-
2011-05-31
10/489,242
2002-09-11
US 7,951,361 B2
2011-05-31
WO; PCT/GB02/04123; 20020911
WO; WO03/022306; 20030320
N. M Minnifield
2027-01-07
A bacterial cell which expresses three or more coli surface (CS) antigens and methods of making such a cell. The cell is useful in making vaccines against diarrhea.
Get notified when new applications in this technology area are published.
A61K39/02 IPC
Medicinal preparations containing antigens or antibodies Bacterial antigens
A61K48/00 IPC
Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
A01N63/00 IPC
Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
A01N65/00 IPC
Biocides, pest repellants or attractants, or plant growth regulators containing material from algae, lichens, bryophyta, multi-cellular fungi or plants, or extracts thereof
This application is the US national phase of international application PCT/GB02/04123 filed 11 Sep. 2002 which designated the U.S. and claims benefit of GB 0121998.9, dated 11 Sep. 2001, the entire content of which is hereby incorporated by reference.
The invention relates to bacterial cells, useful for vaccines, in particular vaccines against diarrhoea.
In general, the purpose of a vaccine is to induce an immune response in the recipient, thus providing protection against subsequent challenge with a pathogen. This may be achieved by inoculation with a live attenuated strain of the pathogen, ie. a strain having reduced virulence such that it does not cause the disease caused by the virulent pathogen while still stimulating a broad immune response.
Enterotoxigenic E. coli (ETEC) strains are a major cause of travellers diarrhoea and of morbidity and death of children in endemic areas. Virulence is associated with expression of fimbrial colonisation factor antigens (CFAs) which mediate adhesion to the intestine and with secretion of toxins (heat stable toxin (ST), heat labile toxin (LT) and EAST toxin) which are responsible for the loss of fluid characteristic of the disease. Protection against ETEC disease is associated with antibody-mediated neutralisation of the toxins and with a humoral immune response against the CFAs.
There are several types of CPA associated with virulent strains of ETEC but CFA/I, CFA/II and CFA/IV are the major types, associated with approximately 70% of clinical isolates. CFA/I is a single fimbrial antigen, whereas CFA/II and CFA/IV are each complexes composed of two different types of coli surface (CS) antigen. CFA/II is composed of CS3 with either CS1 or CS2. CFA/IV is composed of CS6 with either CS4 or CS5.
CFA expression in wild-type ETEC appears to be restricted so that native ETEC strains express only one type of CFA and a maximum of two types of CS antigen. Thus, native CFA/II ETEC cells are generally either CS1/CS3 or CS2/CS3 expressing strains. Similarly, native CFA/IV ETEC cells are generally either CS4/CS6 or CS5/CS6 expressing strains. CS1 and CS2 have not been found in the same wild type strain (34) and likewise CS4 and CS5 are never expressed together in naturally occurring strains (WO92/01703, (34)).
An effective vaccine against ETEC must immunise against CFA/I, CFA/II and CFA/IV strains as a minimum. Thus, ETEC vaccines have traditionally required a minimum of 5 bacterial strainsâone strain expressing CFA/I, one strain expressing CS1/CS3, one strain expressing CS2/CS3, one strain expressing CS4/CS6 and one strain expressing CS5/CS6. However, the present inventors have now devised a method for producing a bacterial cell which is not so restricted in its CS antigen expression. Accordingly, the present invention provides a bacterial cell which expresses three or more coli surface (CS) antigens. The invention also provides a method for making such a cell, comprising introducing a polynucleotide encoding a heterologous CS antigen into a bacterial cell.
A bacterial cell according to the invention can be used to manufacture a vaccine against ETEC disease. Thus, the invention provides a vaccine against diarrhoea comprising a cell of the invention and a pharmaceutically acceptable carrier or diluent. Since the present cell avoids the previous limitations on cellular CS antigen expression, the invention provides for the first time, a vaccine against diarrhoea comprising bacterial cells which together express all of CFA/I, CS1, CS2, CS3, CS4, CS5 and CS6, wherein the vaccine comprises fewer than 5 bacterial strains. The invention additionally provides a method of vaccinating a mammal against diarrhoea comprising administering to the mammal a cell or vaccine of the invention.
FIG. 1A Structure of the CS4 operon.
FIG. 1B Map of plasmid pACYC184.
FIG. 1C Map of plasmid pACYC-csaA.
FIG. 1D Map of plasmid pACYC-CS4.
FIG. 2A SDS PAGE analysis of CS antigen expression in strains WS-2252A, ACAM2006, ACAM2006-pCS4 and Strain K-pCS4. Staining is with Simply Blue Safe Stain (Invitrogen).
FIG. 2B SDS PAGE analysis of CS antigen expression in strains WS-2252A, ACAM2006, ACAM2006-pCS4 and Strain K-pCS4, using Western Blotting.
FIG. 2C SDS PAGE analysis of the effect of bile salts on CS antigen expression in strains ACAM2006, ACAM2009 and ACAM2006-pCS4. Staining is with Simply Blue Safe Stain (Invitrogen).
FIG. 2D SDS PAGE analysis of the effect of bile salts on CS antigen expression in strains ACAM2006, ACAM2009 and ACAM2006-pCS4, using Western Blotting.
FIG. 2E SDS PAGE analysis of CS antigen expression in the absence of bile salts in strain ACAM2006-pCS4 transformed with pGEM-rns. Staining is with Simply Blue Safe Stain (Invitrogen).
FIG. 3A Stages 1 to 5 in the construction of pJCB12-ompC-CS4-ompC, and features of the primers used.
FIG. 3B Features of primers used in construction of pJCB12-ompC-CS4-ompC (SEQ ID NOS: 17 to 22). Forward primers are written 5â˛-3Ⲡin bold. Reverse primers are written 3Ⲡto 5Ⲡin normal font. Restriction sites are boxed. Additional nucleotides to introduce complementary sequence for overlap extension PCR are underlined.
FIG. 4 SDS-PAGE analysis of CS antigen expression in strains ACAM2006 and ACAM2006-CS4 showing the effects of bile salts.
(A) Staining is with Simply Blue Safe Stain (Invitrogen)
(B) Western Blot.
FIG. 5A Structure of the CS1 operon.
FIG. 5B Map of plasmid pACYC-CS1.
FIG. 6 SDS-PAGE analysis of CS antigen expression in strains PTL003, ACAM2007 and ACAM2007-pCS1, using Western Blotting.
FIG. 7A Structure of the CS5 operon.
FIG. 7B Construction of plasmid pACYC-Xmal.
FIG. 7C Structure of plasmid pACYC-CS5.
FIG. 8A SDS PAGE analysis of CS antigen expression in the presence of bile salts in strains ACAM2009 and ACAM2009-pCS5, using Western Blotting.
FIG. 8B SDS PAGE analysis of the effect of bile salts on CS antigen expression in strains ACAM2006, ACAM2009 and ACAM2009-pCS5, using Western Blotting.
FIG. 9 SDS PAGE analysis of CS antigen expression in strains ACAM2009, PTL003 and PTL003-pCS4. Staining is with Simply Blue Safe Stain (Invitrogen).
FIG. 10 SDS PAGE analysis of CFA/I and CS antigen expression in strains WS2252A, ACAM2010 and ACAM2010-pCS4:
(A) Staining with Simply Blue Safe Stain (Invitrogen)
(B) Western Blot.
FIG. 11 Map of suicide vector plasmid pDM4. u=unknown sequence, unknown length.
FIG. 12 Map of suicide vector plasmid pJCB12.
FIG. 13 Diagram of method used to create specific gene deletion constructs by overlap extension PCR. Step 1=PCR amplification of two DNA fragments. Step 2=overlap extension PCR using DNA products from reaction 1 and reaction 2 of step 1 and amplification of the overlap PCR product. R and S stand for restriction enzyme sites.
FIG. 14 Diagram of method used to demonstrate correct integration of suicide vector into targeted locus by linkage PCR.
SEQ ID NO:1 is nucleotide sequence encoding cooA of the CS1 operon as under GenBank accession number M58550.
SEQ ID NO:2 is nucleotide sequence encoding cooB of the CS1 operon as under Genbank accession number X62495.
SEQ ID NO:3 is nucleotide sequence encoding cooC and cooD of the CS1 operon as under GenBank accession number X76908.
SEQ ID NO:4 is nucleotide sequence encoding cfaD as under GenBank accession number M55609.
SEQ ID NO:5 is nucleotide sequence encoding cotB, cotA, cotC and cotD of the CS2 operon as under GenBank accession number Z47800.
SEQ ID NO:6 is nucleotide sequence encoding ms as under GenBank accession number J04166.
SEQ ID NO:7 is nucleotide sequence of the CS3 operon as under GenBank accession number X16944.
SEQ ID NO:8 is nucleotide sequence encoding csaA, csaB, csaC, csaE and IS1 of the CS4 operon as under GenBank accession number AF296132.
SEQ ID NO:9 is nucleotide sequence encoding csfA, csfB, csfC, csfE, csfF and csfD of the CS5 operon as under GenBank accession number AJ224079.
SEQ ID NO:10 is nucleotide sequence encoding csvR as under GenBank accession number X60106.
SEQ ID NO:11 is nucleotide sequence encoding cssA, cssB, cssC and cssD of the CS6 operon as under GenBank accession number U04844.
A cell of the invention may be derived from any bacterial cell which is capable of expressing an ETEC CS antigen on its surface. In general, the cell is derived from a bacterium that infects a mammalian host by the oral route. The cell may derive from or be descended from a bacterium that invades and grows within eukaryotic cells and/or colonises mucosal surfaces. In general, the cell is gram negative but in some embodiments gram positive bacteria may be used. The bacterium is generally a pathogen.
The bacterial cell used may be from the genus Escherichia, Salmonella, Shigella or Vibrio. Preferably the cell of the invention is an E. coli cell. The present cell may be produced from an ETEC or a non-ETEC E. coli strain which does not itself express any ETEC CS antigens.
Preferably the present cell is derived or descended from an ETEC strain which endogenously expresses an ETEC CS antigen, such as CS1, CS2, CS3, CS4, CS5 or CS6. The present cell may for example, be produced from a wild-type ETEC isolate. Alternatively, the present cell may be produced from an ETEC strain which is itself derived from a wild-type or native ETEC strain. For example, the present cell may be descended from a strain in which a particular toxin gene or genes has been mutated or deleted, or which comprises a further attenuating mutation, or which expresses a further heterologous antigen as described below. A wild-type ETEC strain can be isolated from a human clinical sample using standard techniques. An example of a standard ETEC strain is H10407, deposited at the ATCC under catalogue #35401.
A cell of the invention may, for example, be produced from one of ETEC strains ACM2005, ACM2002, ACM2003, ACM2004, ACAM2007, ACAM2008, ACAM 2009 or ACAM2012 listed in Tables 1 and 2. Each of the strains has been deposited by Acambis Research Limited of Peterhouse Technology Park, 100 Fulbourn Road, Cambridge, CB1 9PT, United Kingdom with the European Collection of Cell Cultures (ECACC), CAMR, Salisbury, Wiltshire SP4 0JG, United Kingdom in accordance with the Budapest Treaty. Accession numbers for the deposited strains are given in the Tables. Deposits 01090302 to 01090306 were deposited on 3 Sep. 2001. Deposits 02082964 to 02082968 were deposited on 29 Aug. 2002. Further information about strain characteristics is given in Table 1.
PTL003 (ACM2005, deposit No. 01090302) (Ref 4, 31) was derived from ETEC strain E1392/75-2A (a) (CS1/CS3, ST minus, LT minus) by targeted deletion of three further attenuating genes (aroC, ompC and ompF) (Table 1). PTL003 has already been tested in two clinical trials and has been shown to be safe and immunogenic.
Strains with deposit nos. 01090303-01090306 were described in UK Patent Application 0121998.9. Both these and the strains with deposit nos. 02082964 to 02082968 are described in the International patent application, claiming priority from UK patent application 0121998.9, and filed by Acambis Research Limited on the same day as the present International application. The contents of that application are hereby incorporated by reference. Each of the strains has been made toxin negative by specific removal of the known toxin genes.
A cell according to the invention may express any combination of ETEC CS antigens provided that the cell expresses three or more ETEC CS antigens. A large number of CS antigens have been identified, the most prevalent being CS1, CS2, CS3 (the components of CFA/II) and CS4, CS5 and CS6 (the components of CFA/IV). Additional antigens include CS17, CS7, CS9, CS14, CS12, PCFO159, PCFO166. However CFA/I (GenBank accession no M55661) is not a CS antigen for the purposes of this document.
Preferably a cell of the invention expresses at least one CS antigen selected from ETEC CS1, CS2, CS3, CS4, CS5, CS6. Thus in one embodiment, the present cell may express three or more CS antigens wherein the CS antigen is selected from CS 1, CS2, CS3, CS4, CS5 and CS6. Such a cell may express three, four, five or six of the listed CS antigens. A cell may express the CS antigens in any combination. It is particularly preferred that a cell of the invention expresses one of the following combinations of antigens:
Thus a cell of the invention may comprise a mixture of CFA protein, for example, a mixture of CFA/II and CFA/IV proteins.
Bacterial cells according to the invention include ACAM 2006-pCS4 (CS4, CS5, CS6), ACAM 2006-CS4 (CS4, CS5, CS6), ACAM2012-pCS4 (CS4, CS5, CS6), ACAM2012-CS4 (CS4, CS5, CS6), ACAM 2007-pCS1 (CS1, CS2, CS3), ACAM 2009-pCS5 (CS4, CS5, CS6), PTL003-pCS4 (CS 1, CS3, CS4) and ACAM2006-pCS1 (CS1, CS5, CS6).
Strain ACAM2012-CS4 was deposited as ACAM2013 on 29 Aug. 2002 by Acambis Research Limited of Peterhouse Technology Park, 100 Fulbourn Road, Cambridge, CB 1 9PT, United Kingdom with the European Collection of Cell Cultures (ECACC), CAMR, Salisbury, Wiltshire, SP4 0JG, United Kingdom, in accordance with the Budapest Treaty. The strain was given Accession No. 02082969 (Table 2).
In general, a bacterial cell according to the invention expresses a CS antigen on its surface, typically assembled into fimbriae or pili. A candidate cell can be tested for expression of a particular ETEC CS antigen by methods known in the art and described in the Examples herein. For example, in one embodiment a suspension of candidate cells is heated to extract CS antigens and centrifuged. The supernatant is then isolated, subjected to gel electrophoresis and analysed by Western blotting using antigen-specific antibodies or direct protein staining. Typically a strain known to express the particular antigen is included as a positive control for comparative purposes. A negative control may also be included. Suitable methods are known to those skilled in the art. Preferably the level of expression of a CS antigen in a cell of the invention is effective to induce an immune response in a host subject to which the cell has been administered, e.g. as a component of an immunogenic composition such as a vaccine.
Typically in a wild-type ETEC strain, a CS antigen is expressed from an operon of genes. Usually an operon includes genes for one or two structural proteins, a chaperone and an usher protein. The chaperone and usher proteins generally facilitate transport of the structural protein to the surface of the bacterium for assembly into fimbriae. An operon may be located on the bacterial chromosome (as in the case of CS4 and CS2 in some strains) or on a low copy number plasmid (as in the case of CS1, CS3, CS5 and CS6). In addition, each operon is associated with a regulatory gene, the product of which controls the expression of the operon genes. However, this regulatory gene may be located some distance from the operon itself.
The CS1 operon (27) is illustrated in FIG. 5A and consists of four genes cooB, cooA, cooC and cooD (Genbank M 58550, X62495 and X76908). The major pilin protein is encoded by cooA, with cooC and cooD encoding transport functions. cooB is required for assembly. Expression of the operon genes is regulated by a further gene cfaD (GenBank M55609).
The CS2 operon (17) consists of four genes, cotA, cotB, cotC, cotD (GenBank Z 47800) with cotA encoding the major pilin protein. Transport functions are encoded by cotC and cotD. Expression of these genes is regulated by another separate gene rns (GenBank J04166).
The sequence of the CS3 operon (20) may be found at GenBank X16944. The operon include cstA, which encodes a chaperone protein, cstB which encodes a protein with an usher function and cstH which encodes structural protein.
The structure of the CS4 operon, which consists of four genes csaA, csaB, csaC, csaE (Genbank AF296132) is shown in FIG. 1A. csaA encodes a chaperone, csaB encodes a major subunit protein, csaC encodes an usher protein and csaE encodes a fimbrial tip protein. Expression of the CS4 genes is regulated by the cfaD gene (GenBank M55609).
The CS5 operon (15)(Genbank AJ 224079) consists of six genes, csfA, csfB, csfC, csfE, csfF and csfD. csfA encodes a major structural protein, csfC encodes a transport protein and csfD encodes a minor structural protein. The operon is illustrated in FIG. 7A. Regulation of the CS5 operon genes is dependent on the presence of bile salts. The gene involved may be csvR (GenBank X60106).
The sequence of the CS6 operon (33, 35) is available at GenBank U04844. The operon includes the cssA and cssB genes which encode structural proteins and the cssC and cssD genes which encode transport proteins.
The sequences of the above operons and genes, specified above by GenBank accession number are also presented in the present sequence listing, as described in the âBrief Description of the Sequencesâ.
Typically, a cell of the invention expresses sufficient genes, including structural, transport and regulatory genes, to enable expression of a given ETEC CS antigen on the bacterial surface. Usually, the antigen is assembled on the surface in fimbriae or pili. Thus, for a given CS antigen, the present cell expresses a structural gene or genes and if necessary, one or more genes, the products of which will aid correct transport to and assembly on the bacterial surface of the structural protein.
Any of the genes referred to above, structural, transport or regulatory, may be useful in the present invention. In one embodiment, an antigenic structural, transport or regulatory protein expressed by a cell of the invention may be encoded by:
A homologue of the polynucleotide sequence in (a) may be used in the invention. Typically, a homologue has at least 40% sequence identity to the corresponding specified sequence, preferably at least 60 or 80% and more preferably at least 90%, 95% or 99% sequence identity. Such sequence identity may exist over a region of at least 15, preferably at least 30, for instance at least 40, 60 or 100 or more contiguous nucleotides.
Methods of measuring polynucleotide homology are well known in the art. For example, the UWGCG Package providing the BESTFIT program can be used to calculate homology, e.g. on its default settings (Devereux et al (1984) Nucleic Acids Research 12, p 387-395). The PILEUP and BLAST algorithms can also be used to calculate homology or line up sequences (typically on their default settings), for example as described in Altschul (1993) J Mol Evol 36: 290-300 or Altschul et al (1990) J Mol Biol 215: 403-10.
A homologue typically hybridises with the corresponding specified sequence at a level significantly above background. The signal level generated by the interaction between the homologue and the specified sequence is typically at least 10 fold, preferably at least 100 fold, as intense as background hybridisation. The intensity of interaction may be measured, for example, by radiolabelling the probe, e.g. with 32P. Selective hybridisation is typically achieved using conditions of medium to high stringency, for example 0.03M sodium chloride and 0.003M sodium citrate at from about 50° C. to about 60° C.
The homologue may differ from the corresponding specified sequence by at least 1, 2, 5, 10 or more substitutions, deletions or insertions over a region of at least 30, for instance at least 40, 60 or 100 or more contiguous nucleotides, of the homologue. Thus, the homologue may differ from the corresponding specified sequence by at least 1, 2, 5, 10, 30 or more substitutions, deletions or insertions.
A homologue structural gene may be tested by expressing the gene in a suitable host and testing for cross reactivity with antibody specific to the particular antigen. A homologue transport or regulatory gene may be tested for the ability to complement the activity of the endogenous transport or regulatory gene in a bacterial cell.
A transport gene may be endogenous to the structural gene or genes with which it functions. Thus the present cell may comprise both the structural gene or genes and one or more of the transport genes of a given CS operon. In a preferred embodiment, a cell of the invention comprises a complete operon for a given CS antigen.
In a further embodiment, a cell of the invention may comprise less than the whole operon for a given CS antigen. For example, a cell of the invention may comprise the structural gene or genes for a given CS antigen, without one or more of the endogenous transport genes. In such a cell, one or more heterologous transport genes function to transport the structural protein to the surface of the cell. Thus, for example, structural CS1 gene products may be transported to the surface by the action of the transport genes of CS2 (cot C and cot D) and vice versa (17). Thus, a cell according to the invention may comprise an incomplete operon for a given CS antigen, provided that the antigen is expressed on the bacterial surface. For example, the cell may express the structural gene or genes of a particular operon, accompanied by one or more heterologous but complementary transport genes.
It is generally preferred that the present cell expresses a CS antigen stably; a cell exhibiting stable antigen expression is a better candidate for an ETEC vaccine. As described above, in native ETEC isolates, the CS2 and CS4 operons are generally located on the bacterial chromosome and the CS1, CS3, CS5 and CS6 operons are generally carried on low copy number plasmids. Thus, in the absence of specific selection mechanisms, endogenous CS genes are generally stably maintained and expressed over many generations. The present cell generally comprises one or more heterologous polynucleotide sequences encoding one or more CS antigens. Such heterologous polynucleotide sequences may be present in the cell on a plasmid or may be located, as a result of an insertion event, in the bacterial chromosome.
Where a heterologous polynucleotide sequence is carried on and expressed from a plasmid, the plasmid is preferably stably maintained. Stable maintenance is also desirable for ETEC CS bearing native plasmidsâthis may become an issue where, for example, a native plasmid is manipulated for attenuation purposes as described below. Methods for enhancing plasmid stability are discussed below.
Preferably a heterologous polynucleotide encoding a CS antigen is positioned in the bacterial chromosome, for example by a recombination event. A chromosomal location generally provides more stable expression than a plasmid location and would also result in a heterologous operon being present at a copy number similar to that occurring in wild-type strains. Where the cell has been obtained by introduction of a heterologous CS antigen encoding polynucleotide into an ETEC strain which endogenously expresses a CS antigen, chromosomal placement also helps to prevent âoverloadingâ with the additional antigenic protein and to minimise interference with regulation of expression of the endogenous antigenic proteins.
In a wild type ETEC strain, regulation of expression of a CS operon is often effected by a gene which is at some distance from the structural gene or genes. In the present cell, expression of a heterologous CS antigen may be regulated by a regulatory gene native to the cell, a homologue thereof, or a by a heterologous regulatory gene. Thus, where the present cell is obtained by introduction of a heterologous polynucleotide into an E. coli strain which endogenously expresses an ETEC CS antigen, expression of the heterologous sequence may be regulated by a regulatory gene associated with the endogenous CS operon. Without wishing to be bound by theory, it is proposed that host specific regulatory proteins are able to interact with the genes that have been introduced artificially and changed in mode of regulation. Thus, for example, when CS4 genes are introduced into a CS5/CS6 expressing E. coli strain, without the native CS4 regulatory gene cfaD, expression of the CS4 genes may be regulated by the endogenous CS5 regulatory gene, which is dependent on the presence of bile salts. However, if a rns regulator (a homologue of cfaD) is also introduced to this cell, expression of the CS4 gene becomes bile salt independent. Conversely, when CS5 genes are introduced into a CS4/CS6 strain, without the native regulatory gene, expression of the CS5 genes may be regulated by the CS4 regulatory gene cfaD.
In one embodiment it may be preferable for CS antigen expression in the present cell to be bile salt independent. For example, this may be advantageous if a cell of the invention is to be âpreloadedâ with CS antigen, in preparation for vaccine use, since animal product free medium may be used to induce CS antigen expression.
A cell according to the invention has not been isolated in nature. Accordingly, the present cell is generally obtainable by introducing a polynucleotide (e.g. DNA) encoding a heterologous ETEC CS antigen into a suitable bacterial host cell.
Suitable host strains (or starter strains) from which the present cell may be produced have been described above. Preferably the host strain is an ETEC strain which endogeneously expresses an ETEC CS antigen. In particular the host strain may express CFA/II (includes CS1/CS3 and CS2/CS3) or CFA/IV (includes CS4/CS6 or CS5/CS6). In one embodiment the host strain is selected from deposited strains ACM2005, ACM2003, ACM2002, ACM2004, ACAM2007, ACAM2008, ACAM2009 or ACAM2012 listed in Tables 1 and 2 or descendents of these cells. A descendent is any cell derived from the deposited cell. A descendent may include a cell with one or more further attenuating mutations, such as those described herein. A descendent may include a cell engineered to express a heterologous antigen, also as described herein.
In general the polynucleotide introduced into the host strain comprises one or more structural genes for a CS antigen. Preferably the polynucleotide includes the structural gene or genes for at least one antigen selected from ETEC CS1, CS2; CS3, CS4, CS5 and CS6. GenBank accession numbers for these gene sequences are given above and in Table 5. Sequences corresponding to those entered under the accession numbers are included in the present sequence listing.
The process for making the present cell may also comprise the step of introducing into a cell a polynucleotide comprising one or more transport (typically chaperone or usher) genes. In one preferred embodiment, the method comprises introducing to a suitable cell a polynucleotide comprising one or more structural genes for an ETEC CS antigen and one or more complementary transport genes. Alternatively the structural genes and the transport genes may be present on separate polynucleotides. Preferably a method is used which comprises introducing a polynucleotide comprising a heterologous ETEC CS operon. In a further embodiment, transport genes, endogenous to an ETEC host strain may act on an antigen, including a heterologous antigen, in the cell, aiding its progression to the cell surface.
As already described, regulation of expression of a heterologous ETEC CS antigen in the present cell may be carried out by a regulatory gene endogenous to or already present in the host strain. Alternatively or additionally, the method of deriving the present cell may comprise the step of introducing into a cell a polynucleotide comprising a suitable regulatory gene. A regulatory gene when introduced in this way may be present on the same or a different polynucleotide to the structural gene or genes and/or any transport genes which are being introduced. Typically the regulatory gene will be one which regulates expression of the subject ETEC CS antigen in a native ETEC strain or a homologue thereof. Therefore in one embodiment the present process comprises introducing to a suitable cell a polynucleotide comprising a heterologous ETEC CS operon together with its native regulatory gene.
A polynucleotide which is to be introduced into a cell according to the present invention may take any suitable form. Typically the polynucleotide is a plasmid vector. In general, the polynucleotide bears a selectable marker.
The polynucleotide may comprise one or more expression control elements, such as a promoter, enhancer or transcription terminator sequence, operably linked to a gene or genes which need to be expressed. For example, a suitable plasmid expression vector may be used. Suitable vectors are known in the art.
Preferably a polynucleotide, introduced into a cell in accordance with the invention, is to be inserted in the bacterial cell chromosome, for example, by homologous recombination. Methods for causing chromosomal insertion are known in the art. For instance, the polynucleotide may be introduced on a suitable suicide vector. For example, suicide vector pJCB12 described herein may be used.
Methods for introducing foreign DNA into prokaryotic cells are known in the art. Examples of suitable methods include conjugation and electroporation. Transformant colonies may be screened and selected for correct uptake of the heterologous nucleic acid using standard screening and selection procedures. Selected transformants may be tested for surface expression of a given ETEC CS antigen using the screening procedures described above.
In a preferred embodiment the present method comprises:
It is generally preferred that a cell of the invention is attenuated with respect to a wild type ETEC cell. Thus, the present cell typically has reduced virulence, such that it does not cause ETEC associated disease such as diarrhoea, but is nevertheless capable of stimulating an immune response. This is particularly so when the cell is for use in a vaccine to combat ETEC associated disease such as diarrhoea. Use of an attenuated cell in such vaccine generally results in a lower probability of a vaccinated subject experiencing side-effects, such as diarrhoea symptoms.
A cell of the invention may be attenuated in a number of ways, generally by some kind of mutation. For example, toxicity may be reduced by use of a cell which does not express the ETEC associated toxins or does not express these toxins in a functional or toxic form. Alternatively, or additionally, attenuation may arise by mutation of a further bacterial gene, typically to cause its inactivation or deletion (e.g. by replacement).
Colonisation of a host small intestine by ETEC cells is accompanied by the secretion of enterotoxins. Two types of enterotoxins identified in ETEC strains are the heat labile toxin (LT) and the heat stable toxin (ST). LT is highly homologous in structure to the cholera toxin, a multisubunit protein of the form AB5. The A sub-unit is the active component in the toxin, which functions to increase the activity of adenylate cyclase. This is delivered into host cells by the B subunits, which bind to gangliosides on the cell surface. ST is a small (19 amino acids) non-immunogenic polypeptide that has guanylate cyclase stimulating activity. In addition, it has been demonstrated recently that a large proportion of ETEC strains also produce EAST1, a heat stable toxin, similar in size and mode of action to ST but different in sequence, which was originally identified in enteroaggregative E. coli strains.
Thus, in one embodiment a cell of the invention generally does not express functional ETEC toxins, such as LT, ST and EAST1. Such a cell may for example be referred to as a toxin-minus strain. GenBank accession numbers for these toxins are given in Table 5.
Attenuation may arise because the cell is derived or produced from a non-ETEC bacterial cell which does not naturally or endogenously express one or more of the ETEC toxins. Alternatively, the cell may derive from an ETEC cell which is attenuated with respect to the ETEC toxins. Such an ETEC strain may arise as a result of spontaneous mutation, for example a deletion event. Alternatively, or additionally, a toxin-minus strain may be produced using genetic engineering or molecular biology techniques.
Clinical isolates obtained from a long term epidemiological study carried out by scientists at the US NAMRU3 facility in Cairo are listed in Table 3. A number of these isolates are toxin-minus with respect to at least one of the toxins referred to above. Some of these isolates have been used to produce further attenuated strains as described below.
An example of a spontaneous toxin minus strain is E1392/75-2A (CFA/II, ST minus, LT minus) (10) (Table 1). Examples of ETEC strains which have been manipulated to ensure specific removal of all known toxin genes are those with accession numbers 01090304, 1090305, 01090306 (derived from strains H, E, and J in Table 3 respectively) and 02082964, 02082965, 02082966 and 02082968 as described above and shown in Tables 1 and 2. Deposited strain 01090302 is also a toxin minus strain.
A bacterial cell of the invention may be attenuated due to mutation of a further gene. The attenuation may, for example, be brought about by deleting or inactivating one or more of the following genes: aroA, aroC, aroD, aroE, pur, htrA, ompC, ompF, ompR, cya, crp, phoP, phoQ, surA, rfaY, dksA, hupA, invE and clpB. Preferred combinations of genes include:
For example strains PTL002 and PTL003 (Accession number 01090302) were derived from strain E1392/75-2A above by mutation of aroC/ompR and aroC/ompC/ompF respectively.
Furthermore, it is generally preferred that any antibiotic resistance genes are removed from a bacterial cell of the invention before use in a vaccine. Bacteria isolated from the wild often contain antibiotic resistance genes, such as resistance genes against ampicillin, streptomycin, sulphmethoxazole, kanamycin, trimetheprim and tetracycline. These genes can be removed using the suicide vector and methods described herein or by methods known to those skilled in the art.
As noted above, attenuation of the present bacterial cell may arise from one or more mutations in the bacterial genome. A mutation(s) which prevents expression of an enterotoxin or other gene generally deletes or inactivates the gene. Generally there is a complete knock-out of the function of the gene. This may be achieved either by abolishing synthesis of any polypeptide at all from the gene or by making a mutation that results in synthesis of non-functional polypeptide. In order to abolish synthesis of polypeptide, either the entire gene or its 5â˛-end may be deleted. A deletion or insertion within the coding sequence of a gene may be used to create a gene that synthesises only non-functional polypeptide (e.g. polypeptide that contains only the N-terminal sequence of the wild-type protein). In the case of a toxin gene, the mutation may render the gene product non-toxic.
A mutation is generally a non-reverting mutation. This is a mutation that shows essentially no reversion back to the wild-type for example when the bacterium is used as a vaccine. Such mutations include insertions and deletions. Insertions and deletions are preferably large, typically at least 10 nucleotides in length up to the length of the entire gene or coding sequence, for example from 10 to 600 nucleotides. Preferably, the whole coding sequence or whole gene is deleted.
The mutations are typically site-directed. They may be specific or selective to the toxin gene or other gene. For example, in the case of deleting or inactivating the ST gene in a CFA/I or CS5/CS6 strain, the mutation must specifically target the ST gene without deleting or inactivating the (closely-linked) CFA/I gene, CS5 gene or CS6 gene.
A mutation may arise from use of a suicide vector. In particular, the pJCB12 suicide vector may be used. This vector is described in UK Patent Application No. 0121998.9, and also in the International patent application claiming priority from that UK application and filed by Acambis Research on the same day as this International application. The contents of that International application are hereby incorporated by reference. The vector allows specific and reliable targeting, and is typically less than 5 kb in size (for example from 2.5 to 5 kb or 2.5 to 4 kb).
An attenuating mutation may be introduced using a suicide vector or by other methods known to those skilled in the art (26). Appropriate known methods include cloning the DNA sequence of the wild-type gene into a vector, e.g. a plasmid, and inserting a selectable marker into the cloned DNA sequence or deleting a part of the DNA sequence, resulting in its inactivation. A deletion may be introduced by, for example, cutting the DNA sequence using restriction enzymes that cut at two points in or just outside the coding sequence and ligating together the two ends in the remaining sequence. Alternatively, and more usually now, a mutant allele in which the flanking regions of a target gene are amplified separately and linked directly together in a separate overlap PCR reaction, with omission of the intervening target sequence, can be constructed (31). A plasmid carrying the mutated DNA sequence can be transformed into the bacterium by known techniques such as electroporation and conjugation. It is then possible by suitable selection to identify a mutant wherein the inactivated DNA sequence has recombined into the chromosome of the bacterium and the wild-type DNA sequence has been rendered non-functional by homologous recombination.
In another embodiment of the invention, the present cell further expresses an antigen that is not expressed by the native bacterium (a âheterologous antigenâ), in addition to an ETEC CS antigen. This is particularly useful where the cell is to be used in a vaccine, since the presence of additional antigens may enhance the immune response generated. In the case that the bacterium is an ETEC bacterium, the antigen may be from another strain of ETEC, so that the vaccine provides protection against the other strain. Furthermore, the bacterium may be engineered to express more than one such heterologous antigen, in which case the heterologous antigens may be from the same or different strains.
The heterologous antigen may be a complete protein, a part of a protein containing an epitope or a fusion protein. Useful antigens include ETEC non-toxic components or non-toxic mutants of E. coli LT (e.g. the B subunit and mutants of the A subunit, accession numbers for which are given in Table 5), and LT-ST fusion proteins (1, 7-9)
The DNA encoding a heterologous antigen may be expressed from a promoter that is active in vivo. A promoter may be a strong promoter, such as the tac promoter or a derivative thereof. Promoters that have been shown to work well are the nirB promoter (6, 16), the htrA promoter (16), the pagC promoter (13) and the ssaH promoter (32). For expression of derivatives of LT, CT or ST, the wild-type promoters could be used.
As noted, it is preferred that a plasmid expressing a heterologous antigen is stably maintained in the present cell. In order to prevent loss of a plasmid expressing a heterologous antigen or of a native plasmid, an element may be added to the plasmid which enhances its stability.
There are a number of âtoxin/antitoxinâ plasmid stability determining systems known, for example parDE (25) from plasmid RP4 (2), and hok/sok (also known as parB from plasmid R1 or pndAB from plasmid R483 (18, 19)) which could be used to improve plasmid stability. These systems encode two functions: firstly a toxic entity that would kill cells in which it is expressed, which has a long biological half-life, and secondly an antitoxic entity that prevents this killing but has a short biological half-life. In the event that a plasmid encoding these functions is segregated during division the daughter cell which does not contain the plasmid exhausts its supply of antitoxin and is killed by the more persistent toxin moiety. Thus, only cells that continue to harbour the plasmid are maintained in the growing population.
Another system that may be used to enhance the stability of a plasmid in accordance with the invention is a multimer resolution system. Multimer resolution systems confer stability by resolving plasmid multimers into single plasmid copies, hence decreasing the chance of plasmid free daughter cells being generated by random segregation at cell division. A number of site-specific recombination systems which act to resolve plasmid multimers into monomers have been identified. In accordance with such a system, the plasmid to be stabilised contains a recognition site for a site-specific recombinase and the host cell contains a DNA sequence encoding a site-specific recombinase. The recombinase acts on the recognition site and thereby directs proper segregation of the plasmid during cell division. The recombinase may be encoded on the plasmid to be stabilised or in the chromosome of the host cell.
The recombinase is generally a resolvase. Examples of resolvases which may be used in the invention include the Cre recombinase of plasmid P1, the E. coli XerC (ArgR) protein, the D protein recombinase of plasmid F, the ParA recombinases of plasmids RP4 and RK2, the site-specific recombinase of plasmid R1, resolvases encoded by the Tn3-like transposable genetic elements and the Rsd resolvase from the Salmonella dublin virulence plasmid.
The recognition elements which may be used in the present invention include those for the above recombinases. Any recognition element recognised by the site-specific recombinase employed may be used. Suitable recognition elements include those sites recognised by the XerC site-specific recombinase, such as the cer site of plasmid ColE1 and the similar ckr site of plasmid ColK (29), the psi site of plasmid pSC101 and the cer like site of plasmid pHS-2 from Shigella flexneri. Other recognition elements which may be used include the crs site from the Salmonella dublin virulence plasmid, the loxP site of plasmid P1, the rfs site of the F plasmid and the res site of the Tn3-like transposable genetic element
In a particularly preferred embodiment of the invention, the recombinase, is the Rsd resolvase which acts via the crs recognition element. The Rsd/crs system is described in detail in WO 02/28423.
A cell according to the invention is suitable for use in the manufacture of a composition or medicament to target bacterial infection.
Typically the bacterium is ETEC. For example, compositions including the present cell may be used against ETEC associated disease, such as diarrhoea. In general, the composition comprises at least one cell strain of the invention and a pharmaceutically acceptable carrier or diluent. The composition may also comprise one or more other bacterial strains or components.
A suitable cell for inclusion in the composition may be any of those described herein. In general the composition is capable of generating an immune response in an individual to at least the three or more CS antigens expressed in the cell. This capability can be tested by immunisation studies. For example, the composition may be administered to an animal such as a human and tests may be made for generation of an antibody or T-cell response specific for the three or more CS antigens. Antiserum generated following administration of a composition to an animal can be evaluated for ability to specifically bind either the cell expressing the CS antigens or purified CS antigen. Subsequently the animal may be challenged with an ETEC strain to evaluate whether there is a protective immune response.
Preferably, an immunogenic composition can generate an immune response against at least CFA/I, CFA/II and CFA/IV strains. Thus the immunogenic composition preferably comprises one or more bacterial strains according to the invention such that each of the above antigens is represented. The composition may comprise one or more other strains. In one embodiment, the composition of the invention comprises:
Examples of CFA/I strains include ACM2001 and ACAM2010 listed in Table 2.
In a preferred embodiment, the immunogenic composition is a vaccine. For example a vaccine against an ETEC associated disease such as diarrhoea. The vaccine is generally a live attenuated vaccine, comprising one or more live attenuated bacterial strains, at least one of which is a cell strain according to the invention.
Traditionally, due to the restricted expression of CS antigens by ETEC cells, an effective vaccine has had to include a minimum of 5 bacterial strains. However, by providing the present cells, the present invention now provides an anti-ETEC vaccine which may comprise fewer than 5 strainsâfor example 3 or 4 strains.
The present composition or vaccine may be formulated using known techniques for formulating attenuated bacterial compositions or vaccines. The composition or vaccine is advantageously presented for oral administration, for example as a dried stabilised powder for reconstitution in a suitable buffer prior to administration. Reconstitution is advantageously effected in a buffer at a suitable pH to ensure the viability of the bacteria. In order to protect the attenuated bacteria and the composition or vaccine from gastric acidity, a sodium bicarbonate preparation is advantageously administered with each administration of the vaccine. Alternatively the composition or vaccine is presented in a lyophilised encapsulated form.
The composition or vaccine may be used in the treatment, such as the vaccination, of a mammalian host, particularly a human host. An infection caused by a microorganism, especially a pathogen, may therefore be targeted or prevented by administering an effective dose of a vaccine prepared according to the invention. The dosage employed may ultimately be at the discretion of the physician, but will be dependent on various factors including the size and weight of the host and the type of composition or vaccine formulated. However, a dosage comprising the oral administration of from 107 to 1011, e.g. from 108 to 1010, bacteria per dose may be convenient for a 70 kg adult human host.
The following Examples serve to illustrate the invention.
Unless otherwise indicated, the methods used are standard biochemistry and molecular biology techniques (2, 26).
Materials and Methods
Strains
This work was carried out using a number of clinical isolates of ETEC. Strain E1392/75-2A (9) was provided by the National Collection of Type Cultures and Pathogenic Fungi, Central Public Health Laboratories, Colindale, UK. This is a spontaneous toxin-loss variant of Strain E1392, originally isolated in Hong Kong. Attenuating deletions were introduced into the aroC, ompC and ompF genes at Acambis, UK to create vaccine strain PTL003 (Deposited strain 01090302, Tables 1 and 2) (31). The other wild-type strains were isolated at Naval Medical Research Unit 3 (NAMRU3), Cairo, Egypt from patients with diarrhoea. Toxin genes were deleted from these strains and attenuating deletions were introduced into the aroC, ompC and ompF genes at Acambis, UK (UK Patent application 0121998.9). The strains used in the Examples, their genotypes/phenotypes and where appropriate, the accession numbers for deposited strains are described in Tables 1 and 2.
The Examples also use three laboratory strains of E. coli which carry the pir gene on the chromosome. These are SY327Νpir (23), SM10Νpir (28) and DH5ιΝpir (P Barrow, Institute for Animal Health, Compton).
Growth of Strains
All media used for maintenance and growth of strains during vaccine development were made from certified animal-free components. Basic LB media was composed of 10 g/l soy peptone, 5 g/l yeast extract and 10 g/l NaCl. Agar (15 g/l) and antibiotics were added as required. CFA agar was used for analysis of vaccine strains and was composed of 10 g/l agar, 10 g/l soy peptone, 1.5 g/l yeast extract, 0.005% MgSO4, 0.0005% MnCl2 and 0.15% bile salts.
Preparation of CS Proteins by Heat Extraction
Strains were grown overnight in LB media, with antibiotics as required, at 37° C. with shaking. A 10 Îźl aliquot was then spread onto a 15 ml CFA-agar plate containing antibiotics where appropriate. The plate was incubated overnight at 37° C. until a confluent lawn was achieved. The bacteria were then scraped off the plate into 0.5 ml PBS. 10 Îźl of this cell suspension was added to 1 ml PBS and the OD600 was measured (OD600 of 1=1Ă109 cells/ml). An aliquot of cell suspension containing 109 cells was centrifuged at 13000 rpm for 5 min and the pellet was resuspended in 10 Îźl PBS. The sample was heated at 65° C. for 10 min and then centrifuged at 13000 rpm for 5 min. The supernatant was retained and added to 10 Îźl 2Ă Novex Tris-Gly sample buffer (Invitrogen) containing 2 Îźl 1M DTT. Samples were heated at 95° C. for 5 min and then analysed by SDS-PAGE on 14% Novex Tris-Gly gels (Invitrogen) followed by direct staining with SimplyBlue SafeStain (Invitrogen) or by immunoblotting.
Detection of Proteins by Western Blot
Samples were electrophoresed on 14% Novex Tris-Gly gels at 125V until the dye front was about 0.5 cm from the bottom of the gel. SeeBlue Plus2 markers (Invitrogen) were used as molecular weight standards. Transfer onto 0.45 Îźm nitrocellulose membrane (LC2001, Invitrogen) was performed for 1 h at 25V according to the manufacturer's instructions (XCell II Blot Module EI 9051 instruction manual, Invitrogen). After transfer, the membrane was blocked for 1 h using PBST (Sigma P-3813, 0.01M Phosphate-buffered saline (0.138M NaCl, 0.0027M KCl) with 0.05% Tween pH7.4) and 5% Marvel dried milk powder. The membrane was washed four times (10 min each) in PBST containing 1% Marvel. The blot was incubated with primary antibody in PBST/1% Marvel for 1 hour and then washed four times as before. The blot was incubated with secondary antibody (anti-rabbit HRP conjugate, Sigma A4914) in PBST/1% Marvel for 1 h and then washed four times as before and twice in PBST alone. The blot was developed using the Pierce Super Signal West Pico reagent according to the manufacturer's instructions and exposed to X-ray film for various time periods.
PCR Reactions
Except where otherwise described, two types of PCR reactions were formed: reactions to amplify DNA fragments for cloning and reactions for screening and analysis of plasmids/strains. To obtain fragments for cloning, the high fidelity enzyme Pfu Turbo (Stratagene) was used according to the protocols set out in the Instruction Manual #039001b. For screening clones, and cloning the rns gene, Taq polymerase (Invitrogen, Catalogue number 10342-020) was employed according to the manufacturer's instructions.
Oligonucleotides
The sequences of the oligonucleotides, for example the primers, used in the Examples are given in Table 4.
1.1 Cloning the CS4 Operon
The sequence of the CS4 operon has been published in Genbank (Reference number AF296132). Computer-aided restriction analysis of this sequence (using the VectorNTi program Version 7, Informax) revealed two BglII sites, one (site (a)) in the first gene of the operon (csaA) and one (site (b)) downstream of the last gene in the operon (csaE) (FIG. 1A). Thus the major part of the operon could be cloned by restriction digestion using these BglII sites, avoiding any PCR-related errors. However, it was necessary to clone the 5Ⲡregion of the operon by PCR amplification since there were no suitable restriction sites that would permit direct cloning. Two PCR primers (Primer 47151 and Primer 47152) were used to amplify the csaA gene up to and including the BglII site, using chromosomal DNA from Strain WS2252-A (CS4/CS6, Table 1) as template. The forward primer, Primer 47151, introduced a SalI restriction site upstream of the csaA gene, whilst the reverse primer, Primer 47152, introduced an SphI site downstream of the BglII site. These sites were used to clone the 723 bp PCR product into the stable, low-copy number vector pACYC184 ((5); supplied by NEB, FIG. 1B) which was also digested with SalI and SphI. This vector was named pACYC-csaA (FIG. 1C). In this construct, site (a) in FIG. 1A is preserved and can be used for cloning the large fragment from the CS4 operon (between the (a) and (b) sites).
Thus, another portion of chromosomal DNA from Strain WS2252-A was digested with BglII and subjected to agarose gel electrophoresis. DNA fragments of approximately 5 kb were isolated from the gel using a QIAquick gel extraction kit and were ligated into pACYC-csaA that had been digested with BglII and treated with Calf Intestinal Phosphatase (CIP). Ligation mixture was used to transform E. coli XL10 Gold KanR and transformed colonies were selected on agar plates containing chloramphenicol. Colonies with plasmids containing the 3Ⲡregion of the CS4 operon in the correct orientation were detected by PCR using Primer 47151 and Primer 47150 that binds within csaC (FIG. 1A). Correct plasmids containing the complete CS4 operon were named pACYC-CS4 (FIG. 1D).
1.2 Expression of CS4
1.2.1 Expression of CS4 from the Plasmid pACYC-CS4
The plasmid pACYC-CS4 was used to transform two strains: âStrain Kâ is a derivative of a CS4/CS6 strain that has spontaneously lost its CS4 gene such that it expresses CS6 only; ACAM2006 is an attenuated, toxin-minus derivative of WS2773-E, a CS5/CS6 ETEC strain. The strains were designated Strain K-pCS4 and ACAM2006-pCS4 respectively and were maintained on chloramphenicol.
CS proteins were purified by heat extraction from Strain K-pCS4 and ACAM2006-pCS4 as described in the âMaterials and Methodsâ. For comparison, Strain WS-2252A, a CS4/CS6 strain, and ACAM2006 were similarly analysed. After heating for 5 min at 95° C., the samples were analysed by electrophoresis on 14% Tris-Gly polyacrylamide gels (Novex). Bands were visualised by staining with SimplyBlue SafeStain (Invitrogen) (FIG. 2A) or by Western Blot using CS4-specific antibodies (FIG. 2B) as described in the âMaterials and Methodsâ.
CS4 antigen was clearly detected in the control strain, WS-2252A, and also in Strain K-pCS4 indicating that the cloned operon was intact and functioning. However, CS4 was not detected in either ACAM2006 or in ACAM2006-pCS4. It seemed likely that this disparity was due to the presence of different regulatory mechanisms in Strains K and ACAM2006. The cfaD gene product, a protein that is present in Strain K but not in ACAM2006, normally regulates the CS4 operon. Expression of the CS5 operon is poorly understood. The csvR gene has been isolated from another CS5/CS6 strain and is 87% homologous to cfaD. The protein product is able functionally to replace activity of cfaD to mediate CFA/I expression, however, it's role in expression of CS5 is unclear (11, 14). CS5 biosynthesis also differs from expression of CS1, CS2, CS3, CS4 and CS6 in that bile-salts are necessary for production of fimbriae. It was speculated that it might be necessary to add bile salts to the CFA agar used for growth of ACAM2006-pCS4 in order to stimulate expression of the CS4 operon. CS proteins were purified by heat extraction from Strains ACAM2006, ACAM2009 (an attenuated derivative of WS2252A) and ACAM2006-pCS4 as described in the âMaterials and Methodsâ. Samples were analysed by electrophoresis on 14% Tris-Gly polyacrylamide gels (Invitrogen) and bands were visualised by staining with SimplyBlue SafeStain (Invitrogen) or by Western blot using CFA/IV specific antibodies as described in the âMaterials and Methodsâ. In the presence of bile salts good quantities of CS4 and CS5 were detected in the CFA preparation from ACAM2006-pCS4 (FIGS. 2C and D) indicating that a regulator protein present in ACAM2006, possibly csvR, can activate the CS4 operon and induce expression. CS6 was also detected in ACAM2006-pCS4. Although the levels of this antigen are low they are similar to those seen in CS5/CS6 strains such as ACAM2006. Hence we demonstrated that it was possible to express all three CFA/IV CS proteins within a single strain.
Bile-salt dependent regulation should work well in vivo in a vaccine strain where expression of CS proteins is expected to mimic that seen in a natural infection However, it may be possible to change the pattern of regulation by introduction of a different regulator such as rns or cfaD (rns is homologous to cfaD). To investigate this an rns gene was isolated from strain E1392-2A by PCR using primers RNS-03 and RNS-04. The PCR product was amplified using Taq polymerase that leaves an âAâ overhang and permits the use of cloning vector pGEM-T Easy (Promega) for cloning. The PCR construct was cloned into the vector according to the supplier's instructions to create plasmid pGEM-rns. This plasmid was introduced into ACAM2006-pCS4 by electroporation and selection on media containing ampicillin and chloramphenicol. CS proteins were prepared from cells grown in CFA media without bile salts and samples were analysed by SDS-PAGE on 14% Tris-Gly gels (Novex) stained with Simply Blue Safe Stain (Invitrogen). Expression of CS4, CS5 and CS6 that was not dependent on the presence of bile salts, was observed (FIG. 2E). However, the amount of CS5 in the cells had a deleterious effect on the level of CS4 in the cell compared with induction by bile salts in the absence of rns (as seen in FIGS. 2C and 2D). Using a low copy number plasmid for expression of rns may have reduced this effect. Thus, regulation of the CS proteins in the vaccine strains could be altered by introduction of different regulator proteins.
1.2.2 Chromosomal Expression
CS4 and CS2 operons are normally found on the chromosome in wild-type strains and the other CS operons are located on low copy number plasmids. To overcome plasmid stability problems and to create a strain suitable for use as a vaccine, it was desirable to insert the CS4 operon into the chromosome of ACAM2006. This would also result in the operon being present at a similar copy number to that seen in wild-type strains and it was hoped that this would prevent âover-loadingâ with the additional CS protein. Excessive CS4 protein expression could cause attenuation of the strain and/or interfere with expression of the endogenous CS proteins.
1.2.2.1 Construction of Targeting Vector
The cloning strategy for chromosomal insertion is described in detail in FIG. 3. The suicide vector pJCB12 (FIG. 12) was used for introducing the operon into the chromosome. This plasmid contains the R6K origin and can only be propagated in strains containing Νpir (21). In this case pJCB12 and its derivatives were propagated in E. coli strain DH5Νpir. It was decided to insert the operon into the ompC locus of ACAM2006. Since the ompC gene itself had already been deleted from this strain, its 5Ⲡand 3Ⲡflanking regions were used to target the CS4 operon into the correct site.
The first stage of the cloning strategy involved individually amplifying the 5Ⲡand 3ⲠompC flanking regions and the csaA gene by PCR (Stage 1, FIG. 3A). Primers 47173 and 47174 were used to amplify the upstream flanking region of the ompC gene and primers 47177 and 47178 were used to amplify the downstream region of the ompC gene. ACAM2006 chromosomal DNA was used as the template. A 721bp fragment including the 5Ⲡregion of the CS4 operon, up to and including the BglII site in the csaA gene was amplified, using primers 47175 and 47176 and WS-2252A chromosomal DNA as template. Primers 47174 and 47175 contained extended sequences such that the 3Ⲡsequence of the upstream-ompC flanking region PCR product and the 5Ⲡend of the csaA PCR product contained complementary sequences. This allowed the two fragments to be joined together by overlap extension PCR using primers 47173 and 47176 (Stage 2, FIG. 3A). Similarly, primers 47176 and 47177 contained extended sequences such that the 3Ⲡsequence of the csaA PCR product and the 5Ⲡsequence of the downstream-ompC flanking region PCR product contained complementary sequences. This allowed the ompC-csaA fragment to be fused to the downstream-ompC flanking region by overlap extension PCR using primers 47173 and 47178 (Stage 3, FIG. 3A).
The ompC-csaA-ompC fragment contained BamHI sites at the 5Ⲡand 3Ⲡends, introduced by the primers 47173 and 47178. These sites were used to clone the ompC-csaA-ompC fragment into the BglII site of pJCB12, destroying both the BamHI and BglII recognition sequences (Stage 4, FIG. 3A). This plasmid was called pJCB12-ompC-csaA-ompC. This meant that the BglII site in the csaA gene was now unique and could be used for cloning the remainder of the CS4 operon. Therefore, the remaining 3Ⲡregion of the CS4 operon was excised from pACYC-CS4 by digestion with BglII and inserted into the BglII restriction site inside the csaA gene (Stage 5, FIG. 3A). Recombinant plasmids with the csaBCE fragment in the correct orientation were identified by PCR screening using oligos 47105 and RGK01. This completed construction of the suicide vector for targeting the CS4 operon into the ompC locus and the plasmid was designated pJCB12-ompC-CS4-ompC.
1.2.2.2 Insertion of the CS4 Operon into the Chromosome
pJCB12-ompC-CS4-ompC was used to transform the conjugation-competent, tetracycline sensitive E. coli strain SM10Νpir (23). ACAM2006 was made tetracycline-resistant by transformation with plasmid pACYC184 (5). Strain SM10Νpir-pJCB12-ompC-CS4-ompC was conjugated with ACAM2006-TetR by cross-streaking on LB agar plates. A 2 cm square area was densely streaked with one strain and then over-streaked with the other strain in a perpendicular direction. After overnight growth at 37° C. the cells were scraped off and spread onto agar plates containing chloramphenicol and tetracycline. Transconjugants in which pJCB12-ompC-CS4-ompC had been inserted into the chromosome of ACAM2006-TetR formed colonies, whereas neither of the parent strains were able to grow on this combination of antibiotics. Homologous recombination of the CS4 operon into the correct site (ie the ompC locus) was confirmed by PCR using oligos 4732 and 47105.
Having targeted the CS4 operon into the ompC locus it was necessary to select clones where the vector sequences had been excised, but the CS4 operon had remained in the chromosome. pJCB12 contains the sucrase gene which confers toxicity to cells grown on sucrose, hence correctly targeted transconjugants were grown in medium containing 5% sucrose to select for loss of the suicide vector. Only strains in which the suicide vector had been excised were able to grow. Excision of the vector sequence would mean that the chloramphenicol resistance gene was also lost, therefore sucrose-resistant colonies were further screened to check that they were sensitive to chloramphenicol. Chloramphenicol-sensitive, sucrose-resistant colonies were screened by PCR to identify clones in which the CS4 operon had been retained in the ompC locus (primers 4732 and 47105). A strain in which the CS4 operon was correctly inserted was selected and designated ACAM2006-CS4.
1.2.2.3 Expression of CS4 from the Chromosomal Locus
ACAM2006-CS4 was grown overnight on plates containing LB agar, CFA agar or CFA agar plus 0.15% bile salts. CS proteins were prepared by heat-extraction as described in the âMaterials and Methodsâ. Similar preparations were made from ACAM2006 for comparison. Samples were analysed by SDS-PAGE on 14% Tris-Gly polyacrylamide gels (Novex) Bands were visualised by staining with SimplyBlue SafeStain (Invitrogen) or by Western Blot (FIGS. 4A & B). Blots were stained with rabbit CS4, CS5 and CS6-specific antibodies and an anti-rabbit HRP conjugate (Sigma A4914) as described in the âMaterials and Methodsâ.
Low levels of CS6 were detected from ACAM2006 and ACAM2006-CS4 when the stains were grown either with or without bile salts, although slightly higher levels were detected when bile salts were present. CS5 was detected in both stains but only when bile salts were included in the agar. CS4 was present only in ACAM2006-CS4 and only in the presence of bile salts.
Thus a strain has been created in which CS4, CS5 and CS6 are all expressed at good levels. As seen with plasmid pACYC-CS4, control of CS4 expression has shifted to become bile-salt dependent, similar to that seen naturally for CS5 expression. This type of regulation should work well in a vaccine strain where CS proteins are induced in vivo. It may be possible, however, to change the pattern of regulation by introduction of a different regulator such as rns or cfaD (Section 1.2.1).
ACAM2006 and ACAM2006-CS4 carry a P2-like bacteriophage genome in the chromosome (Section 1.2.1). A large part of that genome was deleted from both strains to improve their suitability as components of a vaccine. This deletion did not affect expression of CS4, CS5 or CS6. The bacteriophage-deleted ACAM2006 strain is ACAM2012 (deposited strain with accession number 020282968). Strain ACAM2012-CS4 (ACAM2013) has been deposited with accession number 02082969, as described above.
2.1 Cloning of the CS1 Operon
The genes of the CS1 operon of ETEC have been sequenced (Genbank Accession Numbers M58550, X62495, X76908). These sequences were compiled into the complete operon (cooB, cooA, cooC, cooD) and the restriction sites were analysed using the VectorNTi program Version 7 (Informax) (FIG. 5A). Two sites suitable for cloning the intact operon by restriction digestion were identified: EcoRV upstream of cooB, and BglII downstream of cooD. Plasmid DNA purified from the CS1/CS3 strain E1392/75-2A (Table 1) was digested with EcoRV and BglII and subjected to agarose gel electrophoresis. DNA fragments of approximately 6.6 kb were isolated from the gel using a QIAquick gel extraction kit. This was the correct size for the CS1 operon as predicted from the compiled Genbank sequences. The 6.6 kb fragments were ligated into the cloning vector pACYC184 ((5); Supplied by NEB, FIG. 1B) that had been digested with EcoRV and BamHI. Ligated colonies were used to transform E. coli K12 and colonies were selected on agar plates containing chloramphenicol. Correct constructs were identified by digestion with HindIII or HindIII/SphI. This construct was designated pACYC-CS1 (FIG. 5B).
2.2 Plasmid Expression
Strain ACAM2007, an attenuated CS2/CS3 strain, was transformed with pACYC-CS1 by electroporation. This strain was designated ACAM2007-pCS1. Stains PTL003 (CS1/CS3), ACAM2007 and ACAM2007-pCS1 were spread onto CFA-agar plates and CFA proteins were prepared by heat-extraction as described in the âMaterials and Methodsâ. Samples were analysed by electrophoresis on 14% Tris-Gly polyacrylamide gels. In order to resolve the CS2 and CS3 proteins, which are approx 15.3 and 15.1 kDa respectively, 14 cm gels were utilised. CS proteins were detected by Western Blot, (FIG. 6) stained with rabbit CFA/II-specific antibodies (which recognise CS1, CS2 and CS3) and developed as described in the âMaterials and Methodsâ.
CS1 and CS3 were detected in PTL003, CS2 and CS3 were detected in ACAM2007 and CS1, CS2 and CS3 were detected in ACAM2007-pCS1. Therefore we had demonstrated that it is possible to express three CFA/II antigens in a single strain.
2.3 Chromosomal Insertion
A CS2/CS3 strain expressing CS1 may form a component of an ETEC vaccine even when the CS1 operon is carried on a stable plasmid, however for increased strain stability it would be desirable to insert the CS1 operon into the chromosome of the strain. A similar strategy to that described in Section 1.2.2 for the CS4/CS5/CS6 strain, or other technique known in the art, could be employed.
3.1 Cloning of the CS5 Operon
The sequence of the CS5 operon has been published (Genbank AJ224079). Computer aided restriction analysis of this sequence (using Vector NTi Version 7, Informax) revealed an AgeI site upstream of the first gene of the operon (csfA) and an XmaI site downstream of the last gene in the operon (csfD) (FIG. 7A). These sites were suitable for cloning the intact operon by restriction digestion, avoiding any PCR-related errors. The âoverhangâ generated by digestion with AgeI is complementary to the XmaI overhang, hence the fragment could be cloned directly into XmaI-cut vector. However the vector pACYC184 did not contain an XmaI site and so required some modification (FIG. 7B). Approximately 276 bp of pACYC 184 from the unique BamHI site at position 3961 to the unique SalI site at position 4237 were amplified using Primer 47180 and Primer 47182. Both the BamHI and SalI sites were preserved, and Primer 47182 also introduced a new XmaI site 5Ⲡof the SalI site. The 295 bp PCR-amplified DNA fragment was digested with SalI and BamHI and was cloned into pACYC184 that had also been digested with SalI and BamHI, thus introducing a new and unique XmaI site into the vector. This vector was named pACYC-XmaI (FIG. 7B).
Plasmid DNA was isolated from Strain WS2773-E (CS5/CS6) and a portion was digested with AgeI and XmaI and subjected to agarose gel electrophoresis. DNA fragments of approximately 7 kb were isolated from the gel using a QIAquick gel extraction kit (QIAgen) and were ligated into pACYC-XmaI that had also been digested with XmaI and treated with Calf Intestine Alkaline Phosphatase. Ligation mixture was used to transform E. coli XL10 Gold KanR and colonies were selected on agar plates containing chloramphenicol. Colonies were screened for plasmids containing the CS5 operon by PCR with Primers 47168 and 47167. The orientation was determined using primers 47180 and 47168. A correct plasmid was designated pACYC-CS5 (FIG. 7C).
3.2 Plasmid Expression
Strain ACAM2009, an attenuated CS4/CS6 strain, was transformed with pACYC-CS5 by electroporation and the strain was designated ACAM2009-pCS5.
Strains ACAM2009 and ACAM2009-pCS5 were spread onto CFA-agar plates containing 0.15% bile salts and CFA proteins were purified as described in the âMaterials and Methodsâ. Samples were analysed by SDS PAGE on 14% Tris-Gly gels (Novex) and bands were visualised by Western Blot (FIG. 8A). Blots were stained with rabbit CFA/IV-specific antibodies that detect CS4, CS5 and CS6 and anti-rabbit HRP conjugate (Sigma A4914). All three CS proteins (CS4, CS5 and CS6) were detected in Strain ACAM2009-pCS5 in the presence of bile salts. To determine whether bile salts were necessary for CS5 expression (as in natural CS5/CS6 strains) ACAM2006, ACAM2009 and ACAM2009-pCS5 were spread onto agar plates with or without bile salts and CFA proteins were purified as described in the âMaterials and Methodsâ. Samples were analysed by SDS-PAGE followed by Western blotting using CFA/IV-specific antibodies (FIG. 8B). As expected, in ACAM2006 CS5 was expressed only when bile salts were present in the media, whereas in ACAM2009 CS4 was present both with and without bile salts in the media. In ACAM2009-pCS5 both CS4 and CS5 were present independently of the presence of bile salts in the CFA agar. Presumably the cfaD regulator that is present in ACAM2009 and controls expression of CS4 in a bile-salt independent manner is also able to regulate expression of CS5.
3.3 Chromosomal Insertion
A CS4/CS6 strain expressing CS5 may form a component of an ETEC vaccine even when the CS5 operon is carried on a stable plasmid, however for increased strain stability it would be desirable to insert the CS5 operon into the chromosome of the strain. A similar strategy to that described in Section 1.2.2 or other technique known in the art could be employed.
We wished to know if expression of CS proteins in the strains is restricted by CFA-type, for example would it be possible to express CFA/II proteins within a CFA/IV strain? To investigate this, plasmids carrying cloned CS operons were used to transform ETEC strains of different CFA types.
4.1 CFA/II and CFA/IV Co-Expression
pACYC-CS4 (Section 1.1) was used to transform PTL003 (an attenuated CS1/CS3 strain, Table 1) to create PTL003-pCS4. PTL003, PTL003-pCS4 and ACAM2009 (an attenuated CS4/CS6 strain) were spread onto CFA-agar plates and CS proteins were purified as described in the âMaterials and Methodsâ. Samples were analysed by electrophoresis on 14% Tris-Gly gels (Novex) and bands were visualised by staining with SimplyBlue SafeStain (Invitrogen) (FIG. 9). CS1 and CS3 were detected in PTL003 and CS4 was detected in ACAM2009. In PTL003-pCS4 CS1, CS3 and CS4 were present. This indicated that it is possible to express CFA/II and CFA/IV antigens in a single strain.
4.2 Reference Example: CFA/I and CFA/IV Co-Expression
In order to test if multiple expression of CS proteins in a single strain is restricted by CFA type, pACYC-CS4 (Section 1.1) was used to transform strain ACAM2010 (an attenuated CFA/I strain) to create ACAM2010-pCS4. ACAM2010, ACAM2010-pCS4 and WS-2252A (CS4/CS6) were spread onto CFA-agar plates and CFA proteins were purified as described in the âMaterials and Methodsâ. Samples were analysed by electrophoresis on 14% Tris-Gly gels (Novex) and bands were visualised by staining with SimplyBlue SafeStain (Invitrogen) or by Western Blot using CS4 and CFA/I-specific rabbit antibodies (FIG. 10). CFA/I was detected in ACAM2010 and CS4 was detected in WS-2252A. In strain ACAM2010-pCS4 both CFA/I and CS4 were present. This indicated that it is possible to express to different types of CFA antigen in a single strain.
This section describes the generation of a novel suicide vector plasmid, pJCB12, and its use for the introduction of mutations into chromosomal or plasmid encoded gene loci. Production and use of pJCB12 is described in UK Patent Application 0121998.9 and in the International patent application claiming priority from UK Patent Application 0121998.9, and filed by Acambis Research Limited on the same day as the present International application. The contents of that International application are incorporated by reference.
Suicide vector plasmids such as pDM4 (24), pJCB12, pCVD442 (12) and others can be used to introduce defined genetic constructs into specific targets in the bacterial genome. Plasmid pJCB12 is a new, optimised suicide vector based on the previously constructed suicide vector pDM4. The defined genetic construct to be introduced into the bacterial genome may be a deletion mutation of a specific gene, or a more complex structure such as, for example, an insertion of a gene within another and expressed from a chosen promoter from within the construct. Generally, the extremities of the constructs will consist of nucleotide sequences derived from the region of the genome to be targeted.
Suicide vectors pDM4 and pJCB12 possess a number of key components (see FIGS. 11 and 12):
An origin of replication which directs replication of the vector in some strains of bacteria but not in others, oriR6K. oriR6K is the origin of replication derived from the naturally occurring plasmid R6K. This origin requires the R6K pir gene for replication, which is absent from the suicide vectors. Three laboratory E. coli strains are available that carry the pir gene on their chromosome, which are SY327Νpir, SM10Νpir, and DH5ιΝpir. All three of these strains may be used to propagate pDM4, pJCB12 and their derivatives.
A transfer origin that directs conjugative transfer of the vector from one bacterial strain to another, mobRP4. mobRP4 is the transfer origin from the naturally occurring plasmid RP4. This allows the conjugative transfer of pDM4 and pJCB12 and their derivatives to recipient bacterial strains. In order to function, mobRP4 requires the genes encoding the RP4 transfer functions to be present in the donor bacterial cell. Laboratory E. coli strain SM10Îťpir carries these genes on its chromosome, and so this strain can be used as a donor strain for pDM4, pJCB12 and their derivatives.
A gene encoding a product that is toxic to bacterial cells when the cells are grown under defined conditions, sacB. sacB codes for levansucrase which produces a product that is toxic to Gram-negative bacteria when grown on sucrose.
A selectable marker, cat. cat codes for chloramphenicol acetyltransferase and confers resistance to the antibacterial chloramphenicol.
A multiple cloning site (MCS), i.e. a site into which defined genetic constructs may be cloned for introduction into a recipient bacterial cell.
Suicide vector pJCB12 is a modified version of pDM4 in which much of the intergenic and non-functional DNA has been removed. Therefore, there is much less opportunity for incorrect targeting using this suicide vector. Whereas pDM4 is approximately 7 kb in size, pJCB12 is only 3 kb but retains all the key components. In particular, the mobRP4 region of pJCB12 is merely 0.15 kb, and the IS1-like nucleotide sequences have been removed from the sacB region. These modifications are particularly advantageous when manipulating ETEC strains which generally harbour many plasmids that could act as undesirable targets of homologous recombination with components of the suicide vector. In addition, the smaller size of pJCB12 allows easier in vitro manipulation and construction of derivatives because smaller DNA molecules ligate together and transform into E. coli hosts more efficiently, improving the chances of obtaining derivatives of the correct construction. The smaller size also allows greater efficiency when introducing the constructs into recipient bacteria by transformation rather than by conjugation.
Laboratory E. coli strain SM10Νpir can be used to transfer pJCB12 and its derivatives to recipient bacterial strains by conjugation because it has the tra functions from plasmid RP4 inserted into its chromosome. However, strain SM10Νpir shows relatively low transformation frequencies. For this reason, strain DH5ιΝpir would normally be used for the construction of pJCB12 derivatives, and once derivatives of the correct construction have been identified these would be transferred to SM10Νpir for introduction to recipient strains by conjugation.
Construction of Suicide Vector pJCB12
Suicide vector pJCB12 was constructed by several rounds of overlap extension PCR (30, FIG. 13) using pDM4 plasmid DNA as template. Initially, four fragments were amplified from pDM4 by PCR using the high fidelity DNA polymerase, Pfu Turboâ˘. These were the oriR6K fragment, amplified using oligonucleotides 4714 and 4715; the mobRP4 fragment amplified using oligonucleotides 4716 and 4717; and the cat gene that was amplified in two parts using oligonucleotides 4718 with 4719 and 4720 with 4721. This was done in order to remove an EcoRI restriction enzyme site within the cat gene. The oriR6K fragment and the mobRP4 were then joined in an overlap extension PCR reaction using oligonucleotides 4714 and 4717. Likewise, the cat fragments were joined using oligonucleotides 4718 and 4721. These two resulting fragments were then joined in a final overlap extension PCR reaction using oligonucleotides 4717 and 4718. The resulting PCR product was ligated and transformed into SY327Îťpir cells and transformants were selected on L-agar supplemented with chloramphenicol at 20 mg/ml. Transformants harbouring plasmids of the correct size were obtained and one of these, called pDM4A7, was chosen for further manipulation.
At this stage, clearly the oriR6K and cat components of the plasmid pDM4A7 are functional. However, in order to confirm that the mobRP4 locus was functional plasmid pDM4A7 was transformed into strain SM10Îťpir. These transformants were picked onto L-agar supplemented with chloramphenicol at 15 mg/ml and naladixic acid at 5 mg/ml. This L-agar was cross-streaked with cells of strain SY327Îťpir. While chloramphenicol selects those bacterial cells which harbour pDM4A7, nalidixic acid selects for SY327Îťpir. After overnight incubation, many colonies grew where the strains were cross-streaked, but none grew elsewhere on the plate, confirming that pDM4A7 is mobilisable from strain SM101pir and that the mobRP4 locus is functional.
Plasmid pDM4A7 was then digested with EcoRI, treated with Pfu Turbo⢠DNA polymerase and ligated in order to remove the EcoRI restriction enzyme site to generate plasmid pDM4A7DEcoRI. A short HindIII fragment from pDM4 which includes the multiple cloning site was then ligated into pDM4A7DEcoRI digested with HindIII. The ligation reaction was transformed into SY327Νpir and transformants selected on L-agar supplemented with 20 mg/ml chloramphenicol.
Oligonucleotide R6K-01 hybridises within the short HindIII fragment from pDM4 which includes the multiple cloning site. Therefore, transformants were screened by PCR using oligonucleotides R6K-01 and 4720 in order to identify those harbouring the desired plasmid construct. A number of such transformants were identified, and one of these, called pDM4A7DE, was chosen for further manipulation.
Plasmid pDM4A7DE carries three EcoRI sites very close together on the short HindIII fragment from pDM4 which includes the multiple cloning site. The two very short EcoRI fragments of pDM4A7DE were therefore removed by digestion with EcoRI followed by ligation. This resulted in a pDM4A7DE derivative that possess only one EcoRI site which was called pJCB10. The region of pJCB10 that includes oriR6K and the MCS was amplified using oligonucleotides 4715 and 4917 and nucleotide sequence determinations for part of this fragment were performed using oligonucleotide 4917. This presented us with the nucleotide sequence across the MCS which was previously unknown.
The sacB gene was then amplified using Pfu DNA polymerase and oligonucleotides 4722 and 4723. The 1.6 kb product was ligated with the plasmid vector pPCR-Script⢠(Stratagene) and transformed into E. coli XL10 Gold⢠cells (Stratagene). Transformants were obtained and the functionality of the sacB gene was confirmed by plating the clones onto L-agar and 5% sucrose agar. One construct gave good growth on L-agar, and none on 5% sucrose agar, and so was chosen as the source of the sacB gene. The sacB gene was then digested from this clone using the restriction enzyme PstI, sites for which were incorporated into oligonucleotides 4722 and 4723 for this purpose, and ligated with pJCB10 also digested with PstI. Colonies were checked by PCR using oligonucleotides 4716 and 4766, yielding a product of the expected size (Ë1700 bp). Again the functionality of the gene was confirmed by plating the clones onto L-agar and 5% sucrose agar. One construct grew on L-agar, but not on 5% sucrose agar. Sequencing of this construct using oligonucleotides 4716 and 4766 respectively indicated the orientation of the sacB gene. This construct was called pJCB12.
Principle of Use of pJCB12
Once a defined genetic construct has been ligated into pJCB12 to give a pJCB12-derivative, the plasmid is transferred into a recipient strain such as an ETEC strain. This may be done according to methods well known in the art, either by conjugation from the pJCB12 host strain SM10Îťpir, or by transformation of the purified pJCB12-derivative directly into the recipient strain.
Transconjugants or transformants are selected on bacteriological growth medium supplemented with the antibiotic chloramphenicol. Since the suicide vector pJCB12 is unable to replicate in the absence of the pir gene, any transconjugants or transformants that grow will generally have resulted from fusion of the pJCB12-derivative with another replicon by homologous recombination.
In order to optimise fully the defined mutation process, a novel approach may be taken to screen transformants or transconjugants using PCR to identify those in which the pJCB12-derivative has targeted the desired region of the genome. For this, one oligonucleotide is designed which hybridises within the pJCB12 nucleotide sequences adjacent to the MCS where the defined genetic construct has been inserted. The other oligonucleotide is designed to hybridise to the region of the genome to be targeted, adjacent to but outside of the defined genetic construct. Transformants or transconjugants that are positive using this PCR will have the pJCB12-derivative targeted to the correct region of the genome (see FIG. 14).
Once the correct recombinants have been identified, derivatives need to be isolated in which the pJCB12 vector has been lost. Such derivatives may be selected by supplementing the bacteriological growth medium with 5% sucrose. This sucrose selection may be made more efficient using a modified L-medium in which the NaCl ingredient is absent and supplemented with 5% sucrose. Under these conditions the sacB gene of pJCB12 is toxic, and only derivatives where the sacB gene has been lost will grow. This event again occurs by homologous recombination and has a number of outcomes. Firstly, a reversion event will result in the targeted region remaining as it was. Secondly, homologous recombination may result in the defined genetic construct being swapped with the targeted region resulting in the defined construct being incorporated at the target region. In addition, if the targeted region is part of a plasmid, such as many of the toxin genes of ETEC strains, then two additional events may occur. These are, thirdly, an undefined spontaneous deletion event, resulting in the loss of a part of the targeted region which may extend beyond the boundaries of the defined genetic construct, and, fourthly, the loss of the whole plasmid, an event which may be termed âspecific plasmid curingâ.
Testing of sucrose resistant derivatives by PCR can identify the desired recombinants. For this, oligonucleotides that hybridise at each end of the targeted region and outside of the defined genetic construct are used. If the PCR product is the same size as prior to introduction of the pJCB12-derivative construct, then a reversion event has occurred. If, for example the genetically defined construct is a deletion mutation, then the PCR product should be smaller than previously and of a predictable size. Specific plasmid curing and undefined spontaneous deletion will normally result in no PCR product or non-specific products of unexpected size in this type of PCR reaction.
In summary, vector pJCB12 (or another similar vector of the invention) may be used in a method for producing a bacterial cell in which a target gene (e.g. a toxin gene such as ST, LT or EAST1 or a chromosomal gene such as an omp or aro gene) is deleted, inactivated or replaced, which method comprises transferring the vector into a bacterial cell containing the target gene and selecting for a cell in which the target gene has been deleted, inactivated or replaced. The selection may be carried out using a multi-stage procedure along the following lines:
For example, in the present study, in general:
Bacterial Conjugations were performed by mixing donor and recipient ETEC strains on L-agar and incubating at 37° C. for 3 to 18 h. Bacterial growth was scraped off into L-broth and plated onto L-agar plates supplemented with chloramphenicol and another appropriate antibiotic to select ETEC strains (streptomycin for strain B, tetracycline for other ETEC strains) that had incorporated the pJCB12-derivative. For identification of correctly targeted recombinants, transconjugants or transformants obtained by growth on L-agar supplemented with chloramphenicol following introduction of pJCB12-derivative constructs were tested by PCR in order to identify those in which the desired genetic locus had been targeted. For this, one of the oligonucleotides hybridised within the pJCB12 nucleotide sequences adjacent to the multiple cloning site (MCS) where the defined genetic construct had been inserted. The other oligonucleotide hybridised to the genome, adjacent to but outside of the defined genetic construct. In such a PCR, the generation of a fragment indicated that the binding sites for the respective oligonucleotides had become linked, which could occur only if the pJCB12-derivative had targeted the correct region of the genome.
pJCB12 was excised from transconjugants by growth in the presence of 5% sucrose. Transconjugants or transformants having the pJCB12-derivative targeted to the correct region of the genome were then streaked onto fresh L-agar supplemented with chloramphenicol and another appropriate antibiotic to select ETEC strains (see above), and incubated at 37° C. to allow colonies to grow. L-broth cultures inoculated from these fresh plates were then grown. Cells from these cultures were harvested, resuspended in 5% sucrose broth, and incubated overnight prior to plating serial dilutions on 5% sucrose agar in order to select recombinants in which the pJCB12-derivative had excised. The inoculated sucrose agar plates were then incubated overnight and the resulting colonies tested by PCR using relevant oligonucleotides in order to identify mutants.
| TABLE 1 |
| STRAIN CHARACTERISTICS |
| Accession | Antibiotic | ||||||
| Strain | Parent Strain | Number | LPS:flagellin | Resistance | CS Proteins | Regulator | Toxin Genes |
| E1392/75-2A | E1392/75 | N/A | 06:H16 | Strep | CS1 CS3 | ms | None |
| PTL003 | E1392/75-2A | 01090302 | 06:H16 | Strep | CS1 CS3 | ms | None |
| (submitted as | |||||||
| ACM 2005) | |||||||
| ACAM2008 | PTL003 | 02082965 | 06:H16 | None | CS1 CS3 | ms | None |
| WS-2773E | N/A | N/A | 039:H12 | None | CS5 CS6 | ?csvR | ST EAST LT |
| WS-2773E- | WS-2773E | 01090305 | 039:H12 | None | CS5 CS6 | ?csvR | None |
| Tox minus | (submitted as | ||||||
| ACM2002) | |||||||
| ACAM2006 | WS-2773E- | N/A | 039:H12 | None | CS5 CS6 | ?csvR | None |
| Tox minus | |||||||
| ACAM2012* | ACAM2006 | 02082968 | 039:H12 | None | CS5 CS6 | ?csvR | None |
| WS-3504D | N/A | N/A | 0141:H5 | Amp | CS2 CS3 | ms | EAST |
| WS-3504D- | WS-3504D | 01090304 | 0141:H5 | Amp | CS2 CS3 | ms | None |
| Tox minus | (submitted as | ||||||
| ACM 2003) | |||||||
| ACAM2007 | WS-3504D- | 02082964 | 0141:H5 | None | CS2 CS3 | ms | None |
| Tox minus | |||||||
| WS-1858B | N/A | N/A | 071:H- | Amp/Tmp/Smz | CFA/1 | ms | ST EAST |
| WS-1858B- | WS-1858B | N/A | 071:H- | Amp/Tmp/Smz | CFA/1 | ms | None |
| Tox minus | |||||||
| ACAM2010 | WS-1858B- | 02082967 | 071:H- | None | CFA/1 | ms | None |
| Tox minus | |||||||
| WS-2252A | N/A | N/A | 015:H18 | None | CS4 CS6 | cfaD | ST EAST LT |
| WS-2252A- | WS-2252A | 01090306 | 015:H18 | None | CS4 CS6 | cfaD | None |
| Tox minus | (submitted as | ||||||
| ACM2004) | |||||||
| ACAM2009 | WS-2252A- | 02082966 | 015:H18 | None | CS4 CS6 | cfaD | None |
| Tox minus | |||||||
| WS-2511A | N/A | N/A | 04:H- | None | CS4 CS6 | cfaD | ST EAST X 2 |
| Strain K | WS-2511A- | N/A | 04:H- | None | CS6 | cfaD | ST EAST X 2 |
| Tox minus | |||||||
| *ACAM2006 contains a lysogenic phage in its chromosome. ACAM2012 is a derivative of ACAM2006 from which a large part of the genome, including genes critical for phage assembly, have been deleted. |
| TABLE 2 | |||
| CS Antigen | |||
| Strain | Expression | Accession No | Date of Deposit |
| PTL003 | CS1, CS3 | 01090302 | 3 Sep. 2001 |
| or ACM 2005 | |||
| WS-4437A-Tox | CFA/I | 01090303 | 3 Sep. 2001 |
| minus or ACM | |||
| 2001 | |||
| WS-3504D-Tox | CS2, CS3 | 01090304 | 3 Sep. 2001 |
| minus or | |||
| ACM 2003 | |||
| WS-2773E-Tox | CS5, CS6 | 01090305 | 3 Sep. 2001 |
| minus or | |||
| ACM 2002 | |||
| WS-2252A-Tox | CS4, CS6 | 01090306 | 3 Sep. 2001 |
| minus or | |||
| ACM 2004 | |||
| ACAM 2007 | CS2, CS3 | 02082964 | 29 Aug. 2002 |
| ACAM 2008 | CS1, CS3 | 02082965 | 29 Aug. 2002 |
| ACAM 2009 | CS4, CS6 | 02082966 | 29 Aug. 2002 |
| ACAM 2010 | CFA/I | 02082967 | 29 Aug. 2002 |
| ACAM 2012 | CS5, CS6 | 02082968 | 29 Aug. 2002 |
| ACAM 2013 | CS4, CS5, CS6 | 02082969 | 29 Aug. 2002 |
Each of the strains listed in Table 2 was deposited with the European Collection of Cell Cultures (ECACC), CAMR, Salisbury, Wiltshire, SP4 0JG, United Kingdom in accordance with the Budapest Treaty on the date shown therein.
| TABLE 3 | ||||||
| Strain | Code | Phenotype | CFA | LT | ST | EAST1 |
| WS-1858B | A | O71:Hâ | CFA/I | â | + | + |
| WS-4437A | B | O128:H12 | CFA/I | â | + | â |
| WS-6117A | C | O153:H45 | CFA/I | â | + | + |
| WS-2560B | D | O25:Hâ | CS4, CS6 | + | + | + |
| WS-2773E | E | O39:H12 | CS5, CS6 | + | + | + |
| WS-4150D | F | O6:H16 | CS2, CS3 | + | â | ? |
| WS-6170A | G | O17:H18 | CS2, CS3 | â | + | ? |
| WS-3504D | H | O141:H5 | CS2, CS3 | + | + | + |
| WS-3517A | I | O6:Hâ | CS2, CS3 | â | + | + |
| WS-2252A | J | O15:H18 | CS4, CS6 | + | + | + |
| WS-2511A | K | O4:Hâ | CS4, CS6 | â | + | + |
| WS-2556A | L | O6:H1 | CS4, CS6 | â | + | + |
| WS-4046A | M | O39:Hâ | None | + | â | N.D. |
| identified | ||||||
| TABLEâ4 |
| OLIGONUCLEOTIDESâUSED |
| Name | Nucleotideâsequence | Targetâlocus;âuse |
| 47151 | 5ⲠCCGGTCGACCTTATTGAGGAATATCGG | CloningâcsaAâ(upâtoâBglllâsite).âBindsâ200âbp |
| (SEQâINâNO:â12) | upstream. | |
| 47152 | 5ⲠGGCGCATGCAGATCTGATTAGAGC | CloningâcsaAâ(upâtoâBglllâsite).âIncludes |
| (SEQâINâNO:â13) | Bglllâ&âSphlâsites. | |
| 47150 | 5ⲠGGCGCATGCCGGAATTCCATTTGAGACTCCC | Checkingâorientationâofâ3ⲠregionâofâCS4 |
| (SEQâINâNO:â14) | operonâinâplasmidâpACYC-CS4. | |
| RNS-03 | 5ⲠACATCATAGCGATGGCATCAA | CloningâtheârnsâgeneâfromâE1392/75-2A.âBinds |
| (SEQâINâNO:â15) | upstreamâofâtheâgene | |
| RNS-04 | 5ⲠTATTTCAATTCAGTTCGCATCGC | CloningâtheârnsâgeneâfromâE1392/75-2A.âBinds |
| (SEQâINâNO:â16) | downstreamâofâtheâgene. | |
| 47173 | 5ⲠGACGGATCCGAATGCGAGGCATCCGGTTG | Forwardâprimerâforâamplifyingâupstreamâregion |
| (SEQâINâNO:â17) | ofâompC.âIncludesâBamHIâsite. | |
| 47174 | 5ⲠTTCCTCAATAAGCTCTGTTATATGCCTTTATâTTGC | Reverseâprimerâforâamplifyingâupstreamâregion |
| (SEQâINâNO:â18) | ofâompC.âIncludesâcsaAâoverlap. | |
| 47177 | 5ⲠTCTAATCAGATCTCGACAACCAGTTCACTCGTG | Forwardâprimerâforâamplifyingâdownstream |
| (SEQâINâNO:â21) | regionâofâompC.âIncludesâcsaAâoverlap. | |
| 47178 | 5ⲠGGTGGATCCGTTAAAGCGCATCAGCGCGG | Reverseâprimerâforâamplifyingâdownstream |
| (SEQâINâNO:â22) | regionâofâompC.âIncludesâBamHIâsite. | |
| 47175 | 5ⲠTATAACAGAGCTTATTGAGGAATATCGGTGTC | ForwardâprimerâforâamplifyingâcsaA.âIncludes |
| (SEQâINâNO:â19) | ompCâoverlap. | |
| 47176 | 5ⲠTGGTTGTCGAGATCTGATTAGAGCCGCATA | ReverseâprimerâforâamplifyingâcsaA.âIncludes |
| (SEQâINâNO:â20) | ompCâoverlap. | |
| 47180 | 5ⲠCCGTCCTGTGGATCCTCTACGCCGG | ConstructionâofâpACYCâXmal.âBindsâacrossâthe |
| (SEQâINâNO:â23) | BamHIâsite. | |
| 47182 | 5ⲠATCGGTCGACGCTCTCCCGGGTGCGACTCC | ConstructionâofâpACYCâXmal.âBindsâacrossâthe |
| (SEQâINâNO:â24) | Sallâsite.âIntroducesâXmal. | |
| 4732 | 5ⲠGTACAAATAACCTACAAAAAGCCC | CS4âchromosomeâlinkage/CS4âretainedâinâompC |
| (SEQâINâNO:â25) | locus. | |
| 47105 | 5ⲠTAACGCCTGCTCTAACATTCCC | CS4âchromosomeâlinkage/CS4âretainedâinâompC |
| (SEQâINâNO:â26) | locus. | |
| 47168 | 5ⲠCGTTATGCAGGAATAATTACG | ConfirmâpresenceâofâCS5âinâpACYC-CS5. |
| (SEQâINâNO:â27) | ||
| 47167 | 5ⲠCGTATTTTTATCAACCTTAGC | ConfirmâpresenceâofâCS5âinâpACYC-CS5. |
| (SEQâINâNO:â28) | ||
| 4714 | 5ⲠTTCAACCTTAAAAGCTTTAAAAGCCT | oriR6K;âconstructionâofâpJCB12 |
| (SEQâINâNO:â29) | ||
| 4715 | 5ⲠCTACACGAACTCTGAAGATCAGCAGTTCAACC | oriR6K;âconstructionâofâpJCB12 |
| (SEQâINâNO:â30) | ||
| 4716 | 5ⲠGATCTTCAGAGTTCGTGTAGACTTTCCTTGG | mobRP4;âconstructionâofâpJCB12 |
| (SEQâINâNO:â31) | ||
| 4717 | 5ⲠGCCACTGCAGCCTCGCAGAGCAGGATTC | mobRP4;âconstructionâofâpJCB12 |
| (SEQâINâNO:â32) | ||
| 4718 | 5ⲠGGCACTGCAGGCGTAGCACCAGGCGTTT | cat;âconstructionâofâpJCB12 |
| (SEQâINâNO:â33) | ||
| 4719 | 5ⲠTCATCCGGAGTTCCGTATGGCAAT | cat;âconstructionâofâpJCB12 |
| (SEQâINâNO:â34) | ||
| 4720 | 5ⲠTGCCATACGGAACTCCGGATGAG | cat;âconstructionâofâpJCB12 |
| (SEQâINâNO:â35) | ||
| 4721 | 5ⲠGCTTTTAAAGCTTTTAAGGTTGAATTCGATCGGCACGTAAGAGGTTC | cat;âconstructionâofâpJCB12 |
| (SEQâINâNO:â36) | ||
| 4722 | 5ⲠGGCCTGCAGGCAAGACCTAAAATGTG | sacB;âconstructionâofâpJCB12 |
| (SEQâINâNO:â37) | ||
| 4723 | 5ⲠGCGCTGCAGCTTTATGTTGATAAGAAA | sacB;âconstructionâofâpJCB12 |
| (SEQâINâNO:â38) | ||
| 4766 | 5ⲠCAACAGTACTGCGATGAGTGG | cat;ânucleotideâsequenceâdeterminationsâinto |
| (SEQâINâNO:â39) | sacB | |
| 4917 | 5ⲠATCAACGGTGGTATATCCAGT | catâofâpJCB12;âconfirmationâofâlinkage. |
| (SEQâINâNO:â40) | ||
| R6K-01 | 5ⲠGTGACACAGGAACACTTAACGGC | oriR6K;âconfirmationâofâlinkage |
| (SEQâINâNO:â41) | ||
The sequences shown in Table 4 are SEQ ID NOS: 12 to 41, respectively.
| TABLE 5 |
| GENBANK ACCESSION NUMBERS FOR SEQUENCE DATA |
| EAST1 (astA) | AF143819 | |
| ST (estA) | M18346 | |
| LT-A (eltA) | V00275 | |
| LT-B (eltB) | M17874 | |
| CFA/I operon | M55661 | |
| CS1 operon | M58550 | |
| X62495 | ||
| X76908 | ||
| CS2 operon | Z47800 | |
| CS3 operon | X16944 | |
| CS4 operon | AF296132 | |
| CS5 operon | AJ224079 | |
| CS6 operon | U04844 | |
| cfaD | M55609 | |
| csvR | X60106 | |
| rns | J04166 | |
| parDE RK2 | L05507 | |
| sacB | X02730 | |
| oriR6K | M65025 | |
| mobRP4 | X54459 | |
| cat | V00622 | |
1. Aitken and Hirst (1993) Vaccine 11(2), 227-233.
2. Ausubel et al; Current Protocols in Molecular Biology. 1995: John Wiley & Sons Inc.
3. Burkardt, H. J., G. Riess, and A. Puhler, Relationship of group P1 plasmids revealed by heteroduplex experiments: RP1, RP4, R68 and RK2 are identical. J Gen Microbiol, 1979. 114(2): p. 341-8.
4. Chatfield WO 99/49026
5. Chang A. C. and Cohen S. N. (1978) Journal of Bacteriology 134(3): 1141-1156
6. Charles WO92/15689
7. Chong et al (1998) Vaccine 16, 732-740.
8. Cieplak et al (1995) Journal of Biol. Chem. 270(51), 30545-30550.
9. Clements (1990) Infect. & Immun. 58(5), 1159-1166.
10. Cravioto, A. 1980, PhD Thesis, University of London, London, United Kingdom.
11. de Haan L. A., Willshaw, G. A., Van der Zeijst B. A. and Gaastra W. (1991) FEMS Microbiol Lett 67 (3): 341-346
12. Donnenberg, M. S. and J. B. Kaper, Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect Immun, 1991. 59(12): p. 4310-7.
13. Dunstan, S., Simmons, C. and Strugnell, R. Use of in-vivo regulated promoters to deliver antigens from attenuated Salmonella typhimurium. Infection and Immunity (1999) 67, 5133-5141.
14. Duthy T. G., Staendner L. H., Manning P. A. and Heuzenroeder M. W., (1999) Journal of Bacteriology 181 (18): 5847-5851.
15. Duthy et al (2001) Microbial Pathogenesis 31: p 115-129
16. Everest, P., et al., Expression of LacZ from the htrA, nirB and groE promoters in a Salmonella vaccine strain: influence of growth in mammalian cells. FEMS Microbiol Lett, 1995. 126(1): p. 97-101.
17. Froehlich, B. J., A. Karakashian, H. Sakellario and J. R. Scott, Genes for CS2 Pili of Enterotoxigenic Escherichia coli and their Interchangeability with those for CS1 Pili. Infection and Immunity, 1995 63(12): p. 4849-4856.
18. Gerdes, K., P. B. Rasmussen, and S. Molin, Unique type of plasmid maintenance function: post segregational killing of plasmid-free cells. Proc Natl Acad Sci USA, 1986. 83(10): p. 3116-20.
19. Gerdes, K., et al., The hok killer gene family in gram-negative bacteria. New Biol, 1990. 2(11): p. 946-56.
20. Jalajakumari M. B. et al (1989) Molecular Microbiology 3(12): 1685-1695.
21. Kolter R. et al (1978) Cell 15: 1199-1208.
22. Laemmli, U. K., Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 1970. 227(259): p. 680-5.
23. Miller, V. L. and J. J. Mekalanos, Synthesis of cholera toxin is positively regulated at the transcriptional level by toxR. Proc Natl Acad Sci USA, 1984. 81(11): p. 3471-5.
24. Milton, D. L., et al., Flagellin A is essential for the virulence of Vibrio anguillarum. J Bacteriol, 1996. 178(5): p. 1310-9.
25. Roberts, R. C., A. R. Strom, and D. R. Helinski, The parDE operon of the broad-host-range plasmid RK2 specifies growth inhibition associated with plasmid loss. J Mol Biol, 1994. 237(1): p. 35-51.
26. Sambrook, J., E. F. Fritsch; and T. Maniatis, Molecular cloning: a laboratory manual. 2nd ed. 1989: Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
27. Scott J. R. et al (1992) Molecular Microbiology 6(3): 293-300
28. Simon, R., U. Priefer, and A. Puhler, A broad host range mobilisation system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology, 1983. 1: p. 784-791.
29. Summers et al, Mol. Genet. Genes., 201(2): 334-338.
30. Tao, B. Y. and K. C. P. Lee, Mutagenesis by PCR, in PCR Technology: current innovations, H. G. Griffin and A. M. Griffin, Editors. 1994, CRC Press, Inc.: Boca Raton, Fla. p. 69-83.
31. Turner, A. K., et al., Construction and characterization of genetically defined aro omp mutants of enterotoxigenic Escherichia coli and preliminary studies of safety and immunogenicity in humans. Infect. Immun., 2001. 69(8): p. 4969-79.
32. Valdivia, R. and Falkow, S. Fluorescence-based isolation of bacterial genes expressed within host cells. Science (1997), 277, 2007-2011.
33. Willshaw G. A. et al (1988) Fems Microbiol Lett 49: 473-478
34. Wolf, M. K. Occurrence, Distribution and Association of O and H Serogroups, Colonisation Factor Antigens and Toxins of Enterotoxigenic Escherichia coli. Clinical Microbiology Reviews, 1997 10 (4): p 569-584.
35. Wolf M. K. et al (1997) Fems Microbiol Lett 148(1): 35-42.
1. An essentially purified and isolated enterotoxigenic E. coli (ETEC) cell which expresses coli surface antigens CS1, CS2 and CS3 and is attenuated by deletion or inactivation of ompC.
2. An ETEC cell according to claim 1 which is further attenuated by deletion or inactivation of each of aroC and ompF.
3. An ETEC cell according to claim 1 which does not express one or more of heat stable toxin (ST), heat labile toxin (LT) and EAST 1.
4. An ETEC cell according to claim 3 which is obtainable by a method comprising site-directed deletion of the whole of the LT gene and/or the whole of the EAST 1 gene.
5. An ETEC cell according to claim 1 which does not express an antibiotic resistance gene.
6. An ETEC cell according to claim 1 which further expresses a heterologous antigen in addition to the CS antigens.
7. An ETEC cell according to claim 6 wherein the heterologous antigen is an E. coli antigen.
8. An ETEC cell according to claim 6 wherein the heterologous antigen is a non-toxic component or form of LT.
9. An ETEC cell according to claim 8 wherein the non-toxic component of LT is the B subunit.
10. An ETEC cell according to claim 1 which is obtainable by a method comprising introduction of a polynucleotide encoding a heterologous CS1 antigen into an ETEC cell that expresses CS2 and CS3.
11. An ETEC cell according to claim 10 wherein the polynucleotide comprises the operon of the heterologous CS1 antigen.
12. An ETEC cell according to claim 10 wherein the heterologous CS1 antigen coding sequence is carried on a stable plasmid in the cell.
13. An ETEC cell according to claim 10 wherein the heterologous CS1 antigen coding sequence is inserted in the bacterial chromosome of the cell.
14. A method for making an ETEC cell according to claim 1, which comprises introducing a polynucleotide encoding ETEC CS1 antigen into a CS2- and CS3-expressing ETEC cell.
15. A method according to claim 14 wherein the polynucleotide comprises the operon of the CS1 antigen.