Patent application title:

Nucleic acids encoding a recombinant 250 kDa antigen from sporozoites/merozoites of and their uses

Publication number:

-

Publication date:
Application number:

10/483,165

Filed date:

2002-07-03

✅ Patent granted

Patent number:

US 7,462,707 B1

Grant date:

2008-12-09

PCT filing:

WO; PCT/US02/21237; 20020703

PCT publication:

WO; WO03/004684; 20030116

Examiner:

Shanon A. Foley | Padma Baskar

Adjusted expiration:

2023-06-25

Abstract:

The present invention provides an isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid and a method of producing a recombinant 250 kDa polypeptide of the same. The present invention also provides an isolated nucleic acid comprising a nucleotide sequence encoding an immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima having the amino acid sequence described herein, or encoding a homolog of the polypeptide, or a complement of the nucleic acid. The subject invention also provides a vaccine against Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeriapraecax, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima or the immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid which may also contain a 56 kDa, 82 kDa or 230 kDa protein isolated from the gametocytes of Eimeria maxima and a method of immunizing a subject against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the step of administering to the subject any of the aforementioned vaccines.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C07H21/04 IPC

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical

C07K14/00 IPC

Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof

C12N1/10 IPC

Microorganisms, e.g. protozoa; Compositions thereof ; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor Protozoa; Culture media therefor

A61K39/012 IPC

Medicinal preparations containing antigens or antibodies; Protozoa antigens Coccidia antigens

A61K39/00 IPC

Medicinal preparations containing antigens or antibodies

Description

This application is a §371 national stage of PCT International Application No. PCT/US02/21237, filed Jul. 3, 2002, designating the United States of America, which claims priority of U.S. Provisional Application No. 60/303,670, filed Jul. 6, 2001, the contents of which are hereby incorporated by reference.

Throughout this application various publications are referenced in parenthesis. Full citations for these publications may be found listed in alphabetical order at the end of the specification immediately preceding the claims. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains.

BACKGROUND OF THE INVENTION

The organisms which cause the disease known as “coccidiosis” in chickens belong to the phylum Apicomplexa, class Sporozoa, subclass Coccidia, order Eucoccidia, suborder Eimeriorina, family Eimeriidae, genus Eimeria. Within the Eimerian genus there are many species, several of which are pathogenic in chickens. The species of major concern to the chicken industry are Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix and Eimeria brunetti.

Coccidiosis has become a major economic problem in the chicken industry over the past several decades, mainly due to the overcrowding of chicken houses and the development of drug resistance by the parasite. The rearing of chickens under crowded conditions on a litter floor provides optimal conditions for the growth and spread of Eimeria parasites. Under such circumstances, sanitary control is impossible and the farmer must rely on the effectiveness of coccidiostat drugs. However, drugs must be kept in the feed at all times, shuttle programs must be used to avoid the appearance of drug resistance strains of Eimeria, and certain drugs have costly side effects. Furthermore, these coccidiostats also have antibacterial effects and therefore are considered to be infeed antibiotics. Recently the European Union has decided to ban the use of all in-feed antibiotics in the chicken industry including anticoccidial drugs. Thus, the only viable approach to the control of coccidiosis in the future is by vaccine development.

The Eimeria parasite undergoes a complex life cycle in the mucosa of the intestinal tract. This life cycle is very similar to that of the other hemosporidian parasites (i.e. plasmodium, babesia, etc.) except for the lack of an arthropod vector. Oocysts sporulate on the litter floor producing four sporocysts, each containing two sporozoites (thus belonging to the class sporozoa). The oocysts are ingested by the chicken, and the sporocysts are released by the mechanical grinding of the gizzard. The sporozoites are then released from the sporocysts due to the digestion of the sporocyst wall by proteolytic enzymes in the intestine. Mobile sporozoites then invade lymphocytes and go on to invade epithelial cells where the asexual cycle begins. The parasite goes through 2-4 cycles of replication and division (each species having a defined number of divisions) leading to the production of large numbers of daughter merozoites. After the final cycle of merozoite production the sexual cycle begins with the production of the macrogametocyte (female) and microgametocyte. The macrogametocyte is characterized by the production of wall forming bodies, while microgametocytes contain the components involved in the formation of microgametes, which bud off from the surface of the intracellular parasite.

Microgametes are flagellated and are responsible for the fertilization of the macrogamete. A zygote is formed which matures into the oocyst by fusion of the wall forming bodies and condensation of the nucleus. Oocysts are secreted in the feces, thus completing the cycle.

Over the past several years, native antigens from the sexual (gametocyte) stages of Eimeria maxima have been used to immunize laying hens. Offspring chicks were consequently vaccinated via maternal immunity (protective maternal antibody). Three major protective antigens have previously been identified in E. maxima gametocytes having molecular weights of 250, 82 and 56 kDa (EP Patent No. 0 256 536, U.S. Pat. No. 5,496,550, and U.S. Pat. No. 5,932,225). EP Patent No. 0 256 536, U.S. Pat. No. 5,496,550, and U.S. Pat. No. 5,932,225 are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains. It was shown that these antigens are well conserved amongst Eimeria species (Wallach 1995) and can cross protect against the 3 major species that cause coccidiosis in broiler chickens, E. maxima, E. tenella and E. acervulina. More recently, it was shown that in floor pen trials, chicks from hens vaccinated with these native gametocyte antigens were protected against Eimeria under field conditions (Wallach 1996). This protection acts to lower the peak in oocyst shedding to a level which does not cause any damaging effect on the performance of the broiler chicken. Based on the above results it was concluded that these antigens are effective against coccidiosis in chickens and also have the potential for use against coccidiosis in other domestic animals including turkeys, geese, sheep, cattle, pigs and fish.

These three antigens were also characterized at the molecular level. Cell free translation experiments were carried out to identify the RNA molecules that encode them (Mencher er al.). cDNA molecules that encode these antigens were cloned by immunoscreening of a cDNA library made in the expression vector lambda zap (4, U.S. Pat. No. 5,932,225). By this approach, the gene encoding the 250 kDa antigen was cloned and partially sequenced. The clone pEM 250/14 was partially sequenced in U.S. Pat. Nos. 5,932,225 and 5,496,550. FIG. 8a of the subject application reproduces FIG. 11 of U.S. Pat. Nos. 5,932,225 and 5,496,550, which portrays the DNA sequence of the first 293 nucleotides of clone pEM 250/14. FIG. 8b of the subject application reproduces FIG. 12 of U.S. Pat. Nos. 5,932,225 and 5,496,550, which shows the DNA sequence of the last 196 nucleotides of clone pEM 250/14. Also, in U.S. Pat. Nos. 5,932,225 and 5,496,550, the putative genes encoding the 56 and 82 kDa antigens were cloned and sequenced.

Subsequently, Fried et al. sequenced the entire pEM 250/14 clone and found that the antigen had a molecular weight of 230 kDa rather than 250 kDa as had been previously thought. Fried et al. found that the 230 kDa gene contains highly repetitive motifs and that these repeats are contained throughout the entire gene (Fried et al.). This clone was expressed in bacteria using the pATH plasmid vector and it was shown that it is recognized by convalescent chicken sera taken 14 days post infection with E. maxima. Finally, it was shown that this gene is expressed only in the macrogametocyte stage and by immunofluorescence was found to be located in the wall forming bodies of the macrogamete (Fried et al.).

cDNA clones encoding the 56 and 82 kDa antigens were also obtained by screening the library with polyclonal antibodies as well as a monoclonal antibody against the 56 kDa antigen. This monoclonal antibody was previously shown to provide passive immunity to naive chicks (Wallach 1990). A few clones were obtained and analyzed. One of the clones was found to encode a small 10 kDa antigen and therefore was not the desired clone. Another clone was found to contain only a small part of the open reading frame (ORF) and by northern blotting was shown to hybridize with two mRNAs of about the expected size for the 56 and 82 kDa antigens. It was therefore concluded that this was the desired clone. Genomic libraries were then screened to obtain the full length clone. However, due to the highly repetitive GCA motifs in this clone, it was not possible to specifically isolate the full length clone. Attempts to clone the full length cDNA molecule were also not successful due to these repeats. Finally, attempts to express the partial cDNA clones in bacteria failed as well probably due to their unusual sequences and a reasonable level of gene expression was not obtained. It has previously been shown that the 56 and 82 kDa antigens are glycosylated (U.S. Pat. No. 5,932,225). This is based on their strong reactivity with Soybean lectin. Therefore, glycosylation may be required in order to obtain good expression of these genes and for proper conformation of the gene products.

In addition to the 56, 82 and 230 kDa antigens, a 14 kDa antigen obtained from highly purified fractions of oocyst walls has been proposed as a possible candidate for vaccines against coccidiosis (Eschenbacher et al.). However, this hypothesis has not been explored.

Several laboratories have been working on a subunit vaccine against coccidiosis. Most of these researchers have focused their efforts on the extracellular asexual stages of the life cycle, in particular the sporozoite and merozoite stages which are considered to be the most vulnerable to immune attack. In a previous study it was found that sporozoite extracts from E. tenella could induce in broilers protection against challenge infections against this parasite for up to 7 weeks of age (Karkhanis et al.). Work carried out using monoclonal antibodies against antigens from sporozoites of E. tenella led to the identification of a 25,000 molecular weight antigen which was cloned and sequenced (Eur. Patent publication No. 0 164 176, Dec. 11, 1985). Several other sporozoite genes were identified and their recombinant antigens or the transformed bacteria themselves were tested for protective immunity (Danforth et al.). The results indicated that these recombinants were only able to provide a relatively low level of protection against challenge infection with Eimeria and did not always prevent the appearance of significant lesions.

A vaccine using antigens from the merozoite stage has also been tested (European patent publication No. 0 135 073). Using these antigens to immunize young broiler chicks, it was once again found that the protection afforded was relatively low (Danforth et al.).

In 1993, it was found that there was a correlation between protective maternal immunity with the appearance of maternal antibodies against a 230 kDa merozoite (as opposed to gametocyte) antigen of Eimeria maxima (Smith et al.). This protection was often over 90% and was found to occur even when the maternal antibody level was relatively low (although reactivity with the 230 kDa protein remained strong). It was also found that a very small quantity of the native 230 kDa merozoite antigen cut out of an SDS-PAGE gel could induce a significant (60%) level of protective maternal immunity against infection with E. maxima in offspring chicks. Furthermore, Western blotting showed that this protein was expressed in both merozoites and sporozoites of E. maxima and is also well conserved between Eimeria species.

However, it is extremely difficult to isolate the E. maxima merozoite 230 kDa antigen on a large scale from the parasite itself. Therefore, there is a need to clone and express this antigen recombinantly. This will enable the production of the antigen for use in vaccination and to test its optimal concentration for inducing protective immunity.

SUMMARY OF THE INVENTION

The subject invention provides an isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

The subject invention further provides a method of producing a recombinant 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima comprising culturing a transformed cell comprising an isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid and isolating the recombinant 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima.

The subject invention also provides a vaccine against Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima or the immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

The subject invention also provides the above vaccine further comprising a 56 kDa, 82 kDa or 230 kDa protein isolated from the gametocytes of Eimeria maxima or a mixture thereof.

The subject invention also provides a vaccine against coccidiosis comprising the recombinant 250 kDa antigen.

The subject invention also provides a method of immunizing a subject against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the step of administering to the subject the any of the aforementioned vaccines.

The subject invention also provides an isolated nucleic acid comprising a nucleotide sequence encoding an immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima having the amino acid sequence shown in SEQ. ID NO. 26, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 Western blot of a crude sporulated oocyst extract of E. maxima using sera and yolk from maternal immunization trials. Lane 1—Serum of 12 day old hatchlings of hens infected with E. maxima, which also were exposed to a challenge infection; Lane 2—serum from 3 day old hatchlings of hens infected with E. maxima; Lane 3—Yolk from hens immunized with the SDS-PAGE cutout 250 kDa merozoite protein band; Lane 4—serum from hens immunized with a crude merozoite extract. The 250 kDa band is shown with an arrow on the left of the figure.

FIG. 2 Elution profile (OD 280) of sporulated oocyst proteins from the DEAE-sephacel column using various concentrations of NaCl.

FIG. 3 Silver staining (3a) and Western blot (3b) analysis of ion exchange fractionated sporulated oocyst extract. The Western blot was performed using serum from hens immunized with a crude merozoite extract. The 250 kDa protein band is indicated on the left.

FIG. 4 Western blot analysis of sporulated oocyst extract fractions from the DEAE column detected with serum from a 3 day old offspring chick of hens immunized by live infection. The concentration of NaCl used for elution is indicated at the bottom of the blot and the 250 kDa protein band is shown with an arrow.

FIG. 5 The amplified cDNA product from PCR using gene specific primers specific to the 3′ and 5′ ends of the gene encoding for the 250 kDa antigen. Lane 1 shows the DNA marker bands and lane 2 the 7 KB PCR product band.

FIG. 6 A complete DNA sequence of the 250 kDa cDNA clone. The coding sequence, its complement and amino acid sequences are shown (SEQ. ID. NOs. 1-3).

FIGS. 7A & 7B Multiple sequence alignment of the 250 kDa cDNA E. maxima clone with a homologous DNA sequence from patent WO 90/00403. 7A) DNA sequence alignment showing 60% homology (SEQ. ID. NOs. 4-5). 7B) Protein sequence alignment showing 59% homology (SEQ. ID. NOs. 6-7).

FIG. 8a depicts the DNA sequence of the first 293 nucleotides of clone pEM 250/14. The coding sequence and its amino acid sequences are shown (SEQ. ID. NOs. 11-12).

FIG. 8b depicts the DNA sequence of the last 196 nucleotides of clone pEM 250/14. The coding sequence and its amino acid sequences are shown (SEQ. ID. NOs. 13-14).

FIG. 9 Western blot analysis of crude sporulated oocyst extract of E. maxima separated on a 5% polyacrylamide gel, using selected sera and yolk from maternal immunisation trials (Smith et al, 1995). Lane 1, serum from 3-day-old hatchlingts of hens infected with E. maxima; Lane 2, serum from 12-day-old hatchlings of hens infected with E. maxima following infection of hatchlings with E. maxima; Lane 3, serum from hens immunised with crude merozoite extract; Lane 4, yolk from hens immunised with SDS-PAGE cutout of the 250 kDa merozoite protein band; Lane 5, serum from uninfected control group.

FIG. 10 DEAE-ion exchange chromatography of crude sporulated oocyst extract of E. maxima. Approximately 11.0 mg of extract was added to the column and eluted with a step gradient of 0.0-1 M NaCL in 40 mM Tris. HCL pH 8.0, at a flow rate of 0.7 mL/min. Fractions were collected manually and fraction sizes were between 10-15 mL.

FIG. 11 Silver staining (a) and Western blot analysis (b) of ion exchange fractionated sporulated oocyst extract of E. maxima. 15 μL of each fraction was loaded onto parallel 7.5% SDS-PAGE gels and electrophoresed under reducing conditions. The western blot was immunodetected with serum from hens immunised with crude merozoite extract. (*Column flow-through (unbound protein fraction).)

FIG. 12 Silver staining (a) and Western blot analysis (b) of ion exchange chromatography fractions enriched for the immunodominant protein and electrophoresed on 5% SDS-PAGE gels under reducing conditions. The Western blot was immunodetected with protective maternal antiserum harvested from 12-day-old hatchlings of hens infected with E. maxima following infection of hatchlings with E. maxima following infection of hatchlings with E. maxima. (*Molecular weight markers (2 μL))

FIG. 13 Superdex 200 gel filtration chromatography of ion exchange chromatography fractions enriched for the immunodominant protein. IEX fractions eluted with 0.3-0.4M NaCL from 10 mg of crude sporulated oocyst extract were pooled and concentrated to a sample volume of 15 mL. The sample was applied to the column and eluded at a flow rate of 50 μL/min. Fractions of size 50 μL were collected automatically as indicated.

FIG. 14 Silver staining of gel filtration chromatography fractions separated on a 7.5% SDS-polyacrylamide gel. A 10 μL sample from each of fractions 7-15 was electrophoresed under reducing conditions. Lane 1, molecular weight markers (Amersham Rainbow MWM, 2 μL); Lane 2, fraction 7; Lane 3, fraction 8; Lane 4, fraction 9; Lane 5, fraction 10; Lane 6, fraction 11; Lane 7, fraction 12; Lane 8, fraction 13; Lane 9, fraction 14; Lane 10, fraction 15. The arrow indicates the immunodominant protein.

FIG. 15 Western blot analysis of Triton X-114 fractionated merozoites immunodetected with serum from hens immunised with crude E. maxima merozoite extract. Purified merozoites were partitioned in the nonionic detergent TX-114 as described. Lane 1, TX-114 aqueous soluble fraction; Lane 2, TX-114 detergent soluble fraction; Lane 3, TX-114 detergent insoluble fraction. (*Column flow-through (unbound protein fraction).)

FIG. 16 Western blot analysis of crude antigen extracts of E. maxima derived from asexual and sexual developmental stages. A 10 μg sample of each extract prepared as described was eletcrophoresed on a 7.5% SDS-polyacrylamide gel under reducing conditions. Lane 1, sporulated oocyst extract; Lane 2, merozoite extract; Lane 3, gametocyte extract. The Western blot was immunodetected using serum from hens infected with crude merozoite extract.

FIG. 17 Western blot analysis of crude sporulated oocyst extracts of the Houghton strain of E. maxima and Australian strains of E. maxima and E. tenella, immunodetected with serum from hens infected with crude merozoite extract from the Houghton strain of E. maxima. A 10 μg sample of each extract was applied to 7.5% SDS-polyacrylamide gels and eletrophoresed under reducing conditions. A, Lane 1, Houghton E. maxima; Lane 2, Australian E. maxima. B, Lane 1, Australian E. maxima; Lane 2, Australian E. tenella.

FIG. 18 Western blot analysis of the immunodominant protein separated on 7.5% (A) and 5% (B)SDS-plyacrylamide gels under reducing and non-reducing conditions. Ion exchange chromatography fractions enriched for the immunodominant protein were electrophoresed with and without 2-β-Mercaptoethanol in the sample buffer. A: Lane 1, without β-ME; Lane 2, 2.5% β-ME; Lane 3, 3.75% β-ME; Lane 4, 5% β-ME; Lane 5.7.5% β-ME; Lane 6, 10% β-ME. B: Lane 1, without β-ME; Lane 2, 2.5% β-ME. Western blots were immunodetected with antiserum from hens infected with crude merozoite extract.

FIG. 19 Total RNA isolated from sporulated oocysts of Eimeria maxima and separated by electrophoresis on a 1% non-denaturing agarose gel, Lane 1, 1 μg Lambda DNA/EcoRI+HindIII Markers; Lane 2, 2.5 μg sporulated oocyst RNA. The 28S and 18S ribosomal RNA bands are indicated.

FIG. 20 Similarity between tryptic peptide #1 of the E. maxima immunodominant protein and selected motifs from EtMIC4 and surface antigen 5401 of E tenella. The conserved cysteine residue (shown in bold type) was considered in the design of degenerate PCR primers based on tryptic peptide #1 of EmIP. The numbers proceeding motifs refer to their respective positions within the EtMIC4/5401 amino acid sequence. (SEQ. ID NOS. 15-19)

FIG. 21 3′ RACE amplification of sporulated oocyst cDNA of E. maxima using degenerate PCR primer FP008. The reaction sample and molecular weight markers were separated on a 1% agarose gel. Lane 1, 1 μg of Lambda DNA/EcoRI+HindIII Markers; Lane 2, 10 μL of 100 bp DNA ladder.

FIG. 22 Protein sequence sharing homology with translated sequence form a 3′ RACE PCR product generated with primer FP008. A 445 bp query was submitted for BLASTX analysis against all non-redundant protein databases through NCBI. The ten highest scores are listed and the alignment for the most significant score displayed. (SEQ. ID NO. 20)

FIG. 23 Generation of intermediate cDNA products encoding EmIP and separated on 0.8% agarose gels. Amplification with degenerate primer FP004 and gene-specific primer RP016 produced a faintly visible, appropriate size band of approximately 6 kb (A, Lane 2). The band was gel-purified and characterised by nested PCR with degenerate primer FP006 and gene-specific primer RP015. A band of the expected size of approximately 6 kb was amplified (B, Lane 2) and is indicated by the arrow. A:Lane 1 and B:Lane 1, 1 μg of Lambda DNA/EcoRI+HidIII Markers; A:Lane 2 and B:Lane 1, 1 μg of Lambda DNA/EcoRI+HidIII Markers; A:Lane 2 and B:Lane 2, 10 μL of PCR reaction as indicated.

FIG. 24 Amplification of the 5′ end of the cDNA encoding EmIP. Gene-specific primers RP019 and RP020 were used in 5′ RACE reactions with AP1 (Lanes 2 and 3 respectively). A product between 500-600 bp visible in Lane 3 was further characterized by nested PCR with primers RP019 and AP2 (Lane 4). Lane 1, 1 μg of Lambda DNA/EcoRI+HidIII Markers; Lanes 2, 3 and 4, 10 μL of PCR reaction as indicated. The samples were analysed on a 0.8% agarose gel.

FIG. 25 Partial DNA sequence and predicted amino acid sequence of the 5′ PCR product generated with primers AP2 and RP019. The putative initiating methionine is shown in bold type at position 231, with an upstream in-frame TAG codon at position 186. The N-terminus sequence of the mature protein as predicted by Edman sequencing is boxed. (SEQ. ID. NOS. 21-23)

FIG. 26 Generation of a cDNA encoding the full, mature E. maxima immunodominant protein. Gene-specific primers FP015 and RP023 designed from 5′ and 3′ RACE sequence respectively, amplified a single PCR product of approximately 7 kb (Lane 2). Lane 1, 1 μg of Lambda DNA/Hind III Markers; Lane 2, 10 μL of PCR reaction as indicated. Samples were separated on a 0.8% agarose gel.

FIG. 27 Schematic overview of the PCR strategy used to clone the cDNA for the E. maxima immunodominant protein. The figure depicts the order in which the different cDNA fragments were generated. The bottom horizontal bar represents the full-length cDNA. Lines with arrowheads represent the overlapping cDNA regions amplified by the indicated primer pairs (also shown by corresponding bp numbers in parentheses).

FIG. 28 BLASTN similarity search with the putative cDNA coding region for the E. maxima immunodominant protein. The five highest scores are listed and the alignment with the most significant score-mRNA for EtMIC4—is displayed. (SEQ. ID NO. 24)

FIG. 29A-D Nucleotide and predicted amino acid sequence of the E. maxima immunodominant protein. (SEQ. ID NOS. 25-26) The sequence was derived from cDNA clones encoding the full mature protein and overlapping 5′ and 3′ RACE products. The predicted signal sequence is underlined and the N-terminus amino acid sequence of the mature protein is boxed.

FIG. 30 CLUSTALW (4.1) alignment showing the predicted TSP-1 like domains present within the E. maxima immunodominant protein. The consensus sequence was established with a 50% identity cut-off, showing the WXXW and RXR motifs (underlined). The highly conserved cysteine residues are shown in bold type.

FIG. 31 CLUSTALW (4.1) alignment of the predicted EGF-line like domains present within the E. maxima immunodominant protein. The consensus sequence was established with a 75% identity cut-off, showing the highly conserved cysteine residues in bold type.

FIG. 32 Regions of low complexity within the predicted polypeptide sequence of the E. maxima immunodominant protein A: CLUSTALW (4.1) alignment highlighting the degenerate repetitive motif with low complex region 1. The consensus sequence shows conserved identities with similarity between residues indicated by ‘.’.B: Low complex region 2 showing the high frequency of glutamic acid, glycine and proline residues.

FIG. 33 Alignment of the transmembrane and cytoplasmic tail regions of EmIP and other proteins belonging to the TRAP family of apicomplexan microneme proteins. The putative transmembrane region is underlined and the conserved tyrosine and tryptophan residues shown in bold. Sequences are from the following organism: Eimeria maxima (EmIP, EmIP100); Eimeria telnella (EtMIC4, EtMICl/Etp100); Cryptosporidum parvum (cpTRAPC1, CpGP900); Neospara caninum (NcTRAP); Plasmodium falciparum (PfTRAP PFCTRP); Plasmodium berghei (PbTRAP); Plasmodium relictum (PrTRAP); Plasmodium knowlesi (PkDBP); Sarcocystis muris (Sm70); Toxoplasma gondii (TgMIC2, TgMIC6, TgMIC7, TgMIC8, TgMIC9, TgAMA1). (SEQ. ID NOS. 27-41)

FIG. 34 Schematic representation of the E. maxima immunodominant protein showing the major structural features.

FIG. 35 Protein sequences sharing homology with the predicted amino acid sequence for the E. maxima immunodominant protein. The sequence representing the mature protein was submitted for BLASTP analysis against all non-redundant protein databases through NCBI. The twenty alignments with the highest significance are listed.

FIG. 36 GAPSHOW graph showing the similarity between EmIP and EtMIC4 amino acid sequences following alignment with the GAP program. The top unbroken line represents EmIP (2360 residues) and the bottom unbroken line EtMIC4 (2189 residues). Similarity is shown by the central vertical lines. The smaller vertical lines (below EmIP and above EtMIC4) represent gaps inserted during alignment.

FIG. 37 Detection of the immunodominant protein across developmental stages of E. maxima. Messenger RNAs for merozoites or gametocytes were subjected to RT-PCR using primers specific to EmIP and HSP70. Standard PCR reactions werre subsequently performed using the RT reactions as template with gene-specific primers for EmIP or HSP70. Lane 1,100 bp DNA ladder (1 μg); Lane 2, sporulated oocyst cDNA amplified with EmIP primers (positive control, 2 μL); Lane 3, merozoite RT reaction amplified with EmIP primers (10 μL), Lane 5, merozoite RT reaction amplified with HSP70 primers (positive control, 10 μL); Lane 6, gametocyte RT reaction amplified with HSP70 primers (positive control, 10 μL); Lane 7, merozoite no RT reaction amplified with EmIP primers (negative control, 10 μL); Lane 8, gametocyte no RT reaction amplified with EmIP primers (negative control, 10 μL); Lane 9, no template reaction amplified with EmIP primers (negative control, 10 μL).

FIG. 38 Southern blot analysis of restriction digested E. maxima genomic DNA. Approximately 2.5 μg samples of DNA were digested with a range of restriction enzymes and separated on a 0.9% agarose as indicated. Lane 1, Bgl II; Lane 2, Eco RI; Lane 3, Hind III; Lane 4, Nco I; Lane 5, Nde I; Lane 6, Nsi I. Hybridisation was performed using a 32P labeled 1590 bp cDNA fragment generated with EmIP gene-specific peimers FP015 and RP033.

FIG. 39 PCR analysis of the intron-exon structure of the gene encoding the E. maxima immunodominant protein. Gene-specific primers pairs were used to amplify corresponding gene fragments from cDNA and genomic DNA. A 10 μL sample from each reaction was separated on a 0.8% agarose gel. Lane 1, 1 μg of Lambda DNA/EcoRI+HindIII Markers; Lane 2 and 3, cDNA and genomic DNA respectively amplified with primer pair FPA015/RP033; lanes 4 and 5, cDNA and genomic DNA respectively amplified with primer pair FP021/RP030; Lanes 6 and 7, cDNA and genomic DNA respectively amplified with primer pair FP010/RP023; Lane 10, 1 μg OF 100 bp DNA ladder.

FIG. 40 Particial genomic DNA sequence generated by primers FP010 and RP023. The two introns detected within the amplified gene fragment are shown underlined.

FIG. 41 ClustalW (4.1) alignment of EmIP and EtMIC4 amino acid sequences showing the regions selected (in bold type) for the design of degenerate primers CP003 and CP004. Identical residues are identified by ‘*’ and similar residues by ‘.’.

FIG. 42 Detection of EmIP homologues in Australian strains of Eimeria by PCR and Southern blot analysis. PCR products were generated from genomic DNA samples as indicated, using degenerate primers CP003 and CP004. Reaction samples (10 μL) were separated on a 0.8% agarose gel. Lane 2 E. acervulina; Lane 3, E. brunetti; Lane 4, E. maxima; Lane 5, E. mittis; Lane 6, E. necatrix; Lane 7, E. praecox; Lane 8, E. tenella. (Lane 1, 1 μg of 100 bp ladder). Products were detected by Southern hybridisation with a Houghton strain E. maxima genomic DNA probe generated with primers CP003 and CP004. The membrane was exposed to x-ray film for periods of 10 (A) and 30 (B) min.

FIG. 43 A & B ELISA results for chicken immunogenicity trial of the recombinant form of the 56 kDa and 82 kDa gametocyte antigen. All serum samples were tested at 1:1000 dilution. A) Coating antigen: APGA to test sera against APGA; r56 purified to test sera taken from chickens immunized with PBS, FIA and the two doses of r56. B) Coating antigen: APGA to test sera against APGA; r82 purified protein to test sera taken from chickens immunized with PBS, FIA and the two doses of r82.

FIG. 44 DNA and encoded amino acid sequence of the expressed protein fragment from the 250 kDa asexual stage protein.

FIG. 45 Mouse immunogenicity trial of the recombinant fragment of the 250 kDa asexual stage protein. The average of each group for the three consecutive bleeds is shown, with standard error bars indicated. All serum samples were tested at 1:1000 dilution. Coating antigen was 100 ng of APGA for sera from the positive control APGA group, or 100 ng of the recombinant protein for the negative control PBS and PBS/FIA groups and the two recombinant protein doses (r0.5 μg and r5 μg)

FIG. 46 Chicken immunogenicity trial of the recombinant fragment of the 250 kDa asexual stage protein. The average of each group for the three consecutive bleeds is shown, with standard error bars indicated. All serum samples were tested at 1:1000 dilution. Coating antigen was 100 ng of APGA for sera from the positive control APGA group, or 100 ng of the recombinant protein for the negative control PBS and PBS/FIA groups and the two recombinant protein doses (1 μg and r10 μg)

DETAILED DESCRIPTION OF THE INVENTION

The subject invention provides an isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

It was previously thought that the antigen from the sporozoites/merozoites of E. maxima was a 230 kDa antigen. However, our subsequent studies have revealed that the antigen actually is a 250 kDa antigen of the sporozoites/merozoites of E. maxima.

In one embodiment, the polypeptide has the amino acid sequence shown in FIG. 7b (SEQ. ID. NO. 6).

In another embodiment, the homolog of the polypeptide has greater than 59% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 6.

In a further embodiment, the homolog of the polypeptide has at least 70% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 6.

In an added embodiment, the homolog of the polypeptide has at least 75% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 6.

In yet another embodiment, the homolog of the polypeptide has at least 80% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 6.

In a further embodiment, the homolog of the polypeptide has at least 85% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 6.

In one embodiment, the homolog of the polypeptide has at least 90% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 6.

In another embodiment, the homolog of the polypeptide has at least 93% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 6.

In a further embodiment, the homolog of the polypeptide has at least 95% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 6.

In an additional embodiment, the homolog of the polypeptide has at least 97% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 6.

In one embodiment, the homolog of the polypeptide has at least 99% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 6.

In an additional embodiment, the nucleotide sequence has greater than 60% identity to the nucleotide sequence shown in FIG. 7a (SEQ. ID. NO. 4).

In a further embodiment, the nucleotide sequence has at least 70% identity to the nucleotide sequence shown as SEQ. ID. NO. 4.

In another embodiment, the nucleotide sequence has at least 75% identity to the nucleotide sequence shown as SEQ. ID. NO. 4.

In an additional embodiment, the nucleotide sequence has at least 80% identity to the nucleotide sequence shown as SEQ. ID. NO. 4.

In a further embodiment, the nucleotide sequence has at least 85% identity to the nucleotide sequence shown as SEQ. ID. NO. 4.

In one embodiment, the nucleotide sequence has at least 90% identity to the nucleotide sequence shown as SEQ. ID. NO. 4.

In yet another embodiment, the nucleotide sequence has at least 93% identity to the nucleotide sequence shown as SEQ. ID. NO. 4.

In an added embodiment, the nucleotide sequence has at least 95% identity to the nucleotide sequence shown as SEQ. ID. NO. 4.

In a further embodiment, the nucleotide sequence has at least 97% identity to the nucleotide sequence shown as SEQ. ID. NO. 4.

In one embodiment, the nucleotide sequence has at least 99% identity to the nucleotide sequence shown as SEQ. ID. NO. 4.

In a further embodiment, the nucleic acid is a DNA molecule.

In yet another embodiment, the DNA molecule is a cDNA molecule.

In an added embodiment, the nucleic acid has the nucleotide sequence shown in FIG. 7a (SEQ. ID. NO. 4).

In another embodiment, the nucleic acid is an RNA molecule.

In one embodiment, the isolated nucleic acid is operatively linked to a promoter of RNA transcription.

The subject invention also includes a vector comprising an isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

In one embodiment, the vector comprises the nucleic acid having the nucleotide sequence shown in FIG. 7a (SEQ. ID. NO. 4).

In another embodiment, the vector is a plasmid.

In a further embodiment, the plasmid comprises the nucleic acid having the nucleotide sequence shown in FIG. 7a (SEQ. ID. NO. 4).

In an additional embodiment, the plasmid comprises an isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

In yet another embodiment, the plasmid is the plasmid designated 230.1 plasmid (Australian Government Analytical Laboratories Accession No. NMO1/22396).

The subject invention also encompasses a host cell comprising a vector which comprises an isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

In one embodiment, the host cell comprises a vector comprising a nucleic acid having the nucleotide sequence shown in FIG. 7a (SEQ. ID. NO. 4).

In another embodiment, the host cell is selected from the group consisting of a bacterial cell; a plant cell; an insect cell; and a mammalian cell.

The subject invention additionally presents a transformed cell comprising an isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

In one embodiment, the transformed cell is the transformed cell designated 230.1 in bacteria (Australian Government Analytical Laboratories Accession No. NM01/22397).

The subject plasmid encoding the 250 kDa antigen was deposited with the Australian Government Analytical Laboratories, Pymble, Australia, on Jun. 26, 2001, under Accession No. NM01/22396. The bacterial cell transformed with the 250 kDa antigen was deposited with the Australian Government Analytical Laboratories, Pymble, Australia, on Jun. 26, 2001, under Accession No. NM01/22397. Both deposits were made according to the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of patent Procedure.

In an added embodiment, the transformed cell further comprises a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or a homolog of the polypeptide.

The subject invention further contains a method of producing a recombinant 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima comprising culturing a transformed cell comprising an isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid and isolating the recombinant 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima. The recombinant polypeptide produced by this method is also encompassed by the subject invention.

The subject invention also provides a vaccine against Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

In one embodiment of the vaccine, the isolated nucleic acid is a plasmid.

In addition, the subject invention presents a vaccine against Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising a recombinant 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima produced by culturing a transformed cell comprising an isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid and isolating the recombinant 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima.

In another embodiment, the vaccine is comprised of a mixture of the isolated nucleic acid of the subject invention and the recombinant polypeptide of the subject invention.

In another embodiment, the vaccine is comprised of a mixture of the isolated nucleic acid of the subject invention, the recombinant polypeptide of the subject invention and a plasmid comprising the isolated nucleic acid of the subject invention.

In an added embodiment, the vaccine further comprises a second antigen.

In one embodiment, the second antigen is selected from the group consisting of a nucleic acid coding for an antigen from Eimeria maxima, a plasmid comprising such a nucleic acid, and a polypeptide coded by such a nucleic acid.

In one embodiment, the second antigen is a 56 kDa protein isolated from the gametocytes of Eimeria maxima.

In one embodiment, the second antigen is an 82 kDa protein isolated from the gametocytes of Eimeria maxima.

In one embodiment, the second antigen is a 230 kDa protein isolated from the gametocytes of Eimeria maxima.

In another embodiment, the vaccine further comprises a 56 kDa protein and an 82 kDa protein isolated from the gametocytes of Eimeria maxima.

In another embodiment, the vaccine further comprises a 56 kDa protein, an 82 kDa protein and a 230 kDa protein isolated from the gametocytes of Eimeria maxima.

The extraction and characterization of the E. maxima gametocyte proteins is described in examples 3 and 4 of U.S. Pat. Nos. 5,932,225 and 5,496,550 and the contents of these patents is hereby incorporated by reference into this application. Briefly, chickens were infected with 10,000 oocysts each and then sacrificed several days after infection. The intestines were removed and the gametocytes extracted by one of two methods as described in Example 1 of the above referenced patents. The proteins were then extracted from the gametocytes using various detergents and the extracted proteins were examined by SDS polyacrylamide gel electrophoresis (SDS-PAGE). The proteins had molecular weights between 10 and 300 kDa, with 5 major metabolically labeled proteins of molecular weights of about 82 kDa, 73 kDa, 56 kDa, and 35 kDa. The proteins were then analyzed by ELISA, immunofluoroscence, Western blotting and immune precipitation of cell-free translation products. Western blotting detected 3 major bands in chicken sera at 82, 56 and 43 kDa as well as minor bands at 250, 116, 78, 52 and 36 kDa. Parts of the 250 kDa protein were cloned and sequenced as well. Fried et al. subsequently cloned and sequenced the entire 250 kDa gametocyte protein.

The subject invention also provides a method of immunizing a subject against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the step of administering to the subject the vaccine of the subject invention.

In one embodiment, the subject is a species selected from the group consisting of cattle, sheep, pigs and fish.

In another embodiment, the subject is an avian species.

In a further embodiment, the avian species is selected from the group consisting of chickens, turkeys, geese, ducks, bantams, quail and pigeons.

In an additional embodiment, the avian species is chickens.

In one embodiment, the administering step comprises spraying the vaccine into the nostrils of the subject.

In a further embodiment, the administration comprises intravenous, intramuscular or intraperitoneal injection.

In another embodiment, the administration is performed in ovo.

In a further embodiment, the administration is to the air sac of an egg, thus contacting an embryo with the vaccine.

The subject invention also provides a method of conferring upon a newborn subject of an avian species maternal immunity (antibodies) against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the step of administering to the mother of the subject at a suitable time prior to the laying of a fertilized egg the vaccine of the subject invention in order to thereby confer protection via maternal immunity against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, in the newborn subject.

In a further embodiment, the avian species is selected from the group consisting of chickens, turkeys, geese, ducks, bantams, quail and pigeons.

In a further embodiment, the administration comprises intravenous, intramuscular or intraperitoneal injection.

The subject invention also provides a method of reducing the output of Eimeria oocysts in feces from a newborn subject of an avian species which comprises the step of administering to the mother of the subject at a suitable time prior to the laying of a fertilized egg the vaccine of the subject invention in order induce an immune response and transmit maternal antibodies to the newborn so that the output of oocysts from the newborn is reduced.

In a further embodiment, the avian species is selected from the group consisting of chickens, turkeys, geese, ducks, bantams, quail and pigeons.

In a further embodiment, the administration comprises intravenous, intramuscular or intraperitoneal injection.

The subject invention also provides a method of immunizing a subject against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the step of administering to the subject a live vaccine comprising a living non-virulent micro-organism or live virus that expresses a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima.

In one embodiment, the live virus is the pox virus.

In one embodiment, the subject is a species selected from the group consisting of cattle, sheep, pigs and fish.

In another embodiment, the subject is an avian species.

In a further embodiment, the avian species is selected from the group consisting of chickens, turkeys, geese, ducks, bantams, quail and pigeons.

In a further embodiment, the administration comprises intravenous, intramuscular or intraperitoneal injection.

The subject invention also provides a method of immunizing a subject against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the step of feeding to the subject a plant whose cells express a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima.

In one embodiment, the plant is wheat.

In another embodiment, the plant is corn.

In one embodiment, the subject is a species selected from the group consisting of cattle, sheep, pigs and fish.

In another embodiment, the subject is an avian species.

In a further embodiment, the avian species is selected from the group consisting of chickens, turkeys, geese, ducks, bantams, quail and pigeons.

The subject invention also provides a method of immunizing a subject against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the step of administering to the subject a plasmid comprising an isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

In one embodiment, the subject is a species selected from the group consisting of cattle, sheep, pigs and fish.

In another embodiment, the subject is an avian species.

In a further embodiment, the avian species is selected from the group consisting of chickens, turkeys, geese, ducks, bantams, quail and pigeons.

In a further embodiment, the administration comprises intravenous, intramuscular or intraperitoneal injection.

The subject invention also contains a fertilized egg from an avian species having an air sac which is inoculated with the vaccine of the subject invention, which vaccine is capable of inducing before or immediately after hatching an immune response in the embryo against a virulent form of Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen.

In one embodiment, the avian species is selected from the group consisting of chickens, ducks, turkeys, geese, bantams, quail and pigeons.

In another embodiment, the avian species is chickens.

The subject invention also provides an isolated nucleic acid comprising a nucleotide sequence encoding an immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima having the amino acid sequence shown as SEQ. ID NO. 26, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

In one embodiment, the homolog of the polypeptide has greater than 59% identity to the polypeptide having the sequence shown as SEQ. ID NO. 26.

In a further embodiment, the homolog of the polypeptide has at least 70% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 26.

In an added embodiment, the homolog of the polypeptide has at least 75% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 26.

In yet another embodiment, the homolog of the polypeptide has at least 80% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 26.

In a further embodiment, the homolog of the polypeptide has at least 85% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 26.

In one embodiment, the homolog of the polypeptide has at least 90% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 26.

In another embodiment, the homolog of the polypeptide has at least 93% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 26.

In a further embodiment, the homolog of the polypeptide has at least 95% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 26.

In an additional embodiment, the homolog of the polypeptide has at least 97% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 26.

In one embodiment, the homolog of the polypeptide has at least 99% identity to the polypeptide having the sequence shown as SEQ. ID. NO. 26.

In an additional embodiment, the nucleotide sequence has greater than 60% identity to the nucleotide sequence shown as SEQ. ID. NO. 25.

In a further embodiment, the nucleotide sequence has at least 70% identity to the nucleotide sequence shown as SEQ. ID. NO. 25.

In another embodiment, the nucleotide sequence has at least 75% identity to the nucleotide sequence shown as SEQ. ID. NO. 25.

In an additional embodiment, the nucleotide sequence has at least 80% identity to the nucleotide sequence shown as SEQ. ID. NO. 25.

In a further embodiment, the nucleotide sequence has at least 85% identity to the nucleotide sequence shown as SEQ. ID. NO. 25.

In one embodiment, the nucleotide sequence has at least 90% identity to the nucleotide sequence shown as SEQ. ID. NO. 25.

In yet another embodiment, the nucleotide sequence has at least 93% identity to the nucleotide sequence shown as SEQ. ID. NO. 25.

In an added embodiment, the nucleotide sequence has at least 95% identity to the nucleotide sequence shown as SEQ. ID. NO. 25.

In a further embodiment, the nucleotide sequence has at least 97% identity to the nucleotide sequence shown as SEQ. ID. NO. 25.

In one embodiment, the nucleotide sequence has at least 99% identity to the nucleotide sequence shown as SEQ. ID. NO. 25. In a further embodiment, the nucleic acid is a DNA molecule.

In yet another embodiment, the DNA molecule is a cDNA molecule.

In an added embodiment, the nucleic acid has the nucleotide sequence shown as SEQ. ID. NO. 25.

In another embodiment, the nucleic acid is an RNA molecule.

In one embodiment, the isolated nucleic acid is operatively linked to a promoter of RNA transcription.

The subject invention also includes a vector comprising an isolated nucleic acid comprising a nucleotide sequence encoding an immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima having the amino acid sequence shown as SEQ. ID NO. 26, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

In one embodiment, the vector comprises the nucleic acid having the nucleotide sequence shown as SEQ. ID. NO. 25.

In another embodiment, the vector is a plasmid.

In a further embodiment, the plasmid comprises the nucleic acid having the nucleotide sequence shown as SEQ. ID. NO. 25.

In an additional embodiment, the plasmid comprises an isolated nucleic acid comprising a nucleotide sequence encoding an immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima having the amino acid sequence shown as SEQ. ID NO. 26, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

The subject invention also encompasses a host cell comprising a vector which comprises an isolated nucleic acid comprising a nucleotide sequence encoding an immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima having the amino acid sequence shown as SEQ. ID NO. 26, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

In one embodiment, the host cell comprises a vector comprising a nucleic acid having the nucleotide sequence shown as SEQ. ID. NO. 25.

In another embodiment, the host cell is selected from the group consisting of a bacterial cell; a plant cell; an insect cell; and a mammalian cell.

The subject invention additionally presents a transformed cell comprising an isolated nucleic acid comprising a nucleotide sequence encoding an immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima having the amino acid sequence shown as SEQ. ID NO. 26, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

In an added embodiment, the transformed cell further comprises an immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima having the amino acid sequence shown as SEQ. ID NO. 26 or encoding a homolog of the polypeptide.

The subject invention further provides a method of producing a recombinant polypeptide from Sporozoites/Merozoites of Eimeria maxima comprising culturing a transformed cell comprising an isolated nucleic acid comprising a nucleotide sequence encoding an immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima having the amino acid sequence shown as SEQ. ID NO. 26, or encoding a homolog of the polypeptide and isolating the recombinant immunodominant portion of the 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima. The recombinant polypeptide produced by this method is also encompassed by the subject invention.

The subject invention also provides a vaccine against Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the isolated nucleic acid comprising a nucleotide sequence encoding an immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima having the amino acid sequence shown as SEQ. ID NO. 26, or encoding a homolog of the polypeptide, or a complement of the nucleic acid.

In one embodiment of the vaccine, the isolated nucleic acid is a plasmid.

In addition, the subject invention provides a vaccine against Eimeria tenella, Eimeria maxima, Eimeria acervulina, Elmeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising a recombinant polypeptide from Sporozoites/Merozoites of Eimeria maxima produced by culturing a transformed cell comprising an isolated nucleic acid comprising a nucleotide sequence encoding an immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima having the amino acid sequence shown as SEQ. ID NO. 26, or encoding a homolog of the polypeptide, or a complement of the nucleic acid and isolating the recombinant polypeptide from Sporozoites/Merozoites of Eimeria maxima.

In another embodiment, the vaccine is comprised of a mixture of the isolated nucleic acid of the subject invention and the recombinant polypeptide of the subject invention.

In an added embodiment, the vaccine further comprises a second antigen.

In one embodiment, the second antigen is selected from the group consisting of a nucleic acid coding for an antigen from Eimeria maxima, a plasmid comprising such a nucleic acid, and a polypeptide coded by such a nucleic acid.

The subject invention also provides a method of immunizing a subject against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Elmeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the step of administering to the subject the vaccine of the subject invention.

In one embodiment, the subject is a species selected from the group consisting of cattle, sheep, pigs and fish.

In another embodiment, the subject is an avian species.

In a further embodiment, the avian species is selected from the group consisting of chickens, turkeys, geese, ducks, bantams, quail and pigeons.

In an additional embodiment, the avian species is chickens.

In one embodiment, the administering step comprises spraying the vaccine into the nostrils of the subject.

In another embodiment, the administration comprises intravenous, intramuscular or intraperitoneal injection.

In another embodiment, the administration is performed in ovo.

In a further embodiment, the administration is to the air sac of an egg, thus contacting an embryo with the vaccine.

The subject invention also provides a method of conferring upon a newborn subject of an avian species maternal immunity (antibodies) against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the step of administering to the mother of the subject at a suitable time prior to the laying of a fertilized egg the vaccine of the subject invention in order to thereby confer protection via maternal immunity against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, in the newborn subject.

In a further embodiment, the avian species is selected from the group consisting of chickens, turkeys, geese, ducks, bantams, quail and pigeons.

In a further embodiment, the administration comprises intravenous, intramuscular or intraperitoneal injection.

The subject invention also provides a method of reducing the output of Eimeria oocysts in feces from a newborn subject of an avian species which comprises the step of administering to the mother of the subject at a suitable time prior to the laying of a fertilized egg the vaccine of the subject invention in order induce an immune response and transmit maternal antibodies to the newborn so that the output of oocysts from the newborn is reduced.

In a further embodiment, the avian species is selected from the group consisting of chickens, turkeys, geese, ducks, bantams, quail and pigeons.

In a further embodiment, the administration comprises intravenous, intramuscular or intraperitoneal injection.

The subject invention also provides a method of immunizing a subject against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the step of administering to the subject a live vaccine comprising a living non-virulent micro-organism or live virus that expresses the immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima having the amino acid sequence shown as SEQ. ID NO. 26.

In one embodiment, the live virus is the pox virus.

In one embodiment, the subject is a species selected from the group consisting of cattle, sheep, pigs and fish.

In another embodiment, the subject is an avian species.

In a further embodiment, the avian species is selected from the group consisting of chickens, turkeys, geese, ducks, bantams, quail and pigeons.

In a further embodiment, the administration comprises intravenous, intramuscular or intraperitoneal injection.

The subject invention also provides a method of immunizing a subject against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the step of feeding to the subject a plant whose cells express the immunodominant portion of a 250 kDa polypeptide from Sporozoites/Merozoites of Eimeria maxima.

In one embodiment, the plant is wheat.

In another embodiment, the plant is corn.

In one embodiment, the subject is a species selected from the group consisting of cattle, sheep, pigs and fish.

In another embodiment, the subject is an avian species.

In a further embodiment, the avian species is selected from the group consisting of chickens, turkeys, geese, ducks, bantams, quail and pigeons.

The subject invention also provides a method of immunizing a subject against infection by Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen, comprising the step of administering to the subject a plasmid comprising the nucleic acid having the nucleotide sequence shown as SEQ. ID. NO. 25.

In one embodiment, the subject is a species selected from the group consisting of cattle, sheep, pigs and fish.

In another embodiment, the subject is an avian species.

In a further embodiment, the avian species is selected from the group consisting of chickens, turkeys, geese, ducks, bantams, quail and pigeons.

In a further embodiment, the administration comprises intravenous, intramuscular or intraperitoneal injection.

The subject invention also contains a fertilized egg from an avian species having an air sac which is inoculated with the vaccine of the subject invention, which vaccine is capable of inducing before or immediately after hatching an immune response in the embryo against a virulent form of Eimeria tenella, Eimeria maxima, Eimeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis or Eimeria brunetti, or a microorganism expressing an immunologically cross-reactive antigen.

In one embodiment, the avian species is selected from the group consisting of chickens, ducks, turkeys, geese, bantams, quail and pigeons.

In another embodiment, the avian species is chickens.

The present invention provides the recombinant cloning and sequencing of the 250 kDa sporozoite/merozoite antigen from E. maxima.

The 250 kDa antigen was isolated from purified E. maxima sporozoites which are present in sporulated oocysts (see life cycle above). The isolation procedure involved extraction of proteins from the sporulated oocysts and separation of the extracted proteins on a DEAE-sephacel anion-exchange column. This was followed by SDS-PAGE of the peak fractions and Western blotting to identify the 250 kDa antigen. Furthermore, protective maternal antisera both from vaccinated hens and offspring chicks were used to confirm the identity of the purified antigen. Finally, the 250 kDa protein was isolated from a PVDF membrane filter for carrying out protein sequencing and cloning.

The amino terminal and tryptic peptide digest products of the 250 kDa antigen were sequenced. The sequences from the tryptic digest were used to design degenerate PCR oligonucleotide primers. The primers were used in RACE (rapid amplification of cDNA ends) PCR to amplify partial gene products. From the sequences of these products, gene specific primers were designed and used in RACE PCR to define the 3′ and 5′ ends of the mRNA. A full length 7 kilobase cDNA clone encoding the antigen was then amplified by PCR using gene specific primers designed to the 5′ and 3′ ends. This clone was fully sequenced and shown to contain the correct DNA sequence at its 5′ end when compared to the amino acid sequence of the N-terminus of the native protein. Thus, this nucleic acid sequence encoded the protective 250 kDa sporozoite/merozoite antigen and could now be used to produce recombinant antigen for vaccination of chickens against coccidiosis.

A homolog of the nucleic acid of the invention is a nucleic acid that codes for a polypeptide which has substantially the same biological activity as the polypeptide encoded by the nucleic acid. The term “homology”, as used herein, refers to a degree of complementarity. There may be partial homology or complete homology (i.e., identity). A partially complementary sequence is one that at least partially inhibits an identical sequence from hybridizing to a target nucleic acid; it is referred to using the functional term “substantially homologous.” The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or northern blot, solution hybridization and the like) under conditions of low stringency. A substantially homologous sequence or probe will compete for and inhibit the binding (i.e., the hybridization) of a completely homologous sequence or probe to the target sequence under conditions of low stringency. This is not to say that conditions of low stringency are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction. The absence of non-specific binding may be tested by the use of a second target sequence which lacks even a partial degree of complementarity (e.g., less than about 30% identity); in the absence of non-specific binding, the probe will not hybridize to the second non-complementary target sequence.

As known in the art, numerous equivalent conditions may be employed to comprise either low or high stringency conditions. Factors such as the length and nature (DNA, RNA, base composition) of the sequence, nature of the target (DNA, RNA, base composition, presence in solution or immobilization, etc.), and the concentration of the salts and other components (e.g., the presence or absence of formamide, dextran sulfate and/or polyethylene glycol) are considered and the hybridization solution may be varied to generate conditions of either low or high stringency different from, but equivalent to, the above listed conditions.

It is an object of the present invention to provide nucleotide sequences encoding the 250 kDA antigens from Sporozoites/Merozoites of Eimeria maxima and the deduced amino acid sequence therefor. Specifically exemplified coding sequences are given in FIG. 6, together with the deduced amino acid sequence. All synonymous coding sequences for the exemplified amino acid sequences are within the scope of the present invention.

It is a further object of the present invention to provide functionally equivalent coding and protein sequences, including equivalent sequences from other Eimeria species. Functionally equivalent 250 kDa antigens from Sporozoites/Merozoites of Eimeria maxima coding sequences are desirably from about 50% to about 80% nucleotide sequence homology (identity) to the specifically identified coding sequence, from about 80% to about 95%, and desirably from about 95% to about 100% identical in coding sequence to the specifically exemplified coding sequence.

Hybridization conditions of particular stringency provide for the identification of homologs of the coding sequence from other species and the identification of variant sequences, where those homologs and/or variant sequences have at least (inclusively) 50 to 85%, 85 to 100% nucleotide sequence identity, 90 to 100%, or 95 to 100% nucleotide sequence identity. Each integer and each subset of each specified range is intended within the context of the present invention.

The coding sequence and methods of the present invention include the homologous coding sequences in species other than Eimeria maxima. Methods can be employed to isolate the corresponding coding sequences (for example, from cDNA) from other organisms, including but not limited to other species such as Eimeria tenella, Elmeria acervulina, Eimeria necatrix, Eimeria praecox, Eimeria mitis and Eimeria brunetti useful in the methods of this invention using the sequences disclosed herein and experimental techniques well known to the art.

Specifically included in this invention are sequences from other species than those exemplified herein, which sequences hybridize to the sequences disclosed under stringent conditions. Stringent conditions refer to conditions understood in the art for a given probe length and nucleotide composition and capable of hybridizing under stringent conditions means annealing to a subject nucleotide sequence, or its complementary strand, under standard conditions (i.e., high temperature and/or low salt content) which tend to disfavor annealing of unrelated sequences.

“Conditions of high stringency” means hybridization and wash conditions of 650-68° C., 0.1×SSC and 0.1% SDS (indicating about 95-100% nucleotide sequence identity/similarity). Hybridization assays and conditions are further described in Sambrook et al. (1989) Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory, Plainview, N.Y. As used herein, conditions of moderate (medium) stringency are those with hybridization and wash conditions if 50-65° C., 1×SSC and 0.1% SDS (where a positive hybridization result reflects about 80-95% nucleotide sequence identity). Conditions of low stringency are typically those with hybridization and wash conditions of 40-50° C., 6×SSC and 0.1% SDS (reflecting about 50-80% nucleotide sequence identity).

A homolog of the polypeptide of the invention is a polypeptide which has substantially the same amino acid sequence and biological activity as the polypeptide. Thus, a homolog may differ from the polypeptide of the invention by the addition, deletion, or substitution of one or more non-essential amino acid residues, provided that the resulting polypeptide retains the biological activity of the polypeptide. Persons skilled in the art can readily determine which amino acids residues may be added, deleted, or substituted (including with which amino acids such substitutions may be made) using established and well known procedures, including, for example, conventional methods for the design and manufacture of DNA sequences coding for bacterial expression of polypeptide homologs of the subject polypeptide, the modification of cDNA and genomic sequences by site-directed mutagenesis techniques, the construction of recombinant polypeptides and expression vectors, the bacterial expression of the polypeptides, and the measurement of the biochemical activity of the polypeptides by means of conventional biochemical assays.

Examples of homologs are deletion homologs containing less than all the residues specified in the subject polypeptide, substitution homologs wherein one or more residues specified are replaced by other residues, and addition homologs wherein one or more amino acids residues are added to the polypeptide. All such homologs share the biological activity of the polypeptide of the invention.

“Substantially the same polypeptide” is herein defined as encompassing the deletion, addition or substitution of fewer than four amino acids at the N-terminus of the amino acid sequence of the polypeptide. Furthermore, there may be deletions, additions or substitutions in the sequence which do not eliminate the biological activity of the polypeptide. Such modifications are known to those skilled in the art. For example, substitutions may encompass up to 10 residues in accordance with the homologous or equivalent groups described by e.g. Lehninger, Biochemistry, 2nd ed. Worth Pub., New York. (1975); Creighton, Protein Structure, a Practical Approach, IRL Press at Oxford Univ. Press, Oxford, England (1989); and Dayhoff, Atlas of Protein Sequence and Structure 1972, National Biomedical Research Foundation, Maryland (1972).

The term “biologically active”, as used herein, refers to a polypeptide having structural, regulatory, or biochemical functions of a naturally occurring molecule. Likewise, “immunologically active” refers to the capability of the natural, recombinant, or synthetic polypeptide, or any oligopeptide portion thereof, to induce a specific immune response in an animal or cells and to bind with specific antibodies.

“Substantially the same biological activity” refers to biological activity the same as that of the naturally occurring molecule possibly differing slightly in degree or level which would still be known by the skilled artisan to be the same biological activity.

The term “portion”, as used herein, in connection with a polypeptide (as in “a portion of a given polypeptide”) refers to fragments of that polypeptide. The fragments may range in size from four (4) amino acid residues to the entire amino acid sequence minus one amino acid.

The term “portion”, as used herein, in connection with a nucleic acid (as in “a portion of a given nucleic acid”) refers to fragments of that nucleic acid. The fragments may range in size from twelve (12) nucleotide residues to the entire nucleic acid sequence minus one nucleotide.

A “deletion”, as used herein, refers to a change in either amino acid or nucleotide sequence in which one or more amino acid or nucleotide residues, respectively, are absent.

An “insertion” or “addition”, as used herein, refers to a change in an amino acid or nucleotide sequence resulting in the addition of one or more amino acid or nucleotide residues, respectively, as compared to the naturally occurring molecule.

A “substitution”, as used herein, refers to the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides, respectively.

The present invention provides the recombinant cloning and sequencing of an immunodominant and highly protective 250 kDa antigen from sporulated oocysts of Eimeria maxima.

The antigen was shown to react with serum from protected hens and chicks and the sequence of the gene was based on the amino acid sequence of the protein recognized by the protective sera. The gene is strongly expressed in the sporozoite and merozoite stages of development and has been predicted to play a role in host cell invasion. Thus, this antigen can be used in a vaccine against coccidiosis.

The subject invention also provides a vaccine against coccidiosis comprising the recombinant 250 kDa antigen.

The subject invention also provides an isolated nucleic acid having the nucleotide sequence shown in SEQ. ID NO. 25.

The subject invention also provides a recombinant polypeptide, wherein the amino acid sequence is shown by SEQ. ID NO. 26.

The invention is further illustrated by the following examples which in no way should be construed as being further limiting. One skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims which follow thereafter.

EXPERIMENTAL DETAILS

Example 1

Purification of the 250 kDa Sporozoite Antigen from Sporulated Oocysts

Sporulated oocysts of E. maxima were prepared as described previously (Wagenbach). 100×106 sporulated oocysts were thoroughly washed and then resuspended in an equal volume of 40 mM Tris.HCl pH 8.0, overlayed with glass beads and ruptured by vortexing for 5 minutes. The homogenate was then subjected to three cycles of freeze-thawing using liquid nitrogen/40° C. water bath, followed by centrifugation at 13,000×g for 10 minutes. The supernatant was removed, transferred to a microconcentrator (Centricon 100, Amicon) and concentrated by centrifugation at 9900×g for 30 minutes at 4° C. Protein concentration was determined by the Bradford method. A 5 microgram sample of the crude extract was analyzed by SDS-PAGE and Western blotting the results of which are shown in FIG. 1. As can be seen, sera from hens or their offspring chicks immunized by live infection with E. maxima or with a crude merozoite extract reacted with the 250 kDa protein band present in sporulated oocysts. In addition, as can be seen in lane 3, yolk from eggs of hens immunized with the merozoite 250 kDa cutout protein band (used previously in our maternal immunization trial (Smith et al.)), also reacted with the 250 kDa protein.

DEAE-sephacel (Pharmacia, Sweden) anion-exchange resin was used to fill a 1 cm by 20 cm column and was equilibrated in 40 mM Tris.HCl pH 8.0 at a flow rate of 0.7 ml/min. 1.5 mg of crude sporulated oocyst protein extract was applied to the column and the proteins were subsequently eluted with a step gradient of 0-1M NaCl in 40 mM Tris pH 8.0. The eluate was monitored using a UV detector set at 280 nm and a chart recorder and the results are shown in FIG. 2. Fractions were collected and pooled according to the peaks found, concentrated and centrifuged as above.

The pooled fractions obtained at the various NaCl concentrations used for elution, were analyzed by SDS PAGE and Western blotting (FIG. 3). As can be seen, both by silver staining of the gel or by reactivity with chicken antiserum raised against a crude merozoite extract, the 250 kDa antigen band appeared in the 0.3-0.5 M NaCl fractions. This same band was also recognized by antiserum from protected 3 day old offspring chicks of hens immunized by live infection.

Example 2

Amino Acid Sequencing of the N-Terminus as Well as Internal Tryptic Peptides from the 250 kDa Antigen

Ion-exchange purified fractions eluted with 0.3 to 0.5 M NaCl were pooled and the proteins were separated by SDS-PAGE (FIG. 4). Following electrophoresis, the proteins were transferred to a PVDF membrane, which was then stained with Coomassie Blue. The band corresponding to the immunodominant 250 kDa protein was excised and the N-terminus was sequenced. For the sequencing of internal peptides, the 250 kDa protein band was subjected to tryptic digestion and subsequent sequence analysis of the generated peptides by mass spectrometry.

The results of the sequence analysis were as follows:

N-terminal: EVNNELSK(C)ESGWTPW (SEQ. ID. NO. 8)

Tryptic peptide 1 QWTAWTE (SEQ. ID. NO. 9)

Tryptic peptide 2 EL/IVNWF (SEQ. ID. NO. 10)

Example 3

RACE PCR Cloning and Sequencing of the Gene Encoding the 250 kDa Antigen

Total RNA was extracted from sporulated oocysts using TRIzol Reagent according to the manufacturer's protocol. mRNA was isolated from total RNA using a Dynal mRNA kit according to the manufacturer's instructions. The mRNA was then used for the construction of cDNA using a Marathon RACE kit (Clonetech). Degenerate PCR primers were designed from the N-terminal and tryptic peptide sequences and used in the 5′ and 3′ RACE PCR experiments. Bands generated were cloned and sequenced and the sequence obtained was used to design new gene-specific primers. Gene specific primers were then used together with the degenerate primers to precisely define the 5′ and 3′ ends of the cDNA. Gene specific primers were then designed to amplify the full length 7 kilobase cDNA. The result are shown in FIG. 5 where the 7 KB cDNA band can be visualized.

The DNA sequence data obtained from the 250 kDa cDNA clone is presented in FIG. 6. As can be seen, the sequence contains the amino terminus starting from base pair number 231 (ATG) and ending in the stop codon at base pair 7310. The total length of the sequence is 7987 bases. The sequence encodes for a protein of 2359 amino acids with a predicted molecular weight of 249 kDa.

The subject plasmid encoding the 250 kDa antigen was deposited with the Australian Government Analytical Laboratories, Pymble, Australia, on Jun. 26, 2001, under Accession No. NM01/22396. The bacterial cell transformed with the 250 kDa antigen was deposited with the Australian Government Analytical Laboratories, Pymble, Australia, on Jun. 26, 2001, under Accession No. NM01/22397. Both deposits were made according to the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of patent Procedure.

As can be seen in FIG. 7, the sequence of the E. maxima 250 kDa gene was found to share homology with a gene sequence designated GX5401 and GX5401 FL from E. tenella (WO 90/00403). E. tenella clone GX5401 was selected from a cDNA library prepared from E. tenella sporulated oocysts using convalescent chicken serum for screening the library. The E. tenella full length gene GX5401FL was cloned from a genomic library using the GX5401 cDNA clone as a probe. This gene has an open reading frame of 6,567 bases and encodes a protein with a predicted molecular weight of about 250 kDa. In comparing the full length sequence of the E. maxima 250 kDa clone to the E. tenella sequence (FIGS. 7a and 7b), it was found that overall there was a homology of 60% and 59% for the DNA and amino acid sequences, respectively. This level of homology is relatively low and thus, this newly cloned E. maxima gene is significantly different from the E. tenella clone. Since the subject E. maxima clone is also strongly recognized by protective maternal antibodies, it therefore provides the basis for production of a new recombinant vaccine against coccidiosis in chickens.

Example 4

Purification and Western Blot Analysis of an Immunodominant Asexual Stage Protein from Eimeria maxima

Materials

For convenience, the chemical reagents, biological reagents and miscellaneous materials listed below are grouped with the names of suppliers.

Chemical Reagents

Unless otherwise stated all chemicals used throughout this study were of analytical grade.

    • Amresco (U.S.A); chloroform, citric acid (trisodium hydrate), acetic acid, citric acid EDTA, NaHCO3, phenol, SDS, Tris Borate EDTA buffer (10× stock: 0.89M Tris, 0.89M borate, 0.02M EDTA)
    • British Drug Houses Chemicals (U.K); acetic acid, ethanol, glycine, HCl, isopropanol, KCl KH2PO4, methanol, MgCl2, MgSO4, NaCl, Na2HPO4, NaOH
    • Progen Industries Ltd. (Australia); X-gal
    • Sigma Chemical Company (U.S.A); 2-mercaptoethanol, BCIP/NBT Buffered Substrate Tablet, EtBr, glycerol, IPTG, HBS, isoamyl alcohol, PMSF, Tris
      Biological Reagents
    • Biotech International Ltd. (Australia); 2 mM dNTP solution
    • Clontech (U.S.A); Advantage® 2 Taq polymerase and 10× reaction buffer
    • DIFCO Laboratories (U.S.A); bacteriological agar, trypsin, tryptone, yeast extract
    • Fluka Chemical Corp (U.S.A); taurocholic acid
    • ICN (U.S.A); penicillin 10,000 I.U./mL and streptomycin 10,000 |ig/mL antibiotic mixture
    • New England Biolabs (U.S.A); restriction endonucleases and 10× reaction buffers
    • PerkinElmer Life Sciences, Inc. (U.S.A); 32P-dCTP
    • Pierce Chemical Company (U.S.A); BSA
    • Progen Industries Ltd. (Australia); DNA grade agarose, ampicillin, proteinase K
    • Promega (U.S.A); T4 DNA ligase and 2× ligation buffer
    • Roche; DNase (Rnase free), RNase inhibitor
      Miscellaneous Materials
    • BioRad; Econo-columns (low pressure chromatography columns)
    • Amersham Pharmacia Biotech (Sweden); DEAE sephacel, Hybond-N+ nucleic acid transfer membrane, Percoll
    • Pall corporation (U.S.A); PVDF protein transfer membrane
    • Sigma Chemical Company (U.S.A); glass beads
      Solutions and Growth Media
    • Denaturation solution; 0.5M NaCl, 0.5M NaOH
    • Hybridisation solution; 0.263M Na2HPO4 pH 7.2, 1% BSA, 1 mM EDTA, 7% SDS
    • LB medium; 1% NaCl, 1% tryptone, 0.5% yeast extract
    • LB agar; LB medium with 0.24% MgSO4, 1.5% agar
    • Neutralisation solution; 0.5M Tris-Cl pH 7.4, 2.5M NaCl
    • PBS 1×; 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4, pH 7.4
    • SDS electrophoresis buffer; 0.151% Tris, 7.2% glycine, 0.5% SDS
    • SOB media; 0.05% NaCl, 2% tryptone, 0.5% yeast extract
    • SOC media; SOB with 20 mM glucose, 10 mM MgCl2, 10 mM MgSO4
    • SSC 20×; 3M NaCl, 0.3M NaCltrate, pH 7.0
    • TBE electrophoresis buffer; 0.89M Tris, 0.89M borate, 0.02M EDTA
    • TE buffer; 10 mM Tris-Cl pH8.0, 1 mM EDTA
    • Transfer solution; 1M NaCl, 0.1M NaCitrate, pH 7.0 with 1M citric acid
      Commercial Kits
    • Dynabeads® mRNA DIRECT kit (DYNAL, Norway)
    • GenElute™ Plasmid Miniprep Kit (Sigma, U.S.A.)
    • Marathon™ cDNA Amplification Kit (CLONTECH, U.S.A)
    • Omniscript™ RT Kit (QIAGEN, U.S.A.)
    • pGEM®-T Easy Vector System (Promega, U.S.A)
    • Protease Inhibitor Cocktail P8465 (Sigma, U.S.A.)
    • QIAquick® Gel Extraction Kit (QIAGEN, U.S.A.)
    • QIAquick PCR Purification Kit (QIAGEN, U.S.A.)
    • Random Primed DNA Labelling Kit (Roche)
    • Silver Staining Kit, PlusOne (Amersham Pharmacia Biotech, Sweden)
      Parasites

The Houghton strain of Eimeria maxima was used throughout this study. Sporulated oocysts were initially supplied by the National Veterinary Institute, Uppsala, Sweden. Australian strains of E. maxima and E. tenella were used for comparative experiments and sporulated oocysts were supplied by Medichick Pty. Ltd., Victoria, Australia.

Host Strain

The Australorpe strain of domestic chicken was used throughout this study. Birds were supplied as day-old cockerels by Barter and Sons Pty. Ltd., N.S.W., Australia.

Methods

Parasite Preparation

Sporulated Oocysts

E. maxima was routinely passaged in the host strain every 3-4 months following a modified procedure of that described by Shirley (1995). At 3-4 weeks of age, birds were infected by oral inoculation with 5×103 sporulated oocysts and feces collected each day from day 6 to day 9 pi. On the day of collection, feces were transferred to a 4 L bucket and tap water added in the ratio 4 parts water to 1-part feces. The slurry was homogenized in an industrial strength blender and the resulting homogenate filtered through a 1 mm-gauge stainless steel laboratory sieve. The filtrate was centrifuged at 2000×g for 10 minutes and the supernatant discarded. Pellets containing the oocysts were resuspended in saturated NaCl solution by vigorous shaking and centrifuged at 750×g for 10 minutes. The supernatant containing floated oocysts was then filtered in succession through 17 μm and 10 μm polymon mesh and the oocysts collected with a sterile transfer pipette from the surface of the mesh. In order to maximize the yield, pellets that still contained oocysts were resuspended in fresh saturated NaCl solution and the procedure repeated up to 5 times. Oocysts collected in this manner were immediately washed free of NaCl by repeated dilution in water and centrifugation at 1500×g for 5 minutes. Oocysts were then resuspended in 2% potassium dichromate and sporulated by incubation at 28° C. in a shaking water bath for 72 hrs. Following sporulation, cultures were stored at 4° C.

The use of polymon mesh during the isolation procedure made advantage of the relatively large size of E. maxima oocysts (18 μm×30 μm). Oocysts were unable to pass through the 10 μm mesh and were recovered quickly and in a small volume easily manipulated in downstream steps.

Sodium Hypochlorite Treatment of Oocysts

Oocysts stored in potassium dichromate at 4° C. were cleaned with sodium hypochlorite in the preparation of infective doses and prior to crude antigen preparation. Potassium dichromate was removed from the oocyst culture by repeated water washes and centrifugation at 1500×g for 5 minutes. Pelleted oocysts were resuspended in water, an equal volume of 12.5% w/v sodium hypochlorite (final concentration 6.25% w/v) added and the suspension placed on ice for 10 minutes. Following centrifugation at 750×g for 10 minutes, the supernatant containing clean oocysts was filtered through 10 μm polymon mesh and the oocysts collected from the surface of the mesh with a sterile transfer pipette. Sodium hypochlorite was immediately removed by repeated washing with water and centrifugation at 1500×g for 5 minutes. Oocysts were resuspended in water if used for infection, or an appropriate buffer for crude antigen preparation.

Merozoites

Chickens were infected at 3-4 weeks of age by oral inoculation with 2×105 sporulated oocysts and killed at 93 hrs post infection. The intestines were removed, immediately rinsed in ice-cold PBS pH 7.4, then cut into pieces approximately 3 cm in length. The pieces were added to a solution of Hanks Balanced Salts solution (Sigma) pH 7.4 containing 0.025% trypsin, 1% Taurocholic acid (Fluka), 10 mM MgCl2, 200 units/mL penicillin and 200 μg/mL streptomycin, and incubated at 40° C. for between 20-30 min. The release of merozoites was monitored microscopically throughout the incubation period. The solution was then filtered in succession through 1000 μm and 250 μm stainless steel laboratory sieves and finally through 17 μm polymon mesh, serving to remove larger intestinal debris. The resulting filtrate was centrifuged at 1000×g for 10 min, the supernatant discarded and pellets containing merozoites resuspended in an equal volume of ice-cold HBSS containing 10mM MgCl2.

To remove smaller debris the merozoites were layered on a discontinuous Percoll (Pharmacia) gradient based on the method of Fernando et al (1984). The gradient was prepared by the addition of 2 ml each of an isotonic stock Percoll solution (9 parts Percoll to 1 part 10×PBS), followed by 70% stock (7 parts isotonic stock to 3 parts 1×PBS), then 50% stock (5 parts isotonic stock to 5 parts 1×PBS) and finally the merozoite suspension. The gradient was centrifuged at 10000×g for 10 min and merozoites pipetted from the 70%-50% boundary. The collected merozoites were washed with 1×PBS and pelleted by centrifugation at 1000×g for 10 min. Pellets were stored at −80° C.

SDS-Page

Proteins were separated on precast Tris-glycine polyacrylamide gels (Bio-Rad or Gradipore) using a Bio-Rad electrophoresis unit, according to the method of Laemmli (1970). All protein samples were diluted with 4× Sample buffer (1×=62 mM Tris-HCl pH 6.8, 10% glycerol, 2% SDS, 0.01% bromophenol blue) and for those samples analyzed under reducing conditions, (β-mercaptoethanol was added to a final concentration of 2.5% (unless otherwise indicated). The samples and molecular weight markers (Bio-Rad LMW) were heated at 100° C. for 4 min, immediately placed on ice to cool and then centrifuged at 13,000×g for 1 min to remove insoluble material. Samples and markers were then loaded onto gels submerged in 1× running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS, pH 8.3) and electrophoresed at 125V for approximately 90 min.

Western Blotting

The transfer of protein from polyacrylamide gels to PVDF membrane was carried out using a Pharmacia NovaBlot electrophoretic transfer kit and Multiphor II electrophoresis unit. The system applied a semi-dry, discontinuous buffer technique using filter paper soaked in electrode buffer and stacked between graphite electrode plates.

In preparation for transfer both the anode and cathode plates were saturated with distilled water and excess water removed with paper towels. Each transfer unit was assembled by placing 6 filter papers soaked in Anode solution 1 (0.3M Tris pH 10.4, 20% v/v methanol) on the anode electrode, then 3 filter papers and the PVDF membrane soaked in Anode solution 2 (25 mM Tris pH 10.4, 20% v/v methanol). Following PAGE, the gel was placed onto the stack and overlaid with 9 filter papers soaked in Cathode solution (4 mM 6-Amino-n-hexanoic acid pH 7.6, 20% v/v methanol). All filter papers and PVDF membrane were pre-cut to gel size. The transfer unit was completed with the addition of the cathode plate and then placed into the Multiphor base. Transfer was performed at 0.8 mA/cm2 gel surface area. Coloured molecular weight markers included on the gel served as a control to confirm successful transfer.

Immunodetection of Western Blots

Following the electrophoretic transfer of protein, PVDF membrane was blocked in PBS/5% SMP solution for 1 hr at RT with shaking. After blocking, the membrane was immersed in primary antibody diluted to an appropriate concentration in PBS/5% SMP and incubated for 2 hrs at RT with shaking. The membrane was then washed 3 times for 10 minutes each wash in PBS/0.03% TWEEN 20. The secondary antibody—alkaline phosphatase conjugated rabbit anti-chicken IgG—was then added at a concentration of 1/1000 in PBS/5% SMP and incubated for 1 hr at RT with shaking. Following secondary antibody incubation, the membrane was washed as previously and detected using BCIP/NET (SIGMA FAST BCIP/NBT tablets).

Preparation of Crude Antigens

Sporulated Oocysts

Potassium dichromate was removed from oocysts by repeated centrifugation at 1500×g for 5 min and water washes. The clean pellets were resuspended in an equal volume of 40 mM Tris.HCl pH 8.0 and protease inhibitors added (Sigma) according to the manufacturer's instructions. The suspension was overlayed with a saturating quantity of glass beads (Sigma) and ruptured by votexing for 5 min. Rupture of the oocysts was confirmed by microscopic examination. The homogenate was then subjected to three cycles of freeze thawing using liquid nitrogen and a 40° C. water bath, followed by centrifugation at 13000×g for 10 min at 4° C. The supernatant was removed, transferred to a microconcentrator (Centricon 100, Amicon) and concentrated by centrifugation at 900×g for 30 min at 4° C. The extract was stored at −80° C.

Merozoites and Gametocytes

Pellets of purified merozoites or gametocytes were resuspended in 40 mM Tris.HCl pH 8.0 containing 10 mM PMSF, and subjected to three cycles of freeze thawing as described above. The suspension was sonicated on ice using a Cole-Parmer Ultrasonic Homogeniser set at 25 W and 70% output for 20 sec, and the resulting homogenate centrifuged at 13000×g for 10 min at 4° C. The supernatant was retained and stored at −80° C.

Protein Concentration Determination

The protein concentrations of all crude antigen extracts and other protein samples used throughout this study were determined using the Bio-Rad Protein Assay kit, based on the Bradford dye-binding, method.

Protein Visualization

Proteins separated by electrophoresis on SDS-polyacrylamide gels were detected by Coomassie Blue or Silver staining. For Coomassie Blue staining, gels were immersed in a solution of 0.2% Coomassie Brilliant Blue R250 (Sigma), 50% methanol and 10% glacial acetic acid for 30 min with shaking. The gels were then destained in 12% Ethanol/7% glacial acetic acid with shaking until the protein bands became visible and the background was almost clear. Silver staining was performed using the Amersham Pharmacia Silver staining kit according to the manufacturer's instructions.

Proteins transferred to PVDF membrane for the purpose of N-termmal sequencing were detected by Coomassie Blue staining. Membranes were stained for 2 min as above and destained until protein bands were visible.

Protein Purification Procedures

Ion Exchange Chromatography

Proteins from crude extracts of sporulated oocysts were separated by DEAE-ion exchange chromatography. Approximately 5 ml of DEAE sephacel (Amersham Pharmacia Biotech) anion exchange resin was added to a lcm (internal diameter) by 20 cm (length), low pressure chromatography column (Econo-column, Bio-Rad), and equilibrated for 2 hrs in 40mM Tris.HCl pH 8.0 at a flow rate of 0.7 ml/min. Crude antigen prepared as described above was clarified by centrifugation at 13000×g for 10 min at 4° C., and applied to the column. Protein elution was subsequently performed with a step gradient of 0-1M NaCl in 40 mM Tris.HCl pH 8.0 at a flow rate of 0.7 ml/min. The eluate was monitored by a Gilson 112 UV/Vis in-line detector set at 280 nm and connected to an Activon Omniscribe series D5000 chart recorder. Fractions were collected manually, corresponding to increasing NaCl concentration. Following elution, all fractions were transferred to Centricon 100 microconcentrators (Amicon) and centrifuged at 900×g for 1 hr at 4° C., yielding retentate volumes of approximately 60 μL. To desalt the fractions, retentates were diluted to a volume of 2 ml with 40 mM Tris.HCl and centrifuged as above. Following concentration/buffer exchange the filtrate was discarded and the retentate stored at −20° C.

Size-Exclusion Chromatography

Following ion exchange chromatography, selected fractions containing the immunodominant protein were further separated by size-exclusion chromatography using a SMART HPLC system fitted with a Superdex 200 PC gel filtration column (Pharmacia Biotech). The column was equilibrated in 40 mM Tris.HCl pH 8.0 for 2 hrs at a flow rate of 50 μL/min. Protein fractions were injected onto the column and eluted at a flow rate as above. The eluate was monitored using the SMART system software at dual wavelengths of 280 nm and 214 nm, and 100 μL fractions were collected automatically over the course of the elution period.

N-Terminal Sequencing

Crude extracts of sporulated oocysts were purified by ion exchange chromatography as described, and fractions enriched for the immunodominant protein were pooled and concentrated by centrifugal ultrafiltration to a volume of 60 μL. Sample aliquots of 19 μL were applied to 3 adjacent wells of a 5% SDS-polyacrylamide gel, and a 3 μL aliquot applied to a 4th well. Following electrophoresis under reducing conditions, the separated proteins were transferred to PVDF by Western blotting. A strip of PVDF containing the protein from the 3 μL sample aliquot was then cut from the membrane and immunodetected with anti-crude merozoite serum to serve as a control for the visualisation of the immunodominant protein. The remaining membrane piece was stained with Coomassie Blue as described, and membrane bands containing the immunodominant protein were excised with a scalpel blade. Membrane pieces were stored at −20° C. prior to sequencing. Automated Edman degradation of protein, samples was subsequently carried out using an Applied Biosystems 494 Procise Protein Sequencing System at the Australian Proteome Analysis Facility (Sydney) and at Biotech Australia Pty. Ltd. (Sydney).

Tryptic Peptide Sequencing

Concentrated ion exchange chromatography fractions containing the immunodominant protein were separated under reducing conditions on a 5% SDS-polyacrylamide gel as above. Following electrophoresis the gel was stained with Coomassie Blue and the region of the gel containing the immunodominant protein excised with a scalpel blade. Gel pieces were immediately transported to the Australian Proteome Analysis Facility and the sample subjected to a 16 hr tryptic digest at 37° C., followed by concentration and desalting of the resulting peptides using a ZipTip. The sample peptides were then separated and selected peptides analysed by ESI-TOF MS/MS using a Micromass Q-TOF mass spectrometer.

Triton X-114 Fractionation

Purified merozoites were fractionated in the nonionic detergent Triton X-114 based on the method of Bordier (1981). Approximately 107 purified merozoites were resuspended in 250 μL of a solution of 0.5% TX-114 in PBS containing 10 mM PMSF and 0.002% bromophenol blue. Following incubation on ice for 30 min, the suspension was centrifuged at 13000×g for 10 min, separating into a detergent insoluble pellet and a TX-114 supernatant. The supernatant fraction was transferred onto a sucrose cushion containing 6% sucrose and 0.06% TX-114 in PBS, and incubated at 37° C. for 3 min. The sample was then centrifuged at 13000×g for 3 min at RT, forcing separation into an upper aqueous phase and a lower, detergent rich phase. The aqueous phase was removed and the detergent phase diluted in ice cold PBS to the original lysate volume of 250 μL. The aqueous and detergent phases and the detergent insoluble pellet were kept on ice until separated by SDS-PAGE.

RNA Extraction

Total RNA was isolated from sporulated oocysts using TRIzol® Reagent (Life Technologies) following a procedure adapted from that described by Johnston et al (1998). Approximately 2.5×107 clean sporulated oocysts were pelleted in a 10 mL polypropylene tube by centrifugation at 1500×g for 5 min. An equal volume of glass beads (Sigma) and 1 mL of icecold PBS pH 7.4 were added to the pellet, and the mixture vortexed for 4×1 periods at 4° C., alternating with 1 min incubations on ice. The resulting homogenate was transferred to a sterile 10 mL tube and an equal volume (3.75 mL) of TRIzol reagent added. The solution was mixed by inversion and incubated at RT for 5 min to allow for the complete dissociation of nucleotide complexes. In order to remove insoluble material (i.e. sporocyst and oocyst shells) the suspension was then centrifuged at 11,000×g for 10 min at 4° C. The supernatant was removed, transferred to a sterile 10 mL tube and 0.75 mL of chloroform added (2 mL of chloroform per 1 mL of TRIzol® Reagent). Following vigorous shaking for 15 sec, the mixture was incubated at RT for 3 min and then centrifuged at 10,000×g for 15 min at 4° C. to force separation into a lower phenol-chloroform phase and an upper aqueous phase containing the purified RNA. The aqueous phase was transferred to a sterile 10 mL tube, 1.875 mL of isopropanol (0.5 mL per 1 mL of TRIzol® Reagent) added to precipitate the RNA, and the solution mixed by inversion. Following incubation for 10 min at RT, the RNA was pelleted by centrifugation at 11,000×g for 10 min at 4° C. The supernatant was removed and the pellet washed in 4 mL of 75% EtOH by briefly vortexing. The pellet was recovered by further centrifugation at 7,000×g for 5 min at 4° C., and, following removal of the 75% EtOH, was briefly dried in a vacuum hood for 10 min. The partially dried pellet was then resuspended in 200 μL of DEPC treated ddH2O, and stored at −80° C.

Poly(A)+ RNA was purified from total RNA of sporulated oocysts, or directly from merozoites and gametocytes using a Dynabeads® mRNA DIRECT kit (DYNAL Pty. Ltd.) with minor changes to the manufacturer's instructions. Briefly, total RNA from sporulated oocysts, or pellets of merozoites or gametocytes were mixed with Lysis/binding buffer (Dynal) and combined with Dynabeads® Oligo (dT)25 magnetic polystyrene beads in a 1.5 mL sterile polypropylene tube. The suspension was mixed by gentle inversion for 4 min and the tube then placed in the Dynal magnetic particle concentrator (MPC) for 2 min. The supernatant was removed and the beads washed in Wash buffer A (Dynal) by repeated pipetting, before concentration in the MPC for 1 min. The wash procedure was repeated a second time with Wash buffer A and twice with Wash buffer B (Dynal). Following the final wash, mRNA was eluted from the beads by the addition of 10 mM Tris-HCl pH 8.0 and heating at 65° C. for 2 min. The tube was then transferred to the MPC for 1 min and the supernatant containing mRNA tranferred to a sterile 1.5 mL tube before storage at −80° C.

Nucleic Acid Concentration and Purity Determination

The concentrations of purified DNA or RNA samples used throughout this study were determined using a Pharmacia GeneQuant spectrophotometer to measure absorbance at 260 nm. The purity of samples was assessed by measurement of A260/280 ratios, accepting samples with ratios between 1.6-2.0.

EtOH Precipitation of Nucleic Acids

Dilute solutions of DNA or RNA were routinely concentrated by EtOH precipitation. To each sample, 0.1 volume of 3M sodium acetate pH 5.2 and 2.5 volumes of EtOH were added and the solution mixed by inversion. Following incubation on ice for 30 min, the sample was centrifuged at 13,000×g for 45 min at 4° C. and the supernatant subsequently removed and discarded. The pellet was washed with 70% EtOH and recovered by further centrifugation at 13,000×g for 5 min. at 4° C. Pellets were dried in a vacuum hood and resuspended in a suitable volume of either ddH2O for DNA samples (non-genomic), or DEPC treated ddH2O for RNA samples.

cDNA Library Construction

Messenger RNA of sporulated oocysts of E. maxima was isolated from total RNA as described. An estimated 1 μg of mRNA was used with a Marathon™ cDNA Amplification Kit (CLONTECH), to prepare a library of adaptor-ligated, RACE PCR ready double-stranded cDNA. No changes in procedure were made to the manufacturer's instructions. The library was stored at −20° C.

PCR

PCR reactions were carried out using a PTC-200 Peltier Thermal Cycler DNA Engine (MJ Research). All reactions were of 50 μL volume using 1 μL of 50× Advantage 2 Polymerase Mix (CLONTECH)—a high fidelity polymerase mixture recommended for use with the Marathon™ cDNA Amplification Kit (CLONTECH). Oligonucleotide primers were synthesised by Sigma Genosys Australia Pty. Ltd., and 10 μM working stocks were prepared and used at a concentration of 0.2 μM for gene-specefic primers, or 0.4 μM for degenerate primers. For reactions employing cDNA as template, 5 μL of cDNA equivalent to approximately 0.5 ng was used per reaction, and with genomic DNA template, 5 μL of a 10 ng/μL working stock. Second round or nested PCR experiments employed 1 μL of a first round PCR reaction or gel-purified PCR product as template, while reactions involving amplification from plasmid DNA used 1 μL of a standard Miniprep (SIGMA) preparation equivalent to approximately 5-10 ng. For the amplification of products with an expected size less than 5 kb, 5 μL of 2 mM dNTP solution (Biotech International Ltd.) was added per reaction, and increased to 10 μL for the amplification of products larger than 5 kb. All reactions contained 5 μL of 10× Advantage 2 PCR Buffer (CLONTECH) and sterile ddH2O to 50 μL. Cycling parameters using both touchdown and conventional PCR were modified for optimal amplification from programmes recommended in the Marathon™ cDNA Amplification Kit User Manual (CLONTECH).

PCR Purification

Prior to direct sequencing or ligation into sequencing or expression vectors, PCR products were cleaned using a QIAquick PCR Purification Kit (QIAGEN, U.S.A.) according to the manufacturer's instructions. Clean DNA was routinely recovered in 30 μL of sterile ddH2O and stored at −20° C.

Gel Extraction

PCR products were regularly gel-purified to provide template for second round or nested PCR reactions, or in some instances prior to direct sequencing. Products were separated by agarose gel electrophoresis and appropriate DNA fragments were excised with a clean scalpel blade. DNA was purified from gel slices using a QIAquick® Gel Extraction Kit (QIAGEN) according to the manufacturer's instructions, and routinely recovered in 30 μL of sterile ddH2O. The purified DNA was stored at −20° C.

Ligation

For purposes of sequencing, PCR products were cloned into the PGEM®-T Easy vector (Promega). Amplified DNA was purified as described and 8.5 μL added to a ligation mix containing 0.5 μL of pGEM®-T Easy vector, 10 μL of 2× Ligation buffer, and 1 μL of T4 Ligase. The solution was mixed by pipetting and incubated O/N at 4° C. prior to transformation into competent cells.

The vector pTrcHis B (Invitrogen®) was used for expression studies and the development of expression constructs is described in detail below. Purified insert DNA (7 μL) encoding the polypeptide to be expressed was added to a ligation mix containing 2 μL of digested pTrcHis B vector, 10 μL of 2× Ligation buffer and 1 μL of T4 Ligase (Promega). Vector only control ligations were also prepared as above, but with ddH2O replacing insert DNA. The ligation reactions were mixed by pipetting and incubated at 4° C. O/N.

Competent Cell Preparation

From frozen glycerol stocks of either DH5-α or TOP10 E. coli strains, a small portion was streaked on a LB media plate and incubated O/N at 4° C. The next day, a single colony was selected, transferred to 100 mL of SOB media and incubated at 37° C. in a rotary shaker set to 200 rpm. After the culture reached an OD600 of approximately 0.5, the cells were collected by centrifugation at 2,500×g for 10 min at 4° C. and resuspended in 10 mL of ice-cold 50 mM CaCl2. The cells were kept on ice for 30 min, centrifuged at 2,500×g for 5 min at 4° C., and gently resupended in 4 mL of ice-cold 50 mM CaCl2. Following incubation on ice for 1 hr, the competent cells were divided into 90 μL aliquots and stored at −80° C.

Transformation

Aliquots of competent cells (90 μL) were routinely transformed with either 10 μL of a 20 μL ligation reaction, or 1 μL (approximately 5-10 ng) of plasmid from a standard Miniprep (Sigma) plasmid preparation. Following gentle mixing, the solution was incubated on ice for 20 min, heat shocked in a water bath at 42° C. for 90 sec and returned to ice for 1 min. SOC media (900 μL) was then added and the solution mixed by inversion before incubation at 37° C. for 1 hr in a rotary shaker set at 200 rpm. Appropriate amounts of the mixture were then plated onto LB plates containing 100 μg/mL ampicillin, and incubated O/N at 37° C. For the transformation of recombinant plasmids derived from the pGEM®-T Easy vector, plates were pre-spread with 20 μL of 50 mg/ml Xgal and 100 μL of 100 mM IPTG to allow for the direct identification of recombinant clones by colour screening. Following O/N incubation, a minimum of three bacterial colonies putatively containing recombinant plasmids were selected, cultured O/N and used for plasmid preparation as described below. The presence and size of DNA inserts was determined by PCR amplification using 1 μL of the plasmid as template with vector or insert specific primers, and subsequent analysis of the products by agarose gel electrophoresis.

Plasmid Preparation

A single bacterial colony was used to inoculate 4 mL of LB media with 100 μg/mL ampicillin, and the culture incubated with shaking (200 rpm) in a rotary shaker at 37° C. O/N. The next day plasmid was harvested from 1.5 mL of the O/N culture using a GenElute™ Plasmid Miniprep Kit (Sigma) according to the manufacturers instructions. Purified plasmid was recovered in 100 μL of sterile ddH2O and stored at −20° C.

DNA Sequencing

DNA sequencing was carried out at the Sydney University Prince Alfred Macromolecular Analysis Centre (SUPAMAC, Sydney) using dideoxy dye-terminator chemistry and ABI automated sequencers. Approximately 10 ng per 300 bp of purified PCR product, or 3 μg of plasmid were provided per reaction in a cocktail with 20 μmol of the appropriate primer and ddH2O to a final volume of 16 μL.

DNA for sequencing was regularly generated by PCR using plasmid template with vector or gene-specific primers. For the amplification of PCR products cloned into the pGEM®-T Easy vector, M13 forward and reverse primers were used with the following programme: 1 min at 94° C.; 30 cycles of 30 s at 94° C., 1 min at 55° C. and 3 min at 72° C. Gene-specific primers were designed with high Tms (>72° C.) and were used in amplification with a more stringent programe, similar to the above but employing an annealing temperature of 68° C.

PCR Generation of cDNA Encoding the Immunodominant Protein

3′ RACE PCR was carried out using adaptor-ligated double-stranded cDNA with the Marathon™ cDNA Amplification Kit (CLONTECH) Adaptor Primer 1 (AP1), and degenerate primers designed from the protein sequences for the N-terminus and tryptic peptides of the immunodominant protein. RACE products were generated with the following touchdown program: 1 min at 94° C.; 5 cycles of 30 s at 94° C. and 3 min at 65° C.; 5 cycles of 30 s at 94° C., 30 s at 60° C. and 3 min at 72° C.; 35 cycles of 30 s at 94° C., 1 min at 55° C. and 3 min at 72° C. Aliquots (10 μL) of the reactions were separated by agarose gel electrophoresis and appropriate bands were excised, purified and cloned into pGEM®-T Easy as described.

From the sequences of 3′ RACE products, gene-specific primers were designed and used with degenerate primers based on the N-terminus protein sequence, to amplify an intermediate DNA fragment (between 5′ and 3′ ends) from cDNA template. PCR products were generated with the following touchdown programme: 1 min at 94° C.; 5 cycles of 30 s at 94° C., 30 s at 65° C. and 7 min at 72° C.; 5 cycles of 30 s at 94° C., 30 s at 60° C. and 7 min at 72° C.; 35 cycles of 30 s at 94° C., 1 min at 55° C. and 7 min at 72° C. Aliquots (10 μL) of the reactions were separated by agarose gel electrophoresis and appropriate bands were excised and gel-purified. The purified first round DNA was then used as template with nested primers for amplification with the following programme: 1 min at 94° C.; 30 cycles of 30 s at 94° C., 1 min at 55° C. and 8 min at 72° C. Following agarose gel electrophoresis, appropriate PCR products were gel-purified, cloned into pGEM®-T Easy and subsequently sequenced.

5′ RACE was carried out using cDNA as template with AP1 and gene-specific primers designed from the 5′ region of sequences of putative intermediate DNA fragments. PCR products were generated with the following touchdown programme: 1 min at 94° C.; 5 cycles of 30 s at 94° C. and 4 min at 72° C.; 5 cycles of 30 s at 94° C. and 4 min at 70° C.; 30 cycles of 20 s at 94° C. and 4 min at 68° C. In order to characterise products, 1 μL samples from the 5′ RACE reactions were used as template with Nested Adaptor Primer 2 (AP2, CLONTECH) and nested gene-specific primers for amplification with the following programme: 1 min at 94° C.; 30 cycles of 30 s at 94° C., 1 min at 65° C. and 4 min at 72° C. Appropriate PCR products were gel-purified, cloned as described and sequenced.

From the sequence obtained from the 5′ and 3′ RACE products, gene-specific primers were designed and used with cDNA template to generate a full-length cDNA with the following programme: 1 min at 94° C.; 30 cycles of 20 s at 94° C. and 10 min at 72° C. The DNA product was gel-purified and cloned as above.

Sequencing of Clones Encoding the Immunodominant Protein

Clones containing the cDNA encoding the full mature immunodominant protein were sequenced using a primer-walking strategy, moving downstream from the 5′ end and upstream from the 3′ end of the cDNA. A minimum of three clones was used to generate a consensus sequence in both forward and reverse directions. The sequence of the extreme 5′ and 3′ ends of the cDNA was obtained by sequencing the 5′ and 3′ RACE products.

RT-PCR

Messenger RNAs from purified merozoites and gametocytes were isolated from cell pellets containing approximately 106 parasites and were recovered in 10 μL of 10 mM Tris-HCl pH 8.0. Reverse transcriptions were performed using an Omniscript™ RT Kit (QIAGEN) with 1 μL of each mRNA preparation and primers specific for EmTFP250 and constitutively expressed E. maxima HSP70. Sham RT reactions serving as a negative control were also carried out in the absence of reverse transcriptase. All RT reactions were amplified at 37° C. for 1 hr and subsequently used as templates for standard PCR. Gene-specific primers for EmTFP250 were used with 1 μl from each RT reaction and negative controls in amplification with the following programme: 1 min at 94° C.; 30 cycles of 30 s at 94° C. and 4 min at 72° C. In addition the EmTFP250 primers were also used in PCR with 1 μL of a plasmid preparation containing the sporulated oocyst cDNA encoding EmTFP250, and with a no template control using the programme described above. Primers specific for HSP70 were designed with lower Tms and were used with 1 μL from each RT reaction and the following programme: 1 min at 94° C.; 30 cycles of 30 s at 94° C., 1 min at 55° C. and 3 min at 72° C.

Genomic DNA Purification

Cell pellets containing approximately 5×105 purified gametocytes were gently resuspended in 2 mL of PBS and 40 μL of 10% N-lauryl sarcosine, and incubated at 37° C. for 20 min. DNAse free RNAse (20 μL) was added and the solution incubated for a further 20 min at 37° C., followed by the addition of 20 μL of 20 mg/mL proteinase K and incubation at 37° C. for 30 min. An equal volume of phenol/chloroform/isoamyl-alcohol (25:24:1) was then added and the solution mixed by inversion before centrifugation at 5,000×g for 5 min to force separation into organic and aqueous soluble phases. The aqueous phase containing genomic DNA was removed and the extraction procedure repeated once with phenol/chloroform/isoamyl alcohol as above and once with chloroform/isoamyl-alcohol (24:1). Following the final extraction, the aqueous phase was removed and the DNA EtOH precipitated as described. Pellets of genomic DNA were dried in a vacuum hood for approximately 1 hr and allowed to resuspend in 75 μL T.E. buffer O/N at 4° C. Samples were stored at 4° C.

Restriction Digestion

For the purpose of Southern blotting, genomic DNA from E. maxima was digested with a number of restriction enzymes prior to separation by agarose gel electrophoresis. Approximately 2.5 μg of genomic DNA was added to each digestion mix containing 40 U of restriction enzyme (2-4 μL), 10 μL of the appropriate 10× enzyme buffer, and ddH2O to a final volume of 100 μL. The mixtures were incubated at 37° C. for 2 hr, then EtOH precipitated O/N as described. The following day the dried pellets were resuspended in 20 μL of TE buffer, heated for 5 min at 65° C. and briefly vortexed. A further 10 U of the appropriate restriction enzyme (0.5-1 μL), 5 μL of 10× enzyme buffer and TE buffer to 25 μL were added, and the mixtures incubated for 1 hr at 37° C. To assess the degree of digestion, 2 μL of each sample was separated on a 0.8% agarose gel. Samples that produced a visibly uniform smear from approximately 23 kb to 1 kb were accepted for further analysis.

In the development of expression constructs, PCR amplified insert DNA and vector DNA were double digested with Bam HI and Eco RI restriction enzymes. The mixtures were incubated at 37° C. for 1 hr prior to analysis by agarose gel electrophoresis and subsequent gel purification.

Southern Blotting

Restriction enzyme-digested genomic DNA or PCR products were separated by agarose gel electrophoresis as described. Following staining with EtBr and subsequent photography, gels were submerged in a solution of 0.5M NaCl and 0.5M NaOH for 20 min to denature the DNA, then rinsed in ddH2O before neutralisation for 20 min in a solution of 2.5M NaCl and 0.5M Tris-Cl pH 7.4. After rinsing the gels in ddH2O, the DNA was tranferred by capilliary action to Hybond-N+ nucleic acid transfer membrane (Amersham) using standard procedures (Sambrook). Following O/N transfer, each membrane was allowed to air dry for 10 min and then baked in a vacuum oven at 80° C. for 1 hr. Membranes were stored in heat-sealed plastic bags prior to hybridisation with radio-labelled DNA probes.

DNA Probe Preparation

A 1590 bp DNA fragment from the 5′ region of the cDNA encoding EmTFP250 was used to generate a probe for the detection of restriction enzyme-digested E. maxima genomic DNA. Probe DNA was amplified with EmTFP250 gene-specific primers and EmTFP250 plasmid using the following programme: 1 min at 94° C.; 30 cycles of 30 s at 94° C., 1 min at 68° C. and 3 min at 72° C. Degenerate PCR primers designed on EmTFP250/EtMIC4 DNA sequence homology were used to generate a 622 bp probe for the detection of PCR products amplified from genomic DNA from Australian Eimeria strains. The probe DNA was amplified from E. maxima genomic DNA using the following touchdown programme: 1 min at 94° C.; 5 cycles of 30 s at 94° C., 30 s at 70° C. and 3 min at 72° C.; 5 cycles of 30 s at 94° C., 30 s at 65° C. and 3 min at 72° C.; 30 cycles of 30 s at 94° C., 1 min at 60° C. and 3 min at 72° C.

The PCR amplified probe DNA was purified as described and approximately 25 ng was labelled with 32P-dCTP using a Random Primed DNA Labelling Kit (Roche) according to the manufacturer's instructions. The specific activity of probes was determined by TCA precipitation following the method of Sambrook, and probes with an incorporation greater than 75% were accepted for use.

Hybridisation

Each nylon membrane was placed in an appropriate size hybridisation tube (Hybaid) and hybridisation solution pre-heated to 65° C. was added. Following prehybridisation for 2 hr at 65° C. the solution was replaced with fresh hybridisation solution pre-heated to 65° C. The radiolabelled DNA probe was denatured by heating at 100° C. for 10 min then added to the hybridisation tube and allowed to hybridise for between 16-20 hr at 65° C. After hybridisation the membrane was removed and subjected to 2×30 min washes in 2×SSC and 0.1% SDS at 65° C., followed by 2×30 min washes in 0.1% SSC and 0.1% SDS at 65° C. The membrane was then blotted with 3 mM paper to remove excess moisture, covered in plastic wrap and placed in a film cassette containing intensifying screens on both sides. Following exposure to x-ray film for a suitable period the film was developed using standard procedures.

Examination of Genomic Organisation by PCR

A series of primer pairs specific for the cDNA encoding EmTFP250 were used to amplify the corresponding fragments from plasmid containing EmTFP250 cDNA and from E. maxima genomic DNA. The following high stringency programme was employed: 1 min at 94° C.; 30 cycles of 20 s at 94° C. and 4 min at 72° C. PCR products were analysed by agarose gel electrophoresis and appropriate bands were sequenced in order to confirm the presence of introns.

Detection of EmTFP250 Homologues in Australian Strains of Eimeria by PCR and Southern Hybridisation

A pair of degenerate PCR primers designed on sequence homology between EmTFP250 and EtMIC4 were used in amplification with genomic DNA isolated from Australian strains of the seven species of Eimeria parasitic in chickens. Approximately 50 ng of DNA from each strain was used with the following touchdown PCR programme: 1 min at 94° C.; 5 cycles of 30 s at 94° C., 30 s at 70° C. and 3 min at 72° C.; 5 cycles of 30 s at 94° C., 30 s at 65° C. and 3 min at 72° C.; 30 cycles of 30 s at 94° C., 1 min at 60° C. and 3 min at 72° C. A 10 μL sample from each reaction was separated on a 0.8% agarose gel, subsequently stained and photographed and then transferred to nylon membrane by Southern blotting. A DNA probe was generated from E. maxima Houghton strain genomic DNA as described using the degenerate primer pair as above, and hybridised to the transferred DNA. Following hybridisation and washing procedures, the membrane was exposed to x-ray film for periods of 10 and 30 min.

Protective maternal antibodies induced by the deliberate infection of hens with Eimeria maxima were shown by Western blot analyses to consistently recognise a high molecular weight, asexual stage protein in crude extracts of E. maxima. Furthermore, immunization with an emulsified SDS-PAGE cutout of the immunodominant protein was found to induce significant protection in chicks subsequently challenged with E. maxima. (Smith et al, 1994).

In light of the preliminary investigations suggesting a protective potential for the imuunodominant protein, the aims of the work presented below were two-fold: (1) to partially purify the immunodominant protein in order to obtain N-terminal and peptide sequence data for downstream application in cDNA cloning and; (2) to use antisera recognising the protein to provide fundamental information on its biochemistry, as well as an insight into its stage development and conservation across various strains and species of Eimeria.

Results

Immunodetection of Crude Antigens

Approximately 5 μg samples of crude sporulated oocyst extract were loaded onto separate wells of a 5% resolving polyacrylamide gel (Bio-Rad), electrophoresed and transferred to PVDF. Following transfer the PVDF was cut into strips and individual strips detected with a range of chicken sera and yolk collected during previous maternal immunisation trials (Smith et al, 1995). Sera were used at a dilution of 1/100 and yolk at 1/500.

The selected immune sera used to analyze the strips shown in FIG. 9, were harvested from 3-day-old hatchlings of hens infected with E. maxima (lane 1), like 12-day-old hatchlings challenged with E. maxima (lane 2), and hens immunized with crude merozoite extract of E. maxima (lane 3). All predominantly detected a protein band with an apparent molecular weight greater then 230 kDa. Analysis with a yolk sample derived from the 230 kDa band merozoite cutout experiment also reacted with a band of the same size although not as strongly (lane 4). Control chicken serum from uninfected birds did not react with the extract (lane 5).

Purification of the Immunodominant Protein

Ion Exchange Chromatography

Approximately 1.5 mg of crude sporulated oocysts antigen was applied to a DEAE sephacel ion exchange column as described. Fractions were collected manually corresponding to A280 nm absorbtion peaks representing elution with increasing NaCl concentration (FIG. 10).

All fractions were concentrated by centrifugal ultrafiltration yielding a retentate volume for each of approximately 60 μL. From each fraction, 15 μL of retentate was loaded onto parallel 7.5% SDS-PAGE gels (Bio-Rad) and electrophoresed under reducing conditions. Following electrophoresis, one of the gels was subjected to silver staining (FIG. 11.A) while the second gel was Western blotted and the transferred protein detected with serum from hens infected with crude merozoite extract (FIG. 11.B). The serum sample was used at a dilution of 1/100 in PBS.

As can be seen both by silver staining and immunoblotting, the immunodominant protein migrating with an apparent molecular weight greater than 230 kDa, appeared predominantly in those fractions eluted with 0.3-0.5M NaCl. The majority of contaminating, smaller molecular weight proteins were eluted in the preceding fractions as visualised by silver staining, or presumably removed during the course of ultrafitration.

In order to further resolve the partially purified fractions containing the immunodominant protein, 15 μL each of those fractions eluted with 0.3-0.4M NaCl was loaded onto parallel 5% SDS-PAGE gels (Bio-Rad). Following electrophoresis one of the gels was silver stained (FIG. 12 A) and the other Western blotted (FIG. 12 B). The transferred protein was immonodetected with serum harvested from 12-day-old hatchlings of hens infected with E. maxima, following challenge of the hatchlings with E. maxima. Serum was used at a dilution of 1/100.

In those fractions enriched for the immunodominant protein and separated by 5% SDS-PAGE, the protein appears as an individual band migrating above 250 kDa and resolved from contaminating, co-migrating proteins (FIG. 12 A). Serum associated with maternal immunity reacted strongly with the high molecular weight protein band (FIG. 12 B).

Size-Exclusion Chromatography

Approximately 10 mg of crude sporulated oocyst extract was separated by IEX chromatography and the collected fractions concentrated as above. Fractions eluted with 0.3-0.4M NaCl were pooled and the sample volume reduced to 15 μL by vacuum centrifugation for 2 hrs. The concentrated sample was injected onto a Superdex 200 PC gel filtration column and protein fractions eluted and collected as described. FIG. 13 shows the A280 nm elution profile obtained. From each of fractions 7-15, 5 μL was loaded onto separate wells of a 7.5% SDS-PAGE gel (Bio-Rad) and electrophoresed under reducing conditions. Fractions eluted after fraction 15 were not expected to contain the high molecular weight immunodominant protein and were not analysed. Following electrophoresis the gel was subjected to silver staining (FIG. 14).

From FIG. 14 it can be seen that the immunodominant protein migrating at above 250 kDa eluted through fractions 7-15. While all fractions appear visibly cleaner than the IEX purified precursor fractions, some lower molecular weight contaminating proteins remained.

Protein Sequencing

N-Terminal Sequencing

Approximately 10 mg of crude sporulated oocyst extract from the Houghton strain of E. maxima was purified by ion exchange chromatography, and concentrated fractions enriched for the immunodominant protein were further separated by SDS-PAGE as described. Following transfer of the protein to PVDF and detection by Coomassie Blue staining, membrane pieces containing the immunodominant protein were excised, and the protein sample subsequently sequenced by Edman degradation at the Australian Proteome Analysis Facility. In addition, a protein sample prepared as above and derived from approximately 1.0 mg of crude sporulated extract from an Australian strain of E. maxima, was sequenced at Biotech Australia Pty. Ltd.

The results of N-terminal sequencing shown in table 1 indicate that the methods of IEX chromatography, centrifugal ultrafiltration and gel electrophoresis sufficiently purified the immunodominant protein for the purpose of amino terminal analysis. From the Houghton strain sample approximately 13 pmole of protein was available for sequencing, while approximately 1 pmole of the Australian strain sample was present. The sequence for the Houghton strain sample was called to 16 cycles, with a blank at cycle 9 probably indicating a Cysteine residue or a modified amino acid (eg glycosylated) at that cycle. The sequence for the Australian strain was called to 8 cycles, matching identically the first 8 residues predicted for the Houghton strain sequence.

TABLE 1
N-terminal sequencing results for the immunodominant protein
isolated from Houghton and Australian strains of E. maxima.
Sequences are represented using single-letter amino acid symbols,
with the N-terminus on the left.
E. maxima strain N-terminal sequence SEQ. ID NO.
Houghton E V N N E L S K - E S G W T P W 8
Australian E V N N E L S K 42

Tryptic Peptide Sequencing

Approximately 10 mg of crude sporulated oocyst extract was purified by IEX chromatography and fractions enriched for the immunodomiant protein were pooled, concentrated by centrifugal ultrafiltration and separated by SDS-PAGE as described. Gel pieces containing the immunodominant protein were then excised from the gel and delivered to the Australian Proteome Analysis Facility for tryptic digestion and subsequent sequence analysis of resulting peptides by mass spectrometry. The procedure was repeated for a second protein sample, similarly derived from approximately 10 mg of crude sporulated oocyst extract.

Predicted sequences were generated for 2 tryptic peptides and are shown in Table 2, however limited confidence was given to the sequences called. Probably due to the structure of the protein, many of the peptides generated were of similar mass making it difficult to separate them and ensure that only single peptides were subjected to MS/MS analysis (Hains, APAF, personal communication). Additionally the technique does not distinguish between Leucine and Isoleucine (shown as [L/I]) due to their identical molecular mass.

TABLE 2
Tryptic peptide sequencing results for the immunodominant
protein isolated from the Houghton strain of E. maxima.
Sequences are represented using single-letter amino acid
symbols, with the N-terminus of each peptide on the left.
Protein sample # Peptide sequence SEQ. ID NO.
1 Q W T A W T E 9
2 E [L/I] V N W F 10

Sequence Analysis

The sequences generated for the N-terminus and tryptic peptides of the immunodominant protein were submitted for BLASTP analysis against all non-redundant databases accessed through NCBI. No significant alignments were obtained for the sequences using the Basic BLAST parameters, however an Advanced BLAST search selecting a PAM-30 matrix and E value of 100 for tryptic peptide #1, produced an alignment with microneme protein 4 from Eimeria tenella (EtMIC4). Applying the same search against the patent database generated a single alignment with surface antigen 5401 from E. tenella—a protein almost identical to EtMIC4. Neither the N-terminal sequence nor tryptic peptide #2 sequence could be aligned to either EtMIC4 or surface antigen 5401 sequences.

Triton X-114 Fractionation

To determine whether the immunodominant asexual stage protein exists largely as a soluble protein within the parasite, or as an integral membrane protein, merozoites of E. maxima were fractionated in the detergent TX-114. Approximately 107 merozoites were solubilised and partitioned as described, and aqueous and detergent soluble fractions and a detergent insoluble fraction retained. All fractions were diluted to a volume of 250 μL (equal to the initial cell lysate volume) with ddH2O and 4×SDS-PAGE reducing sample buffer to a 1× concentration. From each sample, 20 μL was loaded onto separate wells of a 7.5% SDS-PAGE gel (Bio-Rad) and electrophoresed as described. The separated proteins were then transferred to PVDF by Western blotting and detected with anti-crude merozoite serum used at a dilution of 1/100.

From FIG. 15, it can be seen that the high molecular weight immunodominant protein partitioned predominantly into the aqueous soluble fraction (lane 1), however a protein band migrating at the same apparent molecular weight is faintly visible in the TX-114 detergent soluble phase (lane 2). Additionally a protein band of the same size is visible in the detergent insoluble fraction (lane 3).

Detection of the Immunodominant Protein Across Developmental Stages

Protein extracts from asexual and sexual stages of development were prepared as described and compared by Western analysis. Approximately 10 μg samples from crude extracts of sporulated oocysts, merozoites and gametocytes were loaded onto adjacent wells of a 7.5% SDS-polyacrylamide gel, electrophoresed under reducing conditions and transferred to PVDF. Following transfer the membrane was immunodetected with serum from hens infected with crude merozoite extract.

As can be seen in FIG. 16, the immunodominant protein was detected in the sporulated oocyst and merozoite extracts (lanes 1 and 2), but was not visible in the crude gametocyte extract (lane 3). The results are consistent with earlier findings (Smith, 1994) and indicate that the immunodominant protein is confined to the asexual stages of development.

Detection of the Immunodominant Protein Across Strains and Species of Eimeria

In order to examine conservation of the immunodominant protein, crude sporulated oocyst extracts from the Houghton and Australian strains of E. maxima, and from an Australian strain of E. tenella were compared by immunoblot analysis using serum from hens infected with crude merozoite extract. Approximately 10 μg of each extract was separated on 7.5% SDS-polyacrylamide gels under reducing conditions, tranferred to PVDF and immunodetected as described.

From FIG. 17, the immunodominant protein migrating at approximately 250 kDa was observed in the Houghton strain (A, lane 1) and Australian strain (A, lane 2; B, lane 1) of extracts from E. maxima. Additionally the serum predominantly detected a high molecular weight protein band in the Australian E. tenella strain extract (B, lane 2), migrating slightly faster than the immunodominant protein band visible in the E. maxima extracts. The results suggest a degree of conservation for the immunodominant protein across strains and species of Eimeria and imply a functional significance.

SDS-PAGE Characterisation

Samples of protein enriched for the high molecular weight immunodominant protein were analysed by SDS-PAGE under reducing and non-reducing conditions. Approximately 1.2 mg of crude sporulated oocyst antigen was purified by ion-exchange chromatography as described and fractions containing the immunodominant protein (0.3 and 0.4M NaCl fractions) were pooled and concentrated to a volume of 60 μL. Aliquots (8 μL) from those fractions were loaded onto 7.5% (FIG. 18.A) and 5% (FIG. 18.B) PAGE gels (Bio-Rad) and electrophoresed with and without 2-β-mercaptoethanol present in the sample buffer. Following electrophoresis gels were western blotted and immunodetected with anti-crude merozoite serum used at a dilution of 1/100.

As can be seen in FIG. 18.A, when samples enriched for the immunodominant protein were analysed on a 7.5% gel in the presence of 2-β-mercaptoethanol within the concentration range 2.5-10% v/v (Lanes 2-6), a single predominant band was detected migrating at approximately 250 kDa. Under non-reducing conditions however, the serum detected a high molecular weight doublet band migrating slightly faster than the immunodominant band visible in the reduced samples. In addition, a second immunodominant band was detected migrating with an apparent molecular weight of approximately 75 kDa, which was not visible in the reduced samples.

When compared to separation on a 5% gel (FIG. 18. B), the immunodominant band was detected in the reduced sample (lane 2) migrating with an apparent molecular weight considerably higher than 250 kDa. Under non-reducing conditions the doublet band was more apparent and seen to migrate substantially faster than the immunodominant band in the reduced sample. The 75 kDa band detected in the non-reduced sample when separated on a 7.5% gel was not detected following separation on 5% polyacylamide, presumably because it had migrated off the bottom of the gel. It is likely that it is not visible in samples analysed under reducing conditions either because epitopes present in the native protein are lost after reduction, or the native form is an oligomer of smaller dusulphide-bonded polypeptides that migrate off the gel.

The results suggest that the high molecular weight immunodominant protein is monomeric and that intra-chain disulphide bonding stabilizes the native protein. The doublet band detected under non-reducing conditions might indicate the presence of isomeric forms of the protein.

Discussion

The purification of a high molecular weight, immunodominant protein for the purposes of protein sequencing has been described. Extracts of sporulated oocysts of E. maxima were fractionated by ion exchange chromatography, concentrated by centrifugal ultrafiltration and further separated by SDS-PAGE to provide protein of sufficient purity and quantity for N-terminal and tryptic peptide sequencing.

In order to examine the migration of the protein on polyacrylamide gels with higher resolving power, and to select suitable antibodies for detection, extracts of sporulated oocysts were initially separated on 5% polyacrylamide gels under reducing conditions, and immunoblotted with a range of sera and yolk harvested during previous maternal immunisation trials (Smith et al, 1994). The serum and yolk samples predominantly detected a single protein band with an apparent molecular weight significantly greater than 250 kDa, somewhat larger than the previous estimation of 230 kDa from SDS-PAGE using 11% gels (Smith et al, 1994). The estimates can only be considered approximate however, as proteins in some instances can migrate with disproportionate increases in apparent molecular weight, for example glycosylated and phosphorylated proteins (Smith, 1997; Dunn, 1993).

From the serum and yolk samples used in the initial immunodetection experiment, serum from hens infected with crude merozoite extract of E. maxima was selected for immunoblotting in many of the subsequent experiments. Although ideally, maternal protective antibodies derived from the deliberate infection of hens with viable oocysts would have been used throughout the study, such antibodies were available in extremely limited quantity and were conserved where possible. Repeating maternal immunisation trials to obtain antibodies was considered too time consuming, and the possibility that antisera raised in such an experiment would not detect the same immunodominant protein could not be excluded. The antisera derived from hens infected with crude merozoite extract were available in relatively large quantity and proved to be strongly reactive. While it can be argued that the different antibodies might have predominantly detected different proteins, results suggest that this is unlikely. Proteins of such high molecular weight are relatively rare in the proteome (Shirley et al, 1992) and silver staining of the protein detected by antisera from both sources did not suggest the presence of co-migrating proteins.

In selecting and developing a method for the purification of the immunodominant protein a number of issues were considered, the first being the protein source. Previous work had detected the protein in extracts of sporulated oocysts and merozoites, and the SDS-PAGE cutout protection experiment used protein extracts prepared from merozoites. Although in terms of association with the previous study it might have been preferable to source the protein from merozoites, the large numbers of merozoites required for method development and sequencing proved difficult to obtain. It was estimated that for a 250 kDa protein and requiring a suggested 10 pmol minimum for N-terminal sequencing (McInerny, Biotech Australia and APAF, personal communication), approximately 10 μg of purified protein would be needed. Conservatively, if the immunodominant protein represented 1/1000th of the E. maxima proteome, then 10 mg of crude extract would be required for N-terminal sequencing alone, not allowing for method development. In routine infections of chickens for harvesting merozoites, approximately 108 merozoites per bird were obtained from 20 birds, yielding a total protein extract less than 0.5 mg. In comparison, approximately 1×108 oocysts were obtained from infection of 20 birds giving approximately 10 mg of crude extract (results not shown). In addition merozoites are difficult to purify and preparations invariably contain some degree of host tissue and debris contamination, while the more robust oocysts are relatively easily cleaned and sterilized by sodium hypochlorite treatment. Furthermore, large supplementary numbers of sporulated oocysts were available through collaboration with the National Veterinary Institute, Uppsala, Sweden.

Although it cannot be excluded that the immunodominant band detected in sporulated oocyst and merozoite extracts does not represent the same protein, it appears unlikely. Anti-crude merozoite antibodies predominantly detected a protein of approximately 250 kDa in both sporulated oocyst and merozoite extracts and, as stated above, proteins of such high molecular weight are relatively rare within the proteome. In addition yolk sample from the SDS-PAGE cutout experiment and sera from hens infected with crude merozoite extract both detected a protein band of the same apparent molecular weight in extracts of crude sporulated oocysts.

The quantity of protein required for N-terminal sequencing necessitated the development of procedures that would produce protein fractions enriched for the immunodominant protein. Although 2-D electrophoresisis has a great capacity to separate complex protein mixtures, it was not considered a suitable technique for N-terminal sequencing in this application, due to its inherently low protein loading capacity (Dunn, 1997). In addition, hydrophobic and high molecular weight proteins are poorly absorbed onto IEF gels in the first dimension (personal communication, APAF). Ion exchange chromatography was selected for separation, being a widely used technique suitable for aqueous soluble proteins, having a high binding capacity and preserving the biological activity of proteins (Scopes, 1994).

Following IEX chromatography it was necessary to desalt and concentrate fractions before further analysis. Centrifugal concentrators with a molecular weight cut-off of 100 kDa were selected for the application, giving the additional benefit of removing some small molecular weight proteins. Gel filtration chromatography was then trialed in an endeavor to take advantage of the high molecular weight of the immunodominant protein and remove remaining lower molecular weight proteins. The technique is best suited as a final polishing step in purification however, and not as a separation tool for relatively complex protein mixtures (Scopes, 1994). Subsequent analysis of fractions by SDS-PAGE and silver staining did not suggest a significant further separation of IEX fractions enriched for the immunodominant protein, and the method was not further developed.

The results obtained for N-terminal and tryptic peptide sequencing indicated that the techniques employed for concentration and separation of the immunodominant protein were adequate for the purpose of protein sequencing. The N-terminal and tryptic peptide sequences were subjected to Basic BLAST searches, however no significant alignments were produced. An Advanced BLAST search was then conducted in order to generate short sequence alignments, using an appropriate search matrix (PAM-30) and increased Expect (E) value. An alignment was produced with tryptic peptide #1 and microneme protein 4 from E. tenella, a high molecular weight, acidic protein that is expressed within micronemes and on the parasite surface (Tomley et al, 2001). Although interesting, the result could not be considered statistically significant. The greatest indicator of significance in BLAST searches is the E value that represents the number of expected chance matches from the database with the same score (Wolfsberg and Madden, 1999). The E value of 43 produced for the EtMIC4 alignment suggested a strong probability that the match was due to chance.

During anion exchange chromatography the immunodominant protein was eluted under relatively high NaCl concentrations and over a wide concentration range, indicating that the protein is acidic and suggesting a degree of charge heterogeneity. Such microheterogeneity can be attributed to a number of factors, including the presence of stable alternative conformers, different oligomeric subunit combinations, or varying degrees of glycosylation, phosphorylation, methylation or acetylation (Righetti, 1983). Results from SDS-PAGE analysis under reducing conditions indicated that the immunodominant protein is a monomer consisting of one polypeptide chain, and therefore excluded the possibility of different oligomers contributing to charge heterogeneity. When analyzed under non-reducing conditions however, the high molecular weight immunodominant protein appeared as a doublet band, possibly suggesting the presence of stable conformers, or isomeric forms due to differential post-translation modification. In the presence of 2-β-mercaptoethanol the impact of conformers or varying modification on the apparent molecular weight might then be lessened, explaining the single protein band detected following analysis under reducing conditions.

Example 5

Cloning of the cDNA and Characterization of the Gene Encoding an Immunodominant Asexual Stage Protein from Eimeria maxima

In the development of a recombinant subunit vaccine the cloning of cDNAs encoding proteins of interest is of critical importance. The success of cDNA cloning depends largely on the preparation of a high quality cDNA library, and the selection of a suitable screening procedure that is determined by the available materials and information.

A large number of recombinant cDNA clones encoding putatively protective antigens have been reported, most having been identified by screening cDNA expression libraries with antibodies raised against crude parasite extracts or selected surface or internal proteins. The technique is reliant upon the availability of relatively large amounts of quality antibody able to strongly recognize the protein of interest under denaturing conditions (Sambrook). Primarily because such antisera were available only in very limited quantity, the method was not considered suitable for cloning the cDNA encoding the E. maxima asexual stage immunodominant protein. As an alternative, a RACE PCR-based strategy was considered, initially employing degenerate primers designed on the protein sequence generated for the N-terminus and tryptic peptides of the immunodominant protein (Example 5). The generation and sequencing of RACE products would then facilitate the amplification and cloning of a full-length cDNA via the use of 5′ and 3′ gene-specific primers.

The aim of the work presented is to clone and sequence the cDNA encoding the high molecular weight immunodominant protein discussed in Example 5 using a PCR-based approach. In addition, subsequent characterisation of the cDNA and corresponding gene can give an increased understanding of the structure and function of the protein, and further illustrate its potential as a target for a recombinant vaccine.

Results

RNA Isolation and cDNA Library Construction

The disruption of oocysts with glass beads and treatment of the resulting homogenate with TRIzol Reagent proved to be a suitable method for isolating high-quality total RNA from sporulated oocysts of E. maxima. RNA was isolated from approximately 2.5×107 sporulated oocysts as described, giving a yield of 184 μg of RNA equivalent to 7.36 pg/oocyst. In order to assess the integrity of the RNA preparation, a 2.5 μg sample was separated on a 1% non-denaturing agarose gel. As shown in FIG. 19, the discrete rRNA bands and the greater intensity of the 28S rRNA band in comparison to the 18S rRNA band indicated a high-quality sample. In addition the purity of the preparation was assessed by measurement of the A260/280 ratio, giving a value of 1.983 falling within the accepted range of 1.7-2.0.

The entire total RNA sample was used in the preparation of mRNA as described, and the mRNA recovered in 8 μL of DEPC treated ddH2O. Assuming 100% recovery and a relative mRNA distribution between 1-5% of total RNA, a yield of between 1.84-9.2 μg of mRNA was estimated. Requiring 1 μg of mRNA for cDNA library construction, one half of the mRNA sample was used for first strand cDNA synthesis. A positive control cDNA synthesis was also carried out using 1 μg of Human Placental Poly A+ RNA included in the Marathon™ cDNA Amplification Kit, reported to typically produce approximately 1 μg of ds cDNA.

In order to monitor the synthesis and purification of the cDNA during construction of the library, [α-32P]dCTP was included in the first-strand reaction mixture. Following second-strand synthesis the experimental ds cDNA yield was checked with a series 900 radiation mini-monitor (Mini Instruments Ltd., England) and estimated to be approximately 1/10th the yield of the positive control ds cDNA. Because the sample yield was considerably less than expected, the integrity of the sporulated oocyst ds cDNA was not assessed by agarose gel electrophoresis. The entire ds cDNA sample was used in adaptor ligation and diluted accordingly to a concentration suitable for PCR.

To ensure that cDNA adaptor ligation was successful and that the Marathon RACE protocol was suitable for use with the PTC-200 Peltier Thermal Cycler, a control PCR experiment was carried out using the control ds cDNA with control primers and recommended PCR programme. Following amplification the samples were analysed on a 1% agarose gel. The 5′ and 3′ RACE and internal control reactions all generated DNA bands of the expected size (results not shown).

Cloning of a DNA Encoding the Immunodominant Protein

Note: For convenience the sequences of the degenerate and gene-specific primers referred to throughout this section are presented in Table 3

A number of degenerate PCR primers were designed based on the sequences generated from the N-terminus and tryptic peptides of the immunodominant protein. In addition, further examination of the EtMIC4 and 5401 E. tenella surface antigen sequences revealed a number of short peptide motifs similar to tryptic peptide #1 from the E. maxima immunodominant protein. As shown in FIG. 20, the E. tenella motifs all contain a conserved cysteine residue at the carboxy end. The information was used to design further degenerate primers based on tryptic peptide #1 and incorporating a C-terminal cysteine. The level of degeneracy within primers was reduced by consideration of codon usage reported in gene sequences of Eimeria tenella (Ellis et al, 1993).

Degenerate primers based on tryptic peptide #1 were used in 3′RACE PCR and as shown in FIG. 21 amplified a number of products. A predominant band of approximately 2.2 kb was generated with primers AP1 and FP008—designed with a 3′ TG pertaining to a C-terminal cysteine residue. The band was cloned and partially sequenced, and the sequence submitted for BLASTX analysis against all non-redundant databases accessed through NCBI. The analysis revealed a high level of homology with a region of the predicted amino acid sequence of EtMIC4 (FIG. 22).

Forward and reverse gene-specific primers were designed from the 3′ DNA band sequence and used in PCR with degenerate primers based on the N-terminus protein sequence. FP004 (degenerate) and RP016 (gene-specific) primers amplified a number of products and a band of approximately 6 kb was selected for gel-purification (FIG. 23 A). In order to further characterise the band, 1 μL of the purified product was used as template in a nested PCR reaction with FP006 (degenerate) and RP015 (gene-specific) primers. An amplified band of approximately 6 kb (FIG. 23 B) was gel-purified, cloned and partially sequenced.

From the 5′ region of the sequence obtained above, gene-specific reverse primers were designed to amplify the 5′ end of the cDNA. Separate 5′ RACE reactions were carried out using primers RP019 and RP020 (situated 31 bp 3′ of RP019) and as shown in FIG. 24, Lanes 2 and 3, both reactions amplified a similar size band of between 500-600 bp. To further characterize the amplification products, 1 μL of the RP020 RACE reaction was used as template in a nested PCR reaction with AP2 and RP019 primers. The reaction generated a single product of the expected size of between 500-600 bp (FIG. 24, Lane 4). The band was cloned and a translation of the sequence revealed the N-terminus protein sequence of the mature immunodominant protein as determined by Edman degradation (FIG. 25).

Gene-specific primers were designed from the sequences of the 5′ and 3′ RACE products to amplify a cDNA putatively encoding the entire, mature immunodominant protein. A single band estimated to be approximately 7 kb was generated with primers FP015 and RP023 (FIG. 26) and cloned as described. A schematic overview of the PCR cloning strategy is presented in FIG. 27.

TABLE 3
Oligonucleotide primers used in the cloning of the cDNA
for the E. maxima immunodominant protein.
Primer Sequence (5′-3′)
AP1 CCATCCTAATACGACTCACTATAGGGC
FP008 TGGACNGCNTGGACNGARTG
FP004 AARTGYGARTCNGGNTGGAC
RP016 CGTTGTTCGCCGGCTTGCTGCACTCCTC
FP006 GARTCNGGNTGGACNCC
RP015 GTTGCATTCGCTCCATGGGCCCCACTG
RP019 CTGTCCCACCACACACGACATATCGCC
RP020 CCTGCATGCCCTCACTTCCTGCACCTC
AP2 AGTCACTATAGGGCTCGAGCGGC
FP015 GCTGCACTCTATGGCGGAACAGGAATCG
RP023 GCCTGTTTCGCCTTCGCATCCTTCG

Sequence Analysis of the Full-Length cDNA

The full-length cDNA sequence was generated by sequencing the clone putatively encoding the entire mature protein, and the 5′ and 3′ RACE PCR products overlapping this. All but a region of approximately 50 bp at the extreme 5′ end of the cDNA was sequenced, with repeated attempts to sequence this T rich area unsuccessful. The cDNA predicts an open reading frame of 7122 bp and indicates a coding region of 7080 bp, a 3′ untranslated region of 680 bp and a 5′ untranslated region of approximately 280 bp. BLASTN analysis of the putative coding sequence against all non-redundant databases accessed through NCBI revealed a high level of homology with the mRNA sequence for EtMIC4 (FIG. 28). A Clustal W (1.4) sequence alignment pairing the EmIP and EtMIC4 cDNA coding sequences produced an identity score of 60% (alignment not shown).

Predicted Primary Structure of the Immunodominant Protein

The full cDNA putatively encoding EmIP and the predicted translation are presented in FIG. 29. The first in-frame ATG appears 43 bp downstream from the beginning of the predicted ORF, and is likely to represent the initiating methionine given that it encodes the only in-frame methionine occurring upstream of the mature N-terminus as determined by Edman degradation. Furthermore the translated sequence was submitted to the SignalP V1.1 WWW server through ExPASY, and revealed a typical signal peptide of 26 amino acids, starting with the putative initiating methionine and with a cleavage site immediately preceding the mature N-terminus.

The mature polypeptide predicted by the ORF consists of 2334 amino acids with a predicted molecular mass of approximately 246 kDa and a theoretical pI of 4.2 as determined by the program ProtParam. The polypeptide has a high frequency of glutamic acid residues representing 12.3% of the amino acid content, and a total of 440 negatively charged residues (glutamic acid and aspartic acid) compared to 147 positively charged residues (arginine and lysine), accounting for the predicted negative charge. The protein is also particularly rich in glycine and cysteine residues representing 11.8% and 10.6% of the amino acid composition respectively.

In order to search for conserved domains within the protein, the polypeptide sequence was submitted for analysis to the SMART, ScanProsite and PROSCAN programs through the ExPASY server. The majority of the protein is predicted to comprise repeats of two different cysteine rich adhesive domains, known to be associated with important binding interactions both between cells and between cells and the extracellular matrix. The first group consists of 16 repeats of a truncated form of the type 1 repeat of human platelet thrombospondin (TSP-1), occurring between residues 27-194 (4 copies), 1517-1648 (3 copies) and 1765-2143 (9 copies) (FIG. 30). Nine of the 16 repeats feature a WXXW motif, similar to the TSP-1 WSXW motif directly associated with binding to proteoglycans and sulfated glycolipids (Guo eta al, 1992). Downstream of the WXXW motif, eight of the repeats contain a basic residue motif RXR, associated with glycosaminoglycan-mediated cell binding activities (Gantt et al., 1997).

The second adhesive domain group constitutes approximately 57% of the mature protein and comprises 31 tandem repeats of a family of epidermal growth factor-like (EGF-like) domains, occurring between residues 195-1516 (FIG. 31). The domains have been identified in a large number of membrane-bound and extracellular proteins in eukaryotes and are believed to be involved primarily in ligand-receptor interactions. A characteristic feature of the domains is the presence of six highly conserved cysteine residues. All of the EGF-like repeats present in the immunodominant protein suggest a pattern typical of the EGF-CA calcium binding domain subset that require calcium for their biological function.

Between TSP-1 repeats 7 and 8 (residues 1649-1764) the polypeptide contains the first of two low complex, highly negatively charged regions abundant in glutamic acid and glycine residues. The first region features 7 repeats of a degenerate form of the motif GEVQPGTEEGAGVG SEQ. ID NO. (FIG. 32 A). The second region occurs following the final TSP-1 repeat between residues 2144-2285 and is additionally rich in proline residues (FIG. 32 B). Immediately downstream of the second region of low complexity is a predicted transmembrane region (TM) and cytoplasmic tail (CT), found highly conserved in the apicomplexa within members of the TRAP family of microneme proteins (FIG. 33). The cytoplasmic tail region is usually characterised by the presence of conserved tyrosine residues within close proximity to the TM and conserved tryptophan residues near the C-terminus.

The structural features of the protein are shown schematically in FIG. 34. BLASTP analysis of the predicted polypeptide sequence against all non-redundant databases accessed through NCBI revealed a highest score alignment with EtMIC4, and significant scores with members of the fibrillin family of proteins (FIG. 35). A ClustalW (1.1) alignment with EtMIC4 revealed an amino acid identity score of 61% with an additional 10% similarity (full alignment not shown). The overall similarity between EmIP and EtMIC4 at the amino acid level is represented diagrammatically in FIG. 36 by analysis with the GAP and GAPSHOW programs, showing a particularly high degree of conservation over the region spanned by the EGF-like repeats. The two proteins are most dissimilar at the N-termini.

Expression of the Immunodominant Protein Across Developmental Stages

Note: For convenience the sequences of the gene-specific primers referred to throughout this section are presented in Table 4

To substantiate earlier findings indicating that EmIP is confined to the asexual stages of development, mRNA was isolated from merozoites and gametocytes and subjected to RT-PCR primed with EmIP gene-specific primer RP022. In addition, primer CRP6 (specific for constitutively expressed E. maxima HSP70) was included in all RT. reactions to act as a positive control. Duplicate reactions were also carried out in the absence of reverse transcriptase to confirm that PCR bands generated were not amplified from genomic DNA potentially contaminating the mRNA samples. Standard PCR reactions were performed with 1 μl of each RT reaction, using EmIP specific primers FP010 and RP023 to generate a product with an expected size of 1211bp, and HSP70 specific primers CFP1 and CRP3 to produce a band with a predicted size of 336 bp. To verify the identity of products amplified with EMIP primers, 1 μL of plasmid DNA containing sporulated oocyst cDNA encoding EmIP was also used in amplification with FP010 and RP023 as described. A no template control was included to ensure that PCR reagents were uncontaminated.

Following PCR, samples from all reactions were analyzed by electrophoresis on a 0.8% agarose gel. As can be seen in FIG. 37, primers specific for EmIP amplified a band of the expected size from sporulated oocyst cDNA (Lane 2) and detected messenger RNA specific for EmIP in merozoites (Lane 3). A PCR product specific for EmIP was not generated from gametocyte mRNA template (Lane 4), however HSP70 positive control primers amplified a band of the expected size from both merozoite (Lane 5) and gametocyte (Lane 6) mRNA. No amplification products were generated in the RT negative controls (Lanes 7 and 8), or in the no template control (Lane 9). The results confirm that the immunodominant protein is present in the asexual stages of development but not expressed in gametocytes.

TABLE 4
Oligonucleotide primers used for the amplification of
gene-specific products in RT-PCR analysis.
The predicted size of PCR products is given where applicable.
Gene Primers Sequence (5′-3′) Product size (bp)
EmIP RP022 CGAGCTCTTGGGGTGGAGATGCAACTG N/A
EmHSP70 CRP6 TGTTTATTAGCCTCATCCTCTGCC N/A
EmIP FP010 CAGTGGGGCCCATGGAGCGAATGCAAC 1211
RP023 GCCTGTTTCGCCTTCGCATCCTTCG
EmHSP70 CFP1 AGGATTAGAGACAGCAGGAGGAG 336
CRP3 CCTTGACTAAGTCTACCCTTATC

Genomic Organisation
Restriction Enzyme Analysis

Restriction digested genomic DNA of E. maxima was separated on a 0.9% agarose gel and transferred to nylon membrane as described. The membrane was hybridised using a 1590 bp cDNA fragment generated by PCR amplification with EmIP specific primers FP015 (5′-GCTGCACTCTATGGCGGAACAGGAATCG-3′) and RP033 (5′-GGCGCACTCGTCG ATATC TTTGCATGC-3′). As can be seen in FIG. 38, digestion with Bgl II (Lane 1), Eco RI (Lane 2), Hind III (Lane 3), Nco I (Lane 4), and Nde I (Lane 5) produced a single hybridising band, while digestion with Nsi I (Lane 6) resulted in two bands due to the presence of a cleavage site within the probe sequence, and therefore the complementary genomic DNA. The Southern analyses suggest that the gene encoding EmTFP250 is present as a single copy within the E. maxima genome.

Intron-Exon Structure

A group of four gene-specific primer pairs were used in PCR amplification with EmIP cDNA to generate a series of DNA fragments covering the cDNA encoding the mature immunodominant protein (Table 5). In order to detect introns within the EmIP gene, the primer pairs were also used in amplification with E. maxima genomic DNA to generate DNA bands representing the corresponding gene fragments. Following separation of the PCR products by agarose gel electrophoresis, DNA bands putatively containing intron sequence were identified by an increase in size over the corresponding cDNA fragments. As shown in FIG. 39, all primers pairs predominantly amplified a single PCR product from genomic DNA, greater in size than the cDNA counterpart. No products were generated from single primer and no template negative controls performed for all primer pairs (results not shown).

To confirm the presence of introns, the genomic DNA fragment generated by amplification with primers FP010 and RP023 was purified and sequenced. Analysis of the sequence revealed two putative introns of 139 bp and 151 bp respectively, containing typical eukaryoytic donor/acceptor sites (FIG. 40). Genomic fragments amplified by primer pairs FP015/RP033, FP021/RP030 and FP026/RP015 were not sequenced.

Conservation of EmIP Across Strains and Species of Eimeria

The cDNA and protein sequences of EmIP and EtMIC4 were aligned using a Clustal W (1.4) multiple sequence alignment programme, and degenerate PCR primers were designed based on highly conserved regions (FIG. 41). Primer pair CP003 (5′-AAGACTTCGGCGARGGNGGNGTNTG-3′) and CP004 (5′-GCCTCGCACTCRTCNACRT CNACRC was used with genomic DNA from the Houghton strain of E. maxima to amplify a DNAfragment with an expected size of 622 bp. A DNA product of appropriate size was generated and its identity confirmed by gel purification and sequencing.

TABLE 5
Oligonucleotide primer pairs used in intron-exon analysis for the
amplification of gene-specific products from cDNA and genomic DNA.
The region of cDNA amplified and predicted product size are shown.
Primer cDNA region cDNA product
Pair Sequence (5′-3′) amplified (bp) size (bp)
FP015 GCTGCACTCTATGGCGGAACAGGAATCG  273-1865 1593
RP033 GGCGCACTCGTCGATATCTTTGCATGC
FP021 GCATGCAAAGATATCGACGAGTGCGCC 1839-4554 2716
RP030 CTGCTGTGCACTCATCGATGTCAACG
FP026 CGTTGACATCGATGAGTGCACAGCAG 4529-6209 1681
RP015 GTTGCATTCGCTCCATGGGCCCCACTG
FP010 CAGTGGGGCCCATGGAGCGAATGCAAC 6183-7394 1212
RP023 GCCTGTTTCGCCTTCGCATCCTTCG

In order to assess the degree of conservation of EmIP, genomic DNA from Australian isolates of all seven species of Eimeria parasitic in chickens was used in PCR amplification with degenerate primers CP003 and CP004. EtBr staining of PCR products separated on a 0.8% agarose gel revealed only faint bands of the appropriate size in samples generated using E. acervulina, E. maxima, E. necatrix and E. tenella DNA (results not shown). To examine the PCR products further, the DNA was transferred to nylon membrane by Southern blotting and hybridised with a Houghton strain, E. maxima genomic DNA probe generated with primers CP003 and CP004.

As shown in FIG. 42 A, following high stringeny washes and exposure of the membrane to x-ray film for 10 min, a hybridising band of appropriate size was detected in E. acervulina, E. maxima, E. necatrix and E. tenella samples (Lanes 2, 4, 6 and 8 respectively). After 30 min exposure (FIG. 42 B) a single hybridising band of similar size was also detected in E. brunetti, E. mitis and E. praecox PCR products (Lanes 3, 5 and 7 respectively). The results provide further evidence that the EmIP gene is highly conserved throughout strains and species of Eimeria causing coccidiosis in chickens.

Example 6

Immunization and Challenge Trial of the Recombinant 56 kDa (r56) and 82 kDa (r82) Gametocyte Antigens, and the 250 kDa (r250) Asexual Stage Antigen in Chickens

Immunization

Animals

Chickens:

    • 84 day old (˜12 weeks) Australorp cockerels
    • kept on medicated (robenidene) food
    • all chickens were individually tagged and recorded
      Antigens

Recombinant proteins in the pTRCHisb expression system were grown at 37° C. in 0.1 mg/ml ampicillin in 0.01 M Mg2+ SOB and induced for 4 hours with 1 mM IPTG. Proteins were purified on a Ni-agarose column, concentrated, desalted, and lyophilized with stabilizers (3% lactose, 1% monosodium glutamate). Protein concentrations used for all antigens were measured using the Bradford assay. Affinity Purified Gametocyte Antigen (APGA) preparations provided by M. Wallach was used as a positive control for the trial.

Groups and Doses

    • 9 chickens used per group; 9 groups in total; 81 chickens used in total.
    • Chickens were immunized with 0.5 ml antigen/Freunds Incomplete Antigen (FIA) cocktail (0.25 ml antigen/0.25 ml FIA) per bird, intra-muscularly, on one side only of the chicken, with the following antigens:

Group 1 PBS only
Group 2 Adjuvant (FIA)/PBS
Group 3 APGA (2.5 g)
Group 4 r250 protein (1.0 g)
Group 5 r250 protein (10.0 g)
Group 6 r56 protein (0.5 g)
Group 7 r56 protein (5.0 g)
Group 8 r82 protein (0.5 g)
Group 9 r82 protein (5.0 g)

Immunization Schedule

Immunization 1: week 1
Immunization 2: week 3
Bleed: week 6
Bleed: week 8
Bleed/Kill: week 9

Analyzes

    • Bleeds were taken (˜1.5-2 ml/bird), sera separated and tested by ELISA and immunoblotting
      Results

Results of the bleeds are shown in FIG. 43.

Challenge

Animals and Parasites

    • 5 chickens (148 days old; ˜4.5 months) from each group which had the highest antibody titre based on the ELISA results of bleed 1 were used; in the case of the PBS and FIA controls, chickens with the lowest antibody titres were used
    • E. maxima (strain Houghton);
    • robenidene was removed from the feed one week prior to challenge
      Groups

The following groups and chickens were taken from the immunization trial described above, and used in the challenge experiments

Group 1 PBS only chicken numbers 2, 3, 4, 6, 8
Group 2 Adjuvant (FIA)/PBS chicken numbers 12-16
Group 3 APGA (2.5 g) chicken numbers 20, 22, 23, 25, 27
Group 5 r250 protein (10.0 g) chicken numbers 37, 39, 41, 44, 45
Group 7 r56 protein (5.0 g) chicken numbers 57, 59, 60, 61, 63
Group 9 r82 protein (5.0 g) chicken numbers 74, 75, 76, 79, 80

Challenge Schedule
Robenidene Removed
Challenged with 100 sporulated oocysts per bird Day 6
Oocyst Harvest and Count Schedule
Day 0 post-infection
Day 1 post-infection
Day 2 post-infection
Day 3 post-infection
Day 4 post-infection
Checked oocyst output for contamination of another species Replaced plastic sheet to start collections.
Day 5 post-infection Feces collected, and oocysts counted
Day 6 post-infection Feces collected, and oocysts counted
Day 7 post-infection Feces collected, and oocysts counted
Day 8 post-infection Feces collected, and oocysts counted
Day 9 post-infection Feces collected, and oocysts counted
Day 10 post-infection Feces collected, and oocysts counted

TABLE 6
Immunization and Challenge Trial I
Groups/ Cumulative oocyst counts (× 106) Output (%) % inhibition
Day p.i. 6 7 8 9 10 6 7 8 9 10 6 7 8 9 10
1. PBS only 6.67 17.00 26.40 27.33 27.43 100  100  100  100  100   0  0  0  0  0
2. FIA only 3.20 14.40 17.30 17.50 17.50 48 85 66 64 64 52 15 34 36 36
(100)  (100)  (100)  (100)  (100)  (0) (0) (0) (0) (0)
3. APGA 2.77 9.35 13.48 13.58 13.61 42 55 51 50 50 58 45 49 50 50
(2.5 μg) (87) (65) (78) (78) (78) (13) (35) (22) (22) (22)
5. r250 0.83 8.35 13.72 14.72 14.72 12 49 52 54 54 88 51 48 46 46
(10 μg) (26) (58) (79) (84) (84) (74) (42) (21) (16) (16)
7. r56 0.33 4.53 7.20 8.16 8.53  5 27 27 30 31 95 73 73 70 69
(5 μg) (10) (32) (42) (47) (49) (90) (68) (58) (53) (51)
9. r82 4.23 10.33 14.73 14.93 15.06 63 61 56 55 55 37 39 44 45 45
(5 μg) (132)  (72) (85) (85) (86)  (0) (28) (15) (15) (14)

Example 7

Expression of a Recombinant Fragment of the 250 kDa Asexual Stage Protein

The region of the 250 kDa protein encoding the predicted transmembrane domain/cytosolic tail and upstream hydrophilic domain was selected for expression studies (FIG. 44). The area was chosen for a number of reasons and are as follows: 1) similar 3′ hydrophilic tail regions have been identifiied in a number of apicomplexan microneme proteins and appear unique to this family of proteins; 2) such regions have been identified in other microneme proteins also recognised as immunodominant, primarily Eimeria tenella microneme protein 1 (EtMICl) and surface antigen 5401 (EtMIC4); 3) a similar region was expressed from the E. tenella 5401 antigen (EtMIC4) and was found to afford significant protection against challenge with E. tenella (Danforth et al, 1988); 4) other regions of the protein consist primarily of the EGF-like and TSP-1-like domains. These domain types are found highly conserved within eukaryotes and therefore the possiblility of their inducing auto-immunity must be considered. Furthermore because of the prevalence of such domain types it seems unlikely that they would be responsible for inducing a strong immune response.

PCR primers EP006 (5′-TTGGATCCCGAATTGCACCCCA TTCC-3′) and EP007 (5′-TTGAATTCTGRATGTCGCCGCTGTCG-3′) were designed to amplify the selected DNA region from a cDNA clone encoding the 250 kDa protein. The primers incorporated BamHI (EP006) and EcoRI (EP007) restriction sites to facilitate cloning into the selected expression vector. The PCR product subsequently generated using the primers was gel-purified and its identity confirmed by sequencing.

The bacterial expression vector pTrcHisB (Invitrogen) was selected for expression studies. Plasmid vector DNA and gel purified cDNA. insert were digested with the restriction enzymes BamHI and EcoRI, and the digested DNA fragments gel purified and ligated. The ligation mixture was transformed into E. coli strain DH5-a and following plating and incubation, resulting colonies were selected, cultured and used for plasmid preparation. The identity of the selected recombinants was confirmed by DNA sequencing.

In preparation for expression, plasmid DNA containing the expression construct was transformed into the E. coli host expression strain TOP10. Following plating and incubation, a single bacterial colony was selected and used to establish an O/N culture in LB media. A vector only negative control culture was also established. Aliquots of each culture were then transferred to fresh LB media and incubated until the cells reached mid-log phase, at which stage expression was induced with the addition of 1 mM IPTG. Samples from the expression culture and negative control culture were taken at 0, 1, 2, 5 and 24 hrs post induction, and centrifuged to pellet the bacterial cells. All pellets were subsequently resuspended in TE buffer, sonicated and centrifuged to separate the aqueous soluble fraction (supernatant) from the insoluble fraction (pellet). All fractions were analysed under reducing conditions on SDS-PAGE gels and subsequently stained with Coomassie Blue. When compared to the negative control samples, an over-expressed protein was detected in the soluble fractions, migrating at just below the 45 kDa marker. Western analyis of the soluble fractions using an antibody reactive with the 6× Histidine tag of pTrcHis expression products, detected a protein band of the same apparent molecular weight. The predicted size of the expressed protein is approximately 30 kDa, somewhat less than that observed on SDS-PAGE gels. The size difference might be explained by the high frequency of proline residues in the expressed protein, known to cause proteins to migrate with apparently high molecular weight.

In preparation for immunogenicity trials, the expressed protein was purified using Ni-NTA Agarose nickel-charged resin (QIAGEN), with minor modifications to the manufacturer's recommended protocol. Expressed proteins containing the 6× His tag bind to the resin and are displaced by an increased concentration of imidazole in the elution buffer. Briefly, cell pellets were resuspended in Lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 rM imidazole, pH 8.0), containing 1 mg/ml lysozyme. The suspension was sonicated on ice and centrifuged to pellet insoluble material. The supernatant containing the soluble expressed protein was then mixed with Ni-NTA resin and added to a disposable elution column. The slurry was allowed to settle then washed with Wash buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0), before elution with Elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8.0). The purity of eluted fractions was analysed by reducing SDS-PAGE and Coomassie Blue staining.

Details for the immunogenicity trials are as for the 56 kDa and 82 kDa trials. For the mouse trial, 0.5 μg and 5 μg doses of the recombinant protein per mouse were used (6 mice/group). For the chicken trial, 1 g and 10 μg doses per bird were used (9 chickens/group). ELISA results for the collected serum samples from the mouse and chicken trials are presented in FIGS. 45 and 46 respectively.

REFERENCES

  • Danforth, H. D., Augustine, P. C. and Jenkins, M. C. (1993) A Review of Progress in Coccidial Vaccine Development. pp. 49-60. In Vith International Coccidiosis Conference, Guelph, Ontario, Canada, Barta, J. R. and Fernando, M. A. (ed.)
  • Dunn, M. J., 1993. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). In: Gel electrophoresis:proteins. Ch. 6, pp 51-64. BIOS Scientific Publishers Limited, Oxford.
  • Dunn, M. J., 1997. Two-dimensional polyacrylamide gel electrophoresis for the separation of proteins for chemical characterization. In; Smith, B. J., ed. Protein sequencing protocols. Ch. 3, pp 25-36. Humana Press, Totowa, N.J.
  • Gantt, S. M., Clavijo, P., Bai, X., Esko, J. D., Sinnis, P., 1997. Cell adhesion to a motif shared by the malaria circumsporozoite protein and thrombospondin is mediated by its glycosaminoglycan-binding region and not by CSVTCG. Journal of Biological Chemistry, 272: 19205-19213.
  • Guo, N. H., Krutzsch, H. C., Negre, E., Zabrenetsky, V. S., Roberts, D. D, 1992. Heparin-binding peptides from the type I repeats of thrombospondin. Structural requirements for heparin binding and promotion of melanoma cell adhesion and chemotaxis. Journal of Biological Chemistry. 267: 19349-19355.
  • Karkhanis, Y. D., Nollstadt, K. A., Bhogal, B. S., Ravino, O., Pellegrino, R., Crane, M. S., Murray, P. K., Turner, M. J. (1991) Purification and characterization of a protective antigen for Eimeria tenella. Infect. & Immun. 59: 983-989.
  • Righetti, P. G., 1983. Isoelectric focusing: theory, methodology and applications. In: Laboratory techniques in biochemistry and molecular biology. Ch. 4, pp 305-313. Elsevier Biomedical Press.
  • Scopes, R. K., 1994. Separation by adsorption II: ion exchangers and nonspecific adsorbents, Separation in solution. In: Protein purification. Ch. 6, pp 146-171, Ch. 8, pp 238-249. Springer-Verlag, New York.
  • Smith, N. C., Wallach, M., Miller, C. M. D., Morgenstern, R., Braun, R. and Eckert J., 1994. Maternal transmission of immunity to Eimeria maxima: western blot analysis of protective antibodies induced by infection. Infection and Immunity, 62(11): 4811-4817.
  • Smith, B. J., 1997. SDS polyacrylamide gel electrophoresis for N-terminal sequencing In; Smith, B. J., ed. Protein sequencing protocols. Ch. 2, pp 17-24. Humana Press, Totowa, N.J.
  • Sutton C. A., Shirley, M. W. and Wisher, M, 1989. Characterisation of coccidial proteins by two-dimensional sodium dodecyl sulphate-polyacrylamide gel electrophoresis. Parasitology, 1989(99): 175-187.
  • Tomley, F. M., Billington, K. J., Bumstead, J. M., Clark, J. D., Monaghan, P., 2001. EtMIC4: a microneme protein from Rimeria tenella that contains tandem arrays of epidermal growth factor-like repeats and thrombospondin type-I repeats. International Journal for Parasitology, 2001(31): 1303-1310.
  • Wagenbach, G. E. (1969) Purification of Eimeria tenella sporozoites with glass bead columns. J. Parasitol. 55: 833-838.
  • Wolfsberg and Madden, 1999. Bioinformatics. In: Auubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K., eds. Short protocols in molecular biology. Ch. 18, pp 18.1-18.23.

Claims

What is claimed is:

1. An isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide present in sporozoites/merozoites of Eimeria maxima, wherein the 250 kDa polypeptide has the amino acid sequence shown as SEQ. ID. NO. 6, or a full complement of the nucleic acid.

2. The isolated nucleic acid of claim 1, wherein the nucleic acid has the nucleotide sequence shown as SEQ. ID. NO. 4.

3. An isolated vector comprising a nucleotide sequence encoding a 250 kDa polypeptide present in sporozoites/merozoites of Eimeria maxima, wherein the 250 kDa polypeptide has the amino acid sequence shown as SEQ. ID. NO. 6, or the full complement of the nucleic acid.

4. An isolated host cell comprising a-vector comprising a nucleotide sequence encoding a 250 kDa polypeptide present in sporozoites/merozoites of Eimeria maxima, which has the amino acid sequence shown as SEQ. ID. NO. 6, the full complement of the nucleic acid.

5. The vector of claim 3, wherein the vector is a plasmid.

6. The vector of claim 3, wherein the nucleic acid has the nucleotide sequence shown as SEQ. ID. NO. 4.

7. The nucleic acid of claim 1, wherein the nucleic acid is a DNA molecule or an RNA molecule.

8. The nucleic acid of claim 7, wherein the DNA molecule is a cDNA molecule.

9. The nucleic acid of claim 1 operatively linked to a promoter of RNA transcription.

10. An isolated plasmid comprising a nucleotide sequence encoding a 250 kDa polypeptide present in sporozoites/merozoites of Eimeria maxima, wherein the 250 kDa polypeptide has the amino acid sequence shown as SEQ. ID. NO. 6, or the full complement of the nucleic acid.

11. The plasmid of claim 10, designated 230.1 plasmid deposited under Australian Government Analytical Laboratories Accession No. NM01/22396.

12. The host cell of claim 4, wherein the cell is a bacterial cell, a plant cell, an insect cell, or a mammalian cell.

13. An isolated transformed cell comprising a nucleotide sequence encoding a 250 kDa polypeptide present in sporozoites/merozoites of Eimeria maxima, wherein the 250 kDa polypeptide has the amino acid sequence shown as SEQ. ID. NO. 6, or a the full complement of the nucleic acid.

14. The transformed cell of claim 13, designated 230.1 bacteria deposited under Australian Government Analytical Laboratories Accession No. NM01/22397.

15. A method of producing a 250 kDa polypeptide present in sporozoites/merozoites of Eimeria maxima comprising culturing host cells of claim 4 and isolating the 250 kDa polypeptide from the cells so cultured.

16. A vaccine for immunizing a subject against infection by an Eimeria maxima species comprising an isolated nucleic acid comprising a nucleotide sequence encoding a 250 kDa polypeptide present in gametocytes of Eimeria maxima having the amino acid sequence set forth in SEQ. ID. NO. 6 or the full complement of the nucleic acid, an isolated vector comprising such nucleic acid, or a polypeptide encoded by such nucleic acid.

17. The vaccine of claim 16, further comprising a second nucleic acid encoding for an antigen of Eimeria maxima, an isolated vector comprising such nucleic acid, or a polypeptide encoded by such nucleic acid.

18. The vaccine of claim 17, wherein the second nucleic acid encodes for a 56 kDa antigen of Eimeria maxima, the vector comprises a nucleic acid which encodes for a 56 kDa antigen of Eimeria maxima, and the polypeptide is a 56 kDa antigen of Eimeria maxima.

19. The vaccine of claim 17, wherein the second nucleic acid encodes for an 82 kDa antigen of Eimeria maxima, the vector comprises a nucleic acid which encodes for an 82 kDa antigen of Eimeria maxima, and the polypeptide is an 82 kDa antigen of Eimeria maxima.

20. The vaccine of claim 17, wherein the second nucleic acid encodes for a 230 kDa antigen of Eimeria maxima, the vector comprises a nucleic acid which encodes for a 230 kDa antigen of Eimeria maxima, and the polypeptide is a 230 kDa antigen of Eimeria maxima.

21. The vaccine of claim 16, wherein the subject is an avian species.

22. The vaccine of claim 21 wherein avian species is chickens, ducks, turkeys, geese, bantams, quail, or pigeons.

23. The vaccine of claim 16, wherein the vaccine is designed to be administered by intravenous, intramuscular or intraperitoneal injection; or by spraying said vaccine into the nostrils of the subject.

24. The vaccine of claim 22, wherein the vaccine is designed to be administered in ovo.

25. The vaccine of claim 24, wherein the vaccine is designed to be administered to an air sac of an egg.

26. A method of immunizing a subject against infection by an Eimeria maxima comprising the step of administering to the subject the vaccine of claim 16.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: