-
2010-07-20
10/604,984
2003-08-29
US 7,759,478 B1
2010-07-20
-
-
Tracy Vivlemore
2024-12-25
The present invention relates to a group of novel viral RNA regulatory genes, here identified as “viral genomic address messenger genes” or “VGAM genes”, and as “genomic record” or “GR” genes. VGAM genes selectively inhibit translation of known host target genes, and are believed to represent a novel pervasive viral attack mechanism. GR genes encode an operon-like cluster of VGAM genes. VGAM and viral GR genes may therefore be useful in diagnosing, preventing and treating viral disease. Several nucleic acid molecules are provided respectively encoding several VGAM genes, as are vectors and probes, both comprising the nucleic acid molecules, and methods and systems for detecting VGAM genes, and for counteracting their activity.
Get notified when new applications in this technology area are published.
C07H21/04 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
A61K31/70 IPC
Medicinal preparations containing organic active ingredients Carbohydrates; Sugars; Derivatives thereof
1. Field of the Invention
The present invention relates to a group of bioinformatically detectable novel viral RNA regulatory genes, here identified as “viral genomic address messenger” or “VGAM” genes.
2. Description of Prior Art
Small RNAs are known to perform diverse cellular functions, including post-transcriptional gene expression regulation. The first two such RNA genes, Lin-4 and Let-7, were identified by genetic analysis of Caenorhabditis Elegans (Elegans) developmental timing, and were termed short temporal RNA (stRNA) (Wightman, B., Ha, I., Ruvkun, G., Cell 75, 855 (1993); Erdmann, V. A. et al., Nucleic Acids Res. 29, 189 (2001); Lee, R. C., Feinbaum, R. L., Ambros, V., Cell 75, 843 (1993); Reinhart, B. et al., Nature 403, 901 (2000)).
Lin-4 and Let-7 each transcribe a ˜22 nucleotide (nt) RNA, which acts a post transcriptional repressor of target mRNAs, by binding to elements in the 3″-untranslated region (UTR) of these target mRNAs, which are complementary to the 22 nt sequence of Lin-4 and Let-7 respectively. While Lin-4 and Let-7 are expressed at different developmental stage, first larval stage and fourth larval stage respectively, both specify the temporal progression of cell fates, by triggering post-transcriptional control over other genes (Wightman, B., Ha, I., Ruvkun, G., Cell 75, 855 (1993); Slack et al., Mol. Cell 5, 659 (2000)). Let-7 as well as its temporal regulation have been demonstrated to be conserved in all major groups of bilaterally symmetrical animals, from nematodes, through flies to humans (Pasquinelli, A., et al. Nature 408, 86 (2000)).
The initial transcription product of Lin-4 and Let-7 is a ˜60-80 nt RNA, the nucleotide sequence of the first half of which is partially complementary to that of its second half, therefore allowing this RNA to fold onto itself, forming a “hairpin structure”. The final gene product is a ˜22 nt RNA, which is “diced” from the above mentioned “hairpin structure”, by an enzyme called Dicer, which also apparently also mediates the complementary binding of this ˜22 nt segment to a binding site in the 3″ UTR of its target gene.
Recent studies have uncovered 93 new genes in this class, now referred to as micro RNA or miRNA genes, in genomes of Elegans, Drosophilea, and Human (Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T., Science 294, 853 (2001); Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P., Science 294, 858 (2001); Lee, R. C., Ambros, V., Science 294, 862 (2001). Like the well studied Lin-4 and Let-7, all newly found MIR genes produce a ˜60-80 nt RNA having a nucleotide sequence capable of forming a “hairpin structure”. Expressions of the precursor ˜60-80 nt RNA and of the resulting diced ˜22 nt RNA of most of these newly discovered MIR genes have been detected.
Based on the striking homology of the newly discovered MIR genes to their well-studied predecessors Lin-4 and Let-7, the new MIR genes are believed to have a similar basic function as that of Lin-4 and Let-7: modulation of target genes by complementary binding to the UTR of these target genes, with special emphasis on modulation of developmental control processes. This is despite the fact that the above mentioned recent studies did not find target genes to which the newly discovered MIR genes complementarily bind. While existing evidence suggests that the number of regulatory RNA genes “may turn out to be very large, numbering in the hundreds or even thousands in each genome”, detecting such genes is challenging (Ruvkun G., “Perspective: Glimpses of a tiny RNA world”, Science 294, 779 (2001)).
The ability to detect novel RNA genes is limited by the methodologies used to detect such genes. All RNA genes identified so far either present a visibly discernable whole body phenotype, as do Lin-4 and Let-7 (Wightman et. al., Cell 75, 855 (1993); Reinhart et al., Nature 403, 901 (2000)), or produce significant enough quantities of RNA so as to be detected by the standard biochemical genomic techniques, as do the 93 recently detected miRNA genes. Since a limited number clones were sequenced by the researchers discovering these genes, 300 by Bartel and 100 by Tuschl (Bartel et. al., Science 294, 858 (2001); Tuschl et. al., Science 294, 853 (2001)), the RNA genes found can not be much rarer than 1% of all RNA genes. The recently detected miRNA genes therefore represent the more prevalent among the miRNA gene family.
Current methodology has therefore been unable to detect RNA genes which either do not present a visually discernable whole body phenotype, or are rare (e.g. rarer than 0.1% of all RNA genes), and therefore do not produce significant enough quantities of RNA so as to be detected by standard biochemical technique. To date, miRNA have not been detected in viruses.
The present invention is directed to an isolated nucleic acid wherein the sequence of the nucleic acid consists of the sequence of SEQ ID NO: 1917, or the complement of SEQ ID NO: 1917 or the RNA equivalent of SEQ ID NO: 1917, wherein the complement is identical in length to the nucleic acid of (a) or (b). SEQ ID NO: 1917 is the viral hairpin sequence of the Viral Genomic Address Messenger 1931.
The present invention is also directed to an isolated nucleic acid wherein the sequence of the nucleic acid consists of the sequence of SEQ ID NO: 4642, an RNA equivalent of SEQ ID NO: 4642, or the complement of SEQ ID NO: 4642 or the RNA equivalent of SEQ ID NO: 4642, wherein the complement is identical in length to the nucleic acid of (a) or (b). SEQ ID NO: 4642 is the viral miR of the viral hairpin sequence as set forth in SEQ ID NO: 1917 of the Viral Genomic Address Messenger 1931 (VGAM1931) and modulates expression of host target genes thereof wherein the function and utility of the host genes is known in the art.
The present invention is also directed to a vector comprising the nucleic acid wherein the sequence of the nucleic acid consists of the sequence of SEQ ID NO: 4642, an RNA equivalent of SEQ ID NO: 4642, or the complement of SEQ ID NO: 4642 or the RNA equivalent of SEQ ID NO: 4642, wherein the complement is identical in length to the nucleic acid of (a) or (b). The present invention is also directed to a vector comprising the nucleic acid wherein the sequence of the nucleic acid consists of the sequence of SEQ ID NO: 1917, an RNA equivalent of SEQ ID NO: 1917, or the complement of SEQ ID NO: 1917 or the RNA equivalent of SEQ ID NO: 1917, wherein the complement is identical in length to the nucleic acid of (a) or (b).
The present invention is also directed to an isolated nucleic acid wherein the sequence of the nucleic acid consists of the sequence of SEQ ID NO: 4642, an RNA equivalent of SEQ ID NO: 4642, or the complement of SEQ ID NO: 4642 or the RNA equivalent of SEQ ID NO: 4642, wherein the complement is identical in length to the nucleic acid of (a) or (b). SEQ ID NO: 4642 is the viral miR of the viral hairpin sequence as set forth in SEQ ID NO: 1917 of the Viral Genomic Address Messenger 1931 (VGAM1931) and modulates expression of host target genes thereof wherein the function and utility of the host genes is known in the art.
The present invention is also directed to a probe comprising the nucleic acid wherein the sequence of the nucleic acid consists of the sequence of SEQ ID NO: 4642, an RNA equivalent of SEQ ID NO: 4642, or the complement of SEQ ID NO: 4642 or the RNA equivalent of SEQ ID NO: 4642, wherein the complement is identical in length to the nucleic acid of (a) or (b). The present invention is also directed to a probe comprising the nucleic acid wherein the sequence of the nucleic acid consists of the sequence of SEQ ID NO: 1917, an RNA equivalent of SEQ ID NO: 1917, or the complement of SEQ ID NO: 1917 or the RNA equivalent of SEQ ID NO: 1917, wherein the complement is identical in length to the nucleic acid of (a) or (b).
Reference is now made to FIG. 1, which is a simplified diagram describing each of a plurality of novel bioinformatically detected viral genes of the present invention, referred to here as Viral Genomic Address Messenger (VGAM) viral genes, which modulates expression of respective host target genes thereof, the function and utility of which host target genes is known in the art. VGAM is a novel bioinformatically detected regulatory, non protein coding, viral micro RNA (miRNA) gene. The method by which VGAM was detected is described hereinabove with reference to FIGS. 2-8. VGAM GENE is a viral gene contained in the genome of a virus. VGAM HOST TARGET GENE is a human gene contained in the human genome. VGAM GENE encodes a VGAM PRECURSOR RNA. Similar to other miRNA genes, and unlike most ordinary genes, VGAM PRECURSOR RNA does not encode a protein. VGAM PRECURSOR RNA folds onto itself, forming VGAM FOLDED PRECURSOR RNA, which has a two-dimensional ‘hairpin structure’. As is well known in the art, this ‘hairpin structure’, is typical of RNA encoded by miRNA genes, and is due to the fact that the nucleotide sequence of the first half of the RNA encoded by a miRNA gene is an accurate or partial inversed-reversed sequence of the nucleotide sequence of the second half thereof. By “inversed-reversed” is meant a sequence which is reversed and wherein each nucleotide is replaced by a complementary nucleotide, as is well known in the art (e.g. ATGGC is the inversed-reversed sequence of GCCAT). An enzyme complex designated DICER COMPLEX, ‘dices’ the VGAM FOLDED PRECURSOR RNA into VGAM RNA, a single stranded ˜22 nt long RNA segment. As is known in the art, ‘dicing’ of a hairpin structured RNA precursor product into a short ˜22 nt RNA segment is catalyzed by an enzyme complex comprising an enzyme called Dicer together with other necessary proteins. VGAM HOST TARGET GENE encodes a corresponding messenger RNA, VGAM HOST TARGET RNA. VGAM HOST TARGET RNA comprises three regions, as is typical of mRNA of a protein coding gene: a 5′ untranslated region, a protein coding region and a 3′ untranslated region, designated 5′UTR, PROTEIN CODING and 3′UTR respectively. VGAM RNA binds complementarily to one or more host target binding sites located in untranslated regions of VGAM HOST TARGET RNA. This complementary binding is due to the fact that the nucleotide sequence of VGAM RNA is an accurate or a partial inversed-reversed sequence of the nucleotide sequence of each of the host target binding sites. As an illustration, FIG. 1 shows 3 such host target binding sites, designated BINDING SITE I, BINDING SITE II and BINDING SITE III respectively. It is appreciated that the number of host target binding sites shown in FIG. 1 is meant as an illustration only, and is not meant to be limiting—VGAM RNA may have a different number of host target binding sites in untranslated regions of a VGAM HOST TARGET RNA. It is further appreciated that while FIG. 1 depicts host target binding sites in the 3′UTR region, this is meant as an example only—these host target binding sites may be located in the 3′UTR region, the 5′UTR region, or in both 3′UTR and 5′UTR regions. The complementary binding of VGAM RNA to host target binding sites on VGAM HOST TARGET RNA, such as BINDING SITE I, BINDING SITE II and BINDING SITE III, inhibits translation of VGAM HOST TARGET RNA into VGAM HOST TARGET PROTEIN. VGAM HOST TARGET PROTEIN is therefore outlined by a broken line. It is appreciated that VGAM HOST TARGET GENE in fact represents a plurality of VGAM host target genes. The mRNA of each one of this plurality of VGAM host target genes comprises one or more host target binding sites, each having a nucleotide sequence which is at least partly complementary to VGAM RNA, and which when bound by VGAM RNA causes inhibition of translation of respective one or more VGAM host target proteins. It is further appreciated by one skilled in the art that the mode of translational inhibition illustrated by FIG. 1 with specific reference to translational inhibition exerted by VGAM GENE on one or more VGAM HOST TARGET GENE, is in fact common to other known non-viral miRNA genes. As mentioned hereinabove with reference to the background section, although a specific complementary binding site has been demonstrated only for some of the known miRNA genes (primarily Lin-4 and Let-7), all other recently discovered miRNA genes are also believed by those skilled in the art to modulate expression of other genes by complementary binding, although specific complementary binding sites of these other miRNA genes have not yet been found (Ruvkun G., ‘Perspective: Glimpses of a tiny RNA world’, Science 294, 779 (2001)). It is yet further appreciated that a function of VGAM is inhibition of expression of host target genes, as part of a novel viral mechanism of attacking a host. Accordingly, utilities of VGAM include diagnosis, prevention and treatment of viral infection by a virus. Specific functions, and accordingly utilities, of VGAM correlate with, and may be deduced from, the identity of the host target genes which VGAM binds and inhibits, and the function of these host target genes, as elaborated hereinbelow. Nucleotide sequences of the VGAM PRECURSOR RNA, and of the ‘diced’ VGAM RNA, and a schematic representation of the secondary folding of VGAM FOLDED PRECURSOR RNA of each of the plurality of VGAM GENEs described by FIG. 1 are further described hereinbelow with reference to Table 1. Nucleotide sequences of host target binding sites, such as BINDING SITE-I, BINDING SITE-II and BINDING SITE-III of FIG. 1, found on, and schematic representation of the complementarity of each of these host target binding sites to VGAM RNA are described hereinbelow with reference to Table 2.;
FIG. 2 is a simplified block diagram illustrating a bioinformatic gene detection system capable of detecting genes of the novel group of genes of the present invention, which system is constructed and operative in accordance with a preferred embodiment of the present invention;
FIG. 3 is a simplified flowchart illustrating operation of a mechanism for training of a computer system to recognize the novel genes of the present invention, which mechanism is constructed and operative in accordance with a preferred embodiment of the present invention;
FIG. 4A is a simplified block diagram of a non-coding genomic sequence detector constructed and operative in accordance with a preferred embodiment of the present invention;
FIG. 4B is a simplified flowchart illustrating operation of a non-coding genomic sequence detector constructed and operative in accordance with a preferred embodiment of the present invention;
FIG. 5A is a simplified block diagram of a hairpin detector constructed and operative in accordance with a preferred embodiment of the present invention;
FIG. 5B is a simplified flowchart illustrating operation of a hairpin detector constructed and operative in accordance with a preferred embodiment of the present invention;
FIG. 6A is a simplified block diagram of a dicer-cut location detector constructed and operative in accordance with a preferred embodiment of the present invention;
FIG. 6B is a simplified flowchart illustrating training of a dicer-cut location detector constructed and operative in accordance with a preferred embodiment of the present invention; FIG. 6C is a simplified flowchart illustrating prediction of a viral genomic address messenger.
FIG. 7A is a simplified block diagram of a target-gene binding-site detector constructed and operative in accordance with a preferred embodiment of the present invention;
FIG. 7B is a simplified flowchart illustrating operation of a target-gene binding-site detector constructed and operative in accordance with a preferred embodiment of the present invention;
FIG. 8 is a simplified flowchart illustrating operation of a function & utility analyzer constructed and operative in accordance with a preferred embodiment of the present invention;
Reference is now made to FIG. 9, which is a simplified diagram describing each of a plurality of novel bioinformatically detected regulatory viral genes, referred to here as Viral Genomic Record(VGR) viral genes, which encodes an ‘operon-like’ cluster of novel viral micro RNA-like genes, each of which in turn modulates expression of at least one host target gene, the function and utility of which at least one host target gene is known in the art. VGR GENE is a novel bioinformatically detected regulatory, non protein coding, RNA viral gene. The method by which VGR GENE was detected is described hereinabove with reference to FIGS. 6-15. VGR GENE encodes VGR PRECURSOR RNA, an RNA molecule, typically several hundred nucleotides long. VGR PRECURSOR RNA folds spatially, forming VGR FOLDED PRECURSOR RNA. It is appreciated that VGR FOLDED PRECURSOR RNA comprises a plurality of what is known in the art as ‘hairpin’ structures. These ‘hairpin’ structures are due to the fact that the nucleotide sequence of VGR PRECURSOR RNA comprises a plurality of segments, the first half of each such segment having a nucleotide sequence which is at least a partial inversed-reversed sequence of the second half thereof, as is well known in the art. VGR FOLDED PRECURSOR RNA is naturally processed by cellular enzymatic activity into a plurality of separate VGAM precursor RNAs, schematically represented by VGAM1 PRECURSOR, VGAM2 PRECURSOR, VGAM3 PRECURSOR, VGAM4 PRECURSOR, VGAM5 PRECURSOR, VGAM6 PRECURSOR, VGAM7 PRECURSOR and VGAM8 PRECURSOR, each of which VGAM precursor RNAs being a hairpin shaped RNA segment, corresponding to VGAM PRECURSOR RNA of FIG. 8. The above mentioned VGAM precursor RNAs are diced by DICER COMPLEX of FIG. 8, yielding respective short RNA segments of about 22 nucleotides in length, schematically represented as VGAM1 RNA, VGAM2 RNA, VGAM3 RNA, VGAM4 RNA, VGAM5 RNA, VGAM6 RNA, VGAM7 RNA and VGAM8 RNA respectively, each of which VGAM RNAs corresponding to VGAM RNA of FIG. 8. VGAM1 RNA binds complimentarily to a host target binding site located in an untranslated region of VGAM1 HOST TARGET RNA, which host target binding site corresponds to a host target binding site such as BINDING SITE I, BINDING SITE II or BINDING SITE III of FIG. 10, thereby inhibiting translation of VGAM1 HOST TARGET RNA into VGAM1 HOST TARGET PROTEIN, both of FIG. 10. VGAM2 RNA binds complimentarily to a host target binding site located in an untranslated region of VGAM2 HOST TARGET RNA, which host target binding site corresponds to a host target binding site such as BINDING SITE I, BINDING SITE II or BINDING SITE III of FIG. 10, thereby inhibiting translation of VGAM2 HOST TARGET RNA into VGAM2 HOST TARGET PROTEIN, both of FIG. 10. VGAM3 RNA binds complimentarily to a host target binding site located in an untranslated region of VGAM3 HOST TARGET RNA, which host target binding site corresponds to a host target binding site such as BINDING SITE I, BINDING SITE II or BINDING SITE III of FIG. 10, thereby inhibiting translation of VGAM3 HOST TARGET RNA into VGAM3 HOST TARGET PROTEIN, both of FIG. 10. VGAM4 RNA binds complimentarily to a host target binding site located in an untranslated region of VGAM4 HOST TARGET RNA, which host target binding site corresponds to a host target binding site such as BINDING SITE I, BINDING SITE II or BINDING SITE III of FIG. 10, thereby inhibiting translation of VGAM4 HOST TARGET RNA into VGAM4 HOST TARGET PROTEIN, both of FIG. 10. VGAM5 RNA binds complimentarily to a host target binding site located in an untranslated region of VGAM5 HOST TARGET RNA, which host target binding site corresponds to a host target binding site such as BINDING SITE I, BINDING SITE II or BINDING SITE III of FIG. 10, thereby inhibiting translation of VGAM5 HOST TARGET RNA into VGAM5 HOST TARGET PROTEIN, both of FIG. 10. VGAM6 RNA binds complimentarily to a host target binding site located in an untranslated region of VGAM6 HOST TARGET RNA, which host target binding site corresponds to a host target binding site such as BINDING SITE I, BINDING SITE II or BINDING SITE III of FIG. 10, thereby inhibiting translation of VGAM6 HOST TARGET RNA into VGAM6 HOST TARGET PROTEIN, both of FIG. 10. VGAM7 RNA binds complimentarily to a host target binding site located in an untranslated region of VGAM7 HOST TARGET RNA, which host target binding site corresponds to a host target binding site such as BINDING SITE I, BINDING SITE II or BINDING SITE III of FIG. 10, thereby inhibiting translation of VGAM7 HOST TARGET RNA into VGAM7 HOST TARGET PROTEIN, both of FIG. 10. VGAM8 RNA binds complimentarily to a host target binding site located in an untranslated region of VGAM8 HOST TARGET RNA, which host target binding site corresponds to a host target binding site such as BINDING SITE I, BINDING SITE II or BINDING SITE III of FIG. 10, thereby inhibiting translation of VGAM8 HOST TARGET RNA into VGAM8 HOST TARGET PROTEIN, both of FIG. 10. It is appreciated that a function of VGR GENE is inhibition of expression of host target genes, as part of a novel viral mechanism of attacking a host. Accordingly, utilities of VGR GENE include diagnosis, prevention and treatment of viral infection by a virus. Specific functions, and accordingly utilities, of VGR GENE correlate with, and may be deduced from, the identity of the host target genes, which are inhibited by VGAM RNAs comprised in the ‘operon-like’ cluster of VGR GENE, schematically represented by VGAM1 HOST TARGET PROTEIN through VGAM8 HOST TARGET PROTEIN.
FIG. 10 is a block diagram illustrating different utilities of genes of a novel group of genes, and operons of a novel group of operons, both of the present invention;
FIGS. 11A and 11B are simplified diagrams, which when taken together illustrate a mode of gene therapy applicable to genes of the novel group of genes of the present invention;
FIG. 12A is an annotated sequence of EST72223 comprising novel gene GAM24 detected by the gene detection system of the present invention;
FIGS. 12B and 12C are pictures of laboratory results, which when taken together demonstrate laboratory confirmation of expression of the bioinformatically detected novel gene GAM24 of FIG. 12A;
FIG. 12D provides pictures of laboratory results, which when taken together demonstrate further laboratory confirmation of expression of the bioinformatically detected novel gene GAM24 of FIG. 12A;
FIG. 13A is an annotated sequence of an EST7929020 comprising novel genes GAM23 and GAM25 detected by the gene detection system of the present invention;
FIG. 13B is a picture of laboratory results, which confirm expression of bioinformatically detected novel genes GAM23 and GAM25 of FIG. 13A;
FIG. 13C is a picture of laboratory results, which confirm endogenous-expression of bioinformatically detected novel gene GAM25 of FIG. 13A;
FIG. 14A is an annotated sequence of an EST1388749 comprising novel gene GAM26 detected by the gene detection system of the present invention;
FIG. 14B is a picture of laboratory results, which confirm expression of the bioinformatically detected novel gene GAM26 of FIG. 14A;
FIGS. 15A-D are schematic diagrams illustrating sequences, functions and utilities of the VGAM1931 gene expressing the hairpin as set forth in SEQ ID NO: 191.7 and the miRNAs set forth in SEQ ID NO: 4642, which were detected using the bioinformatic gene detection system described hereinabove with reference to FIGS. 1 through 8; and
A Sequence Listing of genomic sequences of the present invention designated SEQ ID:1 through SEQ ID:46755 is attached to this application, enclosed in computer readable form on CD-ROM. The genomic listing comprises the following nucleotide sequences:Genomic sequences designated SEQ ID:1 through SEQ ID:2725 are nucleotide sequences of 2725 gene precursors of respective novel genes of the present invention; Genomic sequences designated SEQ ID:2726 through SEQ ID:5450 are nucleotide sequences of 2725 genes of the present invention; and Genomic sequences designated SEQ ID:5451 through SEQ ID:46755 are nucleotide sequences of 41305 gene precursors of respective novel genes of the present invention.
The present invention relates to a novel group of bioinformatically detectable, viral regulatory RNA genes, which repress expression of host target host genes, by means of complementary hybridization to binding sites in untranslated regions of these host target host genes. It is believed that this novel group of viral genes represent a pervasive viral mechanism of attacking hosts, and that therefore knowledge of this novel group of viral genes may be useful in preventing and treating viral diseases.
In various preferred embodiments, the present invention seeks to provide improved method and system for detection and prevention of viral disease, which is mediated by this group of novel viral genes.
Accordingly, the invention provides several substantially pure nucleic acids (e.g., genomic nucleic acid, cDNA or synthetic nucleic acid) each encoding a novel viral gene of the VGAM group of gene, vectors comprising the nucleic acids, probes comprising the nucleic acids, a method and system for selectively modulating translation of known “target” genes utilizing the vectors, and a method and system for detecting expression of known “target” genes utilizing the probe.
By “substantially pure nucleic acid” is meant nucleic acid that is free of the genes which, in the naturally-occurring genome of the organism from which the nucleic acid of the invention is derived, flank the genes discovered and isolated by the present invention. The term therefore includes, for example, a recombinant nucleic acid which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic nucleic acid of a prokaryote or eukaryote at a site other than its natural site; or which exists as a separate molecule (e.g., a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. It also includes a recombinant nucleic acid which is part of a hybrid gene encoding additional polypeptide sequence.
“Inhibiting translation” is defined as the ability to prevent synthesis of a specific protein encoded by a respective gene, by means of inhibiting the translation of the mRNA of this gene. “Translation inhibiter site” is defined as the minimal nucleic acid sequence sufficient to inhibit translation.
There is thus provided in accordance with a preferred embodiment of the present invention a bioinformatically detectable novel viral gene encoding substantially pure nucleic acid wherein: RNA encoded by the bioinformatically detectable novel viral gene is about 18 to about 24 nucleotides in length, and originates from an RNA precursor, which RNA precursor is about 50 to about 120 nucleotides in length, a nucleotide sequence of a first half of the RNA precursor is a partial inversed-reversed sequence of a nucleotide sequence of a second half thereof, a nucleotide sequence of the RNA encoded by the novel viral gene is a partial inversed-reversed sequence of a nucleotide sequence of a binding site associated with at least one host target gene, and a function of the novel viral gene is bioinformatically deducible.
There is further provided in accordance with another preferred embodiment of the present invention a method for anti-viral treatment comprising neutralizing said RNA.
Further in accordance with a preferred embodiment of the present invention the neutralizing comprises: synthesizing a complementary nucleic acid molecule, a nucleic sequence of which complementary nucleic acid molecule is a partial inversed-reversed sequence of said RNA, and transfecting host cells with the complementary nucleic acid molecule, thereby complementarily binding said RNA.
Further in accordance with a preferred embodiment of the present invention the neutralizing comprises immunologically neutralizing.
There is still further provided in accordance with another preferred embodiment of the present invention a bioinformatically detectable novel viral gene encoding substantially pure nucleic acid wherein: RNA encoded by the bioinformatically detectable novel viral gene includes a plurality of RNA sections, each of the RNA sections being about 50 to about 120 nucleotides in length, and including an RNA segment, which RNA segment is about 18 to about 24 nucleotides in length, a nucleotide sequence of a first half of each of the RNA sections encoded by the novel viral gene is a partial inversed-reversed sequence of nucleotide sequence of a second half thereof, a nucleotide sequence of each of the RNA segments encoded by the novel viral gene is a partial inversed-reversed sequence of the nucleotide sequence of a binding site associated with at least one target host gene, and a function of the novel viral gene is bioinformatically deducible from the following data elements: the nucleotide sequence of the RNA encoded by the novel viral gene, a nucleotide sequence of the at least one target host gene, and function of the at least one target host gene.
Further in accordance with a preferred embodiment of the present invention the function of the novel viral gene is bioinformatically deducible from the following data elements: the nucleotide sequence of the RNA encoded by the bioinformatically detectable novel viral gene, a nucleotide sequence of the at least one target host gene, and a function of the at least one target host gene.
Still further in accordance with a preferred embodiment of the present invention the RNA encoded by the novel viral gene complementarily binds the binding site associated with the at least one target host gene, thereby modulating expression of the at least one target host gene.
Additionally in accordance with a preferred embodiment of the present invention the binding site associated with at least one target host gene is located in an untranslated region of RNA encoded by the at least one target host gene.
Moreover in accordance with a preferred embodiment of the present invention the function of the novel viral gene is selective inhibition of translation of the at least one target host gene, which selective inhibition includes complementary hybridization of the RNA encoded by the novel viral gene to the binding site.
Further in accordance with a preferred embodiment of the present invention the invention includes a vector including the DNA.
Still further in accordance with a preferred embodiment of the present invention the invention includes a method of selectively inhibiting translation of at least one gene, including introducing the vector.
Moreover in accordance with a preferred embodiment of the present invention the introducing includes utilizing RNAi pathway.
Additionally in accordance with a preferred embodiment of the present invention the invention includes a gene expression inhibition system including: the vector, and a vector inserter, functional to insert the vector into a cell, thereby selectively inhibiting translation of at least one gene.
Further in accordance with a preferred embodiment of the present invention the invention includes a probe including the DNA.
Still further in accordance with a preferred embodiment of the present invention the invention includes a method of selectively detecting expression of at least one gene, including using the probe.
Additionally in accordance with a preferred embodiment of the present invention the invention includes a gene expression detection system including: the probe, and a gene expression detector functional to selectively detect expression of at least one gene.
Further in accordance with a preferred embodiment of the present invention the invention includes an anti-viral substance capable of neutralizing the RNA.
Still further in accordance with a preferred embodiment of the present invention the neutralizing includes complementarily binding the RNA.
Additionally in accordance with a preferred embodiment of the present invention the neutralizing includes immunologically neutralizing. Moreover in accordance with a preferred embodiment of the present invention the invention includes a method for anti-viral treatment including neutralizing the RNA.
Further in accordance with a preferred embodiment of the present invention the neutralizing includes: synthesizing a complementary nucleic acid molecule, a nucleic sequence of which complementary nucleic acid molecule is a partial inversed-reversed sequence of the RNA, and transfecting host cells with the complementary nucleic acid molecule, thereby complementarily binding the RNA.
Still further in accordance with a preferred embodiment of the present invention the neutralizing includes immunologically neutralizing.
Reference is now made to FIG. 1 which is a simplified diagram illustrating a mode by which genes of a novel group of genes of the present invention, modulate expression of known host target.
The novel genes of the present invention are micro RNA (miRNA)-like, regulatory RNA genes, modulating expression of known host target. This mode of modulation is common to other known miRNA genes, as described hereinabove with reference to the background of the invention section.
VGAM GENE and TARGET GENE are two human genes contained in the DNA of the human genome.
VGAM GENE encodes a VGAM PRECURSOR RNA. However, similar to other miRNA genes, and unlike most ordinary genes, its RNA, VGAM PRECURSOR RNA, does not encode a protein.
VGAM PRECURSOR RNA folds onto itself, forming VGAM FOLDED PRECURSOR RNA. As FIG. 8 illustrates, VGAM FOLDED PRECURSOR RNA forms a “hairpin structure”, folding onto itself. As is well known in the art, this “hairpin structure”, is typical genes of the miRNA genes, and is due to the fact that nucleotide sequence of the first half of the RNA of a gene in this group is an accurate or partial inversed-reversed sequence of the nucleotide sequence of its second half. By “inversed-reversed” is meant a sequence which is reversed and wherein each nucleotide is replaced by a complementary nucleotide, as is well known in the art (e.g. ATGGC is the inversed-reversed sequence of GCCAT).
An enzyme complex, designated DICER COMPLEX, “dices” the VGAM FOLDED PRECURSOR RNA into a single stranded RNA segment, about 22 nucleotides long, designated VGAM RNA. As is known in the art, “dicing” of the hairpin structured RNA precursor into shorter RNA segments about 22 nucleotides long by a Dicer type enzyme is catalyzed by an enzyme complex comprising an enzyme called Dicer together with other necessary proteins.
TARGET GENE encodes a corresponding messenger RNA, designated TARGET RNA. This TARGET RNA comprises 3 regions: a 5″ untranslated region, a protein coding region and a 3″ untranslated region, designated 5″UTR, PROTEIN CODING and 3″UTR respectively.
VGAM RNA binds complementary a BINDING SITE, located on the 3″UTR segment of TARGET RNA. This complementarily binding is due to the fact that the nucleotide sequence of VGAM RNA is an accurate or partial inversed-reversed sequence of the nucleotide sequence of BINDING SITE.
The complementary binding of VGAM RNA to BINDING SITE inhibits translation of TARGET RNA into TARGET PROTEIN. TARGET PROTEIN is therefore outlined by a broken line.
It is appreciated by one skilled in the art that the mode of transcriptional inhibition illustrated by FIG. 1 with specific reference to VGAM genes of the present invention, is in fact common to all other miRNA genes. A specific complementary binding site has been demonstrated only for Lin-4 and Let-7. All the other 93 newly discovered miRNA genes are also believed by those skilled in the art to modulate expression of other genes by complimentary complementary binding, although specific complimentary complementary binding sites for these genes have not yet been found (Ruvkun G., “Perspective: Glimpses of a tiny RNA world”, Science 294, 779 (2001)). The present invention discloses a novel group of genes, the VGAM genes, belonging to the miRNA genes group, and for which a specific an complementary binding has been determined.
Reference is now made to FIG. 2 which is a simplified block diagram illustrating a bioinformatic gene detection system capable of detecting genes of the novel group of genes of the present invention, which system is constructed and operative in accordance with a preferred embodiment of the present invention.
A centerpiece of the present invention is a bioinformatic gene detection engine 100, which is a preferred implementation of a mechanism capable of bioinformatically detecting genes of the novel group of genes of the present invention.
The function of the bioinformatic gene detection engine 100 is as follows: it receives three types of input, expressed RNA data 102, sequenced DNA data 104, and protein function data 106, performs a complex process of analysis of this data as elaborated below, and based on this analysis produces output of a bioinformatically detected group of novel genes designated 108.
Expressed RNA data 102 comprises published expressed sequence tags (EST) data, published mRNA data, as well as other sources of published RNA data. Sequenced DNA data 104 comprises alphanumeric data describing sequenced genomic data, which preferably includes annotation data such as location of known protein coding regions relative to the sequenced data. Protein function data 106 comprises scientific publications reporting studies which elucidated physiological function known proteins, and their connection, involvement and possible utility in treatment and diagnosis of various diseases. Expressed RNA data 102, sequenced DNA data 104 may preferably be obtained from data published by the National Center for Bioinformatics (NCBI) at the National Institute of Health (NIH), as well as from various other published data sources. Protein function data 106 may preferably be obtained from any one of numerous relevant published data sources, such as the Online Mendelian Inherited Disease In Man (OMIM) database developed by John Hopkins University, and also published by NCBI.
Prior to actual detection of bioinformatically detected novel genes 108 by the bioinformatic gene detection engine 100, a process of bioinformatic gene detection engine training & validation designated 110 takes place. This process uses the known miRNA genes as a training set (some 200 such genes have been found to date using biological laboratory means), to train the bioinformatic gene detection engine 100 to bioinformatically recognize miRNA-like genes, and their respective potential target binding sites. Bioinformatic gene detection engine training & validation 110 is further describe hereinbelow with reference to FIG. 3.
The bioinformatic gene detection engine 100 comprises several modules which are preferably activated sequentially, and are described as follows:
A non-coding genomic sequence detector 112 operative to bioinformatically detect non-protein coding genomic sequences. The non-coding genomic sequence detector 112 is further described hereinbelow with reference to FIGS. 4A and 4B.
A hairpin detector 114 operative to bioinformatically detect genomic “hairpin-shaped” sequences, similar to VGAM FOLDED PRECURSOR of FIG. 1. The hairpin detector 114 is further described hereinbelow with reference to FIGS. 5A and 5B.
A dicer-cut location detector 116 operative to bioinformatically detect the location on a hairpin shaped sequence which is enzymatically cut by DICER COMPLEX of FIG. 1. The dicer-cut location detector 116 is further described hereinbelow with reference to FIG. 6A.
A target-gene binding-site detector 118 operative to bioinformatically detect host target having binding sites, the nucleotide sequence of which is partially complementary to that of a given genomic sequence, such as a sequence cut by DICER COMPLEX of FIG. 1. The target-gene binding-site detector 118 is further described hereinbelow with reference to FIGS. 7A and 7B.
A function & utility analyzer 120 operative to analyze function and utility of host target, in order to identify host target which have a significant clinical function and utility. The function & utility analyzer 120 is further described hereinbelow with reference to FIG. 8.
Hardware implementation of the bioinformatic gene detection engine 100 is important, since significant computing power is preferably required in order to perform the computation of bioinformatic gene detection engine 100 in reasonable time and cost. As an example, it is estimated that using one powerful 8-processor PC Server, over 30 months of computing time (at 24 hours per day) would be required in order to detect all miRNA genes in human EST data, and their respective binding sites.
For example, in order to address this challenge at reasonable time and cost, a preferred embodiment of the present invention may comprise a cluster of a large number of personal computers (PCs), such as 100 PCs (Pentium IV, 1.7 GHz, with 40 GB storage each), connected by Ethernet to several strong servers, such as 4 servers (2-CPU, Xeon 2.2 GHz, with 200 GB storage each), combined with an 8-processor server (8-CPU, Xeon 550 Mhz w/8 GB RAM) connected via 2 HBA fiber-channels to an EMC Clariion 100-disks, 3.6 Terabyte storage device. Additionally, preferably an efficient database computer program, such as Microsoft (™) SQL-Server database computer program is used and is optimized to the specific requirements of bioinformatic gene detection engine 100. Furthermore, the PCs are preferably optimized to operate close to 100% CPU usage continuously, as is known in the art. Using suitable hardware and software may preferably reduce the required calculation time in the abovementioned example from 30 months to 20 days.
It is appreciated that the abovementioned hardware configuration is not meant to be limiting, and is given as an illustration only. The present invention may be implemented in a wide variety of hardware and software configurations.
The present invention discloses 2725 novel viral genes of the VGAM group of genes, which have been detected bioinformatically, as described hereinbelow with reference to Tables 1 and 2. Laboratory confirmation of 4 genes of the GAM group of genes is described hereinbelow with reference to FIGS. 12 through 14.
Reference is now made to FIG. 3 which is a simplified flowchart illustrating operation of a mechanism for training of a computer system to recognize the novel genes of the present invention. This mechanism is a preferred implementation of the bioinformatic gene detection engine training & validation 110 described hereinabove with reference to FIG. 2.
Bioinformatic gene detection engine training & validation 110 of FIG. 2 begins by training the bioinformatic gene detection engine to recognize known miRNA genes, as designated by numeral 122. This training step comprises hairpin detector training & validation 124, further described hereinbelow with reference to FIG. 12A, dicer-cut location detector training & validation 126, further described hereinbelow with reference to FIGS. 6A and 6B, and target-gene binding-site detector training & validation 128, further described hereinbelow with reference to FIG. 7A.
Next, the bioinformatic gene detection engine 100 is used to bioinformatically detect sample novel genes, as designated by numeral 130. An example of a sample novel gene thus detected is described hereinbelow with reference to FIG. 12.
Finally, wet lab experiments are preferably conducted in order to validate expression and preferably function the sample novel genes detected by the bioinformatic gene detection engine 100 in the previous step. An example of wet-lab validation of the abovementioned sample novel gene bioinformatically detected by the system is described hereinbelow with reference to FIGS. 13A and 13B.
Reference is now made to FIG. 4A which is a simplified block diagram of a preferred implementation of the non-coding genomic sequence detector 112 described hereinabove with reference to FIG. 2. Non-protein coding genomic sequence detector 112 of FIG. 2 preferably receives as input at least two types of published genomic data: expressed RNA data 102, including EST data and mRNA data, and sequenced DNA data 104. After its initial training, indicated by numeral 134, and based on the above-mentioned input data, the non-protein coding genomic sequence detector 112 produces as output a plurality of non-protein coding genomic sequences 136. Preferred operation of the non-protein coding genomic sequence detector 112 is described hereinbelow with reference to FIG. 4B.
Reference is now made to FIG. 4B which is a simplified flowchart illustrating a preferred operation of the non-coding genomic sequence detector 112 of FIG. 2. Detection of non-protein coding genomic sequences to be further analyzed by the system generally preferably progresses in one of the following two paths.
A first path for detecting non-protein coding genomic sequences begins by receiving a plurality of known RNA sequences, such as EST data. Each RNA sequence is first compared to all known protein-coding sequences, in order to select only those RNA sequences which are non-protein coding. This can preferably be performed by BLAST comparison of the RNA sequence to known protein coding sequences. The abovementioned BLAST comparison to the DNA preferably also provides the localization of the RNA on the DNA.
Optionally, an attempt may be made to “expand” the non-protein RNA sequences thus found, by searching for transcription start and end signals, upstream and downstream of location of the RNA on the DNA respectively, as is well known in the art.
A second path for detecting non-protein coding genomic sequences starts by receiving DNA sequences. The DNA sequences are parsed into non protein coding sequences, based on published DNA annotation data: extracting those DNA sequences which are between known protein coding sequences. Next, transcription start and end signals are sought. If such signals are found, and depending on their “strength”, probable expressed non-protein coding genomic sequences are yielded.
Reference is now made to FIG. 5A which is a simplified block diagram of a preferred implementation of the hairpin detector 114 described hereinabove with reference to FIG. 2.
The goal of the hairpin detector 114 is to detect “hairpin” shaped genomic sequences, similar to those of known miRNA genes. As mentioned hereinabove with reference to FIG. 1, a “hairpin” genomic sequence refers to a genomic sequence which “folds onto itself” forming a hairpin like shape, due to the fact that nucleotide sequence of the first half of the nucleotide sequence is an accurate or
The hairpin detector 114 of FIG. 2 receives as input a plurality of non-protein coding genomic sequences 136 of FIG. 4A, and after a phase of hairpin detector training & validation 124 of FIG. 3, is operative to detect and output “hairpin shaped” sequences found in the input expressed non-protein coding sequences, designated by numeral 138.
The phase of hairpin detector training & validation 124 is an iterative process of applying the hairpin detector 114 to known hairpin shaped miRNA genes, calibrating the hairpin detector 114 such that it identifies the training set of known hairpins, as well as sequences which are similar thereto. Preferred operation of the hairpin detector 114 is described hereinbelow with reference to FIG. 5B.
Reference is now made to FIG. 5B which is a simplified flowchart illustrating a preferred operation of the hairpin detector 114 of FIG. 2.
A hairpin structure is a two dimensional folding structure, resulting from the nucleotide sequence pattern: the nucleotide sequence of the first half of the hairpin sequence is an inversed-reversed sequence of the second half thereof. Different methodologies are known in the art for detection of various two dimensional and three dimensional hairpin structures.
In a preferred embodiment of the present invention, the hairpin detector 114 initially calculates possible 2-dimensional (2D) folding patterns of a given one of the non-protein coding genomic sequences 136, preferably using a 2D folding algorithm based on free-energy calculation, such as the Zucker algorithm, as is well known in the art.
Next, the hairpin detector 114 analyzes the results of the 2D folding, in order to determine the presence, and location of hairpin structures. A 2D folding algorithm typically provides as output a listing of the base-pairing of the 2D folded shape, i.e. a listing of which all two pairs of nucleotides in the sequence which will bond. The goal of this second step, is to assess this base-pairing listing, in order to determine if it describes a hairpin type bonding pattern.
The hairpin detector 114 then assess those hairpin structures found by the previous step, comparing them to hairpins of known miRNA genes, using various parameters such as length, free-energy, amount and type of mismatches, etc. Only hairpins that bear statistically significant resemblance of the population of hairpins of known miRNAs, according to the abovementioned parameters are accepted.
Lastly, the hairpin detector 114 attempts to select those hairpin structures which are as stable as the hairpins of know miRNA genes. This may be achieved in various manners. A preferred embodiment of the present invention utilizes the following methodology comprising three steps:
First, the hairpin detector 114 attempts to group potential hairpins into “families” of closely related hairpins. As is known in the art, a free-energy calculation algorithm, typically provides multiple “versions” each describing a different possible 2D folding pattern for the given genomic sequence, and the free energy of such possible folding. The hairpin detector 114 therefore preferably assesses all hairpins found on all “versions”, grouping hairpins which appear in different versions, but which share near identical locations into a common “family” of hairpins. For example, all hairpins in different versions, the center of which is within 7 nucleotides of each other may preferably be grouped to a single “family”.
Next, hairpin “families” are assessed, in order to select only those families which represent hairpins that are as stable as those of known miRNA hairpins. For example, preferably only families which are represented in at least 65% of the free-energy calculation 2D folding versions, are considered stable.
Finally, an attempt is made to select the most suitable hairpin from each selected family. For example, preferably the hairpin which appears in more versions than other hairpins, and in versions the free-energy of which is lower, may be selected.
Reference is now made to FIG. 6A which is a simplified block diagram of a preferred implementation of the dicer-cut location detector 116 described hereinabove with reference to FIG. 2.
The goal of the dicer-cut location detector 116 is to detect the location in which DICER COMPLEX of FIG. 1, comprising the enzyme Dicer, would “dice” the given hairpin sequence, similar to VGAM FOLDED PRECURSOR RNA, yielding VGAM RNA both of FIG. 1.
The dicer-cut location detector 116 of FIG. 2 therefore receives as input a plurality of hairpins on genomic sequences 138 of FIG. 5A, which were calculated by the previous step, and after a phase of dicer-cut location detector training & validation 126 of FIG. 3, is operative to detect a respective plurality of dicer-cut sequences from hairpins 140, one for each hairpin.
In a preferred embodiment of the present invention, the dicer-cut location detector 116 preferably uses a combination of neural networks, Bayesian networks, Markovian modeling, and Support Vector Machines (SVMs) trained on the known dicer-cut locations of known miRNA genes, in order to detect dicer-cut locations. Dicer-cut location detector training & validation 126, which is further described hereinbelow with reference to FIG. 6B.
Reference is now made to FIG. 6B which is a simplified flowchart illustrating a preferred implementation of dicer-cut location detector training & validation 126 of FIG. 3. Dicer-cut location detector 116 first preprocesses known miRNA hairpins and their respective dicer-cut locations, so as to be able to properly analyze them and train the detection system accordingly:
The folding pattern is calculated for each known miRNA, preferably based on free-energy calculation, and the size of the hairpin, the size of the loop at the center of the hairpin, and “bulges” (i.e. mismatched base-pairs) in the folded hairpin are noted.
The dicer-cut location, which is known for known miRNA genes, is noted relative to the above, as well as to the nucleotides in each location along the hairpin. Frequency of identity of nucleotides, and nucleotide-pairing, relative to their location in the hairpin, and relative to the known dicer-cut location in the known miRNA genes is analyzed and modeled.
Different techniques are well known in the art for analysis of existing pattern from a given “training set” of species belonging to a genus, which techniques are then capable, to a certain degree, to detect similar patterns in other species not belonging to the training-set genus. Such techniques include, but are not limited to neural networks, Bayesian networks, Support Vector Machines (SVM), Genetic Algorithms, Markovian modeling, and others, as is well known in the art.
Using such techniques, preferably a combination of several of the above techniques, the known hairpins are represented as a several different networks (such as neural, Bayesian, or SVM) input and output layers. Both nucleotide, and “bulge” (i.e. nucleotide pairing or mismatch) are represented for each position in the hairpin, at the input layer, and a corresponding true/false flag at each position, indicating whether it was diced by dicer at the output layer. Multiple networks are preferably used concurrently, and the results therefrom are integrated and further optimized. Markovian modeling may also be used to validate the results and enhance their accuracy. Finally, the bioinformatic detection of dicer-cut location of a sample novel is confirmed by wet-lab experimentation.
Reference is now made to FIG. 7A which is a simplified block diagram of a preferred implementation of the target-gene binding-site detector 118 described hereinabove with reference to FIG. 2. The goal of the target-gene binding-site detector 118 is to detect a BINDING SITE of FIG. 1, located in an untranslated region of the RNA of a known gene, the nucleotide sequence of which BINDING SITE is at least partially complementary to that of a VGAM RNA of FIG. 1, thereby determining that the abovementioned known gene is a target gene of VGAM of FIG. 1.
The target-gene binding-site detector 118 of FIG. 2 therefore receives as input a plurality of dicer-cut sequences from hairpins 140 of FIG. 6A which were calculated by the previous step, and a plurality of potential target gene sequences 142 which derive sequence DNA data 104 of FIG. 2, and after a phase of target-gene binding-site detector training & validation 128 of FIG. 3, is operative to detect target-genes having binding site/s 144 the nucleotide sequence of which is at least partially complementary to that of each of the plurality of dicer-cut sequences from hairpins 140. Preferred operation of the target-gene binding-site detector is further described hereinbelow with reference to FIG. 7B.
Reference is now made to FIG. 7B which is a simplified flowchart illustrating a preferred operation of the target-gene binding-site detector 118 of FIG. 2. In a preferred embodiment of the present invention, the target-gene binding-site detector 118 first performs a BLAST comparison of the nucleotide sequence of each of the plurality of dicer-cut sequences from hairpins 140, to the potential target gene sequences 142, in order to find crude potential matches. Blast results are then filtered to results which are similar to those of known binding sites (e.g. binding sites of miRNA genes Lin-4 and Let-7 to target genes Lin-14, Lin-41, Lin 28 etc.). Next the binding site is expanded, checking if nucleotide sequenced immediately adjacent to the binding site found by BLAST, may improve the match. Suitable binding sites, then are computed for free-energy and spatial structure. The results are analyzed, selecting only those binding sites, which have free-energy and spatial structure similar to that of known binding sites.
Reference is now made to FIG. 8 which is a simplified flowchart illustrating a preferred operation of the function & utility analyzer 120 described hereinabove with reference to FIG. 2. The goal of the function & utility analyzer 120 is to determine if a potential target gene is in fact a valid clinically useful target gene. Since a potential novel VGAM gene binding a binding site in the UTR of a target gene is understood to inhibit expression of that target gene, and if that target gene is shown to have a valid clinical utility, then in such a case it follows that the potential novel gene itself also has a valid useful function which is the opposite of that of the target gene.
The function & utility analyzer 120 preferably receives as input a plurality of potential novel target genes having binding-site/s 144, generated by the target-gene binding-site detector 118, both of FIG. 7A. Each potential gene, is evaluated as follows:
First the system first checks to see if the function of the potential target gene is scientifically well established. Preferably, this can be achieved bioinformatically by searching various published data sources presenting information on known function of proteins. Many such data sources exist and are published as is well known in the art.
Next, for those target genes the function of which is scientifically known and is well documented, the system then checks if scientific research data exists which links them to known diseases. For example, a preferred embodiment of the present invention utilizes the OMIM(™) database published by NCBI, which summarizes research publications relating to genes which have been shown to be associated with diseases.
Finally, the specific possible utility of the target gene is evaluated. While this process too may be facilitated by bioinformatic means, it might require human evaluation of published scientific research regarding the target gene, in order to determine the utility of the target gene to the diagnosis and or treatment of specific disease. Only potential novel genes, the target-genes of which have passed all three examinations, are accepted as novel genes.
Reference is now made to FIG. 9, which is a simplified diagram describing a novel bioinformatically detected group of regulatory genes, referred to here as Genomic Record (GR) genes, that encode an “operon-like” cluster of novel miRNA-like genes, each modulating expression of a plurality of host target, the function and utility of which target genes is known.
GR GENE (Genomic Record Gene) is gene of a novel, bioinformatically detected group of regulatory, non protein coding, RNA genes. The method by which GR is detected is described hereinabove with reference to FIGS. 6-15.
GR GENE encodes an RNA molecule, typically several hundred nucleotides long, designated GR PRECURSOR RNA.
GR PRECURSOR RNA folds spatially, as illustrated by GR FOLDED PRECURSOR RNA, into a plurality of what is known in the art as “hair-pin” structures. The nucleotide sequence of GR PRECURSOR RNA comprises a plurality of segments, the first half of each such segment having a nucleotide sequence which is at least a partial inversed-reversed sequence of the second half thereof, thereby causing formation of a plurality of “hairpin” structures, as is well known in the art.
GR FOLDED PRECURSOR RNA is naturally processed by cellular enzymatic activity, into 3 separate hairpin shaped RNA segments, each corresponding to VGAM PRECURSOR RNA of FIG. 1, designated VGAM1 PRECURSOR, VGAM2 PRECURSOR and VGAM3 PRECURSOR respectively.
The above mentioned VGAM precursors, are diced by Dicer of FIG. 1, yielding short RNA segments of about 22 nucleotides in length, each corresponding to VGAM RNA of FIG. 1, designated VGAM1, VGAM2 and VGAM3 respectively.
VGAM1, VGAM2 and VGAM3 each bind complementarily to binding sites located in untranslated regions of respective host target, designated VGAM1-TARGET RNA, VGAM2-TARGET RNA and VGAM3-TARGET RNA respectively. This binding inhibits translation of the respective target proteins designated VGAM1-TARGET PROTEIN, VGAM2-TARGET PROTEIN and VGAM3-TARGET PROTEIN respectively.
The structure of VGAM genes comprised in a GR GENE, and their mode of modulation of expression of their respective target genes is described hereinabove with reference to FIG. 1. The bioinformatic approach to detection of VGAM genes comprised in a GR GENE is described hereinabove with reference to FIGS. 9 through 14.
The present invention discloses 3283 novel viral genes of the GR group of genes, which have been detected bioinformatically, as described hereinbelow with reference to Tables 1 and 2. Laboratory confirmation of 3 genes of the GR group of genes is described hereinbelow with reference to FIGS. 9A through 14.
In summary, the current invention discloses a very large number of novel viral GR genes, each of which encodes a plurality of VGAM genes, which in turn may modulate expression of a plurality of host target proteins.
Reference is now made to FIG. 10 which is a block diagram illustrating different utilities of genes of the novel group of genes of the present invention referred to here as VGAM genes and GR genes.
The present invention discloses a first plurality of novel genes referred to here as VGAM genes, and a second plurality of operon-like genes referred to here as GR genes, each of the GR genes encoding a plurality of VGAM genes. The present invention further discloses a very large number of known target-genes, which are bound by, and the expression of which is modulated by each of the novel genes of the present invention. Published scientific data referenced by the present invention provides specific, substantial, and credible evidence that the abovementioned target genes modulated by novel genes of the present invention, are associated with various diseases. Specific novel genes of the present invention, target genes thereof and diseases associated therewith, are described hereinbelow with reference to Tables 1 and 2. It is therefore appreciated that a function of VGAM genes and GR genes of the present invention is modulation of expression of target genes related to known diseases, and that therefore utilities of novel genes of the present invention include diagnosis and treatment of the abovementioned diseases. FIG. 10 describes various types of diagnostic and therapeutic utilities of novel genes of the present invention.
A utility of novel genes of the present invention is detection of VGAM genes and of GR genes. It is appreciated that since VGAM genes and GR genes modulate expression of disease related target genes, that detection of expression of VGAM genes in clinical scenarios associated with said diseases is a specific, substantial and credible utility. Diagnosis of novel genes of the present invention may preferably be implemented by RNA expression detection techniques, including but not limited to biochips, as is well known in the art. Diagnosis of expression of genes of the present invention may be useful for research purposes, in order to further understand the connection between the novel genes of the present invention and the abovementioned related diseases, for disease diagnosis and prevention purposes, and for monitoring disease progress.
Another utility of novel genes of the present invention is anti-VGAM gene therapy, a mode of therapy which allows up regulation of a disease related target-gene of a novel VGAM gene of the present invention, by lowering levels of the novel VGAM gene which naturally inhibits expression of that target gene. This mode of therapy is particularly useful with respect to target genes which have been shown to be under-expressed in association with a specific disease. Anti-VGAM gene therapy is further discussed hereinbelow with reference to FIGS. 11A and 11B.
A further utility of novel genes of the present invention is VGAM replacement therapy, a mode of therapy which achieves down regulation of a disease related target-gene of a novel VGAM gene of the present invention, by raising levels of the VGAM gene which naturally inhibits expression of that target gene. This mode of therapy is particularly useful with respect to target genes which have been shown to be over-expressed in association with a specific disease. VGAM replacement therapy involves introduction of supplementary VGAM gene products into a cell, or stimulation of a cell to produce excess VGAM gene products. VGAM replacement therapy may preferably be achieved by transfecting cells with an artificial DNA molecule encoding a VGAM gene, which causes the cells to produce the VGAM gene product, as is well known in the art.
Yet a further utility of novel genes of the present invention is modified VGAM therapy. Disease conditions are likely to exist, in which a mutation in a binding site of a VGAM gene prevents natural VGAM gene to effectively bind inhibit a disease related target-gene, causing up regulation of that target gene, and thereby contributing to the disease pathology. In such conditions, a modified VGAM gene is designed which effectively binds the mutated VGAM binding site, i.e. is an effective anti-sense of the mutated VGAM binding site, and is introduced in disease effected cells. Modified VGAM therapy is preferably achieved by transfecting cells with an artificial DNA molecule encoding the modified VGAM gene, which causes the cells to produce the modified VGAM gene product, as is well known in the art.
An additional utility of novel genes of the present invention is induced cellular differentiation therapy. As aspect of the present invention is finding genes which determine cellular differentiation, as described hereinabove with reference to FIG. 11. Induced cellular differentiation therapy comprises transfection of cell with such VGAM genes thereby determining their differentiation as desired. It is appreciated that this approach may be widely applicable, inter alia as a means for auto transplantation harvesting cells of one cell-type from a patient, modifying their differentiation as desired, and then transplanting them back into the patient. It is further appreciated that this approach may also be utilized to modify cell differentiation in vivo, by transfecting cells in a genetically diseased tissue with a cell-differentiation determining VGAM gene, thus stimulating these cells to differentiate appropriately.
Reference is now made to FIGS. 11A and 11B, simplified diagrams which when taken together illustrate anti-VGAM gene therapy mentioned hereinabove with reference to FIG. 10. A utility of novel genes of the present invention is anti-VGAM gene therapy, a mode of therapy which allows up regulation of a disease related target-gene of a novel VGAM gene of the present invention, by lowering levels of the novel VGAM gene which naturally inhibits expression of that target gene. FIG. 11A shows a normal VGAM gene, inhibiting translation of a target gene of VGAM gene, by binding to a BINDING SITE found in an untranslated region of TARGET RNA, as described hereinabove with reference to FIG. 1.
FIG. 11B shows an example of anti-VGAM gene therapy. ANTI-VGAM RNA is short artificial RNA molecule the sequence of which is an anti-sense of VGAM RNA. Anti-VGAM treatment comprises transfecting diseased cells with ANTI-VGAM RNA, or with a DNA encoding thereof. The ANTI-VGAM RNA binds the natural VGAM RNA, thereby preventing binding of natural VGAM RNA to its BINDING SITE. This prevents natural translation inhibition of TARGET RNA by VGAM RNA, thereby up regulating expression of TARGET PROTEIN.
It is appreciated that anti-VGAM gene therapy is particularly useful with respect to target genes which have been shown to be under-expressed in association with a specific disease.
Reference is now made to FIG. 12A which is an annotated sequence of an EST comprising a novel gene detected by the gene detection system of the present invention. FIG. 12A shows the nucleotide sequence of a known human non-protein coding EST (Expressed Sequence Tag), identified as EST72223 (SEQ ID NO: 46756). It is appreciated that the sequence of this EST comprises sequences of one known miRNA gene, identified as MIR98, and of one novel GAM gene, referred to here as GAM24, detected by the bioinformatic gene detection system of the present invention, described hereinabove with reference to FIG. 2.
Reference is now made to FIGS. 12B and 12C that are pictures of laboratory results, which when taken together demonstrate laboratory confirmation of expression of the bioinformatically detected novel gene of FIG. 12A. Reference is now made to FIG. 12B which is a Northern blot analysis of MIR-98 and EST72223 transcripts. MIR-98 and EST72223 were reacted with MIR-98 and GAM24 probes as indicated in the figure. It is appreciated that the probes of both MIR-98 and GAM24 reacted with EST72223, indicating that EST72223 contains the sequences of MIR-98 and of GAM24. It is further appreciated that the probe of GAM24 does not cross-react with MIR-98.
Reference is now made to FIG. 12C. A Northern blot analysis of EST72223 and MIR-98 transfections were performed, subsequently marking RNA by the MIR-98 and GAM24 probes. Left, Northern reacted with MIR-98, Right, Northern reacted with GAM24. The molecular Sizes of EST72223, MIR-98 and GAM24 are indicated by arrows. Hela are control cells that have not been introduced to exogenous RNA. EST and MIR-98 Transfections are RNA obtained from Hela transfected with EST72223 and MIR-98, respectively. MIR-98 and EST are the transcripts used for the transfection experiment. The results indicate that EST72223, when transfected into Hela cells, is cut yielding known miRNA gene MIR-98 and novel miRNA gene GAM24.
Reference is now made to FIG. 12D, which is a Northern blot of a lysate experiment with MIR-98 and GAM24. Northern blot analysis of hairpins in EST72223. Left, Northern reacted with predicted Mir-98 hairpin probe, Right, Northern reacted with predicted GAM24 hairpin probe. The molecular size of EST Is indicated by arrow. The molecular sizes of Mir-98 and GAM24 are 80 nt and 100 nt, respectively as indicated by arrows. The 22 nt molecular marker is indicated by arrow. 1-Hela lysate; 2-EST incubated 4 h with Hela lysate; 3-EST without lysate; 4-Mir transcript incubated 4 h with Hela lysate; 5-Mir transcript incubated overnight with Hela lysate; 6-Mir transcript without lysate; 7-RNA extracted from Hela cells following transfection with Mir transcript.
Technical methods used in experiments, the results of which are depicted in FIGS. 12B, 12C and 12D are as follows:
Transcript preparations: Digoxigenin (DIG) labeled transcripts were prepared from EST72223 (TIGER), MIR98 and predicted precursor hairpins by using a DIG RNA labeling kit (Roche Molecular Biochemicals) according to the manufacturer's protocol. Briefly, PCR products with T7 promoter at the 5″ end or T3 promoter at the 3″ end were prepared from each DNA in order to use it as a template to prepare sense and antisense transcripts, respectively. MIR-98 was amplified using EST72223 as a template with T7miR98 forward primer: 5-″TAATACGACTCACTATAGGGTGAGGTAGTAAGTTGTA TTGTT-3″ (SEQ ID NO: 46760) and T3miR98 reverse primer: 5″-AATTAACCCTCACTAAAGGGAAAGTAGTAAG TTGTATAGTT-3″ (SEQ ID NO: 46761). EST72223 was amplified with T7-EST 72223 forward primer: 5″-TAATACGACTCACTATAGGCCCTTATTAGAGGATTCTGCT-3″ (SEQ ID NO: 46762) and T3-EST72223 reverse primer: 5″-AATTAACCCTCACTAAAGGTTTTTTTTTCCTGAGACAG AGT3″ (SEQ ID NO: 46763). Bet-4 was amplified using EST72223 as a template with Bet-4 forward primer: 5″-GAGGCAGGAGAATGCTTGA-3″ (SEQ ID NO: 46764 and T3-EST72223 reverse primer: 5″-AATTAACCCTCACTAA AGGCCTGAGACAGAGTCTTGCTC-3″ (SEQ ID NO: 46765). The PCR products were cleaned and used for DIG-labeled or unlabeled transcription reactions with the appropriate polymerase. For transfection experiments, CAP reaction was performed by using a mMessage mMachine kit (Ambion).
Transfection procedure: Transfection of Hela cells was performed by using TransMessenger reagent (Qiagen) according to the manufacture's protocol. Briefly, Hela cells were seeded to 1−2×10^6 cells per plate a day before transfection. Two Âμg RNA transcripts were mixed with 8Âμl Enhancer in a final volume of 100Âμl, mixed and incubated at room temperature for 5 min. 16Âμl TransMessenger reagent was added to the RNA-Enhancer, mixed and incubated for additional 10 min. Cell plates were washed with sterile PBS twice and then incubated with the transfection mix diluted with 2.5 ml DMEM medium without serum. Cells were incubated with transfection mix for three hours under their normal growth condition (370 C and 5% CO2) before the transfection mix was removed and a fresh DMEM medium containing serum was added to the cells. Cells were left to grow 48 hours before harvesting.
Target RNA cleavage assay: Cap-labeled target RNAs were generated using mMessage mMachine™ (Ambion). Caped RNA transcripts were preincubated at 30° C. for 15 min in supplemented Hela S100 obtained from Computer Cell Culture, Mos, Belgium. After addition of all components, final concentrations were 100 mM target RNA, 1 m M ATP, 0.2 mM GTP, 10 U/ml RNasin, 30μ g/ml creatine kinase, 25 mM creatine phosphate, and 50% S100 extract. Incubation was continued for 4 hours to overnight. Cleavage reaction was stopped by the addition of 8 volumes of proteinase K buffer (200 Mm Tris-Hcl, pH 7.5, 25 m M EDTA, 300 mM NaCI, and 2% SDS). Proteinase K, dissolved in 50 mM Tris-HCI, pH 8, 5 m M CaCl2, and 50% glycerol, was added to a final concentration of 0.6 mg/ml. Sample were subjected to phenol/chlorophorm extraction and kept frozen until analyzed by urea-TBE PAGE.
Northern analysis: RNAs were extracted from cells by using Tri-reagent according to the manufacture's protocol. The RNAs were dissolved in water and heated to 650 C. to disrupt any association of the 25 nt RNA with larger RNA molecules. RNA were placed on ice and incubated for 30 min with PEG (MW=8000) in a final concentration of 5% and NaCI in a final concentration of 0.5M to precipitate high molecular weight nucleic acid. The RNAs were centrifuged at 10,000×g for 10 min to pellet the high molecular weight nucleic acid. The supernatant containing the low molecular weight RNAs was collected and three volumes of ethanol was added. The RNAs were placed at −200 C for at least two hours and then centrifuged at 10,000×g for 10 min. The pellets were dissolved in Urea-TBE buffer (1Xtbe, 7M urea) for further analysis by a Northern blot.
RNA samples were boiled for 5 min before loading on 15%-8% polyacrylamide (19:1) gels containing 7M urea and 1×TBE. Gels were run in 1×TBE at a constant voltage of 300V and then transferred into a nylon membrane. The membrane was exposed to 3 min ultraviolet light to cross link the RNAs to the membrane. Hybridization was performed overnight with DIG-labeled probes at 420 C. Membranes were washed twice with SSCx2 and 0.2% SDS for 10 min. at 420 C and then washed twice with SSCx0.5 for 5 min at room temperature. The membrane was then developed by using a DIG luminescent detection kit (Roche) using anti DIG and CSPD reaction, according to the manufacture's protocol.
It is appreciated that the data presented in FIGS. 12A, 12B, 12C and 12D, when taken together validate the function of the bioinformatic gene detection engine 100 of FIG. 2. FIG. 12A shows a novel GAM gene bioinformatically detected by the bioinformatic gene detection engine 100, and FIGS. 12B, 12C and 12D show laboratory confirmation of the expression of this novel gene. This is in accord with the engine training and validation methodology described hereinabove with reference to FIG. 3.
Reference is now made to FIG. 13A which is an annotated sequence of an EST comprising a novel gene detected by the gene detection system of the present invention. FIG. 13A shows the nucleotide sequence of a known human non-protein coding EST (Expressed Sequence Tag), identified as EST 7929020 (SEQ ID NO: 46757). It is appreciated that the sequence of this EST comprises sequences of two novel GAM genes, referred to here as GAM23 and GAM25, detected by the bioinformatic gene detection system of the present invention, described hereinabove with reference to FIG. 2.
Reference is now made to FIG. 13B which presents pictures of laboratory results, that demonstrate laboratory confirmation of expression of the bioinformatically detected novel gene of FIG. 13A. Northern blot analysis of hairpins in EST7929020. Left, Northern reacted with predicted GAM25 hairpin probe, Right, Northern reacted with predicted GAM23 hairpin probe. The molecular size of EST is indicated by arrow. The molecular sizes of GAM23 and GAM25 are 60 nt, as indicated by arrow. The 22 nt molecular marker is indicated by arrow. 1-Hela lysate; 2-EST incubated 4 h with Hela lysate; 3-EST incubated overnight with Hela lysate; 4-EST without lysate; 5-GAM transcript; 6-GAM 22 nt marker; 7-GAM PCR probe; 8-RNA from control Hela cells; 9-RNA extracted from Hela cells following transfection with EST.
Reference is now made to FIG. 13C which is a picture of a Northern blot confirming Endogenous expression of bioinformatically detected gene GAM25 of FIG. 13A from in Hela cells. Northern was reacted with a predicted GAM25 hairpin probe. The molecular size of EST7929020 is indicated. The molecular sizes of GAM25 is 58 nt, as indicated. A 19 nt DNA oligo molecular marker is indicated. Endogenous expression of GAM25 in Hela total RNA fraction and in S-100 fraction is indicated by arrows. 1-GAM25 transcript; 2-GAM25 DNA oligo marker; 3-RNA from control Hela cells; 4-RNA extracted from Hela cells following transfection with EST; 5-RNA extracted from S-100 Hela lysate.
Reference is now made to FIG. 14A which is an annotated sequence of an EST comprising a novel gene detected by the gene detection system of the present invention. FIG. 14A shows the nucleotide sequence of a known human non-protein coding EST (Expressed Sequence Tag), identified as EST 1388749 (SEQ ID NO: 46758). It is appreciated that the sequence of this EST comprises sequence of a novel GAM gene, referred to here as GAM26, detected by the bioinformatic gene detection system of the present invention, described hereinabove with reference to FIG. 2.
Reference is now made to FIG. 14B which is a picture of Northern blot analysis, confirming expression of novel bioinformatically detected gene GAM26, and natural processing thereof from EST1388749. Northern reacted with predicted GAM26 hairpin probe. The molecular size of EST is indicated by arrow. The molecular sizes of GAM26 is 130 nt, as indicated by arrow. The 22 nt molecular marker is indicated by arrow. 1-Hela lysate; 2-EST incubated 4 h with Hela lysate; 3-EST incubated overnight with Hela lysate; 4-EST without lysate; 5-GAM transcript; 6-GAM 22 nt marker; 7-GAM PCR probe.
VGAM1931 RNA, herein schematically represented by VGAM2 binds complimentarily to a host target binding site located in an untranslated region of VGAM1931 host target RNA, herein schematically represented by VGAM2 HOST TARGET RNA, which host target binding site corresponds to a host target binding site such as BINDING SITE I, BINDING SITE II, or BINDING SITE III of FIG. 1, thereby inhibiting translation of VGAM1931 host target RNA, herein schematically represented by VGAM2 HOST TARGET RNA into VGAM1931 host target protein, herein schematically represented by VGAM2 HOST TARGET PROTEIN, both of FIG. 1.
Reference is now made to FIG. 15A, which is a simplified diagram providing a conceptual explanation of the mode by which a novel bioinformatically detected viral gene, referred to here as Viral. Genomic Address Messenger 1931 (VGAM1931) modulates expression of host target genes thereof, the function and utility of which host target genes is known in the art.
VGAM1931 is a novel bioinformatically detected regulatory, non protein coding, viral micro RNA (miRNA) gene. The method by which VGAM1931 was detected is described hereinabove with reference to FIGS. 2-8.
VGAM1931 GENE is a viral gene contained in the genome of Human herpesvirus 4. VGAM1931-HOST TARGET GENE is a human gene contained in the human genome.
VGAM1931 GENE encodes a VGAM1931 PRECURSOR RNA. Similar to other miRNA genes, and unlike most ordinary genes, the RNA transcribed by VGAM1931, VGAM1931 PRECURSOR RNA, does not encode a protein.
VGAM1931 PRECURSOR RNA folds onto itself, forming a ‘hairpin structure’ designated VGAM1931 FOLDED PRECURSOR RNA. As is well known in the art, this ‘hairpin structure’, is typical of RNA encoded by miRNA genes, and is due to the fact that the nucleotide sequence of the first half of the RNA encoded by a miRNA gene is an accurate or partial inversed-reversed sequence of the nucleotide sequence of the second half thereof. By “inversed-reversed” is meant a sequence which is reversed and wherein each nucleotide is replaced by a complementary nucleotide, as is well known in the art (e.g. ATGGC is the inversed-reversed sequence of GCCAT).
An enzyme complex designated DICER COMPLEX, ‘dices’ the VGAM1931 FOLDED PRECURSOR RNA into a single stranded ˜22 nt long RNA segment, designated VGAM1931 RNA. As is known in the art, ‘dicing’ of a hairpin structured RNA precursor product into a short ˜22 nt RNA segment is catalyzed by an enzyme complex comprising an enzyme called Dicer together with other necessary proteins.
VGAM1931-HOST TARGET GENE encodes a corresponding messenger RNA, designated VGAM1931-HOST-TARGET RNA. VGAM1931-HOST-TARGET RNA comprises three regions, as is typical of mRNA of a protein coding gene: a 5′ untranslated region, a protein coding region and a 3′ untranslated region, designated 5′UTR, PROTEIN CODING and 3′UTR respectively.
VGAM1931 RNA binds complementarily to one or more host binding sites located in untranslated regions of VGAM1931-HOST-TARGET RNA. This complementary binding is due to the fact that the nucleotide sequence of VGAM1931 RNA is an accurate or a partial inversed-reversed sequence of the nucleotide sequence of each of the host binding sites. As an illustration, FIG. 1931A shows 3 such host binding sites, designated BINDING SITE-I, BINDING SITE-II and BINDING SITE-III respectively. It is appreciated that the number of host binding sites shown in FIG. 1931A is meant as an illustration only, and is not meant to be limiting—VGAM1931 may have a different number of binding sites in untranslated regions of a VGAM1931-HOST-TARGET RNA. It is further appreciated that while FIG. 15A depicts the host binding sites in the 3′UTR region, this is meant as an example only—the binding sites may be located in the 3′UTR region, the 5′UTR region, or in both 3′UTR and 5′UTR regions.
The complementary binding of VGAM1931 RNA to BINDING SITE-I, BINDING SITE-II and BINDING SITE-III inhibits translation of VGAM1931-HOST-TARGET RNA into VGAM1931-HOST-TARGET PROTEIN. VGAM1931-HOST-TARGET PROTEIN is therefore outlined by a broken line.
It is appreciated that VGAM1931-HOST-TARGET GENE in fact represents a plurality of host target genes of VGAM1931. The mRNA of each of this plurality of host target genes of VGAM1931 comprises one or more host binding site, having a nucleotide sequence which is at least partly complementary to VGAM1931 RNA, and which when bound by VGAM1931 RNA causes inhibition of translation of one of a plurality of host target proteins of VGAM1931. Host target genes of VGAM1931 and their respective host binding sites, are described hereinbelow with reference to FIG. 15D.
It is further appreciated by one skilled in the art that the mode of translational inhibition illustrated by FIG. 15A with specific reference to translational inhibition exerted by VGAM1931 on one or more host target genes of VGAM1931, is in fact common to other known non-viral miRNA genes. As mentioned hereinabove with reference to the background section, although a specific complementary binding site has been demonstrated only for miRNA genes Lin-4 and Let-7, all other recently discovered miRNA genes are also believed by those skilled in the art to modulate expression of other genes by complementary binding, although specific complementary binding sites of these genes have not yet been found (Ruvkun G., ‘Perspective: Glimpses of a tiny RNA world’, Science 294, 779 (2001)).
It is yet further appreciated that a function of VGAM1931 is inhibition of expression of host target genes, as part of a novel viral mechanism of attacking a host. Accordingly, utilities of VGAM1931 include diagnosis, prevention and treatment of viral infection by Human herpesvirus 4. Specific functions, and accordingly utilities, of VGAM1931 correlate with, and may be deduced from, the identity of the target genes which VGAM1931 binds and inhibits, and the function of these target genes, as elaborated hereinbelow with reference to FIG. 15D.
Reference is now made to FIG. 15B, which shows the nucleotide sequence of VGAM1931 PRECURSOR RNA of FIG. 15A, designated SEQ ID:1917, and a probable (over 74%) nucleotide sequence of VGAM1931 RNA of FIG. 15A, designated SEQ ID:4642. The nucleotide sequence of SEQ ID:4642 is marked by an underline within the sequence of VGAM1931 PRECURSOR RNA. Nucleotide sequence SEQ ID:1917 is located at position 151629 relative to the genome of Human herpesvirus 4.
Reference is now made to FIG. 15C, which shows the secondary folding of VGAM1931 PRECURSOR RNA, forming a ‘hairpin structure’ designated VGAM1931 FOLDED PRECURSOR RNA, both of FIG. 15A. The nucleotide sequence of SEQ ID:4642, which is highly likely (>74%) to be identical or highly similar to the nucleotide sequence of VGAM1931 RNA is marked on VGAM1931 FOLDED PRECURSOR RNA by a solid underline. It is appreciated that the complementary base-paring is not perfect, with ‘bulges’, as is well known in the art with respect to the RNA folding of all known miRNA genes.
Reference is now made to FIG. 15D, which is a table showing complementarity of host binding sites of VGAM1931, found in untranslated regions of host target genes of VGAM1931, to SEQ ID:4642, which is highly likely (>74%) to be identical or highly similar to the nucleotide sequence of VGAM1931 RNA of FIG. 15A. Each of the host binding sites described hereinbelow corresponds to a host binding site, such as BINDING SITE-I, BINDING SITE-II or BINDING SITE-III, all of FIG. 15A, and each of the host target genes of VGAM1931 described hereinbelow corresponds to VGAM HOST TARGET GENE of FIG. 15A.
As mentioned hereinabove with reference to FIG. 15A a function of VGAM1931 is inhibition of expression of host target genes, as part of a novel viral mechanism of attacking a host. Accordingly, utilities of VGAM1931 include diagnosis, prevention and treatment of viral infection by Human herpesvirus 4. It is appreciated that specific functions, and accordingly utilities, of VGAM1931 correlate with, and may be deduced from, the identity of the host target genes which VGAM1931 binds and inhibits, and the function of these host target genes, as elaborated herein below.
Reference is now made to COL6A1 BINDING SITE. collagen, type VI, alpha 1 (COL6A1, Accession NM—001848) is a host target gene of VGAM1931, corresponding to VGAM1931-HOST TARGET GENE of FIG. 15A. COL6A1 BINDING SITE is a host binding site found in the 3′ untranslated region of COL6A1, corresponding to a host binding site such as BINDING SITE-I, BINDING SITE-H or BINDING SITE-III, all of FIG. 15A. FIG. 15D illustrates the complementarity of the nucleotide sequence of COL6A1 BINDING SITE, designated SEQ ID:7584, to the nucleotide sequence of VGAM1931 RNA of FIG. 15A, designated SEQ ID:4642.
A function of VGAM1931 is therefore inhibition of collagen, type VI, alpha 1 (COL6A1), a host gene which encodes a Protein that is associated with BETHLEM MYOPATHY, as part of a novel viral mechanism used by Human herpesvirus 4 for attacking a host. Accordingly, utilities of VGAM1931 include diagnosis, prevention and treatment of viral infection by Human herpesvirus 4. The function and utilities of COL6A1 have been established by previous studies, as described hereinabove with reference to FIG. 1119D.
Reference is now made to SFRS1 BINDING SITE. splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor) (SFRS1, Accession NM—006924) is a host target gene of VGAM1931, corresponding to VGAM1931-HOST TARGET GENE of FIG. 15A. SFRS1 BINDING SITE is a host binding site found in the 3′ untranslated region of SFRS1, corresponding to a host binding site such as BINDING SITE-I, BINDING SITE-II or BINDING SITE-III, all of FIG. 15A. FIG. 15D illustrates the complementarity of the nucleotide sequence of SFRS1 BINDING SITE, designated SEQ ID:13801, to the nucleotide sequence of VGAM1931 RNA of FIG. 15A, designated SEQ ID:4642.
Yet another function of VGAM1931 is therefore inhibition of splicing factor, arginine/serine-rich I (splicing factor 2, alternate splicing factor) (SFRS1), a host gene which encodes a Protein that plays an essential role in pre-mRNA splicing, as part of a novel viral mechanism used by Human herpesvirus 4 for attacking a host. Accordingly, utilities of VGAM1931 include diagnosis, prevention and treatment of viral infection by Human herpesvirus 4. The function and utilities of SFRS1 have been established by previous studies, as described hereinabove with reference to FIG. 323D.
Reference is now made to HIP12 BINDING SITE. HIP12 (Accession XM—038791) is a host target gene of VGAM1931, corresponding to VGAM1931-HOST TARGET GENE of FIG. 15A. HIP12 BINDING SITE is a host binding site found in the 3′ untranslated region of HIP12, corresponding to a host binding site such as BINDING SITE-I, BINDING SITE-II or BINDING SITE-III, all of FIG. 15A. FIG. 15D illustrates the complementarity of the nucleotide sequence of HIP12 BINDING SITE, designated SEQ ID:32922, to the nucleotide sequence of VGAM1931 RNA of FIG. 15A, designated SEQ ID:4642.
An additional function of VGAM1931 is therefore inhibition of (HIP12), a host gene which encodes a Protein that is a component of clathrin-coated pits and vesicles, that may link the endocytic machinery to the actin cytoskeleton., as part of a novel viral mechanism used by Human herpesvirus 4 for attacking a host. Accordingly, utilities of VGAM1931 include diagnosis, prevention and treatment of viral infection by Human herpesvirus 4.
The function of HIP12 has been established by previous studies. Huntingtin-interacting protein-1 (HIP1; 601767) is a membrane-associated protein that interacts with huntingtin (143100), the protein altered in Huntington disease. While attempting to isolate the mouse homolog of HIP1, Chopra et al. (2000) identified a homologous cDNA, which they designated Hip12. By screening a human frontal cortex cDNA library with an EST that showed homology to mouse Hip12, Chopra et al. (2000) cloned a full-length HIP12 cDNA encoding a deduced 1,068-amino acid protein that shares 47% sequence identity with HIP1. The highest degree of similarity occurs in the C-terminal region, which shows considerable homology to the cytoskeletal protein talin (186745). Northern blot analysis detected expression of a 5-kb HIP12 transcript in brain, heart, kidney, pancreas, and liver, but not in lung or placenta. In ES cell-derived neurons, both HIP1 and HIP12 are highly expressed and distributed throughout the cytoplasm and cell processes with enrichment within the cis-Golgi. In contrast to HIP1, which is toxic in cell culture, HIP12 does not confer toxicity in the same assay systems. HIP12 does not interact with huntingtin but can interact with HIP1, suggesting a potential interaction in vivo that may influence the function of each respective protein. By searching EST databases for homologs of yeast Sla2p, Engqvist-Goldstein et al. (1999) identified mouse and human cDNAs encoding HIP1R. The deduced human protein, which is 91% identical to the mouse sequence, is identical to the KIAA0655 protein reported by Ishikawa et al. (1998). It is also identical to the shorter sequence reported by Seki et al. (1998) except that it contains approximately 180 additional amino acids in it N terminus, including a conserved domain implicated in the endocytic function of Sla2p. HIP1R has 3 predicted coiled coils and a C-terminal talin-like domain, which Engqvist-Goldstein et al. (1999) confirmed binds F-actin in vitro. Northern blot analysis revealed that mouse Hip1r is expressed ubiquitously, with reduced expression in skeletal muscle and heart, consistent with RT-PCR analysis of human HIP1R expression (Seki et al., 1998; Ishikawa et al., 1998). Fluorescence microscopy demonstrated that mouse Hip1r is expressed as punctate structures, enriched at the cell cortex and excluded from the nucleus, which colocalize with clathrin (see 118955) and other markers of receptor-mediated endocytosis.
Full details of the abovementioned studies are described in the following publications, the disclosure of which are hereby incorporated by reference:
Chopra, V. S.; Metzler, M.; Rasper, D. M.; Engqvist-Goldstein, A. E. Y.; Singaraja, R.; Gan, L.; Fichter, K. M.; McCutcheon, K.; Drubin, D.; Nicholson, D. W.; Hayden, M. R.: HIP12 is a non-proapoptotic member of a gene family including HIP1, an interacting protein with huntingtin. Mammalian Genome 11: 1006-1015, 2000.; and
Engqvist-Goldstein, A. E. Y.; Kessels, M. M.; Chopra, V. S.; Hayden, M. R.; Drubin, D. G.: An actin-binding protein of the Sla2/Huntingtin interacting protein 1 family is a novel compo.
Further studies establishing the function and utilities of HIP12 are found in John Hopkins OMIM database record ID 605613, and in sited publications numbered 10160, 20936 and 20937-20938 listed in the bibliography section hereinbelow, which are also hereby incorporated by reference.
Reference is now made to ZNF212 BINDING SITE. zinc finger protein 212 (ZNF212, Accession NM—012256) is a host target gene of VGAM1931, corresponding to VGAM1931-HOST TARGET GENE of FIG. 15A. ZNF212 BINDING SITE is a binding site found in the 3′ untranslated region of ZNF212, corresponding to a host binding site such as BINDING SITE-I, BINDING SITE-II or BINDING SITE-III, all of FIG. 15A. FIG. 15D illustrates the complementarity of the nucleotide sequence of ZNF212 BINDING SITE, designated SEQ ID:14557, to the nucleotide sequence of VGAM1931 RNA of FIG. 15A, designated SEQ ID:4642.
A further function of VGAM1931 is therefore inhibition of zinc finger protein 212 (ZNF212). Accordingly, utilities of VGAM1931 include diagnosis and treatment of diseases and clinical conditions with which ZNF212 is associated.
Reference is now made to FLJ20436 BINDING SITE. FLJ20436 (Accession NM—017822) is a host target gene of VGAM1931, corresponding to VGAM1931-HOST TARGET GENE of FIG. 15A. FLJ20436 BINDING SITE is a binding site found in the 3′ untranslated region of FLJ20436, corresponding to a host binding site such as BINDING SITE-I, BINDING SITE-II or BINDING SITE-III, all of FIG. 15A. FIG. 15D illustrates the complementarity of the nucleotide sequence of FLJ20436 BINDING SITE, designated SEQ ID:19472, to the nucleotide sequence of VGAM1931 RNA of FIG. 15A, designated SEQ ID:4642.
Yet a further function of VGAM1931 is therefore inhibition of (FLJ20436). Accordingly, utilities of VGAM1931 include diagnosis and treatment of diseases and clinical conditions with which FLJ20436 is associated.
Reference is now made to KIAA1622 BINDING SITE. KIAA1622 (Accession NM—058237) is a host target gene of VGAM1931, corresponding to VGAM193′-HOST TARGET GENE of FIG. 15A. KIAA1622 BINDING SITE is a binding site found in the 3′ untranslated region of KIAA1622, corresponding to a host binding site such as BINDING SITE-I, BINDING SITE-II or BINDING SITE-III, all of FIG. 15A. FIG. 15D illustrates the complementarity of the nucleotide sequence of KIAA1622 BINDING SITE, designated SEQ ID:27766, to the nucleotide sequence of VGAM1931 RNA of FIG. 15A, designated SEQ ID:4642.
Another function of VGAM1931 is therefore inhibition of (KIAA1622). Accordingly, utilities of VGAM1931 include diagnosis and treatment of diseases and clinical conditions with which KIAA1622 is associated.
Reference is now made to LOC51312 BINDING SITE. LOC51312 (Accession NM—018579) is a host target gene of VGAM1931, corresponding to VGAM1931-HOST TARGET GENE of FIG. 15A. LOC51312 BINDING SITE is a binding site found in the 5′ untranslated region of LOC51312, corresponding to a host binding site such as BINDING SITE-I, BINDING SITE-II or BINDING SITE-III, all of FIG. 15A. FIG. 15D illustrates the complementarity of the nucleotide sequence of LOC51312 BINDING SITE, designated SEQ ID:20659, to the nucleotide sequence of VGAM1931 RNA of FIG. 15A, designated SEQ ID:4642.
Yet another function of VGAM1931 is therefore inhibition of (LOC51312). Accordingly, utilities of VGAM1931 include diagnosis and treatment of diseases and clinical conditions with which LOC51312 is associated.
Reference is now made to LOC57105 BINDING SITE. LOC57105 (Accession NM—020377) is a host target gene of VGAM1931, corresponding to VGAM1931-HOST TARGET GENE of FIG. 15A. LOC57105 BINDING SITE is a binding site found in the 3′ untranslated region of LOC57105, corresponding to a host binding site such as BINDING SITE-I, BINDING SITE-II or BINDING SITE-III, all of FIG. 15A. FIG. 15D illustrates the complementarity of the nucleotide sequence of LOC57105 BINDING SITE, designated SEQ ID:21639, to the nucleotide sequence of VGAM1931 RNA of FIG. 15A, designated SEQ ID:4642.
An additional function of VGAM1931 is therefore inhibition of (LOC57105). Accordingly, utilities of VGAM1931 include diagnosis and treatment of diseases and clinical conditions with which LOC57105 is associated.
Reference is now made to LOC146603 BINDING SITE. LOC146603 (Accession XM—085514) is a host target gene of VGAM1931, corresponding to VGAM1931-HOST TARGET GENE of FIG. 15A. LOC146603 BINDING SITE is a binding site found in the 5′ untranslated region of LOC146603, corresponding to a host binding site such as BINDING SITE-I, BINDING SITE-II or BINDING SITE-III, all of FIG. 15A. FIG. 15D illustrates the complementarity of the nucleotide sequence of LOC146603 BINDING SITE, designated SEQ ID:38215, to the nucleotide sequence of VGAM1931 RNA of FIG. 15A, designated SEQ ID:4642.
A further function of VGAM1931 is therefore inhibition of (LOC146603). Accordingly, utilities of VGAM1931 include diagnosis and treatment of diseases and clinical conditions with which LOC146603 is associated.
Reference is now made to LOC145761 BINDING SITE. LOC145761 (Accession XM—096855) is a host target gene of VGAM1931, corresponding to VGAM1931-HOST TARGET GENE of FIG. 15A. LOC145761 BINDING SITE is a binding site found in the 5′ untranslated region of LOC145761, corresponding to a host binding site such as BINDING SITE-I, BINDING SITE-II or BINDING SITE-III, all of FIG. 15A. FIG. 15D illustrates the complementarity of the nucleotide sequence of LOC145761 BINDING SITE, designated SEQ ID:40584, to the nucleotide sequence of VGAM1931 RNA of FIG. 15A, designated SEQ ID:4642.
Yet a further function of VGAM1931 is therefore inhibition of (LOC145761). Accordingly, utilities of VGAM1931 include diagnosis and treatment of diseases and clinical conditions with which LOC145761 is associated.
Reference is now made to LOC202986 BINDING SITE. LOC202986 (Accession XM—117489) is a host target gene of VGAM1931, corresponding to VGAM1931-HOST TARGET GENE of FIG. 15A. LOC202986 BINDING SITE is a binding site found in the 3′ untranslated region of LOC202986, corresponding to a host binding site such as BINDING SITE-I, BINDING SITE-II or BINDING SITE-III, all of FIG. 15A. FIG. 15D illustrates the complementarity of the nucleotide sequence of LOC202986 BINDING SITE, designated SEQ ID:43470, to the nucleotide sequence of VGAM1931 RNA of FIG. 15A, designated SEQ ID:4642.
Another function of VGAM1931 is therefore inhibition of (LOC202986). Accordingly, utilities of VGAM1931 include diagnosis and treatment of diseases and clinical conditions with which LOC202986 is associated.
| TABLE 1 |
Nucleotide sequence of the VGAM PRECURSOR RNA, and of the ‘diced’ VGAM RNA, and a Schematic representation of the secondary folding of VGAM FOLDED PRECURSOR RNA of each of the plurality VGAM GENEs described by FIG. 1 are further described hereinbelow with reference to Table 1.
Nucleotide sequences of the VGAM1931 precursor RNA, herein designated VGAM PRECURSOR RNA, and of the diced VGAM1931 RNA, herein designated VGAM RNA, and a schematic representation of the secondary folding of VGAM1931
folded precursor RNA, herein designated VGAM FOLDED PRECURSOR RNA, of VGAM1931 are further described hereinbelow with reference to Table 1.
| TABLE 2 |
Nucleotide sequence of host target binding sites, such as BINDING SITE-I, BINDING SITE-II and BINDING SITE-III of FIG. 1, found on, and schematic representation of the complementarity of each of these host target binding sites to VGAM RNA are described hereinbelow with reference to Table 2.
Nucleotide sequences of host target binding sites, such as BINDING SITE-I, BINDING SITE-II and BINDING SITE-III of FIG. 1, found on, and schematic representation of the complementarity of each of these host target binding sites to VGAM1931 RNA, herein designated VGAM RNA, are described hereinbelow with reference to Table 2.
1. An isolated nucleic acid, wherein the sequence of the nucleic acid consists of:
(a) the sequence of SEQ ID NO: 4642;
(b) an RNA equivalent of (a); or
(c) the complement of (a) or (b), wherein the complement is identical in length to the nucleic acid of (a) or (b).
2. A vector comprising the nucleic acid according to claim 1.
3. A probe comprising the nucleic acid according to claim 1.
4. An isolated nucleic acid, wherein the sequence of the nucleic acid consists of:
(a) the sequence of SEQ ID NO: 1917;
(b) an RNA equivalent of (a); or
(c) the complement of (a) or (b), wherein the complement is identical in length to the nucleic acid of (a) or (b).
5. A vector comprising the nucleic acid according to claim 4.
6. A probe comprising the nucleic acid according to claim 4.