constructs, expression cassettes and vectors for plants and methods for generating transgenic plants as well as the transgenic plants themselves.

The sequences preferred for operable linkage, but not limited thereto, are targeting sequences for ensuring subcellular localization in the apoplasts, in the vacuole, in plastids, in the mitochondrion, in the endoplasmic reticulum (ER), in the nucleus, in elaioplasts, or other compartments and translation enhancers such as the tobacco mosaic virus 5′-leader sequence (Gallie et al., Nucl. Acids Res. 15 (1987), 8693-8711).

Suitable promoters in the expression cassette are, in principle, all promoters which are capable of controlling the expression of foreign genes in plants. It is preferable to use in particular a plant promoter or a promoter derived from a plant virus. Especially preferred is the cauliflower mosaic virus CaMV 35S promoter (Franck et al., Cell 21 (1980), 285-294). As is known, this promoter comprises different recognition sequences for transcriptional effectors which, in their totality, lead to permanent and constitutive expression of the gene which has been introduced (Benfey et al., EMBO J. 8 (1989), 2195-2202).

The expression cassette may also comprise a chemically inducible promoter, by means of which the expression of the target gene in the plant can be controlled at a particular point in time. Examples of such promoters which can be used are the PRP1 promoter (Ward et al., Plant. Mol. Biol. 22 (1993), 361-366), a salicylic-acid-inducible promoter (WO 95/19443), a benzenesulfonamide-inducible promoter (EP-A 388186), a tetracycline-inducible promoter (Gatz et al., (1992) Plant J. 2, 397-404), an abscisic-acid-inducible promoter (EP-A 335528) or an ethanol- or cyclohexanone-inducible promoter (WO 93/21334).

Further preferred promoters are in particular those which ensure the expression in tissues or plant parts in which, for example, the biosynthesis of vitamin E or its precursors takes place. Promoters which must be mentioned in particular are those which ensure leaf-specific expression. Those to be mentioned are the potato cytosolic FBPase promoter or the potato ST-LSI promoter (Stockhaus et al., EMBO J. 8 (1989), 2445-245).

A foreign protein was expressed stably in an amount of up to 0.67% of the total soluble seed protein in the seeds of transgenic tobacco plants with the aid of a seed-specific promoter (Fiedler and Conrad, Bio/Technology 10 (1995), 1090-1094). The expression cassette can therefore comprise, for example, a seed-specific promoter (preferably the phaseolin promoter (U.S. Pat. No. 5,504,200), the USP promoter (Baumlein, H. et al., Mol. Gen. Genet. (1991) 225 (3), 459-467), the LEB4 promoter (Fiedler and Conrad, 1995), the sucrose binding protein promoter (reference), the LEB4 signal peptide, the gene to be expressed and an ER retention signal.

The biosynthesis site of vitamin E in plants is, inter alia, the leaf tissue, so that leaf-specific expression of the nucleic acids according to the invention encoding a tyrosine aminotransferase makes sense. However, this is not limiting since the expression can also take place in a tissue-specific manner in all the remaining parts of the plant, in particular in fatty seeds.

A further preferred embodiment therefore relates to a seed-specific expression of the above-described nucleic acids.

In addition, a constitutive expression of exogenous target genes is advantageous. On the other hand, however, inducible expression may also be desirable.

The expression efficacy of the recombinantly expressed target genes can be determined, for example, in vitro by shoot-meristem propagation. Moreover, an expression of the target gene, which has been modified with regard to type and level, and its effect on the vitamin E biosynthesis rate may be tested in greenhouse experiments using test plants.

An expression cassette is preferably generated by fusing a suitable promoter to an above-described target nucleic acid and, preferably, to a nucleic acid inserted between promoter and target nucleic acid sequence, which nucleic acid encodes a chloroplast-specific transit peptide, and also to a polyadenylation signal, using customary recombination and cloning techniques as are described, for example, in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in T. J. Silhavy, M. L. Berman and L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, F. M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987).

Especially preferred are inserted nucleic acid sequences which ensure targeting in the plastids.

However, it is also possible to use expression cassettes whose nucleic acid sequence encodes a target protein fusion protein, one moiety of the fusion protein being a transit peptide which governs the translocation of the polypeptide. Preferred are chloroplast-specific transit peptides, which, after translocation of the target protein into the chloroplasts, are cleaved enzymatically from the target protein moiety.

Especially preferred is the transit peptide which is derived from the Nicotiana tabacum plastid transketolase or from another transit peptide (for example the transit peptide of the Rubisco small subunit or of ferredoxin NADP oxidoreductase or else the isopentenyl-pyrophosphate isomerase-2) or its functional equivalent.

Especially preferred are nucleic acid sequences of three cassettes of the plastid transit peptide of the tobacco plastid transketolase in three reading frames as KpnI/BamHI fragments with an ATG codon in the NcoI cleavage site:

pTP09
KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATC
CTCTCTCGTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTC
CCCTTCTTCTCTCACTTTTTCCGGCCTTAAATCCAATCCCAATATCACCA
CCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGG
TCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGA
GACTGCGGGATCC_BamHI
pTP10
KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATC
CTCTCTCGTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTC
CCCTTCTTCTCTCACTTTTTCCGGCCTTAAATCCAATCCCAATATCACCA
CCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGG
TCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGA
GACTGCGCTGGATCC_BamHI
pTP11
KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGCTATC
CTCTCTCGTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTCTCAACTTTC
CCCTTCTTCTCTCACTTTTTCCGGCCTTAAATCCAATCCCAATATCACCA
CCTCCCGCCGCCGTACTCCTTCCTCCGCCGCCGCCGCCGCCGTCGTAAGG
TCACCGGCGATTCGTGCCTCAGCTGCAACCGAAACCATAGAGAAAACTGA
GACTGCGGGGATCC_BamHI

A further example of a plastid transit peptide is the transit peptide of the Arabidopsis thaliana plastid isopentenyl-pyrophosphate isomerase-2 (IPP-2).

The nucleic acids according to the invention can have been prepared synthetically or obtained naturally or comprise a mixture of synthetic and natural nucleic acid constituents or else be composed of various heterologous gene segments of various organisms.

Preferred are, as described above, synthetic nucleotide sequences with codons which are preferred by plants. These codons which are preferred by plants can be determined from codons with the highest protein frequency which are expressed in most of the plant species of interest.

When preparing an expression cassette, it is possible to manipulate various DNA fragments in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame. To connect the DNA fragments to each other, adapters or linkers may be attached to the fragments.

The promoter and the terminator regions can expediently be provided, in the direction of transcription, with a linker or polylinker comprising one or more restriction sites for inserting this sequence. As a rule, the linker has 1 to 10, in most cases 1 to 8, preferably 2 to 6, restriction sites. In general, the linker within the regulatory regions has a size of less than 100 bp, frequently less than 60 bp, but at least 5 bp. The promoter can be either native, or homologous, or else foreign, or heterologous, relative to the host plant. The expression cassette preferably comprises, in the 5′-3′ direction of transcription, the promoter, a coding nucleic acid sequence or a nucleic acid construct and a region for transcriptional termination. Various termination regions can be exchanged for each other as desired.

Furthermore, manipulations can be employed which provide suitable restriction cleavage sites or which remove excess DNA or restriction cleavage sites. Where insertions, deletions or substitutions such as, for example, transitions and transversions, are suitable, in-vitro mutagenesis, primer repair, restriction or ligation can be used.

In the case of suitable manipulations, such as, for example, restrictions, chewing-back or filling in overhangs for blunt ends, complementary ends of the fragments can be provided for ligation.

Preferred polyadenylation signals are plant polyadenylation signals, preferably those which essentially correspond to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular of gene 3 of the T-DNA (octopine synthase) of the Ti plasmid pTiACH5 (Gielen et al., EMBO J. 3 (1984), 835 et seq.) or functional equivalents.

The invention furthermore relates to the use of the above-described nucleic acids encoding a tyrosine aminotransferase or of the above-described nucleic acid constructs or of tyrosine aminotransferase for generating transgenic organisms, in particular plants.

Preferably, these transgenic plants have a vitamin E content which is increased in comparison with the wild type.

The invention therefore furthermore relates to the use of the nucleic acids according to the invention or of the nucleic acid constructs according to the invention for increasing the vitamin E content in organisms whose wild type is capable of producing vitamin E.

It is known that plants with a high vitamin E content have an increased resistance to abiotic stress. Abiotic stress is understood as meaning, for example, low temperatures, frost, drought, high temperatures and salinity.

The invention therefore furthermore relates to the use of the nucleic acids according to the invention for generating transgenic plants which have an increased resistance to abiotic stress in comparison with the wild type.

The above-described proteins and nucleic acids can be used for producing fine chemicals in transgenic organisms, preferably for producing vitamin E in transgenic plants.

The transfer of foreign genes into the genome of an organism, in particular of a plant, is termed transformation.

In addition, in plants, in particular, methods known per se for the transformation and regeneration of plants from plant tissues or plant cells can be used for transient or stable transformation.

Suitable methods for the transformation of plants are the protoplast transformation by polyethylene-glycol-induced DNA uptake, the biolistic method with the gene gun—what is known as the particle bombardment method, electroporation, the incubation of dry embryos in DNA-containing solution, microinjection and the above-described Agrobacterium-mediated gene transfer. The abovementioned methods are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S. D. Kung and R. Wu, Academic Press (1993), 128-143 and in Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225.

The construct to be expressed is preferably cloned into a vector which is suitable for the transformation of Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711).

Accordingly, the invention furthermore relates to vectors comprising the above-described nucleic acids, nucleic acid constructs or expression cassettes.

Agrobacteria which have been transformed with an expression cassette can be used in the known manner for transforming plants, for example by bathing scarified leaves or leaf sections in an agrobacterial solution and subsequently growing them in suitable media.

The expression cassette can be employed not only in the plants, but also for the transformation of bacteria, in particular cyanobacteria, mosses, yeasts, filamentous fungi and algae.

For the preferred generation of genetically modified plants, also termed transgenic plants hereinbelow, the fused expression cassette which expresses a tyrosine aminotransferase is cloned into a vector, for example pBin19, which is suitable for the transformation of Agrobacterium tumefaciens.

Agrobacteria which have been transformed with such a vector can then be used in the known fashion for the transformation of plants, in particular crop plants, for example by bathing scarified leaves or leaf sections in an agrobacterial solution and subsequently growing them in suitable media.

The transformation of plants by agrobacteria is known, inter alia, from F. F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S. D. Kung and R. Wu, Academic Press, 1993, pp. 15-38. Transgenic plants which comprise a gene for the expression of a nucleic acid encoding a tyrosine aminotransferase integrated in the expression cassette can be regenerated in a known fashion from the transformed cells of the scarified leaves or leaf sections.

To transform a host plant with a nucleic acid encoding a tyrosine aminotransferase, an expression cassette is incorporated into a recombinant vector in the form of an insertion, the DNA of the vector thereof additionally comprising functional regulatory signals, for example sequences for replication or integration. Suitable vectors are described, inter alia, in “Methods in Plant Molecular Biology and Biotechnology” (CRC Press), Chapter 6/7, pp. 71-119 (1993).

For example, the plant expression cassette can be incorporated into a derivative of the transformation vector pBin-19 with 35S promoter (Bevan, M., Nucleic Acids Research 12: 8711-8721 (1984)).

Using the above-cited recombination and cloning techniques, the expression cassettes can be cloned into suitable vectors which make possible their amplification, for example in E. coli. Examples of suitable cloning vectors are, inter alia, pBR322, pUC series, M13mp series and pACYC184. Especially suitable are binary vectors which are capable of replication both in E. coli and in agrobacteria.

The invention therefore furthermore relates to the use of the above-described nucleic acids, of the above-described nucleic acid constructs, in particular the expression cassettes, for the generation of genetically modified plants or for the transformation of plants, plant cells, plant tissues or plant parts.

The use is preferably aimed at increasing the vitamin E content of the plant or plant parts.

Depending on the choice of the promoter, the expression may take place specifically in the leaves, in the seeds, petals or other parts of the plant.

Accordingly, the invention furthermore relates to a method of generating genetically modified organisms by introducing an above-described nucleic acid or an above-described nucleic acid construct or an above-described combination of nucleic acid constructs into the genome of the starting organism.

The invention furthermore relates to the above-described genetically modified organisms themselves.

As mentioned above, the genetically modified organisms, in particular plants, have an increased vitamin E content.

The increase in the tyrosine aminotransferase activity in the organism to a further effect. Not only is the total vitamin E content increased, but the tocotrienols are additionally selectively increased in comparison with the tocopherols.

Materials used as organisms and for the generation of organisms with an increased fine chemicals content in comparison with the wild type are, in a preferred embodiment, as mentioned above, photosynthetically active organisms such as, for example, cyanobacteria, mosses, algae or plants, especially preferably plants, as starting organisms and, accordingly, also as genetically modified organisms.

Such transgenic plants, their propagation material and their plant cells, plant tissues or plant parts are a further subject of the present invention.

Preferred plants are, as mentioned above, Tagetes, sunflower, Arabidopsis, tobacco, red pepper, soybean, tomato, eggplant, capsicum, carrot, potato, maize, lettuces and cabbage species, cereals, alfalfa, oats, barley, rye, wheat, triticale, sorghum and millet, rice, lucerne, flax, cotton, hemp, Brassicaceae such as, for example, oilseed rape or canola, sugar beet, sugar cane, nut and grapevine species, or woody species such as, for example, aspen or yew.

Especially preferred are Arabidopsis thaliana, Tagetes erecta, Brassica napus, Nicotiana tabacum, sunflower, canola, potato or soybean.

As described above, the genetically modified organisms, in particular plants, can be used for the production of vitamin E.

Genetically modified plants according to the invention with an increased vitamin E content which can be consumed by humans and animals can also be used, for example directly or, following processing known per se, as food or feed, or as feed or food supplements.

The plants which have been genetically modified in accordance with the invention can furthermore be used for the production of vitamin E-containing extracts.

Increasing the vitamin E content preferably means, for the purposes of the present invention, the artificially acquired capability of an increased biosynthesis rate of these compounds in the plant in comparison with the non-genetically modified plant, preferably for the duration of at least one plant generation.

As a rule, an increased vitamin E content is understood as meaning an increased total tocopherol content. However, an increased vitamin E content is also understood as meaning, in particular, a modified content of the above-described 8 compounds with tocopherol activity.

For example, introduction of a tyrosine aminotransferase gene into plants surprisingly leads to a particularly pronounced increase in the tocotrienol content.

The invention will now be illustrated by examples which follow, but is not limited thereto:

EXAMPLES

General Experimental Conditions:

Sequence analysis of recombinant DNA

Recombinant DNA molecules were sequenced with a Licor laser fluorescence DNA sequencer (available from MWG Biotech, Ebersbach) using the method of Sanger (Sanger et al., Proc. Natl. Acad. Sci. USA 74 (1977), 5463-5467).

Example 1

Cloning the tyrosine aminotransferase gene encoding the Rattus norvegicus tyrosine aminotransferase.

RNA was prepared from rat liver in a manner known per se as described by S. Kar and B. J. Carr in Biochem. Biophys. Res. Commun. 1995, 212(1), 21-6 (Differential display and cloning of messenger RNAs from the late phase of rat liver regeneration).

The cDNA synthesis was carried out using the SuperScript II cDNA synthesis kit (Gibco BRL) following the manufacturer's instructions.

The nucleic acid encoding a tyrosine aminotransferase was amplified from Rattus norvegicus by means of polymerase chain reaction (PCR) using a sense-specific primer (tyrosine aminotransferase 5′ SEQ. ID No. 3) and an antisense-specific primer (tyrosine aminotransferase 3′ SEQ. ID No. 4).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 2 μl of a Rattus norvegicus cDNA (prepared as described above)
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 ∥g of bovine serum albumin
    • 40 pmol of tyrosine aminotransferase 5′ primer
    • 40 pmol of tyrosine aminotransferase 3′ primer
    • 15 μl of 3.3×rTth DNA polymerase XL buffer (PE Applied Biosystems)
    • 5 U of rTth DNA polymerase XL (PE Applied Biosystems)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 55° C. (annealing)
  • Step 4: 2 minutes at 72° C. (elongation) 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)
  • Step 6: 4° C. (waiting loop)

The amplicon was cloned into the PCR cloning vector pGEM-Te (Promega) using standard methods. The identity of the amplicon generated in the vector pGEM-Te/RnTATase1 was confirmed by sequencing using the M13F (−40) primer and the M13R primer (SEQ. ID. No. 1 and SEQ. ID. NO. 3).

Example 2

Cloning the tyrosine aminotransferase gene 1 encoding the Arabidopsis thaliana tyrosine aminotransferase 1.

The DNA encoding the tyrosine aminotransferase gene 1 was amplified from Arabidopsis thaliana by means of polymerase chain reaction (PCR) using a sense-specific primer (At1 tyrosine aminotransferase 5′ SEQ. ID. No. 28) and an antisense-specific primer (At1 tyrosine aminotransferase 3′ SEQ. ID. No. 29).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 2 μl of an Arabidopsis thaliana cDNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of At1 tyrosine aminotransferase 5′ primer
    • 40 pmol of At1 tyrosine aminotransferase 3′ primer
    • 15 μl of 3.3×rTth DNA polymerase XL buffer (PE Applied Biosystems)
    • 5 U of rTth DNA polymerase XL (PE Applied Biosystems)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute 55° C. (annealing)
  • Step 4: 2 minutes at 72° C. (elongation) 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The amplicon was cloned into the PCR cloning vector pGEM-Te (Promega) using standard methods. The identity of the amplicon generated in the vector pGEMTe/AtTATase1 was confirmed by complete sequencing using the M13F (−40) primer and the M13R primer (Seq. ID. No. 5).

Example 3

Cloning the tyrosine aminotransferase gene 3 encoding the Arabidopsis thaliana tyrosine aminotransferase 3.

The DNA encoding the tyrosine aminotransferase gene 3 was amplified from Arabidopsis thaliana by means of polymerase chain reaction (PCR) using a sense-specific primer (At3 tyrosine aminotransferase 5′: SEQ. ID. No. 30) and an antisense-specific primer (At3 tyrosine aminotransferase 3′: SEQ. ID. No. 31).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 2 μl of an Arabidopsis thaliana cDNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of At3 tyrosine aminotransferase 5′ primer
    • 40 pmol of Ar3 tyrosine aminotransferase 3′ primer
    • 15 μl of 3.3×rTth DNA polymerase XL buffer (PE Applied Biosystems)
    • 5 U of rTth DNA polymerase XL (PE Applied Biosystems)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 56° C. (annealing)
  • Step 4: 2 minutes at 72° C. (elongation)
  • 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The amplicon was cloned into the PCR cloning vector pGEM-Te (Promega) using standard methods. The identity of the amplicon generated in the vector pGEMTe/AtTATase3 was confirmed by complete sequencing using the M13F (−40) primer and the M13R primer (Seq. ID. No. 7).

Example 4

Cloning the tyrosine aminotransferase gene 5 encoding the Arabidopsis thaliana tyrosine aminotransferase 5.

The DNA encoding the tyrosine aminotransferase gene 5 was amplified from Arabidopsis thaliana by means of polymerase chain reaction (PCR) using a sense-specific primer (At5 tyrosine aminotransferase 5′: SEQ. ID. No. 32) and an antisense-specific primer (At5 tyrosine aminotransferase 3′: SEQ. ID. No. 33).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 2 μl of an Arabidopsis thaliana cDNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of At5 tyrosine aminotransferase 5′ primer
    • 40 pmol of At5 tyrosine aminotransferase 3′ primer
    • 15 μl of 3.3×rTth DNA polymerase XL buffer (PE Applied Biosystems)
    • 5 U of rTth DNA polymerase XL (PE Applied Biosystems)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 56° C. (annealing)
  • Step 4: 2 minutes at 72° C. (elongation)
  • 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The amplicon was cloned into the PCR cloning vector pGEM-Te (Promega) using standard methods. The identity of the amplicon generated in the vector pGEMTe/AtTATase5 was confirmed by complete sequencing using the M13F (−40) primer and the M13R primer (Seq. ID. No. 9).

Example 5

Cloning the tyrosine aminotransferase gene 6 encoding the Arabidopsis thaliana tyrosine aminotransferase 6.

The DNA encoding the tyrosine aminotransferase gene 6 was amplified from Arabidopsis thaliana by means of polymerase chain reaction (PCR) using a sense-specific primer (At6 tyrosine aminotransferase 5′: SEQ. ID. No. 34) and an antisense-specific primer (At6 tyrosine aminotransferase 3′: SEQ. ID. No. 35).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 2 μl of an Arabidopsis thaliana cDNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of At6 tyrosine aminotransferase 5′ primer
    • 40 pmol of Ar6 tyrosine aminotransferase 3′ primer
    • 15 μl of 3.3×rTth DNA polymerase XL buffer (PE Applied Biosystems)
    • 5 U of rTth DNA polymerase XL (PE Applied Biosystems)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 56° C. (annealing)
  • Step 4: 2 minutes at 72° C. (elongation)
  • 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The amplicon was cloned into the PCR cloning vector pGEM-Te (Promega) using standard methods. The identity of the amplicon generated in the vector pGEMTe/AtTATase6 was confirmed by complete sequencing using the M13F (−40) primer and the M13R primer (Seq. ID. No. 11).

Example 6

Cloning the geranylgeranyl-pyrophosphate oxidoreductase gene encoding the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase

The DNA encoding the geranylgeranyl-pyrophosphate oxidoreductase gene was amplified from Nicotiana tabacum by means of polymerase chain reaction (PCR) using a sense-specific primer (geranylgeranyl-pyrophosphate oxidoreductase 5′: SEQ. ID. NO. 36) and an antisense-specific primer (geranylgeranyl-pyrophosphate oxidoreductase 3′: SEQ. ID. No. 37).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 2 μl of a Nicotiana tabacum cDNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of geranylgeranyl-pyrophosphate oxidoreductase 5′ primer
    • 40 pmol of geranylgeranyl-pyrophosphate oxidoreductase 3′ primer
    • 15 μl of 3.3×rTth DNA polymerase buffer (PE Applied Biosystems)
    • 5 U of rTth DNA polymerase (PE Applied Biosystems)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 56° C. (annealing)
  • Step 4: 2 minutes at 72° C. (elongation)
  • 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The amplicon was cloned into the PCR cloning vector pGEMTe (Promega) using standard methods. The identity of the amplicon generated in the vector pGEMTe/NtGGPPOR was confirmed by complete sequencing using the M13F (−40) primer and the M13R primer (Seq. ID. No. 17).

Example 7

Cloning the hydroxyphenylpyruvate dioxygenase gene encoding the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase.

The DNA encoding the hydroxyphenylpyruvate dioxygenase gene was amplified from Arabidopsis thaliana by means of polymerase chain reaction (PCR) using a sense-specific primer (At hydroxyphenylpyruvate dioxygenase 5′: SEQ. ID. No. 38) and an antisense-specific primer (At hydroxyphenylpyruvate dioxygenase 3′: SEQ. ID. No. 39).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 2 μl of an Arabidopsis thaliana cDNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of At hydroxyphenylpyruvate dioxygenase 5′ primer
    • 40 pmol of At hydroxyphenylpyruvate dioxygenase 3′ primer
    • 15 μl of 3.3×rTth DNA polymerase XL buffer (PE Applied Biosystems)
    • 5 U of rTth DNA polymerase XL (PE Applied Biosystems)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 58° C. (annealing)
  • Step 4: 2 minutes at 72° C. (elongation)
  • 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The amplicon was cloned into the PCR cloning vector pGEM-Te (Promega) using standard methods. The identity of the amplicon generated in the vector pGEMTe/AtHPPD was confirmed by complete sequencing using the M13F (−40) primer and the M13R primer (Seq. ID. No. 13).

Example 8

Cloning the homogentisate prenyltransferase gene encoding the Arabidopsis thaliana homogentisate prenyltransferase.

The DNA encoding the homogentisate prenyltransferase gene was amplified from Arabidopsis thaliana by means of polymerase chain reaction (PCR) using a sense-specific primer (At homogentisate prenyltransferase 5′: SEQ. ID. No. 40) and an antisense-specific primer (At homogentisate prenyltransferase 3′: SEQ. ID. No. 41).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 2 μl of an Arabidopsis thaliana cDNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of At homogentisate prenyltransferase 5′ primer
    • 40 pmol of At homogentisate prenyltransferase 3′ primer
    • 15 μl of 3.3×rTth DNA polymerase XL buffer (PE Applied Biosystems)
    • 5 U of rTth DNA polymerase XL (PE Applied Biosystems)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 58° C. (annealing)
  • Step 4: 2 minutes at 72° C. (elongation)
  • 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The amplicon was cloned into the PCR cloning vector pGEM-Te (Promega) using standard methods. The identity of the amplicon generated in the vector pGEMTe/AtHPT was confirmed by complete sequencing using the M13F (−40) primer and the M13R primer (Seq. ID. No. 15).

Example 9

Cloning the 2-methyl-6-phytylhydroquinone methyltransferase gene encoding the Synechocystis sp. PCC6803 2-methyl-6-phytyl-hydroquinone methyltransferase.

The DNA encoding the 2-methyl-6-phytylhydroquinone methyl-transferase gene was amplified from Synechocystis sp. PCC6803 by means of polymerase chain reaction (PCR) using a sense-specific primer (2-methyl-6-phytylhydroquinone methyltransferase 5′: SEQ. ID. No. 42) and an antisense-specific primer (2-methyl-6-phytyl-hydroquinone methyltransferase 3′: SEQ. ID. No. 43).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 2 μl of a Synechocystis sp. PCC6803 DNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of 2-methyl-6-phytylhydroquinone methyltransferase 5′ primer
    • 40 pmol of 2-methyl-6-phytylhydroquinone methyltransferase 3′ primer
    • 15 μl of 3.3×rTth DNA polymerase XL buffer (PE Applied Biosystems)
    • 5 U of rTth DNA polymerase XL (PE Applied Biosystems)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 58° C. (annealing)
  • Step 4: 2 minutes at 72° C. (elongation)
  • 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The amplicon was cloned into the PCR cloning vector pGEM-Te (Promega) using standard methods. The identity of the amplicon generated in the vector pGEMTe/SynMT1 was confirmed by complete sequencing using the M13F (−40) primer and the M13R primer (Seq ID. No. 19).

Example 10

Cloning the tocopherol cyclase gene (also referred to as 2,3-dimethyl-5-phytylplastoquinol cyclase gene) encoding the Synechocystis sp. PCC6803 tocopherol cyclase (also referred to as 2,3-dimethyl-5-phytylplastoquinol cyclase).

The DNA encoding the 2,3-dimethyl-5-phytylplastoquinol cyclase gene was amplified from Synechocystis sp. PCC6803 by means of polymerase chain reaction (PCR) using a sense-specific primer (2,3-dimethyl-5-phytylplastoquinol cyclase 5′: SEQ. ID. No. 44) and an antisense-specific primer (2,3-dimethyl-5-phytylplastoquinol cyclase 3′: SEQ. ID No. 45).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 2 μl of a Synechocystis sp. PCC6803 DNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of 2,3-dimethyl-5-phytylplastoquinol cyclase 5′ primer
    • 40 pmol of 2,3-dimethyl-5-phytylplastoquinol cyclase 3′ primer
    • 15 μl of 10×Pful-Turbo DNA polymerase buffer (Stratagene)
    • 5 U of Pful-Turbo DNA polymerase (Stratagene)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 60° C. (annealing)
  • Step 4: 1.5 minutes at 72° C. (elongation)
  • 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The amplicon was cloned into the PCR cloning vector pCRTopo4blunt (Invitrogen) using standard methods. The identity of the amplicon generated in the vector pCR4topoblunt/SynCyc was confirmed by complete sequencing using the M13F (−20) primer and the M13R primer (Seq. ID. No. 21).

Example 11

Cloning the γ-tocopherol methyltransferase gene encoding the Arabidopsis thaliana γ-tocopherol methyltransferase.

The DNA encoding the γ-tocopherol methyltransferase gene was amplified from Arabidopsis thaliana by means of polymerase chain reaction (PCR) using a sense-specific primer (Atγ-tocopherol methyltransferase 5′: SEQ. ID. No. 46) and an antisense-specific primer (Atγ-tocopherol methyltransferase 3′: SEQ. ID. No. 47).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 2 μl of an Arabidopsis thaliana cDNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of Atγ-tocopherol methyltransferase 5′ primer
    • 40 pmol of Atγ-tocopherol methyltransferase 3′ primer
    • 15 μl of 3.3×rTth DNA polymerase XL buffer (PE Applied Biosystems)
    • 5 U of rTth DNA polymerase XL (PE Applied Biosystems)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 58° C. (annealing)
  • Step 4: 2 minutes at 72° C. (elongation)
  • 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The amplicon was cloned into the PCR cloning vector pGEM-Te (Promega) using standard methods. The identity of the amplicon generated in the vector pGEMTe/AtγTMT was confirmed by complete sequencing using the M13F (−40) primer and the M13R primer (Seq. ID. No. 23).

Example 12

Cloning a part-fragment of the homogentisate dioxygenase gene encoding the Brassica napus homogentisate dioxygenase.

The DNA encoding a part-fragment of the homogentisate dioxygenase gene was amplified from Brassica napus by means of polymerase chain reaction (PCR) using a sense-specific primer (homogentisate dioxygenase 5′: SEQ. ID. No. 48) and an antisense-specific primer (homogentisate dioxygenase 3′: SEQ. ID. No. 49).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 2 μl of a Brassica napus cDNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of homogentisate dioxygenase 5′ primer
    • 40 pmol of homogentisate dioxygenase 3′ primer
    • 15 μl of 3.3×rTth DNA polymerase XL buffer (PE Applied Biosystems)
    • 5 U of rTth DNA polymerase (PE Applied Biosystems)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 56° C. (annealing)
  • Step 4: 2 minutes at 72° C. (elongation)
  • 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The amplicon was cloned into the PCR cloning vector pGEM-Te (Promega) using standard methods. The identity of the amplicon generated in the vector pGEMTe/*BnHGD was confirmed by complete sequencing using the M13F (−40) primer and the M13R primer (Seq. ID. No. 25).

Example 13

Generation of the DNA construct for the seed-specific suppression of the expression of the Brassica napus homogentisate dioxygenase gene.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express a reduced expression of the Brassica napus homogentisate dioxygenase gene under the control of a seed-specific promoter, the vector pSUN2 (WO 02/00900) was used. This vector was modified in such a way that it comprises the seed-specific promoter of the Vicia faba vicilin gene (Weschke W., Bassüner R., van Hai N., Czihal A., Bäumlein H., Wobus U. The structure of a Vicia faba Vicilin Gene. Biochem. Physiol. plants 183,233-242 (1988)) and the Intron 2 (IV2) of the Solanum tuberosum ST-LS1 gene (Vancanneyt G., Schmidt R., O'Connor-Sanchez A., Willmitzer L., Rocha-Sosa M. Construction of an intron-containing marker gene: Splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. MGG (1990)) and the termination signal 2 of the Agrobacterium tumefaciens octopine synthase gene (Gielen et al. 1984).

The DNA fragment encoding the part-fragment of the Brassica napus homogentisate dioxygenase gene was cloned as SacI/ScaI fragment from plasmid pGEMTe/*BnHGD into the SmaI-opened pSUN2-Pvic-STLS1-ocsT after the overhanging ends of the fragment had been made blunt-ended with T4 polymerase. The resulting plasmid pSUN2-Pvic-*BnHGD-STLS1-ocsT was digested with ScaI. The fragment of the Brassica napus homogentisic acid dioxygenase gene was cloned from plasmid pGEMTe/*BnHGD as blunt-ended SacI/ScaI fragment into this linearized vector. In doing so, care was taken that the two BnHGD fragments are present in opposite orientation on the two sides of the STLS1 intron. This plasmid (pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT (FIG. 1) is used for generating transgenic Brassica napus and A. thaliana plants.

Fragment A (2559 bp) in FIG. 1 comprises the promoter of the Vicia faba vicilin gene, fragment B (580 bp) encodes a fragment of the Brassica napus homogentisate dioxygenase gene. Fragment C (190 bp) encodes the intron 2 (IV2) of the Solanum tuberosum ST-LS1 gene. Fragment D is identical with fragment B, but has, in the vector, the opposite orientation of B. Fragment E (208 bp) encodes the termination signal 2 of the octopine gene.

Example 14

Generation of DNA constructs for expressing the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic A. thaliana, Nicotiana tabacum and Brassica napus plants which express the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter, the vector pSUN2 (patent WO 02/00900) was used. This vector was modified in such a way that it comprises the seed-specific promoter of the Vicia faba unknown seed protein gene (USPP) (Bäumlein H., Boerjan W., Nagy I., Bassüner R., van Montagu M., Inzé D., Wobus U. A novel seed protein gene from Vicia faba is developmentally regulated in transgenic tobacco and Arabidopsis plants. MGG 225:459-467 (1991)), the sequence encoding the chloroplast transit peptide of the Vicia faba ribulose-bisphosphate carboxylase (rbcS) gene (Guerineau F., Woolston S., Brooks L., Mullineaux P. An expression cassette for targeting foreign proteins into chloroplasts. Nucleic Acids Res 16(23): 11380. (1988)) and the termination signal of the A. tumefaciens nopaline synthase gene (Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman H M. Nopaline synthase: transcript mapping and DNA sequence. J Mol Appl Genet. 1982;1(6):561-73).

The DNA fragment encoding the Rattus norvegicus tyrosine aminotransferase gene was cloned from plasmid pGEMTe/RnTATase as EcoR5 fragment into pSUN2-USPP-rbcS-nosT after the latter had been digested with the restriction enzyme SmaI. This gave a translational fusion with the transit peptide of ribulose-bisphosphate carboxylase (rbcS), thus ensuring the import of the Rattus norvegicus tyrosine aminotransferase into the plastids.

This plasmid (pSUN2USPP-rbcS-RnTATase-nosT, FIG. 2) is used for generating transgenic Brassica napus and A. thaliana plants.

Fragment A (678 bp) in FIG. 2 comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment B (235 bp) encodes the Vicia faba ribulose-bisphosphate carboxylase (rbcS) transit peptide. Fragment C (1365 bp) encodes the Rattus norvegicus tyrosine aminotransferase gene. Fragment D (272 bp) encodes the termination signal of the A. tumefaciens nopaline synthase gene.

Example 15

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase under the control of a seed-specific promoter, the vector pSUN2 (WO 02/00900) was used.

This vector was modified in such a way that it comprises the seed-specific promoter of the Vicia faba unknown seed protein (USPP) (Bäumlein et al., 1991) and the termination signal of the Agrobacterium tumefaciens nopaline synthase gene (GIELEN, J., de BEUCKELEER, M., SEURINCK, J., DEBROECK, H., de GREVE, H., LEMMERS, M., van MONTAGU, M., SCHELL, J. The complete nucleotide sequence of the TL-DNA of the Agrobacterium tumefaciens plasmid pTiAch5. EMBO J. 3: 835-846. (1984)).

The DNA fragment encoding the Arabidopsis thaliana tyrosine aminotransferase gene 1 was isolated as SalI fragment from plasmid pGEMTe/AtTATase1 and, after the SalI ends had been filled in with Klenow enzyme, cloned into pSUN2-USPP-nosT after the latter had been digested partially with the restriction enzyme SmaI (size of the linearized vector 8250 bp).

This plasmid (pSUN2-USPP-AtTATase1-nosT, FIG. 3) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 3 comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment B (1269 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 1, and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 16

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter, the vector pSUN2 (WO 02/00900) was used.

This vector was modified in such a way that it comprises the seed-specific promoter of the Vicia faba unknown seed protein (USPP) (Bäumlein et al., 1991) and the termination signal of the Agrobacterium nopaline synthase gene (Gielen et al. 1984).

The DNA fragment encoding the Arabidopsis thaliana tyrosine aminotransferase gene 3 was isolated as SalI fragment from plasmid pGEMTe/AtTATase3 and, after the SalI end had been filled in with Klenow enzyme, cloned into pSUN2-USPP-nosT after the latter had been digested partially with the restriction enzyme SmaI (size of the linearized vector 8250 bp).

This plasmid (pSUN2USPP-AtTATase3-nosT, FIG. 4) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 4 comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment B (1334 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 3, and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 17

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter, the vector pSUN2 (WO 02/00900) was used.

This vector was modified in such a way that it comprises the seed-specific promoter of the Vicia faba unknown seed protein (USPP) (Bäumlein et al., 1991) and the termination signal of the Agrobacterium nopaline synthase gene (Gielen et al. 1984).

The DNA fragment encoding the Arabidopsis thaliana tyrosine aminotransferase gene 5 was isolated as BamHI fragment from plasmid pGEMTe/AtTATase5 and, after the SalI end had been filled in with Klenow enzyme, cloned into pSUN2-USPP-nosT after the latter had been digested partially with the restriction enzyme SmaI (size of the linearized vector 8250 bp).

This plasmid (pSUN2-USPP-AtTATase5-nosT, FIG. 5) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 5 comprises the promoter of the Vicia faba unknown seed protein gene, fragment B (1389 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 5, and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 18

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter, the vector pSUN2 (WO 02/00900) was used.

This vector was modified in such a way that it comprises the seed-specific promoter of the Vicia faba unknown seed protein gene (USPP) (Bäumlein et al., 1991) and the termination signal of the Agrobacterium nopaline synthase gene (Gielen et al. 1984).

The DNA fragment encoding the Arabidopsis thaliana tyrosine aminotransferase gene 6 was isolated as SalI fragment from plasmid pGEMTe/AtTATase6 and, after the SalI ends had been filled with Klenow enzyme, cloned into pSUN2-USPP-nosT after the latter had been digested partially with the restriction enzyme SmaI (size of the linearized vector 8250 bp).

This plasmid (pSUN2-USPP-AtTATase6-nosT, FIG. 6) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 6 comprises the promoter of the Vicia faba unknown seed protein gene, fragment B (1243 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 6, and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 19

Generation of DNA constructs for expressing the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Nicotianum tabacum geranylgeranyl-pyrophosphate oxidoreductase under the control of a seed-specific promoter, the vector pSUN2 (WO 02/00900) was used.

First, vector puc19 (New England Biolabs) was modified in such a way that it comprises the seed-specific promoter of the legumin B4 gene (Kafatos et al., 1986) and the termination signal of the A. tumefaciens nopaline synthase (Depicker et al., 1982). The resulting vector is known as puc19-LeB4-nosT.

The DNA fragment encoding the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene was cloned as KpnI/SalI fragment into puc19LeB4nosT after the latter had been digested with the restriction enzymes KpnI/SalI.

The DNA consisting of LeB4 promoter, geranylgeranyl-pyrophosphate oxidoreductase gene (nucleotides 1 to 1323 of Seq. ID 7) was isolated from vector puc19-LeB4-NtGGPPOR-nosT as SmaI/Hind3 fragment and cloned into vector pSUN2 after the latter had been digested with the restriction enzyme SmaI/Hind3. The resulting vector is known as pSUN2-LeB4-NtGGPPOR (nuc.1-1323). The DNA composed of geranylgeranyl-pyrophosphate oxidoreductase gene (nucleotide 1319 to 1509 of Seq. ID. No. 17), nos termination sequence was isolated as Hind3 fragment from the vector puc19-LeB4-NtGGPPOR-nosT after the latter had also been cleaved with Hind3.

This plasmid (pSUN2-LeB4-NtGGPPOR-nosT, FIG. 7) is used for generating transgenic Brassica napus plants.

Fragment A (2764 bp) in FIG. 7 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (1509 bp) encodes the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene, and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 20

Generation of DNA constructs for expressing the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter, the vector pSUN2 (WO 02/00900) was used.

This vector was modified in such a way that it comprises the seed-specific promoter of the Vicia faba unknown seed protein gene (USPP) (Bäumlein et al., 1988) and the termination signal 1 of the A. tumefaciens octopine synthase gene (Depicker et al., 1982).

The DNA fragment encoding the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase was isolated as BamHI/SalI fragment from plasmid pGEMTe/AtHPPD and, after the BamHI end and SalI end had been filled in with Klenow enzyme, cloned into the vector pSUN2-USPP-ocsT which had been digested partially with the restriction enzyme SmaI (size of the linearized vector 8691 bp).

This plasmid (pSUN2-USPP-AtHPPD-ocsT, FIG. 8) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 8 comprises the promoter of the Vicia faba unknown seed protein gene, fragment B (1338 bp) encodes the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene, and fragment C (713 bp) encodes the termination signal 1 of the octopine synthase gene.

Example 21

Generation of DNA constructs for expressing the Arabidopsis thaliana homogentisate phytyltransferase under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana homogentisate phytyltransferase under the control of a seed-specific promoter, the vector pSUN2 (WO 02/00900) was used.

This vector was modified in such a way that it comprises the seed-specific promoter of the Vicia faba unknown seed protein gene (USPP) (Bäumlein et al., 1991) and the termination signal 1 of the A. tumefaciens nopaline synthase gene (Depicker et al., 1982).

The DNA fragment encoding the Arabidopsis thaliana homogentisate phytyltransferase was isolated as BamHI fragment from plasmid pGEMTe/AtHPT and, after the BamHI ends had been filled in with Klenow enzyme, cloned into pSUN2-USPP-ocsT after the latter had been digested partially with SmaI (size of the linearized vector 88691 bp).

This plasmid (pSUN2-USPP-AtHPT-ocsT, FIG. 9) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 9 comprises the promoter of the Vicia faba unknown seed protein gene, fragment B (1182 bp) encodes the Arabidopsis thaliana homogentisate phytyltransferase gene, and fragment C (713 bp) encodes the termination signal 1 of the octopine synthase gene.

Example 22

Generation of DNA constructs for expressing the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter, the vector pSUN2 (WO 02/00900) is used.

This vector is modified in such a way that it comprises the seed-specific promoter of the legumin B4 gene (Kafatos et al., 1986), the sequence encoding the transit peptide of the A. thaliana plastid-specific isopentenyl-pyrophosphate isomerase-2 (IPP-2) and the termination signal of the A. tumefaciens nopaline synthase gene (Depicker et al., 1982).

The DNA fragment encoding the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase is isolated as BamHI fragment from plasmid pGEMTe/SynMT1 and, after the BamHI ends have been filled in with Klenow enzyme, and cloned into the SalI-digested pSUN2-Leb4P-IPP-nosT whose SalI ends are also filled in with Klenow enzyme. This generates a translational fusion with the IPP-2 transit peptide, thus ensuring the import of 2-methyl-6-phytylhydroquinone methyltransferase into the chloroplasts.

This plasmid (pSUN2LeB4-IPP-SynMT1-nosT, FIG. 10) is used for generating transgenic Brassica napus plants.

Fragment A (2764 bp) in FIG. 10 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase-2. Fragment C (957 bp) encodes the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase gene, and fragment D (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 23

Generation of DNA constructs for expressing the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase under the control of a seed-specific promoter, the vector pSUN2 (WO 02/00900) was used.

This vector is modified in such a way that it comprises the seed-specific promoter of the legumin B4 gene (Kafatos et al., 1986), the sequence encoding the transit peptide of the A. thaliana plastid-specific isopentenyl-pyrophosphate isomerase-2 (IPP-2) and the termination signal of the A. tumefaciens nopaline synthase gene (Depicker et al., 1982).

The DNA fragment encoding the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase is isolated as BamHI fragment from plasmid pGEMTe/SynCyc and, after the BamHI ends have been filled in with Klenow enzyme, cloned into the SalI-digested pSUN2-Leb4P-IPP-nosT whose SalI ends are also filled in with Klenow enzyme. This generates a translational fusion with the IPP-2 transit peptide, thus ensuring the import of 2,3-dimethyl-5-phytylplastoquinol cyclase into the chloroplasts.

This plasmid (pSUN2-LeB4P-IPP-SynCyc-nosT, FIG. 11) is used for generating transgenic Brassica napus plants.

Fragment A (2764 bp) in FIG. 11 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (235 bp) encodes the A. thaliana isopentenyl-pyrophosphate isomerase-2 transit peptide. Fragment C (1100 bp) encodes the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase gene, and fragment D (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 24

generation of DNA constructs for expressing the Arabidopsis thaliana γ-tocopherol methyltransferase under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana γ-tocopherol methyltransferase under the control of a seed-specific promoter, the vector pSUN2 (WO 02/00900) was used.

First, the vector puc19 (New England Biolabs) was modified in such a way that it comprises the seed-specific promoter of the sucrose binding protein gene (SBP-P) (DE 19852195 C2) and the 35S termination sequence of the cauliflower mosaic virus (FRANCK, A., GUILLEY, H., JONARD, G., RICHARDS, K., HIRTH, L. Nucleotide sequence of cauliflower mosaic virus DNA. Cell 21: 285-294. (1980)). The resulting vector is referred to as puc19-SBPP-35ST.

The DNA fragment encoding the Arabidopsis thaliana γ-tocopherol methyltransferase gene was cloned as BamHI/SalI fragment into puc19-SBPP-AtγTMT-35ST after the latter had been digested with the restriction enzyme BamHI/SalI.

The expression cassette consisting of: SBP promoter, Arabidopsis thaliana γ-tocopherol methyltransferase gene and 35ST termination sequence was amplified by PCR using a sense-specific primer (SBPP-XbaI 5′: SEQ. ID. No. 50) and an antisense-specific primer (35ST-XbaI 3′: SEQ. ID. No. 51) and cloned into the vector pCR4topoblunt (Invitrogen).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 1 μl of a puc19-SBPP-AtγTMT-35ST plasmid DNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of SBPP-XbaI 5′ primer
    • 40 pmol of 35ST-XbaI 3′ primer
    • 5 μl of 10×Pful DNA polymerase buffer (Stratagene)
    • 5 U of Pful DNA polymerase (Stratagene)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 55° C. (annealing)
  • Step 4: 10 minutes at 68° C. (elongation)
  • 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The DNA fragment consisting of SBP promoter, Arabidopsis thaliana γ-tocopherol methyltransferase gene and 35ST termination sequence was isolated as XbaI fragment from the plasmid pCR4TOPOblunt/SBPP-γTMT-35ST and cloned into the vector pSUN2 after the latter had been digested with the restriction enzyme XbaI.

This plasmid (pSUN2-SBPP-γTMT-35ST, FIG. 12) is used for generating transgenic Brassica napus plants.

Fragment A (1788 bp) in FIG. 12 comprises the promoter of the Vicia faba SBP gene, fragment B (1047 bp) encodes the Arabidopsis thaliana γ-tocopherol methyltransferase gene, and fragment C (291 bp) encodes the cauliflower mosaic virus 35S terminator.

Example 25

Generation of DNA constructs for expressing the Rattus norvegicus tyrosine aminotransferase gene under the control of a seed-specific promoter in combination with the seed-specific suppression of the expression of the Brassica napus homogentisate dioxygenase gene.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter and simultaneously confer the seed-specific suppression of the expression of the Brassica napus homogentisate dioxygenase gene, the vector pSUN2-Pvic-BnHGD*-STLS1-αBnHGD*-ocsT and the vector pSUN2USPP-rbcS-RnTATase-nosT were used.

The expression cassette consisting of: USP promoter, rbcS transit peptide, Rattus norvegicus tyrosine aminotransferase gene and nos termination sequence was amplified from the vector pSUN2USPP-rbcS-RnTATase-nosT by means of PCR using a sense-specific primer (USPP-SrfI 5′: SEQ. ID. No. 52) and an antisense-specific primer (nosT-SrfI 3′: SEQ. ID. No. 53) and cloned into the vector pCR4topoblunt (Invitrogen).

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 1 μl of the pSUN2-USPP-rbcS-RnTATase-nosT plasmid DNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg (OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of USPP-SrfI 5′ primer
    • 40 pmol of nosT-SrfI 3′ primer
    • 5 μl of 10×Pfu1 Turbo DNA polymerase buffer (Stratagene)
    • 5 U of Pful Turbo DNA polymerase (Stratagene)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 55° C. (annealing)
  • Step 4: 8 minutes at 68° C. (elongation)
  • 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The DNA fragment consisting of USP promoter, rbcS transit peptide, Rattus norvegicus tyrosine aminotransferase gene and nos termination sequence was isolated as SrfI fragment from the plasmid pCR4TOPOblunt/USPP-rbcS-RnATase-nosT and cloned into the vector pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT after the latter had been digested with the restriction enzyme EcoRV.

This plasmid (pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT-USPP-rbcS-RnATase-nosT, FIG. 13) is used for generating transgenic Brassica napus plants.

Fragment A (2559 bp) in FIG. 13 comprises the promoter of the Vicia faba vicilin gene, fragment B (580 bp) encodes a fragment of the Brassica napus homogentisate dioxygenase gene, and fragment C (198 bp) encodes the intron 2 (IV2) of the Solanum tuberosum ST-LS1 gene. Fragment D is identical with fragment B, but has the opposite orientation in the vector relative to B. Fragment E (208 bp) encodes the termination signal 2 of the octopine gene. Fragment F (678 bp) comprises the promoter of the Vicia faba unknown seed protein gene, fragment G (235 bp) encodes the transit peptide of the Vicia faba ribulose-bisphosphate carboxylase (rbcS). Fragment H (1365 bp) encodes the Rattus norvegicus tyrosine aminotransferase gene, and fragment I (272 bp) encodes the termination signal of the Agrobacterium tumefaciens nopaline synthase gene.

Example 26

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and for the seed-specific suppression of the expression of the Brassica napus homogentisate dioxygenase gene

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and which suppress the expression of the endogenous Brassica napus homogentisate dioxygenase gene in a seed-specific fashion, the vector pSUN2-USPP-AtTATase1-nosT and the vector pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT were combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 1 gene and nos terminator was isolated as EcoRI/SmaI fragment from the plasmid pSUN2-USPP-AtTATase1-nosT, the EcoRI end was filled in with Klenow enzyme, and the construct was cloned into the vector pSUNPvic-*BnHGD-STLS1-α*BnHGD-ocsT which had been digested with EcoRV.

This plasmid (pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT/USPP-AtTATase1-nosT, FIG. 14) is used for generating transgenic Brassica napus plants.

Fragment A (2559 bp) in FIG. 14 comprises the promoter of the Vicia faba vicilin gene, fragment B (580 bp) encodes a fragment of the Brassica napus homogentisate dioxygenase gene. Fragment C (190 bp) encodes the intron 2 (IV2) of the Solanum tuberosum ST-LS1 gene. Fragment D is identical with fragment B, but has the opposite orientation in the vector relative to B. Fragment E (208 bp) encodes the termination signal 2 of the octopine gene. Fragment F (678 bp) comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment G (1269 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 1, and fragment H (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 27

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase-3 under the control of a seed-specific promoter and for the seed-specific suppression of the expression of the Brassica napus homogentisate dioxygenase gene

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter and which suppress the expression of the endogenous Brassica napus homogentisate dioxygenase gene in a seed-specific fashion, the vector pSUN2-USPP-AtTATase3-nosT and the vector pSUN2-Pvic-*BnHGD-STLS1-*BnHGD-ocsT were combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 3 gene and nos terminator was isolated as EcoRI/SmaI fragment from the plasmid pSUN2-USPP-AtTATase1-nosT, the EcoRI end was filled in with Klenow enzyme, and the construct was cloned into the vector pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT which had been digested with EcoRV.

This plasmid (pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT/USPP-AtTATase3-nosT, FIG. 15) is used for generating transgenic Brassica napus plants.

Fragment A (2559 bp) in FIG. 15 comprises the promoter of the Vicia faba vicilin gene, fragment B (580 bp) encodes a fragment of the Brassica napus homogentisate dioxygenase gene. Fragment C (190 bp) encodes the intron 2 (IV2) of the Solanum tuberosum ST-LS1 gene. Fragment D is identical with fragment B, but has the opposite orientation in the vector relative to B. Fragment E (208 bp) encodes the termination signal 2 of the octopine gene. Fragment F (678 bp) comprises the promoter of the Vicia faba “unknown seed protein” gene (USPP), fragment G (1334 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 3, and fragment H (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 28

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter and for the seed-specific suppression of the expression of the Brassica napus homogentisate dioxygenase gene

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter and which suppress the expression of the endogenous Brassica napus homogentisate dioxygenase gene in a seed-specific fashion, the vector pSUN2-USPP-AtTATase5-nosT and the vector pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT were combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 5 gene and nos terminator was isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase5-nosT , the EcoRI end was filled in with Klenow enzyme, and the construct was cloned into the vector pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT which had been digested with EcoRV.

This plasmid (pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT/USPP-AtTATase5-nosT, FIG. 16) is used for generating transgenic Brassica napus plants.

Fragment A (2559 bp) in FIG. 16 comprises the promoter of the Vicia faba vicilin gene, fragment B (580 bp) encodes a fragment of the Brassica napus homogentisate dioxygenase gene. Fragment C (190 bp) encodes the intron 2 (IV2) of the Solanum tuberosum ST-LS1 gene. Fragment D is identical with fragment B, but has the opposite orientation in the vector relative to B. Fragment E (208 bp) encodes the termination signal 2 of the octopine gene. Fragment F (678 bp) comprises the promoter of the Vicia faba “unknown seed protein” gene, fragment G (1389 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 5 and fragment H (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 29

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter and for the seed-specific suppression of the expression of the Brassica napus homogentisate dioxygenase gene

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter, and which suppress the expression of the endogenous Brassica napus homogentisate dioxygenase gene in a seed-specific fashion, the vector pSUN2-USPP-AtTATase6-nosT and the vector pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT were combined with each other.

The DNA fragment encoding the expression cassette consisting of: SP promoter, Arabidopsis thaliana tyrosine aminotransferase 6 gene and nos terminator was isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase6-nosT, the EcoRI end was filled in with Klenow enzyme, and the construct was cloned into the vector pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT which had been digested with EcoRV.

This plasmid (pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT/USPP-AtTATase6-nosT, FIG. 17) is used for generating transgenic Brassica napus plants.

Fragment A (2559 bp) in FIG. 17 comprises the promoter of the Vicia faba vicilin gene, fragment B (580 bp) encodes a fragment of the Brassica napus homogentisate dioxygenase gene. Fragment C (190 bp) encodes the intron 2 (IV2) of the Solanum tuberosum ST-LS1 gene. Fragment D is identical with fragment B, but has the opposite orientation in the vector relative to B. Fragment E (208 bp) encodes the termination signal 2 of the octopine gene. Fragment F (678 bp) comprises the promoter of the Vicia faba “unknown seed protein” gene, fragment G (1243 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 6 and fragment H (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 30

Generation of DNA constructs for expressing the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter and the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which encode the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter and which express the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase in a seed-specific fashion, the vectors pSUN2-LEB4-NtGGPPOR-nosT and pCR4topoblunt-USPP-rbcS-RnTATase1-nosT are combined with each other.

The DNA fragment consisting of USP promoter, Rattus norvegicus tyrosine aminotransferase and nos termination sequence is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/USPP-rbcS-RnTATase1-nosT and cloned into the XhoI-digested vector pSUN2-LeB4-NtGGPPOR-nosT whose XhoI ends had previously been made blunt-ended with Klenow enzyme.

This plasmid (pSUN2-LeB4-NtGGPPORnosT/USPP-rbcS-RnTATase1-nosT, FIG. 18) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 18 comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment B (235 bp) encodes the transit peptide of the Vicia faba ribulose-bisphosphate carboxylase (rbcS). Fragment C (1365 bp) encodes the Rattus norvegicus tyrosine aminotransferase gene. Fragment D (272 bp) encodes the termination signal of the A. tumefaciens nopaline synthase gene. Fragment E (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment F (1509 bp) encodes the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene. Fragment G (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 31

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and which express the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase in a seed-specific fashion, the vectors pSUN2-LeB4-NtGGPPOR-nosT and pSUN2-USPP-AtTATase1-nosT were combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 1 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase1-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the XhoI-digested vector pSUN2-LeB4-NtGGPPOR-nosT whose XhoI ends have previously been made blunt-ended with Klenow enzyme.

This plasmid (pSUN2-LeB4-NtGGPPOR-nosT/USPP-AtTATase1-nosT, FIG. 19) is used for generating transgenic Brassica napus plants.

Fragment A. (678 bp) in FIG. 19 comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment B (1269 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 1 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment E (1509 bp) encodes the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene. Fragment F (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 32

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter and the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter and which express the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase in a seed-specific fashion, the vectors pSUN2-LeB4-NtGGPPOR-nosT and pSUN2-USPP-AtTATase3-nosT were combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 3 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase3-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the XhoI-digested vector pSUN2-LeB4-NtGGPPOR-nosT whose XhoI-ends have previously been made blunt-ended with Klenow enzyme.

This plasmid (pSUN2-LeB4-NtGGPPORnosT/USPP-AtTATase3-nosT, FIG. 20) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 20 comprises the promoter of the Vicia faba “unknown seed protein gene” (USPP), fragment B (1334 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 3 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment E (1509 bp) encodes the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene. Fragment F (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 33

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter and the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter and which express the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase in a seed-specific fashion, the vectors pSUN2-LeB4-NtGGPPOR-nosT and pSUN2-USPP-AtTATase5-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 5 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase5-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the XhoI-digested vector pSUN2-LeB4-NtGGPPOR-nosT whose XhoI ends have previously been made blunt-ended with Klenow enzyme.

This plasmid (pSUN2-LeB4-NtGGPPORnosT/USPP-AtTATase5-nosT, FIG. 21) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 21 comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment B (1389 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 5 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment E (1509 bp) encodes the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene. Fragment F (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 34

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter and the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter and which express the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase in a seed-specific fashion, the vectors pSUN2-LeB4-NtGGPPOR-nosT and pSUN2-USPP-AtTATase6-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 6 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase6-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the XhoI-digested vector pSUN2-LeB4-NtGGPPOR-nosT whose XhoI ends have previously been made blunt-ended with Klenow enzyme.

This plasmid (pSUN2-LeB4-NtGGPPORnosT/USPP-AtTATase6-nosT, FIG. 22) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 22 comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment B (1243 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 6 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment E (1509 bp) encodes the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene. Fragment F (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 35

Generation of DNA constructs for expressing the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter and the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for the generation of transgenic Brassica napus plants which express the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter and which express the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase in a seed-specific fashion, the vectors pSUN2-USPP-AtHPPD-ocsT and pCR4topoblunt-USPP-rbcS-RnTATase1-nosT are combined with each other.

The DNA fragment consisting of USP promoter, Rattus norvegicus tyrosine aminotransferase and nos termination sequence is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/USPP-rbcS-RnTATase1-nosT and cloned into the SrfI-digested vector pSUN2-USPP-AtHPPD-ocsT.

This plasmid (pSUN2-USPP-AtHPPD-ocsT/USPP-rbcS-RnTATase1-nosT, FIG. 23) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 23 comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment B (235 bp) encodes the transit peptide of the Vicia faba ribulose-bisphosphate carboxylase (rbcS). Fragment C (1365 bp) encodes the Rattus norvegicus tyrosine aminotransferase gene. Fragment D (272 bp) encodes the termination signal of the A. tumefaciens nopaline synthase gene. Fragment E (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment F (1338 bp) encodes the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene. Fragment G (713 bp) encodes the termination signal 1 of the octopine synthase gene.

Example 36

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and which express the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase in a seed-specific manner, the vectors pSUN2-USPP-AtHPPD-ocsT and pSUN2-USPP-AtTATase1-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 1 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase1-nosT, the EcoRI end is filled up with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-USPP-AtHPPD-ocsT.

This plasmid (pSUN2-USPP-AtHPPD-ocsT/USPP-AtTATase1-nosT, FIG. 24) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 24 comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment B (1269 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 1 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment E (1338 bp) encodes the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene. Fragment F (713 bp) encodes the termination signal 1 of the octopine synthase gene.

Example 37

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter and the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter and which express the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase in a seed-specific manner, the vectors pSUN2-USPP-AtHPPD-ocsT and pSUN2-USPP-AtTATase3-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 3 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase3-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-USPP-AtHPPD-ocsT.

This plasmid (pSUN2-USPP-AtHPPD-ocsT/USPP-AtTATase3-nosT, FIG. 25) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 25 comprises the promoter of the Vicia faba “unknown seed protein gene” (USPP), fragment B (1334 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 3 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment E (1338 bp) encodes the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene. Fragment F (713 bp) encodes the termination signal 1 of the octopine synthase gene.

Example 38

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter and the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter and which express the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase in a seed-specific manner, the vectors pSUN2-USPP-AtHPPD-ocsT and pSUN2-USPP-AtTATase5-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 5 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase5-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-SBPP-AtγTMT-35sT.

This plasmid (pSUN2-USPP-AtHPPD-ocsT/USPP-AtTATase5-nosT, FIG. 26) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 26 comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment B (1389 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 5 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment E (1338 bp) encodes the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene. Fragment F (713 bp) encodes the termination signal 1 of the octopine synthase gene.

Example 39

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter and the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter and which express the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase in a seed-specific fashion, the vectors pSUN2-USPP-AtHPPD-ocsT and pSUN2-USPP-AtTATase6-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 6 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase6-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-USPP-AtHPPD-ocsT.

This plasmid (pSUN2-USPP-AtHPPD-ocsT/USPP-AtTATase6-nosT, FIG. 27) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 27 comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment B (1243 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 6 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment E (1338 bp) encodes the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene. Fragment F (713 bp) encodes the termination signal 1 of the octopine synthase gene.

Example 40

Generation of DNA constructs for expressing the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter and the Arabidopsis thaliana homogentisate phytyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter and the Arabidopsis thaliana homogentisate phytyltransferase in a seed-specific manner, the vectors pSUN2-USPP-AtHPT-ocsT and pCR4topoblunt-USPP-rbcS-RnTATase1-nosT are combined with each other.

The DNA fragment consisting of USP promoter, Rattus norvegicus tyrosine aminotransferase and nos termination sequence is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/USPP-rbcS-RnTATase1-nosT and the construct is cloned into the SrfI-digested vector pSUN2-USPP-AtHPT-ocsT.

This plasmid (pSUN2-USPP-AtHPT-ocsT/USPP-rbcS-RnTATase1-nosT, FIG. 28) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 28 comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment B (235 bp) encodes the transit peptide of the Vicia faba ribulose-bisphosphate carboxylase (rbcS). Fragment C (1365 bp) encodes the Rattus norvegicus tyrosine aminotransferase gene. Fragment D (272 bp) encodes the termination signal of the A. tumefaciens nopaline synthase gene. Fragment E (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment F (1182 bp) encodes the Arabidopsis thaliana homogentisate phytyltransferase gene. Fragment G (713 bp) encodes the termination signal 1 of the octopine synthase gene.

Example 41

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and the Arabidopsis thaliana homogentisate phytyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and which express the Arabidopsis thaliana homogentisate phytyltransferase in a seed-specific manner, the vectors pSUN2-USPP-AtHPT-ocsT and pSUN2-USPP-AtTATase1-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 1 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase1-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-USPP-AtHPT-ocsT.

This plasmid (pSUN2-USPP-AtHPT-ocsT/USPP-AtTATase1-nosT, FIG. 29) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 29 comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment B (1269 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 1 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment E (1182 bp) encodes the Arabidopsis thaliana homogentisate phytyltransferase gene. Fragment F (713 bp) encodes the termination signal 1 of the octopine synthase gene.

Example 42

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter and the Arabidopsis thaliana homogentisate phytyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter and which express the Arabidopsis thaliana homogentisate phytyltransferase in a seed-specific manner, the vectors pSUN2-USPP-AtHPT-ocsT and pSUN2-USPP-AtTATase3-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 3 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase3-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-USPP-AtHPT-ocsT.

This plasmid (pSUN2-USPP-AtHPT-ocsT/USPP-AtTATase3-nosT, FIG. 30) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 30 comprises the promoter of the Vicia faba “unknown seed protein gene” (USPP), fragment B (1334 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 3 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment E (1182 bp) encodes the Arabidopsis thaliana homogentisate phytyltransferase gene. Fragment F (713 bp) encodes the termination signal 1 of the octopine synthase gene.

Example 43

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter and the Arabidopsis thaliana homogentisate phytyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase-5 under the control of a seed-specific promoter and which express the Arabidopsis thaliana homogentisate phytyltransferase in a seed-specific manner, the vectors pSUN2-USPP-AtHPT-ocsT and pSUN2-USPP-AtTATase5-nosT were combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 5 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase5-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-USPP-AtHPT-ocsT.

This plasmid (pSUN2-USPP-AtHPT-ocsT/USPP-AtTATase5-nosT, FIG. 31) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 31 comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment B (1389 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 5 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment E (1182 bp) encodes the Arabidopsis thaliana homogentisate phytyltransferase gene. Fragment F (713 bp) encodes the termination signal 1 of the octopine synthase gene.

Example 44

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter and the Arabidopsis thaliana homogentisate phytyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter and which express the Arabidopsis thaliana homogentisate phytyltransferase in a seed-specific manner, the vectors pSUN2-USPP-AtHPT-ocsT and pSUN2-USPP-AtTATase6-nosT were combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 6 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase6-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-USPP-AtHPT-ocsT.

This plasmid (pSUN2-USPP-AtHPT-ocsT/USPP-AtTATase6-nosT, FIG. 32) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 32 comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment B (1243 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 6 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment E (1182 bp) encodes the Arabidopsis thaliana homogentisate phytyltransferase gene. Fragment F (713 bp) encodes the termination signal 1 of the octopine synthase gene.

Example 45

Generation of DNA constructs for expressing the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter and Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone Methyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase in a seed-specific manner, the vectors pSUN2-LeB4-IPP-SynMT1-nosT and pCR4topoblunt-USPP-rbcS-RnTATase1-nosT are combined with each other.

The DNA fragment consisting of USP promoter, Rattus norvegicus tyrosine aminotransferase and nos termination sequence is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/USPP-rbcS-RnTATase1-nosT and cloned into the SrfI-digested vector pSUN2-LeB4-IPP-SynMT1-nosT.

This plasmid (pSUN2-LeB4-IPP-SynMT1-nosT/USPP-rbcS-RnTATase1-nosT, FIG. 33) is used for generating transgenic Brassica napus plants.

Fragment A (2764 bp) in FIG. 33 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment C (957 bp) encodes the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase gene. Fragment D (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment E (678 bp) comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment F (235 bp) encodes the Vicia faba ribulose-bisphosphate carboxylase (rbcS) transit peptide. Fragment G (1365 bp) encodes the Rattus norvegicus tyrosine aminotransferase gene. Fragment H (272 bp) encodes the termination signal of the A. tumefaciens nopaline synthase gene.

Example 46

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase in a seed-specific manner, the vectors pSUN2-LeB4-IPP-SynMT1-nosT and pSUN2-USPP-AtTATase1-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 1 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase1-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-LeB4-IPP-SynMT1-nosT.

This plasmid (pSUN2-LeB4-IPP-SynMT1-nosT/USPP-AtTATase1-nosT, FIG. 34) is used for generating transgenic Brassica napus plants.

Fragment A (2764 bp) in FIG. 34 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment C (957 bp) encodes the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase gene. Fragment D (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment E (678 bp) comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment F (1269 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 1. Fragment G (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 47

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase in a seed-specific manner, the vectors pSUN2-LeB4-IPP-SynMT1-nosT and pSUN2-USPP-AtTATase3-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 3 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase3-nosT, the EcoRI end is filled in with Klenow enzyme, the construct is cloned into the SrfI-digested vector pSUN2-LeB4-IPP-SynMT1-nosT.

This plasmid (pSUN2-LeB4-IPP-SynMT1-nosT/USPP-AtTATase3-nosT, FIG. 35) is used for generating transgenic Brassica napus plants.

Fragment A (2764 bp) in FIG. 35 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment C (957 bp) encodes the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase gene. Fragment D (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment E (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene” (USPP), fragment F (1334 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 3. Fragment G (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 48

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase in a seed-specific manner, the vectors pSUN2-LeB4-IPP-SynMT1-nosT and pSUN2-USPP-AtTATase5-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 5 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase5-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-LeB4-IPP-SynMT1-nosT.

This plasmid (pSUN2-LeB4-IPP-SynMT1-nosT/USPP-AtTATase5-nosT, FIG. 36) is used for generating transgenic Brassica napus plants.

Fragment A (2764 bp) in FIG. 36 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment C (957 bp) encodes the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase gene. Fragment D (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment E (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment F (1389 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 5. Fragment G (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 49

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase in a seed-specific manner, the vectors pSUN2-LeB4-IPP-SynMT1-nosT and pSUN2-USPP-AtTATase6-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 6 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase6-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-LeB4-IPP-SynMT1-nosT.

This plasmid (pSUN2-LeB4-IPP-SynMT1-nosT/USPP-AtTATase6-nosT, FIG. 37) is used for generating transgenic Brassica napus plants.

Fragment A (2764 bp) in FIG. 37 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment C (957 bp) encodes the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase gene. Fragment D (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment E (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment F (1243 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 6. Fragment G (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 50

Generation of DNA constructs for expressing the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter and Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase under the control of a seed-specific promoter, the vectors pSUN2-LeB4-IPP-SynCyc-nosT and pCR4topoblunt-USPP-rbcS-RnTATase1-nosT are combined with each other.

The DNA fragment consisting of USP promoter, Rattus norvegicus tyrosine aminotransferase and nos termination sequence is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/USPP-rbcS-RnTATase1-nosT and cloned into the EcoRI-digested vector pSUN2-LeB4-IPP-SynCyc-nosT, whose EcoRI ends are also filled in.

This plasmid (pSUN2-LeB4-IPP-SynCyc-nosT/USPP-rbcS-RnTATase1-nosT, FIG. 38) is used for generating transgenic Brassica napus plants.

Fragment A (2764 bp) in FIG. 38 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment C (1100 bp) encodes the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase gene. Fragment D (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment E (678 bp) comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment F (235 bp) encodes the Vicia faba ribulose-bisphosphate carboxylase (rbcS) transit peptide. Fragment G (1365 bp) encodes the Rattus norvegicus tyrosine aminotransferase gene. Fragment H (272 bp) encodes the termination signal of the A. tumefaciens nopaline synthase gene.

Example 51

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase in a seed-specific manner, the vectors pSUN2-LeB4-IPP-SynCyc-nosT and pSUN2-USPP-AtTATase1-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 1 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase1-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the EcoRI-digested vector pSUN2-LeB4-IPP-SynCyc-nosT whose EcoRI ends are filled in with Klenow enzyme.

This plasmid (pSUN2-LeB4-IPP-SynCyc-nosT/USPP-AtTATase1-nosT, FIG. 39) is used for generating transgenic Brassica napus plants.

Fragment A (2764 bp) in FIG. 39 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment C (1100 bp) encodes the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase gene. Fragment D (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment E (678 bp) comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment F (1269 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 1. Fragment G (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 52

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase in a seed-specific manner, the vectors pSUN2-LeB4-IPP-SynCyc-nosT and pSUN2-USPP-AtTATase3-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 3 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase3-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the EcoRI-digested vector pSUN2-LeB4-IPP-SynCyc-nosT whose EcoRI ends are likewise filled in.

This plasmid (pSUN2-LeB4-IPP-SynCyc-nosT/USPP-AtTATase3-nosT, FIG. 40) is used for generating transgenic Brassica napus plants.

Fragment A (2764 bp) in FIG. 40 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment C (1100 bp) encodes the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase gene. Fragment D (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment E (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene” (USPP), fragment F (1334 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 3. Fragment G (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 53

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase in a seed-specific manner, the vectors pSUN2-LeB4-IPP-SynCyc-nosT and pSUN2-USPP-AtTATase5-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 5 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase5-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the EcoRI-digested vector pSUN2-LeB4-IPP-SynCyc-nosT whose EcoRI ends are likewise filled in.

This plasmid (pSUN2-LeB4-IPP-SynCyc-nosT/USPP-AtTATase5-nosT, FIG. 41) is used for generating transgenic Brassica napus plants.

Fragment A (2764 bp) in FIG. 41 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment C (1100 bp) encodes the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase gene. Fragment D (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment E (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment F (1389 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 5. Fragment G (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 54

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter and the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase in a seed-specific manner, the vectors pSUN2-LeB4-IPP-SynCyc-nosT and pSUN2-USPP-AtTATase6-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 6 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase6-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the EcoRI-digested vector pSUN2-LeB4-IPP-SynCyc-nosT whose EcoRI ends are likewise filled in.

This plasmid (pSUN2-LeB4-IPP-SynCyc-nosT/USPP-AtTATase6-nosT, FIG. 42) is used for generating transgenic Brassica napus plants.

Fragment A (2764 bp) in FIG. 42 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment C (1100 bp) encodes the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase gene. Fragment D (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment E (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment F (1243 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 6. Fragment G (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 55

Generation of DNA constructs for expressing the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter and the Arabidopsis thaliana γ-tocopherol methyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter and the Arabidopsis thaliana γ-tocopherol methyltransferase in a seed-specific manner, the vectors pSUN2-SBPP-AtγTMT-35ST and pCR4topoblunt-USPP-rbcS-RnTATase1-nosT are combined with each other.

The DNA fragment consisting of USP promoter, Rattus norvegicus tyrosine aminotransferase and nos termination sequence is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/USPP-rbcS-RnTATase1-nosT and cloned into the SrfI-digested vector pSUN2-SBPP-AtγTMT-35sT.

This plasmid (pSUN2-SBPP-AtγTMT-35sT/USPP-rbcS-RnTATase1-nosT, FIG. 43) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 43 comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment B (235 bp) encodes the transit peptide of the Vicia faba ribulose-bisphosphate carboxylase (rbcS). Fragment C (1365 bp) encodes the Rattus norvegicus tyrosine aminotransferase gene. Fragment D (272 bp) encodes the termination signal of the A. tumefaciens nopaline synthase gene. Fragment E (1788 bp) comprises the promoter of the Vicia faba SBP gene, fragment F (1047 bp) encodes the Arabidopsis thaliana γ-tocopherol methyltransferase gene, fragment G (291 bp) encodes the cauliflower mosaic virus 35S terminator.

Example 56

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and the Arabidopsis thaliana γ-tocopherol methyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 1 under the control of a seed-specific promoter and the Arabidopsis thaliana γ-tocopherol methyltransferase in a seed-specific manner, the vectors SUN2-SBPP-AtγTMT-35sT and pSUN2-USPP-AtTATase1-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 1 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase1-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-SBPP-AtγTMT-35sT.

This plasmid (pSUN2LeB4-SBPP-AtγTMT-35sT/USPP-AtTATase1-nosT, FIG. 44) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 44 comprises the promoter of the Vicia faba unknown seed protein gene (USPP), fragment B (1269 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 1 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (1788 bp) comprises the promoter of the Vicia faba SBP gene, fragment E (1047 bp) encodes the Arabidopsis thaliana γ-tocopherol methyltransferase gene, fragment F (291 bp) encodes the cauliflower mosaic virus 35S terminator.

Example 57

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter and the Arabidopsis thaliana γ-tocopherol methyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 3 under the control of a seed-specific promoter and the Arabidopsis thaliana γ-tocopherol methyltransferase in a seed-specific manner, the vectors pSUN2-SBPP-AtγTMT-35sT and pSUN2-USPP-AtTATase3-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 3 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase3-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-SBPP-AtγTMT-35sT.

This plasmid (pSUN2-SBPP-AtγTMT-35sT/USPP-AtTATase3-nosT, FIG. 45) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 45 comprises the promoter of the Vicia faba “unknown seed protein gene” (USPP), fragment B (1334 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 3 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (1788 bp) comprises the promoter of the Vicia faba SBP gene, fragment E (1047 bp) encodes the Arabidopsis thaliana γ-tocopherol methyltransferase gene, fragment F (291 bp) encodes the cauliflower mosaic virus 35S terminator.

Example 58

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter and the Arabidopsis thaliana γ-tocopherol methyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 5 under the control of a seed-specific promoter and the Arabidopsis thaliana γ-tocopherol methyltransferase in a seed-specific manner, the vectors pSUN2-SBPP-AtγTMT-35sT and pSUN2-USPP-AtTATase5-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 5 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase5-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-SBPP-AtγTMT-35sT.

This plasmid (pSUN2-SBPP-AtγTMT-35sT/USPP-AtTATase5-nosT, FIG. 46) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 46 comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment B (1389 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 5 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (1788 bp) comprises the promoter of the Vicia faba SBP gene, fragment E (1047 bp) encodes the Arabidopsis thaliana γ-tocopherol methyltransferase gene, fragment F (291 bp) encodes the cauliflower mosaic virus 35S terminator.

Example 59

Generation of DNA constructs for expressing the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter and the Arabidopsis thaliana γ-tocopherol methyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana tyrosine aminotransferase 6 under the control of a seed-specific promoter and the Arabidopsis thaliana γ-tocopherol methyltransferase in a seed-specific manner, the vectors pSUN2-SBPP-AtγTMT-35sT and pSUN2-USPP-AtTATase6-nosT are combined with each other.

The DNA fragment encoding the expression cassette consisting of: USP promoter, Arabidopsis thaliana tyrosine aminotransferase 6 gene and nos terminator is isolated as SmaI/EcoRI fragment from the plasmid pSUN2-USPP-AtTATase6-nosT, the EcoRI end is filled in with Klenow enzyme, and the construct is cloned into the SrfI-digested vector pSUN2-SBPP-AtγTMT-35sT.

This plasmid (pSUN2-SBPP-AtγTMT-35sT/USPP-AtTATase6-nosT, FIG. 47) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 47 comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment B (1243 bp) encodes the Arabidopsis thaliana tyrosine aminotransferase gene 6 and fragment C (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment D (1788 bp) comprises the promoter of the Vicia faba SBP gene, fragment E (1047 bp) encodes the Arabidopsis thaliana γ-tocopherol methyltransferase gene, fragment F (291 bp) encodes the cauliflower mosaic virus 35S terminator.

Example 60

Generation of DNA constructs for expressing the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase under the control of a seed-specific promoter and for the seed-specific suppression of the expression of the Brassica napus homogentisate dioxygenase gene

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase under the control of a seed-specific promoter and suppress the expression of the endogenous Brassica napus homogentisate dioxygenase gene in a seed-specific manner, the vectors pCR4topoblunt-LeB4-NtGGPPOR-nosT (see hereinbelow) and pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT are combined with each other.

The expression cassette consisting of LeB4 promoter, Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene and nos termination sequence is amplified by means of PCR using a sense-specific primer (LeB4-SrfI 5′: SEQ. ID. No. 54) and an antisense-specific primer (nosT-SrfI 3′ SEQ. ID. No. 53), and cloned into the vector pCR4topoblunt (Invitrogen).

The resulting plasmid is pCR4topoblunt-LeB4-NtGGPPOR-nosT

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 1 μl of a puc19-LeB4-NtGGPPOR-nosT plasmid DNA
    • 0.2 mM DATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of LeB4-SrfI 5′ primer
    • 40 pmol of nosT-SrfI 3′ primer
    • 5 μl of 10× Pfu1 DNA polymerase buffer (Stratagene)
    • 5 U of Pfu1 DNA polymerase (Stratagene)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 55° C. (annealing)
  • Step 4: 10 minutes at 68° C. (elongation) 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The DNA fragment encoding the expression cassette composed of: LeB4 promoter, Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene and nos terminator is isolated as SrfI fragment from the plasmid pCR4topoblunt-LeB4-NtGGPPOR-nosT and cloned into the EcoRV-digested vector pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT.

This plasmid (pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT/LeB4-NtGGPPOR-nosT, FIG. 48) is used for generating transgenic Brassica napus plants.

Fragment A (2559 bp) in FIG. 48 comprises the promoter of the Vicia faba vicilin gene, fragment B (580 bp) encodes a fragment of the Brassica napus homogentisate dioxygenase gene. Fragment C (190 bp) encodes the intron 2 (IV2) of the Solanum tuberosum ST-LS1 gene. Fragment D is identical with fragment B, but has the opposite orientation in the vector relative to B. Fragment E (208 bp) encodes the termination signal 2 of the octopine gene. Fragment F (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment G (1509 bp) encodes the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene. Fragment H (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 61

Generation of DNA constructs for expressing the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter and for the seed-specific suppression of the expression of the Brassica napus homogentisate dioxygenase gene.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter and which suppress the expression of the endogenous Brassica napus homogentisate dioxygenase gene in a seed-specific fashion, the vectors pCR4topoblunt-USPP-AtHPPD-ocsT (see below) and pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT are combined with each other.

The expression cassette composed of: USP promoter, Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase and ocs termination sequence 1 is amplified by means of PCR using a sense-specific primer (USPP-SrfI-5′: SEQ. ID. No. 52) and an antisense-specific primer (ocsT-SrfI-3′: SEQ. ID. No. 55) and cloned into the vector pCR4topoblunt (Invitrogen). The resulting plasmid is pCR4topoblunt-USPP-AtHPPD-ocsT.

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 1 μl of a pSUN2-USPP-AtHPPD-ocsT plasmid DNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of USPP-SrfI 5′ primer
    • 40 pmol of ocsT-SrfI 3′ primer
    • 5 μl of 10×Pfu1 DNA polymerase buffer (Stratagene)
    • 5 U of Pfu1 DNA polymerase (Stratagene)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 55° C. (annealing)
  • Step 4: 10 minutes at 68° C. (elongation) 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The DNA fragment consisting of USP promoter, Arabiaopsis thaliana hydroxyphenylpyruvate dioxygenase and ocs termination sequence is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/USPP-AtHPPD-ocsT and cloned into the EcoRV-digested vector pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT.

This plasmid (pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT/USPP-AtHPPD-ocsT, FIG. 49) is used for generating transgenic Brassica napus plants.

Fragment A (2559 bp) in FIG. 49 comprises the promoter of the Vicia faba vicilin gene, fragment B (580 bp) encodes a fragment of the Brassica napus homogentisate dioxygenase gene. Fragment C (190 bp) encodes the intron 2 (IV2) of the Solanum tuberosum ST-LS1 gene. Fragment D is identical with fragment B, but has the opposite orientation in the vector relative to B. Fragment E (208 bp) encodes the termination signal 2 of the octopine gene. Fragment F (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment G (1338 bp) encodes the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene. Fragment H (713 bp) encodes the octopine synthase termination signal 1.

Example 62

Generation of DNA constructs for expressing the Arabidopsis thaliana homogentisate phytyltransferase under the control of a seed-specific promoter and for the seed-specific suppression of the expression of the Brassica napus homogentisate dioxygenase gene

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana homogentisate phytyltransferase under the control of a seed-specific promoter and which suppress the expression of the endogenous Brassica napus homogentisate dioxygenase gene in a seed-specific fashion, the vectors pCR4topoblunt-USPP-AtHPT-ocsT (see below) and pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT are combined with each other.

The expression cassette composed of: USP promoter, Arabidopsis thaliana homogentisate phytyltransferase and ocs termination sequence is amplified by means of PCR using a sense-specific primer (USPP-SrfI-5′ SEQ. ID. No. 52) and an antisense-specific primer (ocsT-SrfI-3′ SEQ. ID. No. 55) and cloned into the vector pCR4topoblunt (Invitrogen).

The resulting plasmid is pCR4topoblunt-USPP-AtHPT-ocsT.

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 1 μl of a pSUN2-USPP-AtHPT-ocsT plasmid DNA
    • 0.2 mM DATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of USPP-SrfI 5′ primer
    • 40 pmol of ocsT-SrfI 3′ primer
    • 5 μl of 10× Pfu1 DNA polymerase buffer (Stratagene)
    • 5 U of Pfu1 DNA polymerase (Stratagene)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 55° C. (annealing)
  • Step 4: 10 minutes at 68° C. (elongation) 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The DNA fragment consisting of USP promoter, Arabidopsis thaliana homogentisate phytyltransferase and ocs termination sequence 1 is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/USPP-AtHPT-ocsT and cloned into the EcoRV-digested vector pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT.

This plasmid (pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT/USPP-AtHPT-ocsT, FIG. 50) is used for generating transgenic Brassica napus plants.

Fragment A (2559 bp) in FIG. 50 comprises the promoter of the Vicia faba vicilin gene, fragment B (580 bp) encodes a fragment of the Brassica napus homogentisate dioxygenase gene. Fragment C (190 bp) encodes the intron 2 (IV2) of the Solanum tuberosum ST-LS1 gene. Fragment D is identical with fragment B, but has the opposite orientation in the vector relative to B. Fragment E (208 bp) encodes the termination signal 2 of the octopine gene. Fragment F (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment G (1182 bp) encodes the Arabidopsis thaliana homogentisate phytyltransferase gene. Fragment H (713 bp) encodes the octopine synthase gene termination signal 1.

Example 63

Generation of DNA constructs for expressing the Synechocystis spec PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter and for the seed-specific suppression of the expression of the Brassica napus homogentisate dioxygenase gene

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Synechocystis spec PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter and which suppress the expression of the endogenous Brassica napus homogentisate dioxygenase gene in a seed-specific fashion, the vectors pCR4topoblunt-LeB4-IPP-SynMt1-nosT (see hereinbelow) and pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT are combined with each other.

The expression cassette composed of: LeB4 promoter, the sequence encoding the transit peptide of the A. thaliana plastid-specific isopentenyl-pyrophosphate isomerase 2 (IPP-2), the Synechocystis spec PCC6803 2-methyl-6-phytylhydroquinone methyltranserase and nos termination sequence is amplified by means of PCR using a sense-specific primer (LeB4-SrfI-5′: SEQ. ID. No. 54) and an antisense-specific primer (nosT-SrfI-3′: SEQ. ID. No. 53) and cloned into the vector pCR4topoblunt (Invitrogen). The resulting plasmid is pCR4topoblunt-LeB4-IPP-SynMt1-nosT.

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix consisting of:

    • 1 μl of a pSUN2-LeB4-IPP-SynMT1-nosT plasmid DNA
    • 0.2 mM dATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of LeB4-SrfI 5′ primer
    • 40 pmol of nosT-SrfI 3′ primer
    • 5 μl of 10× Pfu1 DNA polymerase buffer (Stratagene)
    • 5 U of Pfu1 DNA polymerase (Stratagene)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 55° C. (annealing)
  • Step 4: 10 minutes at 68° C. (elongation) 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The DNA fragment consisting of LeB4 promoter, the sequence encoding the transit peptide of the A. thaliana plastid-specific isopentenyl-pyrophosphate isomerase 2 (IPP-2), the Synechocystis spec PCC6803 2-methyl-6-phytylhydroquinone methyltransferase and the nos termination sequence is isolated as SrfI fragment from the plasmid pCR4topoblunt/LeB4-IPP-SynMT1-nosT and cloned into the EcoRV-digested vector pSUN2-Pvic-*nHGD-STLS1-α*nHGD-ocsT.

This plasmid (pSUN2-Pvic-*nHGD-STLS1-α*nHGD-ocsT/USPP-LeB4-IPP-SynMT1-nosT, FIG. 51) is used for generating transgenic Brassica napus plants.

Fragment A (2559 bp) in FIG. 51 comprises the promoter of the Vicia faba vicilin gene, fragment B (580 bp) encodes a fragment of the Brassica napus homogentisate dioxygenase gene. Fragment C (190 bp) encodes the intron 2 (IV2) of the Solanum tuberosum ST-LS1 gene. Fragment D is identical with fragment B, but has the opposite orientation in the vector relative to B. Fragment E (208 bp) encodes the termination signal 2 of the octopine gene. Fragment F (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment G (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment H (957 bp) encodes the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase gene. Fragment I (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 64

Generation of DNA constructs for expressing the Synechocystis spec PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase under the control of a seed-specific promoter and for the seed-specific suppression of the expression of the Brassica napus homogentisate dioxygenase gene

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Synechocystis spec PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase under the control of a seed-specific promoter and which suppress the expression of the endogenous Brassica napus homogentisate dioxygenase gene in a seed-specific fashion, the vectors pCR4topoblunt-LeB4-IPP-SynCyc-nosT (see below) and pSUN27Pvic-*BnHGD-STLS1-α*BnHGD-ocsT are combined with each other.

The expression cassette composed of: LeB4 promoter, the sequence encoding the transit peptide of the Arabidopsis thaliana plastid-specific isopentenyl-pyrophosphate isomerase 2 (IPP-2), the Synechocystis spec PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase and nos termination sequence is amplified by means of PCR using a sense-specific primer (LeB4-EcoR5-5′: SEQ. ID. No. 56) and an antisense-specific primer (nosT-EcoR5-3′: SEQ. ID. No. 57) and cloned into the vector pCR4topoblunt (Invitrogen). The resulting plasmid is pCR4topoblunt-LeB4-IPP-SynMt1-nosT.

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix comprising:

    • 1 μl of a pSUN2-Leb4-IPP-SynCyc-nosT plasmid DNA
    • 0.2 mM DATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of LeB4-EcoR5 5′ primer
    • 40 pmol of nosT-EcoR5 3′ primer
    • 5 μl of 10× Pfu1 DNA polymerase buffer (Stratagene)
    • 5 U of Pfu1 DNA polymerase (Stratagene)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 55° C. (annealing)
  • Step 4: 10 minutes at 68° C. (elongation) 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The DNA fragment consisting of LeB4 promoter, the sequence encoding the transit peptide of the Arabidopsis thaliana plastid-specific isopentenyl-pyrophosphate isomerase 2 (IPP-2), the Synechocystis spec PCC6808 2,3-dimethyl-5-phytylplastoquinol cyclase and the nos termination sequence is isolated as EcoR5 fragment from the plasmid pCR4TOPOblunt/LeB-IPP-SynCyc-nosT and cloned into the EcoR5-digested vector SUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT.

This plasmid (pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT/LeB-IPP-SynCyc-nosT, FIG. 52) is used for generating transgenic Brassica napus plants:

Fragment A (2559 bp) in FIG. 52 comprises the promoter of the Vicia faba vicilin gene, fragment B (580 bp) encodes a fragment of the Brassica napus homogentisate dioxygenase gene. Fragment C (190 bp) encodes the intron 2 (IV2) of the Solanum tuberosum ST-LS1 gene. Fragment D is identical with fragment B, but has the opposite orientation in the vector relative to B. Fragment E (208 bp) encodes the termination signal of the octopine gene. Fragment F (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment G (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment H (1100 bp) encodes the Synechocystis sp. PCC6808 2,3-dimethyl-5-phytylplastoquinol cyclase gene. Fragment I (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 65

Generation of DNA constructs for expressing the Arabidopsis thaliana γ-tocopherol methyltransferase under the control of a seed-specific promoter and for the seed-specific suppression of the expression of the Brassica napus homogentisate dioxygenase gene.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana γ-tocopherol methyltransferase under the control of a seed-specific promoter and which suppress the expression of the endogenous Brassica napus homogentisate dioxygenase gene in a seed-specific fashion, the vectors pCR4topoblunt-SBPP-γTMT-35sT (see below) and pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT are combined with each other.

The expression cassette consisting of: LeB4 promoter, the sequence encoding the transit peptide of the A. thaliana plastid-specific isopentenyl-pyrophosphate isomerase-2 (IPP-2), the Arabidopsis thaliana γ-tocopherol methyltransferase and the nos termination sequence is amplified by means of PCR using a sense-specific primer (SBPP-SRFI-5′: SEQ. ID. No. 58) and an antisense-specific primer (nosT-SRFI-3′ SEQ. ID. No. 53) and cloned into the vector pCR4topoblunt (Invitrogen). The resulting plasmid is pCR4topoblunt-SBPP-γTMT-35sT.

The PCR conditions were as follows:

The PCR was carried out with a 50 μl reaction mix comprising:

    • 1 μl of a pSUN2-SBPP-γTMT-35sT plasmid DNA
    • 0.2 mM DATP, dTTP, dGTP, dCTP
    • 1.5 mM Mg(OAc)2
    • 5 μg of bovine serum albumin
    • 40 pmol of SBPP-SRFI 5′ primer
    • 40 pmol of 35sT-SRFI 3′ primer
    • 5 μl of 10× Pfu1 DNA polymerase buffer (Stratagene)
    • 5 U of Pfu1 DNA polymerase (Stratagene)

The PCR was carried out under the following cycle conditions:

  • Step 1: 5 minutes at 94° C. (denaturing)
  • Step 2: 3 seconds at 94° C.
  • Step 3: 1 minute at 55° C. (annealing)
  • Step 4: 10 minutes at 68° C. (elongation) 30 cycles of steps 2-4
  • Step 5: 10 minutes at 72° C. (post-elongation)

The DNA fragment consisting of LeB4 promoter, the sequence encoding the transit peptide of the A. thaliana plastid-specific isopentenyl-pyrophosphate isomerase 2 (IPP-2), the Arabidopsis thaliana γ-tocopherol methyltransferase and the nos termination sequence is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/SBPP-γTMT-35sT and cloned into the EcoRV-digested vector pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT.

This plasmid (pSUN2-Pvic-*BnHGD-STLS1-α*BnHGD-ocsT/SBPP-γTMT-35sT, FIG. 53) is used for generating transgenic Brassica napus plants:

Fragment A (2559 bp) in FIG. 53 comprises the promoter of the Vicia faba vicilin gene, fragment B (580 bp) encodes a fragment of the Brassica napus homogentisate dioxygenase gene. Fragment C (190 bp) encodes the intron 2 (IV2) of the Solanum tuberosum ST-LS1 gene. Fragment D is identical with fragment B, but has the opposite orientation in the vector relative to B. Fragment E (208 bp) encodes the termination signal 2 of the octopine gene. Fragment F (1788 bp) comprises the promoter of the Vicia faba SBP gene, fragment G (1047 bp) encodes the Arabidopsis thaliana γ-tocopherol methyltransferase gene, fragment H (291 bp) encodes the cauliflower mosaic virus 35S terminator.

Example 66

Generation of DNA constructs for expressing the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter and the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter and which express the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase in a seed-specific manner, the vectors pSUN2-NtGGPPOR-nosT and CR4topoblunt-USPP-AtHPPD-ocsT are combined with each other.

The DNA fragment consisting of USP promoter, Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene and ocs termination sequence is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/USPP-AtHPPD-ocsT and cloned into the SmaI-digested vector pSUN2-LeB4-NtGGPPOR-nosT.

This plasmid (pSUN2LeB4-NtGGPPORnosT/USPP-AtHPPD-ocsT, FIG. 54) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 54 comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment B (1338 bp) encodes the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene. Fragment C (713 bp) encodes the termination signal 1 of the octopine synthase gene. Fragment D (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment E (1509 bp) encodes the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene. Fragment F (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 67

Generation of DNA constructs for expressing the Arabidopsis thaliana homogentisate phytyltransferase under the control of a seed-specific promoter and the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana homogentisate phytyltransferase under the control of a seed-specific promoter and which express the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase in a seed-specific manner, the vectors pSUN2-LeB4-NtGGPPOR-nosT and pCR4topoblunt-USPP-AtHPT-ocsT are combined with each other.

The DNA fragment consisting of USP promoter, Arabidopsis thaliana homogentisate phytyltransferase and ocs termination sequence is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/USPP-AtHPT-ocsT and cloned into the SmaI-digested vector pSUN2-LeB-NtGGPPOR-nosT.

This plasmid (pSUN2-LeB4-NtGGPPOR-nosT/USPP-AtHPT-ocsT, FIG. 55) is used for generating transgenic Brassica napus plants:

Fragment A (678 bp) in FIG. 55 comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment B (1182 bp) encodes the Arabidopsis thaliana homogentisic acid phytyltransferase gene. Fragment C (713 bp) encodes the termination signal 1 of the octopine synthase gene. Fragment D (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment E (1509 bp) encodes the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene. Fragment F (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 68

Generation of DNA constructs for expressing the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter, the Synechocystis spec PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter and the Arabidopsis thaliana γ-tocopherol methyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter, the Synechocystis spec PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter and the Arabidopsis thaliana γ-tocopherol methyltransferase under the control of a seed-specific promoter, the vectors pSUN2-SBPP-AtγTMT35ST and pCR4topoblunt-LeB4-IPP-SynMT1-nosT and pCR4topoblunt-USPP-AtHPPDocsT are combined with each other.

The DNA fragment consisting of USP promoter, Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene and ocs termination sequence 1 is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/USPP-AtHPPD-ocsT and cloned into the SrfI-digested vector pSUN2-SBPP-AtγTMT 35ST, which is likewise previously digested with the restriction enzyme SrfI. The DNA fragment composed of LeB4 promoter, Synechocystis spec PCC6803 2-methyl-6-phytylhydroquinone methyltransferase and nos termination sequence is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/LeB-SynMT1-nosT into the above-obtained plasmid pSUN2-SBPP-AtγTMT-35sT/USPP-AtHPPD-ocsT and cloned into the XhoI-digested vector pSUN2-SBPP-AtγTMT35sT/USPP-AtHPPD-ocsT after the XhoI ends had been filled in.

This plasmid pSUN2-SBPP-AtγTMT35sT/USPP-AtHPPD-ocsT/LeB-SynMT1-nosT, FIG. 56) is used for generating transgenic Brassica napus plants:

Fragment A (1788 bp) in FIG. 56 comprises the promoter of the Vicia faba SBP gene, fragment B (1047 bp) encodes the Arabidopsis thaliana γ-tocopherol methyltransferase gene, fragment C (291 bp) encodes the cauliflower mosaic virus 35S terminator. Fragment D (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment E (1338 bp) encodes the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene. Fragment F (713 bp) encodes the termination signal 1 of the octopine synthase gene. Fragment G (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment H (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment I (957 bp) encodes the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase gene. Fragment J (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 69

Generation of DNA constructs for expressing the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter, the Synechocystis spec PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter and the Synechocystis spec PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter, the vector pSUN2-USPP-AtHPPDocsT and the vector pCR4topoblunt-LeB4-IPP-SynMT1-nosT are combined with each other.

The DNA fragment consisting of LeB4 promoter, Synechocystis spec PCC6803 2-methyl-6-phytylhydroquinone methyltransferase and nos termination sequence is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/LeB-SynMT1-nosT and cloned into the XhoI-digested vector pSUN2-USPP-AtHPPD-ocsT kloniert whose XhoI ends are filled in.

This plasmid pSUN2-USPP-AtHPPD-ocsT/LeB-SynMT1-nosT, FIG. 57) is used for generating transgenic Brassica napus plants:

Fragment A (678 bp) in FIG. 57 comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment B (1338 bp) encodes the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene and fragment C (713 bp) encodes the termination signal 1 of the octopine synthase gene. Fragment D (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment E (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment F (957 bp) encodes the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase gene. Fragment G (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 70

Generation of DNA constructs for expressing the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter and the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase under the control of a seed-specific promoter and the Arabidopsis thaliana homogentisate phytyltransferase under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase under the control of a seed-specific promoter and the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase under the control of a seed-specific promoter and the Arabidopsis thaliana homogentisate phytyltransferase under the control of a seed-specific promoter, the vectors pSUN2-LeB4-NtGGPPOR-nosT/USPP-AtHPT-ocsT and pCR4topoblunt-USPP-AtHPPD-ocsT are combined with each other.

The DNA fragment consisting of USP promoter, Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase and ocs termination sequence 1 is isolated as SrfI fragment from the plasmid pCR4TOPOblunt/USPP-AtHPPD-ocsT and cloned into the XhoI-digested vector pSUN2-LeB4-NtGGPPOR-nosT/USPP-AtHPT-ocsT after the XhoI ends have previously been made blunt-ended with Klenow polymerase.

This plasmid (pSUN2LeB4-NtGGPPORnosT/USPP-AtHPPD-ocsT/USPP-AtHPT-ocsT, FIG. 58) is used for generating transgenic Brassica napus plants.

Fragment A (678 bp) in FIG. 58 comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment B (1338 bp) encodes the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene. Fragment C (713 bp) encodes the termination signal 1 of the octopine synthase gene. Fragment D (678 bp) comprises the promoter of the Vicia faba “unknown seed protein gene”, fragment E (1182 bp) encodes the Arabidopsis thaliana homogentisate phytyltransferase gene. Fragment F (713 bp) encodes the termination signal 1 of the octopine synthase gene. Fragment G (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment H (1509 bp) encodes the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene. Fragment I (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 71

Generation of DNA constructs for expressing the Synechocystis spec PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase under the control of a seed-specific promoter, the Synechocystis spec PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter, and the Arabidopsis thaliana γ-tocopherol methyltransferase under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic Brassica napus plants which express the Synechocystis spec PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase under the control of a seed-specific promoter, the Synechocystis spec PCC6803 2-methyl-6-phytylhydroquinone methyltransferase under the control of a seed-specific promoter, and the Arabidopsis thaliana γ-tocopherol methyltransferase under the control of a seed-specific promoter, the constructs pSUN2-SBPP-AtγTMT35ST/USPP-AtHPPD-ocsT/LeB-SynMT1-nosT and pCR4topoblunt/LeB-IPP-SynCyc-nosT are used.

The DNA fragment consisting of LeB4 promoter, Synechocystis spec PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase and nos termination sequence is isolated as EcoR5 fragment from the plasmid pCR4topoblunt/LeB-IPP-SynCyc-nosT and cloned into the SrfI-digested vector pSUN2-SBPP-AtγTMT-35ST/USPP-AtHPPD-ocsT/LeB-SynMT1-nosT which is previously digested with the restriction enzyme SrfI. Thus, the expression cassette composed of USP promoter, Arabidopsis thaliana hydroxyphenylpyruvate dihydrogenase gene and ocs termination sequence is exchanged for the expression cassette composed of LeB4 promoter, the Synechocystis spec PCC6803 2,3-dimethyl-5-phytylplastochinol cyclase gene and the nos termination sequence.

This plasmid pSUN2-SBPP-AtγTMT35sT/LeB-IPP-SynCyc-nosT/LeB-IPP-SynMT1-nosT, FIG. 59) is used for generating transgenic Brassica napus plants.

Fragment A (1788 bp) in FIG. 59 comprises the promoter of the Vicia faba SBP gene, fragment B (1047 bp) encodes the Arabidopsis thaliana γ-tocopherol methyltransferase gene, fragment C (291 bp) encodes the cauliflower mosaic virus 35S terminator. Fragment D (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment E (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment F (1100 bp) encodes the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase gene. Fragment G (272 bp) encodes the termination signal of the nopaline synthase gene. Fragment H (2764 bp) comprises the promoter of the Vicia faba legumin B4 gene, fragment I (235 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment J (957 bp) encodes the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase gene. Fragment K (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 72

Generation of DNA constructs for expressing the Rattus norvegicus tyrosine aminotransferase under the control of a seed-specific promoter.

To prepare chimeric DNA constructs for generating transgenic A. thaliana, Nicotiana tabacum and B. napus plants which express the Rattus norvegicus tyrosine aminotransferase (Seq. ID. No. 1) under the control of a seed-specific promoter, a derivative of the vector pGPTVkan (D. Becker, E. Kemper, J. Schell, R. Masterson. Plant Molecular Biology 20: 1195-1197, 1992) was used.

This vector was modified in such a way that it contains the seed-specific promoter of the legumin B4 gene (Kafatos et al., Nuc. Acid. Res., 14(6):2707-2720, 1986), the sequence encoding the transit peptide of the A. thaliana plastid-specific isopentenyl-pyrophosphate isomerase 2 (IPP-2) (Badur, unpublished) and the termination signal of the A. tumefaciens nopaline synthase (Depikker et al., J. Mol. Appl. Genet. 1, 561-73, 1982).

The DNA fragment encoding the Rattus norvegicus tyrosine aminotransferase gene was cloned as EcoR5 fragment into the vector pPTVKan-LeP-IPPTP11 after the latter had been digested with the restriction enzyme SalI, and the ends of the linearized plasmid had been made blunt-ended with Klenow enzyme. This generated a translational fusion with the IPP-2 transit peptide and thus ensures the import of tyrosine aminotransferase into the plastids. This plasmid pPTVkan-IPPTP11-TATaseRNnos (also termed pPTVkan-LeB4-IPP-RnTATase-nosT, FIG. 61) was used for generating transgenic Brassica napus and A. thaliana plants.

Fragment A (2764 bp) in FIG. 61 comprises the promoter of the Vicia faba legumin B4 gene, fragment B (207 bp) encodes the transit peptide of the A. thaliana isopentenyl-pyrophosphate isomerase 2. Fragment C (1377 bp) encodes the Rattus norvegicus tyrosine aminotransferase gene. Fragment D (272 bp) encodes the termination signal of the nopaline synthase gene.

Example 73

Generation of expression cassettes comprising the Rattus norvegicus tyrosine aminotransferase gene

Transgenic Nicotiana tabacum and Arabidopsis thaliana plants which express the Rattus norvegicus tyrosine aminotransferase (Seq. ID. No. 1) under the control of the constitutive CaMV (cauliflower mosaic virus) 35S promoter were generated (Franck et al., Cell 21: 285-294, 1980).

The basis of the plasmid generated for the constitutive expression of the Rattus norvegicus tyrosine aminotransferase 1 was pBinAR-IPP-Tp-10 (Ralf Badur, PhD thesis, University of Göttingen, 1998). This vector is a derivative of pBinAR (Höfgen and Willmitzer, Plant Sci. 66: 221-230, 1990) and comprises the CaMV (cauliflower mosaic virus) 35S promoter (Franck et al., 1980), the termination signal of the octopine synthase gene (Gielen et al., EMBO J. 3: 835-846, 1984) and the sequence encoding the transit peptide of the A. thaliana plastid-specific isopentenyl-pyrophosphate isomerase 2 (IPP-2) (Badur, unpublished). Cloning the Rattus norvegicus tyrosine aminotransferase into this vector, taking into consideration the correct reading frame, gives rise to a translational fusion of tyrosine aminotransferase with the plastid transit peptide. Thus, the transgene is transported into the plastids.

To generate this plasmid, the tyrosine aminotransferase gene was isolated from the plasmid pGEM-T/tyrosine aminotransferase using the flanking EcoRV restriction cleavage sites. This fragment was ligated into an SmaI-cut pBinAR-IPP-Tp-10, using standard methods (see FIG. 60). This plasmid pBinAR-IPP-Tp-10/tyrosine aminotransferase (alternatively also termed pBinAr-35SP-IPP-RnTATase-ocsT) was used for generating transgenic Nicotiana tabacum and A. thaliana plants.

Fragment A (529 bp) in FIG. 60 comprises the cauliflower mosaic virus 35S promoter (nucleotides 6909 to 7437 of the cauliflower mosaic virus), fragment B (207 bp) encodes the transit peptide of the isopentenyl-pyrophosphate isomerase 2, fragment C (1377 bp) encodes the Rattus norvegicus tyrosine aminotransferase gene 1, fragment D (208 bp) encodes the termination signal of the octopine synthase gene.

Example 74

Generation of transgenic Arabidopsis thaliana plants

Wild-type Arabidopsis thaliana plants (Columbia) are transformed with Agrobacterium tumefaciens strain (GV3101 [pMP90]) based on a modified vacuum infiltration method (Steve Clough and Andrew Bent. Floral dip: a simplified method for Agrobacterium mediated transformation of A. thaliana. Plant J 16(6):735-43, 1998; Bechtold, N. Ellis, J. and Pelltier, G., in: Planta Agrobacterium-mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. CRAcad Sci Paris, 1993, 1144(2):204-212). The Agrobacterium tumefaciens cells used are previously transformed with the above-described DNA constructs.

Seeds of the primary transformants are selected on the basis of their resistance to antibiotics. Seedlings which are resistant to antibiotics were transplanted into soil and used for biochemical analysis for fully-developed plants.

Example 75

Generation of transgenic Nicotiana tabacum plants

Ten ml of YEB medium supplemented with antibiotic (5 g/l beef extract, 1 g/l yeast extract, 5 g/l peptone, 5 g/l sucrose and 2 mM MgSO4) are inoculated with a colony of Agrobacterium tumefaciens, and the culture was grown overnight at 28° C. The cells were pelleted for 20 minutes at 4° C., 3500 rpm, using a bench-top centrifuge and then resuspended under sterile conditions in fresh YEB medium without antibiotics. The cell suspension is used for the transformation.

The sterile-grown wild-type plants are obtained by vegetative propagation. To this end, only the tip of the plant is cut off and transferred to fresh 2 MS medium in a sterile preserving jar. As regards the rest of the plant, the hairs on the upper side of the leaves and the central veins of the leaves are removed. Using a razor blade, the leaves are cut into sections of approximate size 1 cm2. The agrobacterial culture is transferred into a small Petri dish (diameter 2 cm). The leaf sections are briefly drawn through this solution and placed with the underside of the leaf on 2 MS medium in Petri dishes (diameter 9 cm) in such a way that they touch the medium. After two days in the dark at 25° C., the explants are transferred to plates with callus induction medium and warmed to 28° C. in the controlled-environment cabinet. The medium needs to be changed every 7 to 10 days. As soon as calli form, the explants are transferred into sterile preserving jars onto shoot induction medium supplemented with Claforan (0.6% BiTec agar (w/v), 2.0 mg/l zeatin ribose, 0.02 mg/l naphthylacetic acid, 0.02 mg/l gibberellic acid, 0.25 g/ml claforan, 1.6% glucose (w/v) and 50 mg/l Kanamycin). Organogenesis starts after approximately one month and it is possible to cut off the shoots which had formed. The shoots are grown on 2 MS medium supplemented with Claforan and selection marker. As soon as a substantial root ball has developed, it is possible to put up the plants in seed compost.

Example 76

Generation of transgenic Brassica napus plants

Transgenic oilseed rape plants were generated approximately as described by Bade, J. B. and Damm, B. (in Gene Transfer to Plants, Potrykus, I. and Spangenberg, G., eds, Springer Lab Manual, Springer Verlag, 1995, 30-38), which also specifies the composition of the media and buffers used.

The transformations are effected with the Agrobacterium tumefaciens strain GV3101 [pMP90]. The DNA construct which confers specific expression in the seed is used for the transformation (FIG. 61). Additionally used constructs are those which confer specific expression in seeds and which are described in FIGS. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59. Seeds of Brassica napus var. Westar are surface-sterilized with 70% ethanol (v/v), washed in water for 10 minutes at 55° C., incubated in 1% strength hypochlorite solution (25% v/v Teepol,0.1% v/v Tween 20) for 20 minutes and washed six times with sterile water for in each case 20 minutes. The seeds are dried for three days on filter paper, and 10-15 seeds are germinated in a glass flask containing 15 ml of germination medium. The roots and apices are excised from several seedlings (approximate size 10 cm), and the hypocotyls which remain are cut into segments approx. 6 mm in length. The approximately 600 explants thus obtained are washed for 30 minutes with 50 ml of basal medium and transferred into a 300 ml flask. After addition of 100 ml of callus induction medium, the cultures are incubated for 24 hours at 100 rpm.

An overnight culture of the agrobacterial strain is set up at 29° C. in Luria broth medium supplemented with kanamycin (20 mg/l), and 2 ml of this are incubated for 4 hours in 50 ml of Luria broth medium without kanamycin for 4 hours at 29° C. to an OD600 of 0.4-0.5. After the culture has been pelleted for 25 minutes at 2000 rpm, the cell pellet is resuspended in 25 ml of basal medium. The bacterial concentration in the solution is brought to an OD600 of 0.3 by addition of further basal medium.

The callus induction medium is removed from the oilseed rape explants using sterile pipettes, 50 ml of agrobacterial solution are added, and the mixture is mixed carefully and incubated for 20 minutes. The agrobacterial suspension is removed, the oilseed rape explants are washed for 1 minute with 50 ml of callus induction medium, and 100 ml of callus induction medium are subsequently added. The material is cocultured for 24 hours on an orbital shaker at 100 rpm. Coculturing is stopped by removing the callus induction medium, and the explants are washed twice for in each case 1 minute with 25 ml and twice for 60 minutes with in each case 100 ml of wash medium at 100 rpm. The wash medium together with the explants is transferred to 15 cm Petri dishes, and the medium is removed using sterile pipettes.

For the regeneration, batches of 20-30 explants are transferred into 90 mm Petri dishes containing 25 ml of shoot induction medium supplemented with kanamycin. The Petri dishes are sealed with 2 layers of Leukopor and incubated at 25° C. and 2000 Lux at 8-hour-darkness photoperiods. Every 12 days, the developing calli are transferred to fresh Petri dishes containing shoot induction medium. All further steps for regenerating intact plants were carried out as described by Bade, J. B and Damm, B. (in: Gene Transfer to Plants, Potrykus, I. and Spangenberg, G., eds, Springer Lab Manual, Springer Verlag, 1995, 30-38).

Example 77

a) Characterization of the Transgenic Arabidopsis thaliana and Nicotiana tabacum Plants

The tocopherol and tocotrienol contents in the leaves and seeds of the plants transformed with the above-described constructs (Arabidopsis thaliana and Nicotiana tabacum) are analyzed. To this end, the transgenic plants are grown in the greenhouse, and plants which express the gene encoding the Rattus norvegicus tyrosine aminotransferase 1 are analyzed at Northern level. The tocopherol content and the tocotrienol content in the leaves and seeds of these plants are determined.

To this end, the leaf material of plants is frozen in liquid nitrogen immediately after sampling. The subsequent disruption of the cells is effected by means of a stirring apparatus by three incubations in an Eppendorf shaker at 30° C., 1000 rpm, in 100% methanol, for 15 minutes, the supernatants obtained in each case being combined.

Further incubation steps revealed no further release of tocopherols or tocotrienols.

To avoid oxidation, the extracts obtained were analyzed directly after the extraction with the aid of an HPLC system (Waters Allience 2690). Tocopherols and tocotrienols were separated using a reverse-phase column (ProntoSil 200-3-C30(R), Bischoff) using a mobile phase of 100% methanol, and identified with the aid of standards (Merck). The detection system used was the fluorescence of the substances (excitation 295 nm, emission 320 nm), which was detected with the aid of a Jasco FP 920 fluorescence detector.

In all cases, the tocopherol and/or tocotrienol concentration in transgenic plants was increased in comparison with untransformed plants.

b) Characterization of the Transgenic Brassica napus Plants

To illustrate that the vitamin E content in plants is increased by expressing the Rattus norvegicus tyrosine aminotransferase gene, the Arabidopsis thaliana tyrosine aminotransferase gene 1, the Arabidopsis thaliana tyrosine aminotransferase gene 3, the Arabidopsis thaliana tyrosine aminotransferase gene 5 or the Arabidopsis thaliana tyrosine aminotransferase gene 6, alone or in combination with at least one further gene selected from the group consisting of the Arabidopsis thaliana hydroxyphenylpyruvate dioxygenase gene, the Arabidopsis thaliana homogentisate phytyltransferase gene, the Nicotiana tabacum geranylgeranyl-pyrophosphate oxidoreductase gene, the Synechocystis sp. PCC6803 2-methyl-6-phytylhydroquinone methyltransferase gene, the Synechocystis sp. PCC6803 2,3-dimethyl-5-phytylplastoquinol cyclase gene, the Arabidopsis thaliana γ-tocopherol methyltransferase gene and the suppression of the expression of the homogentisate dioxygenase gene, the tocopherol and tocotrienol contents in the seeds of the plants (Brassica napus) transformed with the above-described constructs are analyzed.

To this end, the transgenic plants are grown in the greenhouse and analyzed at the Northern level. The tocopherol content and the tocotrienol content in the seeds of these plants are determined analogously to Example 77 a).

Example 78

Generation of transgenic Arabidopsis thaliana plants which overexpress tyrosine aminotransferase

Wild-type Arabidopsis thaliana plants (Columbia) were transformed with Agrobacterium tumefaciens strain (GV3101 [pMP90]) based on a modified vacuum infiltration method (Steve Clough and Andrew Bent. Floral dip: a simplified method for Agrobacterium mediated transformation of A. thaliana. Plant J 16(6):735-43, 1998; Bechtold, N. Ellis, J. and Pelltier, G., in: Planta Agrobacterium-mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. CRAcad Sci Paris, 1993, 1144(2):204-212).

The Agrobacterium tumefaciens cells used had previously been transformed with the plasmids pBinAR-35SP-IPP-RnTATase-ocsT (Example 73, FIG. 60) and pPTVkan-LeB4-IPP-RnTATase-nosT (Example 72, FIG. 61) following the method described by R. HÖFGEN and L. WILLMITZER (Plant Sci. 1990, 66, 221-230 and Nucleic Acids Res. 1988, Oct. 25, 16(20), 9877).

Seeds of the primary transformants were selected on the basis of their resistance to antibiotics. Seedlings which are resistant to antibiotics were transplanted into soil and used for biochemical analysis as fully-developed plants.

Example 79

Generation of transgenic Brassica napus plants which overexpress tyrosine aminotransferase

Transgenic oilseed rape plants were generated approximately as described by Bade, J. B. and Damm, B. (in Gene Transfer to Plants, Potrykus, I. and Spangenberg, G., eds, Springer Lab Manual, Springer Verlag, 1995, 30-38), which also specifies the composition of the media and buffers used.

The transformations are effected with the Agrobacterium tumefaciens strain GV3101 [pMP90]. The Agrobacterium tumefaciens cells used had previously been transformed with the plasmid pPTVkan-LeB4-IPP-RnTATase-nosT (Example 72, FIG. 61) in accordance with the method described by R. HÖFGEN and L. WILLMITZER (Plant Sci. 1990, 66, 221-230 and Nucleic Acids Res. 1988, Oct. 25, 16(20), 9877).

Seeds of Brassica napus var. Westar are surface-sterilized with 70% ethanol (v/v), washed in water for 10 minutes at 55° C., incubated in 1% strength hypochlorite solution (25% v/v Teepol, 0.1% v/v Tween 20) for 20 minutes and washed six times with sterile water for in each case 20 minutes. The seeds were dried for three days on filter paper, and 10-15 seeds are germinated in a glass flask containing 15 ml of germination medium. The roots and apices are excised from several seedlings (approximate size 10 cm), and the hypocotyls which remain are cut into segments approx. 6 mm in length. The approximately 600 explants thus obtained were washed for 30 minutes with 50 ml of basal medium and transferred into a 300 ml flask. After addition of 100 ml of callus induction medium, the cultures were incubated for 24 hours at 100 rpm.

An overnight culture of the agrobacterial strain is set up at 29° C. in Luria broth medium supplemented with kanamycin (20 mg/l), and 2 ml of this are incubated in 50 ml of Luria broth medium without kanamycin for 4 hours at 29° C. to an OD600 of 0.4-0.5. After the culture has been pelleted for 25 minutes at 2000 rpm, the cell pellet was resuspended in 25 ml of basal medium. The bacterial concentration in the solution was brought to an OD600 of 0.3 by addition of further basal medium.

The callus induction medium was removed from the oilseed rape explants using sterile pipettes, 50 ml of agrobacterial solution were added, and the mixture was mixed carefully and incubated for 20 minutes. The agrobacterial suspension was removed, the oilseed rape explants were washed for 1 minutes to 50 ml of callus induction medium, and 100 ml of callus induction medium were subsequently added. The material was cocultured for 24 hours on an orbital shaker at 100 rpm. Coculturing was stopped by removing the callus induction medium, and the explants were washed twice for in each case 1 minute with 25 ml and twice for 60 minutes with in each case 100 ml of wash medium at 100 rpm. The wash medium together with the explants was transferred to 15 cm Petri dishes, and the medium was removed using sterile pipettes.

For the regeneration, batches of 20-30 explants were transferred into 90 mm Petri dishes containing 25 ml of shoot induction medium supplemented with kanamycin. The Petri dishes were sealed with 2 layers of Leukopor and incubated at 25° C. and 2000 Lux at 8-hour-darkness photoperiods. Every 12 days, the developing calli were transferred to fresh Petri dishes containing shoot induction medium. All further steps for regenerating intact plants were carried out as described by Bade, J. B and Damm, B. (in: Gene Transfer to Plants, Potrykus, I. and Spangenberg, G., eds, Springer Lab Manual, Springer Verlag, 1995, 30-38).

Example 80

Generation of transgenic Nicotiana tabacum plants which overexpress tyrosine aminotransferase

Ten ml of YEB medium supplemented with antibiotic (5 g/l beef extract, 1 g/l yeast extract, 5 g/l peptone, 5 g/l sucrose and 2 mM MgSO4) were inoculated with a colony of Agrobacterium tumefaciens, and the culture was grown overnight at 28° C. The cells were pelleted for 20 minutes at 4° C., 3500 rpm, using a bench-top centrifuge and then resuspended under sterile conditions in fresh YEB medium without antibiotics. The cell suspension was used for the transformation.

The Agrobacterium tumefaciens cells used had previously been transformed with the plasmid pBinAR-35SP-IPP-RnTATase-ocsT (Example 73, FIG. 60) in accordance with the method described by R. HÖFGEN and L. WILLMITZER (Plant Sci. 1990, 66, 221-230 and Nucleic Acids Res. 1988, Oct. 25, 16(20), 9877).

The sterile-grown wild-type plants were obtained by vegetative propagation. To this end, only the tip of the plant was cut off and transferred to fresh 2 MS medium in a sterile preserving jar. As regards the rest of the plant, the hairs on the upper side of the leaves and the central veins of the leaves were removed. Using a razor blade, the leaves were cut into sections of approximate size 1 cm2. The agrobacterial culture was transferred into a small Petri dish (diameter 2 cm). The leaf sections were briefly drawn through this solution and placed with the underside of the leaf on 2 MS medium in Petri dishes (diameter 9 cm) in such a way that they touched the medium.

After two days in the dark at 25° C., the explants were transferred to plates with callus induction medium and warmed to 28° C. in a controlled-environment cabinet. The medium needed changing every 7-10 days. As soon as calli formed, the explants were transferred into sterile preserving jars containing shoot induction medium supplemented with Claforan (0.6% BiTec-Agar (w/v), 2.0 mg/l zeatin ribose, 0.02 mg/l naphthylacetic acid, 0.02 mg/l gibberelic acid, 0.25 g/ml Claforan, 1.6% glucose (w/v) and 50 mg/l kanamycin). After approximately one month, organogenesis took place, and the shoots formed could be cut off.

The shoots were grown on 2 MS medium supplemented with Claforan and selection marker. As soon as a substantial root ball developed, the plants could be potted up in seed compost.

Example 81

Characterization of the transgenic plants of examples 78, 79 and 80

The tocopherol and tocotrienol contents in the leaves and seeds of the plants transformed with the above-described constructs, of Examples 78, 79 and 80 (Arabidopsis thaliana, Brassica napus and Nicotiana tabacum) are analyzed. To this end, the transgenic plants were grown in the greenhouse, and the plants which express the gene encoding the Rattus norvegicus tyrosine aminotransferase are analyzed at Northern level. The tocopherol content and the tocotrienol content in the leaves and seeds of these plants were determined.

To this end, the leaf material of plants is frozen in liquid nitrogen immediately after sampling. The subsequent disruption of the cells is effected by means of a stirring apparatus by three incubations in an Eppendorf shaker at 30° C., 1000 rpm in 100% methanol, for 15 minutes, the supernatants obtained in each case being combined.

Further incubation steps revealed no further release of tocopherols or tocotrienols.

To avoid oxidation, the extracts obtained were analyzed directly after the extraction with the aid of an HPLC system (Waters Allience 2690). Tocopherols and tocotrienols were separated using a reverse-phase column (ProntoSil 200-3-C30(R), Bischoff) using a mobile phase of 100% methanol, and identified with the aid of standards (Merck). The detection system used was the fluorescence of the substances (excitation 295 nm, emission 320 nm), which was detected with the aid of a Jasco FP 920 fluorescence detector.

Table 1 shows the result of the overexpression of the Rattus norvegicus tyrosine aminotransferase in 16 lines (lines 1 to 24) of the transgenic Nicotiana tabacum plants, generated in accordance with Example 80, in comparison with the wild type (WT, 4 replications). The second column shows the vitamin E content (total content=sum of all 8 isomers) in young leaf material in [μg/g FW]. The third column shows the tocotrienol content of the line in question of the total vitamin E content in [% by weight].

TABLE 1
Line of the trans- Tocotrienol content
genic Nicotiana Total vitamin E in [% by weight]
tabacum plants of content in based on the total
Example 80 [μg/g FW] content
1 9.13 48.5
2 2.95 4.6
3 5.94 49.5
4 7.24 5.8
6 5.97 7.6
7 8.02 6.4
9 16.26 53.1
10 8.95 41.3
11 13.28 51.6
16 8.96 42.9
17 3.99 3.2
18 10.58 51.7
19 7.57 41.3
24 14.76 56.7
WT n = 4 5.4 +/− 0.5 4.75 +/− 2.4

FIG. 63 is a graphic representation of the result of the overexpression of the Rattus norvegicus tyrosine aminotransferase in Nicotiana tabacum (Example 80) in comparison with the wild type. The data shown are the vitamin E contents (sum of all 8 isomers) in young leaf material. The description of the axes indicates the individual transgenic lines. The data shown for the wild-type plants (wt) corresponds to the mean +/− SD of 4 replications.

Claims

We claim:

1. A process for increasing the production of vitamin E in a vitamin E producing plant, wherein said process comprises expressing a recombinant nucleic acid that encodes a tyrosine aminotransferase which increases tyrosine aminotransferase activity as compared to the wild-type plant, wherein said nucleic acid comprises a sequence selected from the group consisting of:

(a) a polynucleotide sequence encoding a protein comprising the amino acid sequence as set forth in SEQ ID NO: 8, 10, or 12, and

(b) the polynucleotide sequence as set forth in SEQ ID NO: 5;

and growing said recombinant plant, thereby increasing the production of vitamin E in said plant.

2. The process as claimed in claim 1, wherein the nucleic acid comprises the sequence as set forth in SEQ ID NO: 5.

3. The process of claim 1, wherein the plant is further transformed with a nucleic acid that expresses at least one enzyme activity selected from the group consisting of hydroxyphenylpyruvate dioxygenase activity, homogentisate phytyltransferase activity, geranylgeranyl-pyrophosphate oxidoreductase activity, 2-methyl-6-phytylhydroquinone methyltransferase activity, tocopherol cyclase activity and γ-tocopherol methyltransferase activity, and wherein said enzyme activity is increased as compared to the wild type enzyme activity of said plant.

4. The process of claim 1, wherein the plant comprises a reduction of at least one enzyme activity selected from the group consisting of homogentisate dioxygenase activity, maleylacetoacetate isomerase activity and fumarylacetoacetate hydrolase activity as compared to the wild-type activity.

5. The process as claimed in claim 4, wherein the reduced activity is homogentisate dioxygenase activity.

6. The process as claimed in claim 5, further comprising introducing an RNA into said plant wherein said RNA contains a region with duplex structure and said region contains a nucleic acid sequence that is identical to or hybridizes with at least a part of the homogentisate dioxygenase gene thereby cleaving the mRNA for said gene.

7. The process as claimed in claim 1, further comprising harvesting said plant and isolating vitamin E.

8. A process for increasing the vitamin E content of a plant in a vitamin E producing plant, comprising introducing a nucleic acid construct encoding a tyrosine aminotransferase operably linked to one or more regulatory signals that allow for transcription and translation of said nucleic acid by said plant and growing the plant, wherein said nucleic acid comprises a sequence selected from the group consisting of:

(a) a polynucleotide sequence encoding a protein comprising the amino acid sequence as set forth in SEQ ID NO: 8, 10, or 12, and

(b) the polynucleotide sequence as set forth in SEQ ID NO: 5;

thereby increasing the production of vitamin E in said plant.

9. A process for increasing the vitamin E content of a vitamin E producing plant comprising introducing a combination of nucleic acid constructs into said plant, wherein the combination comprises a first nucleic acid construct encoding a tyrosine aminotransferase operably linked to one or more regulatory signals that allow for transcription and translation of said first nucleic acid and one or more nucleic acid constructs selected from the group consisting of:

A. a nucleic acid construct encoding a hydroxyphenylpyruvate dioxygenase operably linked with one or more regulatory signals that allow for transcription and translation in said plant,

B. a nucleic acid construct encoding a homogentisate phytyltransferase operably linked with one or more regulatory signals that allow for transcription and translation in said plant,

C. a nucleic acid construct encoding a geranylgeranyl-pyrophosphate oxidoreductase operably linked with one or more regulatory signals that allow for transcription and translation in said plant,

D. a nucleic acid construct encoding a 2-methyl-6-phytylhydroquinone methyltransferase operably linked with one or more regulatory signals that allow for transcription and translation in said plant,

E. a nucleic acid construct encoding a tocopherol cyclase operably linked With one or more regulatory signals that allow for transcription and translation in said plant, and

F. a nucleic acid construct encoding a γ-tocopherol methyltransferase operably linked with one or more regulatory signals that allow for transcription and translation in said plant,

and growing the plant wherein the first nucleic acid comprises a sequence selected from the group consisting of:

(a) a polynucleotide sequence encoding a protein comprising the amino acid sequence as set forth in SEQ ID NO: 8, 10, or 12, and

(b) the polynucleotide sequence as set forth in SEQ ID NO: 5;

thereby increasing the production of vitamin E in said plant.

10. The process as claimed in claim 8 wherein the nucleic acid construct is introduced into the genome of said plant.

11. The process as claimed in claim 9 wherein the combination of nucleic acid constructs is introduced into the genome of said plant.

12. The process as claimed in claim 1, wherein the nucleic acid comprises the polynucleotide sequence as set forth in SEQ ID NO: 7, 9, or 11.

13. The process as claimed in claim 8, wherein the nucleic acid comprises the polynucleotide sequence as set forth in SEQ ID NO: 7, 9, or 11.

14. The process as claimed in claim 9, wherein the nucleic acid comprises the polynucleotide sequence as set forth in SEQ ID NO: 7, 9, or 11.

15. The process as claimed in claim 1, wherein the nucleic acid encodes a protein comprising the amino acid sequence as set forth in SEQ ID NO: 8, 10, or 12 and possesses enzymatic activity of a tyrosine aminotransferase.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: