Patent application title:

Transposon-based transformation system

Publication number:

-

Publication date:
Application number:

10/640,968

Filed date:

2003-08-13

✅ Patent granted

Patent number:

US 7,138,279 B2

Grant date:

2006-11-21

PCT filing:

-

PCT publication:

-

Examiner:

Nancy Vogel

Adjusted expiration:

2023-08-26

Abstract:

A transposon-based mutagenesis method for altering DNA in Sorangium and other Myxococcales host cells is provided, along with vectors and transposases for use in the method.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N15/74 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora

Description

CROSS-REFERENCE TO RELATED PATENT APPLICATIONS

This application claims benefit of provisional patent application No. 60/403,290, filed Aug. 13, 2002, the disclosure of which is incorporated herein in its entirety.

FIELD OF THE INVENTION

The present invention provides methods and materials for transforming microbial strains from the Myxobacteria, particularly Sorangium cellulosum. These organisms produce or can be altered using this system to produce useful compounds, including polyketides. Polyketides are a diverse class of compounds with a wide variety of activities, including activities useful for medical, veterinary, and agricultural purposes. The present invention finds application in the fields of molecular biology, chemistry, recombinant DNA technology, medicine, animal health, and agriculture.

BACKGROUND OF THE INVENTION

Myxobacteria are soil dwelling Gram-negative bacteria. They survive by secreting a variety of hydrolytic enzymes that break down the organic matter as well as other living microorganisms in their environment. They are most noted for their ability to form fruiting body structures when they are starved for nutrients (Dworkin, 1996, “Recent advances in the social and developmental biology of the myxobacteria” Microbiol Rev 60:70–102). These fruiting bodies house thousands of dormant myxospores that are resistant to a variety of environmental stresses. Within the last decade they have gained prominence as producers of secondary metabolites, some of which are currently being exploited as potential drug candidates (Reichenbach, 2001, “Myxobacteria, producers of novel bioactive substances” J Industrial Microbiology and Biotechnology 27:149–156). Analysis of myxobacteria reveals that bacterial of the genus Sorangium are a rich source of unique bioactive secondary metabolites (Reichenbach, 2001; Reichenbach and Höfle, 1999, “Myxobacteria as producers of secondary metabolites,” p. 149–179, in Grabley and Thiericke, ed., Drug Discovery from Nature. Springer Verlag, Berlin; and Reichenbach and Höfle, 1993, Production of bioactive secondary metabolites, p. 347–397, in M. Dworkin and D. Kaiser, ed., Myxobacteria II. American Society for Microbiology, Washington, D.C.), the most prominent of which are the epothilones (Altmann, 2001, “Microtubule-stabilizing agents: a growing class of important anticancer drugs” Curr Opin Chem Biol 5:424–31). Biosynthesis of epothilones remains the method of choice for obtaining commercially useful quantities of these compounds.

However, Sorangium strains are some of the most difficult myxobacteria with which to work. They have the longest doubling time of myxobacteria, up to 16 hours, and very few genetic tools are available. S. cellulosum is difficult to engineer, due to the low efficiency of introducing DNA into the bacteria (Jaoua et al., 1992, “Transfer of mobilizable plasmids to Sorangium cellulosum and evidence for their integration into the chromosome” Plasmid 28:157–65) and the limited number of molecular tools and markers that have been developed to date. For example, a genetic transformation system based on homologous recombination has been described (see U.S. Pat. No. 5,686,295), but this system appears to work inefficiently, if at all, in most instances. Thus, introducing exogenous DNA for expression or to make knockout mutations, particularly when using a vector containing a small region of homology, is problematic.

The ability to make mutations in Sorangium would be extremely useful to identify the gene clusters responsible for the synthesis of secondary metabolites; a single strain of Sorangium can produce several different known secondary metabolites (for example, So ce12 makes four known compounds; see Reichenbach and Höfle, 1999), and in addition, may harbor gene clusters that synthesize compounds that have not been identified. Many of the secondary metabolites isolated from myxobacteria are complex polyketides synthesized by type I polyketide synthases (PKS), which are large multimodular proteins (For review, see Hopwood et al., 1990 “Molecular genetics of polyketides and its comparison to fatty acid biosynthesis” Annu Rev Genet 24:37–66; Khosla et al., 1999, “Tolerance and specificity of polyketide synthases” Annu Rev Biochem 68:219–53; and Shen, B., 2003, “Polyketide biosynthesis beyond the type I, II and III polyketide synthase paradigms” Curr Opin Chem Biol 7:285–95). A method for making mutations in Sorangium to correlate which of several polyketide synthase gene clusters in a genome is responsible for synthesizing which polyketide would be valuable. In addition, technology has been developed to manipulate a PKS gene cluster either to produce the polyketide synthesized by that PKS at higher levels than occur in nature or in hosts that otherwise do not produce the polyketide, or to produce molecules that are structurally related to, but distinct from, the polyketides produced from known PKS gene clusters (see McDaniel, R., et al, 2000; Weissman, K. J. et al. 2001; McDaniel, et al., 1993; Xue, et al., 1999; Ziermann, et al., 2000; U.S. Pat. Nos. 6,033,883 and 6,177,262; and PCT publication Nos. 00/63361 and 00/24907).

Thus, methods and reagents for making mutations in Sorangium would be a valuable tool, simplifying correlation of polyketide synthase gene clusters and specific polyketides, modifying polyketide synthase gene clusters, and having many other uses.

The following articles provide background information relating to the invention and are incorporated herein by reference: Akerley, B. J., et al. (1984), Proc. Natl. Acad. Sci 95: 8927–8932; Balog, D. et al. (1996) Angew Chem Int Ed Engl 37 (19):2675–2678; Bollag, D. M. et al. (1995.) Cancer Res. 55:2325–33; Gerth, K., et al. (1996), J Antibiotics 49:560–563; Jaoua, S., et al. (1992), Plasmid 28:157–165; Jarvik, T., et al. (1998), Genetics 149: 1569–1574; Judson, N., et al. (2000), Nature Biotechnology 18: 740–745; Lampe, D. J., et al (1996) EMBO vol. 15, No. 19, pp. 5470–5479; Lampe, D. J., et al. (1998) Genetics 149: 179–187; Lampe, D. J., et al. (1999) Proc. Natl. Acad. Sci. USA 96: 11428–11433; McDaniel, R., et al. (1993), Science 262:1546–1557; McDaniel, R., et al. (1999), Proc. Natl. Acad. Sci. USA 96:1846–1851; McDaniel, R., et al. (2000), Adv Bio Eng, 73: 31–52; Pelicic, V., et al. (2000), J Bact vol.182, No.19 p. 5391–5398; Reznikoff, W. S., et al. (1993), Annu. Rev. Microbiol. 47:945–63; Robertson, H. M., et al. (1992), Nucleic Acids Research 20:6409; Robertson H. M., et al. (1995), Mol. Biol. Evol. 12(5):850–862; Rubin, E. J., et al. (1999), Proc. Natl. Acad. Sci. USA 96:1645–1650; Sambrook et al., (1989), Molecular Cloning: A manual, Cold Spring Harbor Ed; Su, D.-S., et al. (1997) Angew. Chem. Int. Ed. Engl. 36:757–759; Weissman, K. J., et al. (2001), In H. A. Kirst et al. (ed.), Enzyme technologies for pharmaceutical and biotechnological applications, p. 427–470. Marcel Dekker, Inc. New York; Xue, 0., et al. (1999), Proc. Natl. Acad. Sci. USA 96:11740–11745; Xue, Y., et al. (1998), Proc. Natl. Acad. Sci. USA 95: 12111–12116; Zhang, L., et al. (1998), Nucleic Acids Res. 26(16): 3687–3693; Zhang, J. K., et al (2000), Proc. Natl. Acad. Sci. USA 10.1073; Zhao, L., et al. (1998), J Am Chem Soc 120: 10256–10257; Ziermann, R., et al. (1999), Biotechniques 26: 106–110; Ziermann, R., et al. (2000), J Ind Microbial Biotech 24: 46–50; Gerth et al. 1996, J Antibiotics 49: 560–563; Bollag et al. 1995, Cancer Res. 55:2325–33; Hofle et al., 1996 “Epothilone A and B-novel 16-membered macrolides with cytotoxic activity: isolation, crystal structure, and conformation in solution, Angew. Chem. Int. Ed. Engl. 35:1567–1569; Su et al., 1997 “Structure-activity relationships of the epothilones and the first in vivo comparison with paclitaxel” Angew. Chem. Int. Ed. Engl. 36:2093–2096; Chou et al., 1998, “Desoxyepothilone B: an efficacious microtubule-targeted antitumor agent with a promising in vivo profile relative to epothilone B,” Proc. Natl. Acad. Sci. USA 95: 9642–9647; PCT patent publication Nos. 00/00485, 99/67253, 99/67252, 99/65913, 99/54330, 99/54319, 99/54318, 99/43653, 99/43320, 99/42602, 99/40047, 99/27890, 99/07692, 99/02514, 99/01124, 98/25929, 98/22461, 98/08849, 97/19086; U.S. Pat. No. 5,969,145; and German patent publication No. DE 41 38 042.

SUMMARY OF THE INVENTION

In one aspect, the present invention provides recombinant methods and materials for genetically modifying a cell of the genus Sorangium (e.g., Sorangium cellulosum) using a transposon-based vector. Genetic modification in Sorangium using a transposon system has not previously been described. In an embodiment, the transposon-based vector contains a gene encoding a transposase, where transcription of the gene is under control of the E. coli bacteriophage T7A1 promoter.

In one aspect, the present invention provides recombinant methods and materials for genetically modifying a myxobacteria host cell, such as a Sorangium cell, using a transposase derived from the Chrysoperla carnea species of lacewing fly. In an embodiment, transcription of the Chrysoperla carnea transposase is under control of the T7A1 promoter

In one embodiment, the invention is used for transforming and/or mutagenizing epothilone producing strains of Sorangium cellulosum. In one embodiment, the invention is directed to a method of mutagenizing Sorangium cellulosum to modify production of useful polyketides. In another embodiment, the invention is directed to a method of mutagenizing Sorangium cellulosum to produce epothilone compounds or analogs. In one embodiment, the invention is directed to a method of mutagenizing by transposon-mediated mutagenesis Sorangium cellulosum strain Soce90 or another epothilone A and/or B producing strain or species of Sorangium to inactivate the gene for the P450 cytochrome EpoK, encoded by the epoK gene, resulting in the accumulation of epothilones C and/or D instead of epothilones A and B. The invention also provides S. cellulosum host cells produced by the method, including S. cellulosum host cells that produce epothilones C and D but not epothilones B or A, and methods for fermenting such host cells to produce epothilones C and/or D.

In one embodiment, the invention provides novel transposase sequences, optionally under control of a T7A1 promoter, useful in mutagenizing organisms including Sorangium cellulosum and organisms other than Sorangium cellulosum (for instance, Stigmatella aurantiaca).

In one embodiment the invention is directed to a method of mutagenizing a Myxobacteria host cell to change the DNA in said cell. In one embodiment, the DNA changed encodes a polyketide synthase (PKS) or a non-ribosomal peptide synthase (NRPS) or a mixed PKS/NRPS gene cluster, and the mutagenized cell is fermented to produce useful compounds.

In one aspect, the invention provide a transposon-based vector useful for genetically modifying a host cell, e.g., a cell of the genus Sorangium (e.g., Sorangium cellulosum). In one embodiment, the vector comprises transposon inverted terminal repeat (ITR) nucleotide sequences flanking a marinar-type transposase gene sequence under the control of a T7A1 promoter. In another embodiment, the vector comprises transposon inverted terminal repeat (ITR) nucleotide sequences flanking a transposase gene sequence of SEQ ID NO:3, with the proviso that R1, R5 and R6 of said transposase gene sequence are not G nucleotides, and a selectable marker. In a related embodiment, R1 is A, and/or R5 is T, and/or R6 is C. In an embodiment, the transposase has a sequence of SEQ ID NO:2 or is an E137K variant thereof. In an embodiment, the transposase gene sequence is under the control of a T7A1 promoter. In an embodiment, the ITR sequences comprise

ACAGGTTGGCTGATAAGTCCCCGGTCTGGATCCA [SEQ ID NO:10]
GACCGGGGACTTATCAGCCAACCTGT.

In one embodiment, the invention provides materials and methods to insert a gene or genes into a host cell. In one embodiment, the inserted genes include an operon comprising a prpE gene, accA, and pccB genes to produce increased quantities of malonyl-CoA and/or methylmalonyl-CoA. The genes can be under the control of a suitable promoter, such as a PKS promoter, i.e. from epothilone (U.S. Pat. No. 6,303,342), soraphen (U.S. Pat. No. 5,716,849), or tombamycin (U.S. Pat. Nos. 6,280,999, and 6,090,601 and publication No. 20030054547A1), gene clusters. The gene or genes of interest are inserted between the inverted terminal repeats of transposon-based vector of the invention and transposed into the DNA of the host cell. In one embodiment of the invention, the genes are inserted into the S. cellulosum chromosome. In one embodiment the prpE gene is from Salmonella typhimurium. In one embodiment, the accA, and pccB genes are from Streptomyces coelicolor. In one embodiment the prpE gene, accA, and pccB genes are from Myxococcus xanthus. In another embodiment, the gene is a matB gene or is an operon comprising matB and matC genes, such as those from Rhizobium leguminosarum bv. trifolii, which respectively encode a ligase that can attach a CoA group to malonic or methylmalonic acid and a transporter molecule to transport malonic or methylmalonic acid into the host cell respectively, to produce increased quantities of malonyl-CoA and methylmalonyl-CoA. See U.S. patent application Ser. No. 09/687,855 (corresponding to WO 01/27306); Ser. No. 9/798,033 (corresponding to US20020045220A1); and Ser. No. 10/087,451.

In one aspect the invention provides a recombinant or isolated DNA comprising the sequence of SEQ ID NO:1. In one aspect the invention provides a recombinant or isolated DNA comprising the sequence of SEQ ID NO:3, optionally with the proviso that R1, R5 and R6 of said transposase gene sequence are not G nucleotides, optionally with the proviso that R1 is A, and/or R5 is T, and/or R6 is C. In one aspect the invention provides a recombinant or isolated polypeptide comprising the sequence of SEQ ID NO:2. In one aspect the invention provides a recombinant or isolated polypeptide comprising the sequence of SEQ ID NO:4. In one aspect, the invention provides a vector selected from the group consisting of pKOS183-3, pKOS183-132H, pKOS183-132B, and pKOS249-52B.

These and other embodiments of the invention are described in more detail in the following description, examples, and claims set forth below.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a schematic of plasmid pKOS183-3 with the C. carnea transposase tnp E137K, oriT, ampicillin, kanamycin and bleomycin resistance genes.

FIG. 2 is the C. carnea transposase consensus double strand nucleotide sequence (SEQ ID NO:1) and translated amino acid sequence (SEQ ID NO:2).

FIG. 3 is the C. carnea transposase consensus double strand nucleotide sequence (SEQ ID NO. 3) and translated amino acid sequence (SEQ ID NO. 4) with ambiguity codes for mutations R1 to R9.

FIG. 4 shows a Southern blot of transposon insertion strains. Lane 1. 1 kb ladder. Smallest band is 1.6 kb. Lanes 2–10. Nine independent transposon insertion strains.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides transposon-based genetic modification systems for Sorangium and other host cells of the order Myxococcales. Transposons, or transposable elements, are typically DNA sequences having a single open reading frame encoding a transposase protein flanked by two inverted terminal repeats (ITRs). As their name implies, they transpose themselves in the genome of the organism harboring them.

In one aspect the invention provides methods for altering deoxyribonucleic acid (DNA) in a Sorangium host cell includes transforming the cell with a transposon vector comprising inverted terminal repeat sequences (ITRs) and a gene encoding a transposase that recognizes the ITRs. The transposon vector transposes into said DNA, carrying with it any exogenous DNA that lies between the ITRs. As used herein, “transforming” refers to introducing an exogenous DNA into a cell, for example by conjugation from E. coli to S. cellulosum (or any host that is able to be conjugated with E. coli), electorporation, or other means.

In one aspect of the invention, the gene encoding the transposase is under control of the E. coli bacteriophage T7A1 promoter. This is a synthetic promoter that has two LacI binding sites that repress transcription. The T7A1 promoter is described in Lanzer et al., 1988, “Promoters largely determine the efficiency of repressor action” Proc. Nat'l Acad Sci 85:8973–77. Surprisingly, in Sorangium host cells, the activity of this heterologous promoter is sufficient to drive expression of transposase to achieve significant levels of transposition.

In one aspect of the invention, the methods of the invention utilize transposons of the mariner class (i.e., the vector encodes a mariner-type transposase). The mariner transposons are DNA-mediated transposons that encode transposases with a conserved motif in the catalytic domain of the protein (Doak et al., 1994, Proc. Natl. Acad. Sci. USA 91:942–46). Transposons of the mariner transposon class are widely distributed in animals (Zhang et al, 1998). Mariner transposons move through a DNA intermediate during transposition using a “cut-and-paste” mechanism, resulting in excision of the transposon from the original location and insertion at novel sites in the genome. Two essential components are necessary in this process, the active transposase and the ITRs that are recognized and mobilized by the transposase. Mariner transposons integrate into a thymidine-adenine (TA) target dinucleotide, which is duplicated upon insertion. With the mariner transposon, the transposase is sufficient to mediate transposition (Lampe et al., 1996). Mariner transposons do not rely on species-specific host factors, such as host rec proteins. Two transposons of the mariner class have been described as active in several hosts: the Mos1 mariner, isolated from Drosophila mauritiana, and Himar1 from the horn fly Haematobia irritans. Transposase mutants from the Haematobia irritans Himar1 element have been described in U.S. Pat. No. 6,368,830 B1.

In one aspect of the invention, the transposase is derived from a Chrysoperla carnea lacewing fly mariner transposon. Example 2 describes the cloning and characterization of this novel transposase (the “Carnea transposase”). In one embodiment, the transposase has an amino acid sequence of SEQ ID NO:2. In one embodiment, the transposase is encoded by a gene having (a) the nucleotide sequence of SEQ ID NO:1; (b) the nucleotide sequence of SEQ ID NO:3, with the proviso that R1, R5 and R6 are not G nucleotides; (c) the nucleotide sequence of SEQ ID NO:3, with the proviso that R1, R5 and R6 are not G nucleotides (d) the nucleotide sequence of SEQ ID NO:3 with the proviso that nucleotides at positions 409, 605 and 606 are adenine, thymidine, and cytosine respectively; or (e) an E137K variant of a, b, c, or d.

The vectors of the invention comprise (a) gene encoding a transposase (such as a mariner type transposase), driven by a promoter (such as the T7A1 promoter); (b) a nucleotide sequence of the inverted terminal repeats recognized by the transposase (such as the Himar 1 ITRs; see Robertson et al., 1995, “Recent horizontal transfer of a mariner transposable element among and between diptera and neuroptera” Mol Biol. Evol. 12:850–62) and optionally (c) selectable markers (such as markers that confer antibiotic resistance). The vector can also include the OriT sequence to enable conjugation from E. coli to the host.

The transposons of the present invention include transposons with enhanced transposition frequency. Transposition frequency is mediated by the activity of the transposase protein. Mutations in the transposase encoding region can lead to the mutants having increased transposition frequency. These mutations include those described in FIG. 3 and listed in SEQ ID NO:3. An illustrative double mutant, having a glutamic acid to lysine amino acid change at amino acid residue 137 and a phenylalanine to leucine change at amino acid residue 202, has increased transposition frequency compared to the SEQ ID NO:1 transposase.

In a different embodiment, the invention uses Tn5 transposon elements (Reznikoff et al. 1993, “The Tn5 transposon” Annu Rev Microbiol. 47:945–63). A minimal or basic transposon version of the Tn5 was also made, consisting of the Tn5 inverted terminal repeats nucleotide sequence and selectable markers (see Example 8). However, initial experiments with the Tn5 polymerase did not result in transposition. This may have been due to the absence of host factors.

In one aspect, the invention provides methods for introducing exogenous DNAs into host cells, e.g., Myxoccocus. In particular, methods and vectors disclosed herein have, surprisingly, been shown to result in genetic modifications in Sorangium cellulosum cells, and in one aspect, the invention provides methods for introducing exogenous DNAs into the chromosomes of cells of the suborder Sorangineae, especially Sorangium, and especially Sorangium cellulosum (e.g., So ce90 and SMP44 strains). Myxococcales comprises two suborders, the suborder Cystobacterineae, and the suborder Sorangineae. The suborder Sorangineae includes among other host cells of the present invention, the epothilone producer Sorangium cellulosum. The suborder Cystobacterineae includes the family Myxococcaceae and the family Cystobacteraceae. The family Myxococcacceae includes the genus Angiococcus (i.e., A. disciforrmis), the genus Myxococcus, and the genus Corallococcus (i.e., C. macrosporus, C. corralloides, and C. exiguus). The family Cystobacteraceae includes the genus Cystobacter (i.e., C. fuscus, C. ferrugineus, C. minor, C. velatus, and C. violaceus), the genus Melittangium (i.e., M. boletus and M. lichenicola), the genus Stigmatella (i.e., S. erecta and S. aurantiaca), and the genus Archangium (i.e., A. gephyra).

In one embodiment, the method of the present invention is applied to knock out genes in the epothilone producer Sorangium cellulosum. For illustration, in one embodiment, the methods are applied to knock out the epoK gene, or decrease activity of epoK, in an S. cellulosum host cell to create a host cell showing enhanced production of epothilone C and/or D. See U.S. Pat. No. 6,303,342. The invention also provides recombinant host cells produced by the method. This aspect of the invention is illustrated in (and without being limited by) Example 5, below.

The present invention can also be used to introduce genes to a host. For example, the transposons and methods of the present invention can be used to introduce new biosynthetic pathways into a host cell of the invention. This aspect of the invention is illustrated in Example 6 with respect to methods to increase epothilone production in certain host cells. Epothilone production requires the precursors malonyl-CoA (mCoA) and methylmalonyl-CoA (mmCoA). When methylmalonyl-CoA precursor pools are increased, this can result in increased production of epothilones in host cells in which these precursors are otherwise limiting production. Moreover, the ratio of mCoA and mmCoA in an epothilone producing host cell can influence the ratio of epothilone A and/or C production to epothilone B and/or D production due to the biochemical pathway by which these compounds are produced. By increasing the ratio of mmCo to mCoA, one can increase the ratio of epothilone B and D to epothilone A and C produced in host cells in which the amount of mmCoA is limiting the amount of epothilones B and D produced. Thus, if the epoK gene is also disrupted in such a host having excess methylmalonyl-CoA precursor, epothilone D will be the predominant product. The transposon of the present invention can be used to introduce genes, such as, for example, the matB and/or matC genes from Rhizobium leguminosarum bv trifolrii. MatB is a ligase that can attach a CoA group to malonic or methylmalonic acid. MatC is a transporter protein that can transport malonic or methylmalonic acid into the cell. Thus, by introducing these genes (matB alone may be sufficient) into a Sorangium cellulosum host cell having a disrupted epoK gene and in which precursor supply is limited, an increase in epothilone C and D can be observed. In one embodiment, the host cell into which exogenous DNAs is introduced according to the methods of the invention are cells that produce a polyketide at equal to or greater than 10 to 20 mg/L, more preferably at equal to or greater than 100 to 200 mg/L, and most preferably at equal to or greater than 1 to 2 g/L.

A detailed description of the invention having been provided, the following examples are given for the purpose of illustrating the invention and shall not be construed as being a limitation on the scope of the invention or claims.

EXAMPLE 1

Manipulation of DNA and Organisms

(A) Strains. Routine DNA manipulations were performed in Escherichia coli XL1 Blue or E. coli XL1 Blue MR (Stratagene) & DH10B (BRL) using standard culture conditions (Sambrook et al., 1989). Sorangium cellulosum strain So ce90 was used for the transposon insertion.

(B) Manipulation of DNA and organisms. Manipulation and transformation of DNA in E. coli was performed according to standard procedures (Sambrook et al., 1989) or suppliers'protocols.

(C) DNA Sequencing and Analysis. PCR-based double-stranded DNA sequencing was performed on an Applied Biosystems (ABI) capillary sequencer using reagents and protocols provided by the manufacturer. Sequence was assembled using the SEQUENCHER (Gene Codes) software package and analyzed with MacVector (Oxford Molecular Group) and the NCBI BLAST.

(D) HPLC methods. Quantitation of polyketides was performed using a Hewlett-Packard 1090 HPLC equipped with a diode array detector and an Alltech 500 evaporative light scattering detector as described previously (Leaf et al., 2000, Biotechnol. Prog. 16: 553–556).

(E) Table 1 below shows illustrative plasmids, cosmids, and vectors of the present invention.

TABLE 1
Plasmid name Markers
pKOS183-3 Tn KanR BleoR
pKOS183-132H Tn HygR
pKOS183-132B Tn BleoR
pKOS249-52B PT7AI E137K tnp + oriT + ITR +BleoR
pKOS249-59.1 tnp BleoR (OE-IE Tn5)
pKOS249-59.2 tnp BleoR (OE-OE Tn5)
pKOS111-136.7 PCR tnp (C. carnea)
pKOS111-137.9 PCR tnp (C. carnea)
pKOS111-147 Tnp 136.7 × 137.9
pKOS111-158 ITR
pKOS1II-160 ITR
pKOS111-170 ITR + KanR BleoR
pKOS111-179 ITR + KanR BleoR + oriT
pKOS111-189.1 “wt” tnp (C. carnea)
pKOS111-190 PT7AI “wt” tnp (C. carnea)
pKOS183-70 20X up-mutant E137K tnp (C. carnea)
pKOS249-58.1 Tn5 “wt” OE-IE (Tn5)
pKOS249-58.2 Tn5 “wt” OE-OE Tn5)
PKOS249-57 Tn5 OE-IE

EXAMPLE 2

Cloning Chrysoperla Carnea Mariner Transposase Gene

The Chrysoperla carnea mariner transposase gene was isolated from the genome of the green lacewing fly Chrysoperla carnea by homology polymerase chain reaction amplification. Approximately 2000 Chrysoperla carnea lacewing fly eggs were obtained from Biocontrol Network (Brentwood, Tenn.), and the DNA isolated using the DNA isolation kit from Roche Molecular Biochemicals (Indianapolis, Ind.). After finishing the protocol as recommended, a phenol extraction followed by phenol/chloroform extraction of the DNA were carried out to further clean it up. Using the primers 111-132.5 (AACCATGGAAAAAAAGGAATTTCGTGTTTT [SEQ ID NO:5]) and 111-132.6 (AAAAGCTTATTCAACATAGTTCCCTTCAAGAGC [SEQ ID NO:6]), the nucleotide sequence encoding the mariner transposase was amplified. The Chrysoperla carnea consensus sequence (see SEQ ID NO:1) encoding the transposase was derived from the PCR amplimers generated (which were designated 111-136.7 and 111-136.9). The resulting DNA fragment was cut with NcoI and HindIII, and ligated with pSL1190 (Pharmacia) cleaved with NcoI and HindIII.

Of 60 clones isolated, 15 were completely sequenced. Two clones, pKOS111-136.7 and pKOS111-136.9, contained several point mutations each and were further used to create a transposase gene with the consensus sequence. See FIG. 2 for the nucleotide and translated amino acid sequence of the carnea transposase (SEQ ID NOS: 1 and 2). A sequence listing standard ambiguity codes for various mutants of the present invention is described in FIG. 3 (SEQ ID NOS: 3 and 4).

The C. carnea consensus nucleotide sequence differs from the Himar1 sequence as described in Table 2 below (Row 1). Table 2 also shows the differences between the Himar1 sequence, sequences of clones 111-136.7 and 111-136.9, and the E137K mutant of C. carnea consensus sequences. The C. carnea consensus E137K mutant amino acid sequence differs from Himar1 sequence at amino acid residues 137 and 202, having a glutamic acid to lysine change at amino acid 137, and a tryptophan to phenylalanine change at amino acid 202. A modification of residue 137 of the Himar 1 sequence was reported to enhance transposition in E. coli.

TABLE 2
Comparison of C. carnea Transposase Sequences with Himar 1
Nucleotide Amino Acid Amino Acid
position position change
1 C. carnea consensus 605,606    202 W to F
(SEQ ID NO:1)
2 E137K mutant 409 137 E to K
(SEQ ID NO:3) 605,606    202 W to F
3 111.136.7 453 151 F to L
485 162 L to P
917 306 N to I
932 311 A to V
966 322 L to F
4 111.136–9 449 150 F to S
453 151 F to L

EXAMPLE 3

Mariner-based Transposon Mutagenesis—Plasmid pKOS183-3

The basic transposon without the transposase gene was constructed by synthesizing an oligonucleotide containing the inverted repeats (111-158.1 CCGAATTCACAGGTTGGCTGATAAGTCCCCGGTCTGGATCCAGACCGGGGACTTATC AGCCAACCTGTGAATTCG [SEQ ID NO:11). The oligonucleotide was denatured and annealed with itself, cleaved with EcoRI, and ligated into the EcoRI site of pBluescriptIISK+, to create plasmid pKOS111-158. Next, the inverted repeat was moved into pSL1190 by cleaving pKOS111-158 with EcoRI, isolating the 70 bp fragment and ligating with pSL1190 cleaved with EcoRI and MfeI to create pKOS111-160. The kanamycin and bleomycin resistance gene from Tn5 were inserted between the inverted repeats of the mariner ends by cleaving pBJ160 with BamHI, making the DNA ends blunt with the Klenow fragment of DNA polymerase I. This fragment was ligated with the kanamycin and bleomycin resistance marker that had been isolated on a˜1.6 Kb EcoRI-BamHI fragment, the DNA ends made blunt, from pBJ180-1. The resulting plasmids, pKOS111-170.1.1 and pKOS111-170.1.2, are identical except they differ in the orientation of the resistance genes.

Next, the oriT region from RP4 was added to the two plasmids for the purpose of conjugating the final plasmids from E. coli to S. cellulosum or any host that is able to be conjugated with E. coli. First, the oriT region was isolated as a˜400 BamHI-PstI fragment from pBJ183 and ligated with pSL1190 cleaved with BamHI and PstI to create pKOS111-163. Next, the mini mariner transposon with the kanamycin and bleomycin resistance genes was removed from either pKOS111-170.1.1 or pKOS111-170.1.2 as an EcoRI-EcoRV fragment and ligated with pKOS111-163 cleaved with EcoRI and SmaI. This results in plasmids pKOS111-179.1 and pKOS111-179.2.

Plasmid pKOS111-147 was constructed by isolating the small ClaI-HindIII fragment from pKOS111-136-9 and ligating it with the large ClaI-HindIII fragment of pKOS111-136-7. This removes non consensus nucleotides from the 3′ end of the gene. The C. carnea consensus transposase was isolated by cleaving pKOS111-147 with NcoI and HpaI, isolating the ca. 400 bp fragment and ligating it into the NcoI and HpaI sites of pKOS111-161 resulting in plasmid pKOS111-189.1. To put the transposase gene downstream of the regulated T7A1 promoter, pKOS111-189.1 was cleaved with NcoI and HindIII and the 1.1 kb fragment was ligated with pUHE24-2B cleaved with NcoI and HindIII (plasmid pKOS111-190). Plasmid pUHE24-2B has the engineered T7A1 promoter (see Julien and Calender, 1995, “The purification and characterization of the bacteriophage P4Δ protein” J. Bact. 177:3743–51; Lanzer et al., 1988, “Promoters largely determine the efficiency of repressor action” Proc. Nat'l Acad Sci 85:8973–77).

The “mini mariner transposon” (comprising transposase, ITRs and antibiotic resistance) harboring the kanamycin and bleomycin resistance genes was cloned on the same plasmid as the transposase gene, pKOS111-179.1. Plasmid pKOS111-179.1 was cleaved with EcoRI, the DNA ends made blunt, and then cleaved with HindIII. The˜2.1 Kb fragment was isolated and ligated with pKOS111-190, that had been cleaved with XbaI, the DNA ends made blunt, and cleaved with HindIII. The resulting plasmid, pKOS183.3, contains the C. carnea consensus mariner transposase sequence (see FIG. 2), the mini mariner transposon, and the oriT region. A second plasmid containing the lacIq gene is required in E. coli to repress the transcription of the transposase gene.

EXAMPLE 4

Transposon-Based Mutagenesis in S. Cellulosum

The plasmid pKOS183-3 vector described in Example 3, was used to mutagenize S. cellulosum strain So ce90, essentially according to the procedure described by Jaoua et al., 1992, Plasmid 28:157–65. The number of mutants generated ranged from 16,000 to 80,000 per conjugation. Since approximately 1×109 S. cellulosum cells were used for the conjugation, this translates into a transposition frequency of 1×10−4 to 1×10−5 per cell. The frequency of transposition did not change if the S. cellulosum cells were heat shocked at 50° C. for 10 minutes or if the E. coli strain harbored the dam and dcm mutations, genes required for methylating DNA. Either heat shock or the use of the methylation free E. coli strain improves the efficiency of homologous recombination in S. cellulosum, but they appear not to be necessary for transposition (Jaoua et al., 1992; Pradella et al., 2002, “Characterisation, genome size and genetic manipulation of the myxobacterium Sorangium cellulosum So ce56” Arch Microbiol 178:484–92.

To demonstrate that the phleomycin resistant colonies contained random insertions of transposon in the chromosome, DNA from nine isolates was analyzed by Southern blot. FIG. 4 shows the autoradiogram of chromosomal DNA cleaved with BamHI, a site not found within the transposon, and probed with the kanamycin and bleomycin resistance genes. The figure shows varying banding pattern for each isolate, indicating apparent random insertion into the chromosome. The parent strain does not contain a sequence that hybridizes to this probe and no antibiotic resistant colonies were obtained in the absence of the transposase gene.

EXAMPLE 5

Insertional Inactivation of EpoK Gene of S. Cellulosum

To demonstrate that the mariner transposon constructed had the potential to insert into a gene of interest, the 1260 bp epoK gene was chosen for targeting. This gene is a cytochrome P450 that adds an epoxide to epothilones C and D to make epothilones A and B, respectively (Julien et al., 2000, “Isolation and characterization of the epothilone biosynthetic gene cluster from Sorangium cellulosum” Gene 249:153–60). Insertions in epoK would provide an S. cellulosum strain that would produce epothilones C and D.

The E. coli strain DH10B harboring pKOS111-47, pGZ 119EH, a lacIq plasmid, and pKOS183.3 was grown overnight without shaking at 37° C. to perform the conjugation with S. cellulosum. The strain Soce90 was grown in SYG to an OD600 between 1 and 2, 5 ml of the culture was concentrated and the cells were mixed with the DH10B, pKOS111-47, pGZ119EH, that had been concentrated from 5 ml, in 200 μl of CYE or SYG medium. The S. cellulosum cells can also be heat shocked for 10 minutes at 50° C., as done for conjugations with S. cellulosum, before concentrating but this does not appear to increase transposition frequency. The mixture of cells were spotted onto an S42 plate and incubated at 30° C. for 24 hours. The cells were then scraped into 1 ml of SYG and 20–30 μl were plated onto S42 plates containing 50 μg/ml gentamycin and 30–60 μg/ml phleomycin. After approximately 7–10 days of incubation at 30–32° C., colonies were picked and restreaked onto S42 plates containing 30 μg/ml phleomycin.

Colonies that were phloemycin resistant and harboring epoK mutations were confirmed by PCR analysis or, alternatively, tested for the presence of epothilones by HPLC methods. PCR analysis was performed by using primers that flank the epoK gene, 178-164.1 (CCGCGTTCGAGGCAAAATGATGGCAGCCTC [SEQ ID NO:7) and 178-164.2 (GGATTCGATCTTCGCGCGCTGACAATGGGC [SEQ ID NO:8]), and one for the transposon inverted repeat 183-47.15 (GGGGACTTATCAGCC-AACCTG [SEQ ID NO:9]).

Using the transposon, approximately 12,000 insertion mutant strains were generated in So ce90 and pools of 1000 mutants were grown in liquid medium. DNA was isolated from each of the pools and PCR reaction using primers annealing to the inverted repeat of the transposon and sequence upstream of epoK were performed. Five of the pools gave a PCR product. Sequencing of the PCR products showed that the transposon had inserted into 5 out of 21 TA sequences within the epoK gene, at nucleotides 277, 342, 377, 781, and 1016.

EXAMPLE 6

Increased Levels of Methylmalonyl-CoA

The pool of available methylmalonyl-CoA for the biosynthesis of epothilones is increased by inserting an additional source of cellular methylmalonyl CoA into a host cell. The host cell S. cellulosum produces both malonyl-CoA and methylmalonyl-CoA which are predicted to be synthesized using the accA and pccB genes, as has been reported for M. xanthus. The accA and pccB genes are PCR amplified and assembled into an operon along with a prpE gene, which encodes a propionyl CoA ligase, and a promoter from a PKS operon such as from the epothilone, soraphen, or tombamycin PKS gene clusters, located upstream of the genes. The synthetic operon is placed between the inverted repeats of the Tn5 or mariner transposon and transposed into the chromosomes of S. cellulosum. By increasing the input of starting materials into the epothilone biosynthesis pathway increased production of epothilones are obtained. Because epothilone D requires methylmalonyl-CoA for module 4 whereas epothilone C requires malonyl-CoA, the amount of epothilone D relative to epothilone C is thus increased. But because methylmalonyl-CoA is limiting, more epothilone C has been observed relative to epothilone D produced.

EXAMPLE 7

Introduction of Polyketide Precursor Biosynthesis Pathways in Host Cells

An alternative pathway for synthesis of malonyl-CoA and methylmalonyl-CoA is effectuated by the matB and matC gene products from Rhizobium leguminosarum bv, trifolii. MatB is a ligase that can attach a CoA group to malonic or methylmalonic acid. MatC is a transporter gene required to transport malonic or methyl malonic acid into the cell. The matB and matC genes are fused to an S. cellulosum promoter from the epothilone, soraphen, or tombamycin PKS gene clusters, and together placed between inverted repeats of the mariner transposon and transposed into the chromosome of S. cellulosum.

EXAMPLE 8

Minimal Tn5 Transposon for Use in S. Cellulosum

The wild type Tn5 transposon was transposed into the multicloning site of pBluescriptSKII+ to create plasmid vector pBJTn5. Plasmid vector pBJTn5 serves as a convenient vector for removing pieces of the transposon for construction of a minimal version. To isolate one of the inverted repeats, the inside end (IE), pBJTn5 is cleaved with PstI and PvuII and ligated into the PstI and StuI sites of pSL1190 (Amersham Pharmacia) to create pBJ101. To add the other inverted repeat and the tnp gene, pBJTn5 was cleaved with ApaI and BclI and the ca. 1500 bp fragment was ligated with pBJ100 cleaved with ApaI and BamHI to create pBJ101. A BamHI site was introduced by ligating a BamHI linker into the EcoRV site of pBJ101 to create pBJ102. This plasmid contains the basic requirements for transposition with the addition of an antibiotic resistance marker. This minimal transposon has been shown to work in M. xanthus.

In order to overexpress the tnp gene to get higher transposition frequency, the tnp gene is removed from pBJ102 by cleaving pBJ102 with EagI. The DNA ends are made blunt with the Klenow fragment of DNA polymerase I, and then cleaved with EcoRI. The˜180 bp fragment, which contains the outside end (OE) is ligated into the BssHII site made blunt with the Klenow fragment of DNA polymerase I and EcoRI sites of pBJ1302. This results in a minimal miniTn5 transposon that contains one inside and one outside end of the inverted repeat.

The 1446 bp BspHI fragment from pBJ102 was ligated into the NcoI site of pUHE24-2Bf+ to create pBJ116, and so clone the tnp gene in a regulatable expression vector. In this plasmid, the Tn5 tnp gene is under the regulatable T7A1 promoter. There is a mutant form of the transposase protein that increases the transposition frequency. To construct this mutant, pRZ4857 was cleaved with HpaI and BglII and the 1330 bp fragment was ligated with pBJ116 cleaved with HpaI and BglII to create pBJ116*.

A mini transposon containing an OE and an IE for S. cellulosum was constructed by isolating the oriT fragment from pBJ183 as a BamHI PstI fragment, blunting the DNA ends made with the Klenow fragment of DNA polymerase I, and ligating into pBJ115 cleaved with ApaI site, which had the DNA ends made blunt with the Klenow fragment of DNA polymerase I, to make pKOS249-57. The hygromycin resistance marker was added to this plasmid by cleaving pKOS183-121 with BamHI and HindIII, the DNA ends were made blunt with the Klenow fragment of DNA polymerase I, and ligating the˜1600 bp fragment into the SnaBI site I of pKOS249-57 to create pKOS249-58.

A minitransposon containing two OE ends, was made by cleaving pKOS249-58-1 with BstI Z17I. The resulting DNA ends are made blunt with the Klenow fragment of DNA polymerase I, and the oriT OE HygR fragment was ligated to pBJ115 cleaved with BstZ17I PstI and the DNA ends made blunt with the Klenow fragment of DNA polymerase I to create pKOS249-58-2. To add the tnp gene, pKOS249-58-2 was cleaved with BstBI and SpeI, the DNA ends made blunt with the Klenow fragment of DNA polymerase I and the oriT OE HygR OE fragment was ligated into either pBJ116* or pBJ116 cleaved with BamHI and XbaI, the DNA ends made blunt with the Klenow fragment of polymerase I to create pKOS249-59-2 & pKOS249-59-4, respectively.

To add either the wild type or mutated transposase genes to the mini Tn5 hygromycin construct, pKOS249-58 was cleaved with PstI and SmaI, the DNA ends were made blunt with the Klenow fragment of DNA polymerase I, and the miniTn5 hyg fragment was ligated into either pBJ116 or pBJ116* that had been cleaved with XbaI and BamHI and the DNA ends were made blunt with the Klenow fragment of DNA polymerase I to create pKOS249-59a and pKOS249-59b.

Both pKOS249-59a and pKOS249-59b are conjugated into S. cellulosum using established protocols and hygromycin resistant colonies are selected to test for transposition. In an initial experiment, no transposition was detected, perhaps due to the absence of host factors.

All publications and patent documents cited herein are incorporated herein by reference for all purposes, as if each such publication or document was specifically and individually indicated to be incorporated herein by reference. Although the present invention has been described in detail with reference to one or more specific embodiments, those of skill in the art will recognize that modifications and improvements are within the scope and spirit of the invention, as set forth in the claims which follow. Citation of publications and patent documents is not intended as an admission that any pertinent prior art, nor does it constitute any admission as to the contents or date of the same. The invention having now been described by way of written description and example, those of skill in the art will recognize that the invention can be practiced in a variety of embodiments and that the foregoing description and examples are for purposes of illustration and not limitation of the following claims.

Claims

What is claimed is:

1. A method of altering deoxyribonucleic acid (DNA) in a Sorangium host cell, said method comprising transforming said host cell with a mariner-type transposon vector comprising inverted terminal repeat sequences (ITRs) and a gene encoding a transposase that recognizes the ITRs, whereby the transposon vector transposes into said DNA.

2. The method of claim 1 wherein expression of the gene encoding the transposase is under control of a T7A1 promoter.

3. The method of claim 1 wherein the transposase is encoded by a gene isolated from a Chrysoperla carnea lacewing fly mariner transposon.

4. The method of claim 3 wherein the transposase has an amino acid sequence encoded by:

(a) the nucleotide sequence of SEQ ID NO:1 except that the residue encoded at nucleotides 409–411 is lysine;

(b) the nucleotide sequence of SEQ ID NO:3, with the proviso that R1, R5 and R6 are not G nucleotides;

(c) the nucleotide sequence of SEQ ID NO:3, with the proviso that the residue encoded at nucleotides 409–411 is lysine;

(d) the nucleotide sequence of SEQ ID NO:3 with the proviso that the nucleotide at position 509 is adenine, the nucleotide at position 605 is thymidine, and the nucleotide at position 606 is cytosine.

5. The method of claim 1 wherein the transposase has an amino acid sequence of SEQ ID NO:2.

6. The method of claim 5 wherein the gene encoding said transposase has the nucleotide sequence of SEQ ID NO:1.

7. The method of claim 3 wherein the gene encoding said transposase has the nucleotide sequence of SEQ ID NO:3 with the proviso that R1, R5 and R6 are not G residues.

8. The method of claim 1, wherein said host cell is a Sorangium cellulosum host cell.

9. The method of claim 1 wherein said transposon vector transposes into said DNA and disrupts a gene contained in said DNA.

10. The method of claim 9, wherein said host cell is a Sorangium cellulosum host cell that produces epothilone A and B, and the gene that is disrupted is epoK, and the host cell no longer produces epothilone A or B after said transposition.

11. The method of claim 10, wherein said host cell produces epothilone C and D but not epothilone A and B after said transposition.

12. The method of claim 11, further comprising the step of culturing said host cell under conditions that lead to the production of epothilones C and D.

13. The method of claim 1 wherein said transposon vector transposes into said DNA at a location that does not disrupt a gene.

14. The method of claim 1 wherein said transposon vector comprises exogenous genes in addition to the transposase gene.

15. The method of claim 14 wherein the genes are selectable markers.

16. The method of claim 14, wherein said transforming results in introducing said exogenous genes into the genome of the host cell.

17. The method of claim 16, wherein said genes to be introduced into the host cell are selected from the group consisting of Salmonella typhimurium prpE, Streptomyces coelicolor accA, Streytomyces coelicolor pccB, Rhizobium leguminosarum bv. trifolii matB and Rhizobium leguminosarum bv. trifolii matC.

18. The method of claim 1, wherein said transposon terminal repeat sequences (ITRs) flank said gene encoding said transposase, wherein said transposase is a mariner-type transposase and said gene is under the control of a T7A1 promoter.

19. The method of claim 1, wherein said transposon terminal repeat sequences (ITRs) flank said gene encoding said transposase, wherein said gene comprises the nucleotide sequence of SEQ ID NO:3 with the proviso that R1, R5 and R6 of said transposase gene sequence are not G residues, and said transposon vector further comprises a selectable marker.

20. The method of claim 19, wherein said transposase comprises the amino acid sequence of SEQ ID NO:2 or is an E137K variant thereof.

21. The method of claim 20, wherein said gene encoding said transposase is under the control of a T7A1 promoter.

22. The method of claim 19, wherein said transposon ITRs comprise the nucleotide sequence ACAGGTTGGCTGATAAGTCCCCGGTCTGGATCC AGACCGGGGACTTATCAGCCAACCTGT (SEQ ID NO:10).

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: