-
2007-04-10
10/762,888
2004-01-21
US 7,201,899 B2
2007-04-10
-
-
Shin-Lin Chen
2025-01-21
Human pre-formed xenoantibodies play an important role in the hyperacute rejection response in human xenotransplantation. Disclosed are materials and methods for removing or neutralizing such antibodies. Also disclosed are materials and methods for reducing or eliminating the epitopes in the donor organs that are recognized by such antibodies. Such epitopes are formed as the result of activity by the enzyme α-1,3 galactosyltransferase. The porcine gene encoding α-1,3 galactosyltransferase is disclosed, as are materials and methods for inactivating (“knocking out”) the α-1,3 galactosyltransferase gene in mammalian cells and embryos. Included are nucleic acid constructs useful for inactivating the α-1,3 galactosyltransferase gene in a target cell. Also disclosed is a novel leukemia inhibitory factor (T-LIF) that is useful for maintenance of embryonic stem cells and primordial germ cells in culture.
Get notified when new applications in this technology area are published.
A01N63/00 IPC
Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
C12N15/00 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
C12N15/63 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
C12N15/87 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
C07H21/04 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
This application claims benefit of priority, and is a continuation, of U.S. application Ser. No. 08/984,900, filed Dec. 4, 1997, now U.S. Pat. No. 6,849,448, which claims benefit of priority, and is a divisional, of U.S. application Ser. No. 08/378,617, filed Jan. 26, 1995, now U.S. Pat. No. 5,849,991, issued Dec. 15, 1998, which claims benefit of priority, and is a continuation-in-part, of U.S. application Ser. No. 08/188,607, filed Jan. 27, 1994, now abandoned.
This invention relates generally to the field of xenotransplantation. In particular this invention relates to methods and materials for reduction or elimination of the hyperacute rejection response in humans. More particularly, this invention relates to methods for treating human serum to reduce or eliminate hyperacute rejection. This invention also relates to methods and materials for generating non-human organs lacking or having reduced α 1,3 galactosyl transferase activity.
It is widely acknowledged that there is an acute, worldwide shortage of human organs for transplantation. This is in spite of legislative changes and education programs to increase public awareness of the problem. In the United States, for example, there is an estimated annual shortfall of approximately 18,000 kidneys/year. Similarly, in Australia in 1992, only 41% of renal patients awaiting transplantation received transplants. In Japan the imbalance between supply and demand is even greater due to religious prohibitions on the use of organs from cadaveric donors.
The benefits of transplantation can be seen by comparing the rehabilitation rates of transplant patients with those of dialysis patients. In Australia and New Zealand, the majority of transplant patients (60%) are capable of full time work or school with a further 10% in part time work, while only 7% are unfit for work. In contrast, 23% of dialysis patients are capable of full time work or school, with 15% involved in part time work and 20% unfit for work. The remainder are “retired.” Fifteenth Report of the Australia and New Zealand Dialysis and Transplant Registry (ANZDATA), Queen Elizabeth Hospital, Woodville, S.A., APS Disney, ed. (1992).
The direct financial cost of dialysis in Australia and New Zealand is approximately $A45,000/patient/year. In addition, indirect costs due to unemployment and sickness are higher in dialysis patients and the social costs are considerable. Transplantation engenders an expense of approximately $A30,000/patient in the first year and $A14,000/patient/year thereafter. These statistics indicate that a) transplantation is the optimal therapy for end stage renal failure; b) there is an undersupply of donor kidneys; and c) present strategies aimed at increasing the transplant rate have been less than successful. There are, in addition, serious shortages of other transplantable organs including hearts, livers, lungs and pancreases.
The use of xenografts (transplants between species) is one option for overcoming the short supply of human organs for transplantation. Non-viable, non-antigenic xenografts are commonly used in vascular reconstruction (bovine arteries) and in cardiac surgery (porcine cardiac valves). However, despite their occasional use in the past, immunological barriers have prevented the common use of viable xenografts. Between 1964 and 1991 a total of 27 non-human primate to human organ xenografts was reported; the longest reported patient survival was 9 months. Two liver transplants from baboon to human were recently performed in anticipation that modern immunosuppressive therapies could cope with the severe rejection problems likely to occur in xenotransplantation. To date, the course of one of these patients has been reported, and in this case rejection was not the direct cause of death. Starzl et al., Baboon-to-Human Liver Transplantation. Lancet 341: 65–71 (1993). This clinical experience indicates that a) non-human organs can function and support human life; b) rejection episodes can be reversed by conventional anti-rejection therapy; and c) the mechanisms of rejection are similar, in principle, to those in allograft rejection.
It is unlikely that primates will be a satisfactory source of organs for xenotransplantation. Most are endangered species, breed slowly in the wild and poorly in captivity. The baboon is an exception to these generalizations, but other disadvantages limit the usefulness of this species. Baboons have single pregnancies, long gestation times, are difficult and expensive to maintain and may be infected with or carry organisms, particularly viruses, that are pathogenic in humans. For hearts and kidneys where organ size may be a consideration, the smaller primates are unsatisfactory as donors to human adults. Finally, the use of primates is likely to arouse considerable opposition from the public.
These difficulties have led to renewed interest in the use of non-primate species as organ donors for human patients. The pig is a widely acknowledged choice for xenotransplantation into humans. The pig erythrocyte diameter (6.5 μm) and, by implication, its capillary size, are similar to humans, facilitating connection of xenografts to the human circulatory system. The pig breeds well in captivity, has a short gestation time and produces large litters. In addition, pigs can be bred and maintained in low pathogen facilities, can be reared to any size and do not arouse the level of public reaction associated with primates.
The immunological barriers to use of pig organs in human patients include a) an immediate severe (“hyperacute”) rejection phenomenon that develops in minutes to hours after transplantation, and b) a proposed acute rejection that develops in days to weeks. Once the hyperacute rejection phenomenon has been overcome, it is expected that normal acute rejection would ensue. This form of rejection is thought to be similar to that experienced with allografts (transplants between individuals of the same species) and should be amenable to normal immunosuppressive therapies.
Both preformed “natural antibodies” (xenoantibodies) and complement regulating factors in human serum are thought to be involved in the process of hyperacute rejection. Hyperacute rejection is thought to be initiated when xenoantibodies bind to epitopes on the endothelium of a donor organ, activating the classical complement pathway.
A purified and isolated nucleic acid molecule of the present invention comprises the porcine nucleic acid sequence depicted in FIG. 4 (SEQ ID NO: 7), which encodes a porcine polypeptide having α-1,3 galactosyltransferase activity. Variations on this sequence that may be routinely generated by the skilled artisan include those sequences corresponding to FIG. 4 but varying within the scope of the degeneracy of the genetic code. That is, the present invention includes variants of the sequence set out in FIG. 4, readily determined by the skilled artisan, that code for the same amino acid sequence encoded by the sequence set out in FIG. 4. The present invention also includes a purified and isolated nucleic acid molecule that encodes a porcine α-1,3 galactosyltransferase and that hybridizes under standard high stringency conditions with a sequence complementary to the sequence set out in FIG. 4, or with a sequence complementary to a variation of the sequence set out in FIG. 4 within the scope of the degeneracy of the genetic code. The complementary strands to the above-described nucleic acid sequences are readily determined by standard methods, and are also within the scope of the present invention.
Within the parameters set out in the preceding paragraph, the present invention includes variants of the porcine α-1,3 galactosyltransferase coding sequence that preserve the functional characteristics of the native gene product. Such variants include, for example, minor nucleotide variations in the 5′ untranslated region or in various coding regions of the disclosed sequence. Minor amino acid variations deriving from changes in the coding regions, that leave a functional α-1,3 galactosyltransferase catalytic site, membrane anchor domain and stem region as described below, are within the scope of the present invention. Such routine variations in nucleic acid and amino acid sequences can be identified by those having ordinary skill in the art based on the sequence and structural information provided herein.
As used herein, “high stringency conditions” are those hybridization conditions generally understood by the skilled artisan to reflect standard-conditions of high stringency as set out in widely recognized protocols for nucleic acid hybridization. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual (2nd Edition), Cold Spring Harbor Laboratory Press (1989), pp. 1.101–1.104; 9.47–9.58 and 11.45–11.57. Generally, these conditions reflect at least one wash of the hybridization membrane in 0.05× to 0.5×SSC with 0.1% SDS at 65° C., or washing conditions of equivalent stringency.
The present invention also includes a host cell transformed with any of the above-described purified and isolated nucleic-acid molecules, as well as a porcine α-1,3 galactosyltransferase encoded by such transforming nucleic acid molecules and expressed from the host cell. Methods for transforming appropriate host cells and for expressing polypeptides from such host cells are known in the art and are described, for example, in Sambrook et al., (1984), pp. 12.2–12.44; 16.3–17.44.
The invention further includes a DNA construct useful for inactivating the porcine α-1,3 galactosyltransferase gene by insertion of a desired DNA sequence into an insertion site of the gene. As used herein, the term “α-1,3 galactosyltransferase gene” includes the exons encoding or potentially encoding α-1,3 galactosyltransferase, introns contiguous with such exons, and regulatory elements associated with such exons and introns. The DNA construct includes the desired DNA sequence flanked by first and second homology sequences. These first and second homology sequences are sufficiently homologous, respectively, to first and second genomic sequences flanking the insertion site to allow for homologous recombination of the DNA construct with the porcine α-1,3 galactosyltransferase gene when the DNA construct is introduced into a target cell containing the porcine α-1,3 galactosyltransferase gene. Preferably the insertion site is within exon 4, exon 7, exon 8 or exon 9 of the porcine α-1,3 galactosyltransferase gene. The desired DNA sequence is preferably a selectable marker, including but not limited to the neoR gene, the hydromycin resistance (hygR) gene and the thymidine kinase gene. The desired DNA sequence may be bordered at both ends by FRT DNA elements, with stop codons for each of the three reading frames being inserted 3′ to the desired DNA sequence. Presence of the FRT elements allows the selectable marker to be deleted from the targeted cell, and the stop codons ensure that the α-1,3 galactosyltransferase gene remains inactivated following deletion of the selectable marker.
The invention further includes a DNA construct useful for inactivating the murine α-1,3 galactosyltransferase gene by insertion of a desired DNA sequence into an insertion site of the gene. The DNA construct includes the desired DNA sequence flanked by first and second homology sequences. These first and second homology sequences are sufficiently homologous, respectively, to first and second genomic sequences flanking the insertion site to allow for homologous recombination of the DNA construct with the murine α-1,3 galactosyltransferase gene when the DNA construct is introduced into a cell containing the murine α-1,3 galactosyltransferase gene. Preferably the insertion site is within exon 4, exon 7, exon 8 or exon 9 of the murine α-1,3 galactosyltransferase gene. The desired DNA sequence is preferably a selectable marker, including but not limited to the neoR gene, the hygR gene and the thymidine kinase gene. The desired DNA sequence may be bordered at both ends by FRT DNA elements, with stop codons for each of the three reading frames being inserted 3′ to the desired DNA sequence. Presence of the FRT elements allows the selectable marker to be deleted from the targeted cell, and the stop codons ensure that the α-1,3 galactosyltransferase gene remains inactivated following deletion of the selectable marker.
The invention also includes methods for generating a mammalian totipotent cell having at least one inactivated (non-functional) α-1,3 galactosyltransferase alleles, where the totipotent cell is derived from a mammalian species in which alleles for the α-1,3 galactosyltransferase gene normally are present and functional. A “functional” allele is capable of being transcribed and translated to produce a polypeptide having an activity the same as or substantially similar to the native α-1,3 galactosyltransferase. The methods include providing a plurality of cells characterized as totipotent cells of the aforementioned mammalian species, introducing into the totipotent cells a nucleic acid construct effective for inactivating the α-1,3 galactosyltransferase gene by insertion of a desired DNA sequence into an insertion site of the gene through homologous recombination, and then identifying a totipotent cell having at least one inactivated α-1,3 galactosyltransferase allele.
The totipotent cells can include, without limitation, embryonic stem (ES) cells, primordial germ cells (PGC's) and eggs. The cells can be taken from a variety of mammalian species in which alleles for the α-1,3 galactosyltransferase gene are present and functional, including without limitation murine and porcine species.
The invention further includes methods for generating a mammal lacking a functional α-1,3 galactosyltransferase gene, where the mammal belongs to a species having a functional α-1,3 galactosyltransferase gene. The methods include providing a mammalian totipotent cell having at least one inactivated α-1,3 galactosyltransferase allele, where the totipotent cell is derived from the aforementioned mammalian species having a functional α-1,3 galactosyltransferase gene, manipulating the totipotent cell such that mitotic descendants of the cell constitute all or part of a developing embryo, allowing the embryo to develop to term, recovering a neonate individual derived from the embryo, and raising and breeding the neonate to obtain a mammal homozygous for an inactivated α-1,3 galactosyltransferase allele, i.e., a mammal in which both α-1,3 galactosyltransferase allele are inactivated.
The totipotent cells can include, without limitation, ES cells, PGC's and eggs. The cells can be taken from a variety of mammalian species in which alleles for the α-1,3 galactosyltransferase gene are present and functional, including without limitation murine and porcine species. ES cells and PGC's are manipulated in various ways such that their mitotic descendants are found in a developing embryo. These manipulations can include, without limitation, injection into a blastocyst or morula, co-culture with a zona pellucida-disrupted morula, and fusion with an enucleated zygote. Cells injected into a blastocyst- or morula-stage embryo become incorporated into the inner cell mass of the blastocyst embryo, giving rise to various differentiated cell types of the resulting embryo, including in some cases germ cells. The embryo derived from such manipulations is a chimera composed of normal embryonic cells as well as mitotic descendants of the introduced ES cells or PGC's. Alternatively, chimeric embryos can be obtained by co-culturing at least one ES cell or PGC with a morula embryo in which the zona pellucida is sufficiently disrupted to allow direct contact between the ES cell/PGC and at least one cell of the morula. The zona pellucida-disrupted embryo may be an embryo that is completely free of the zona pellucida. Finally, the genome of an ES cell or PGC can be incorporated into an embryo by fusing the ES cell/PGC with an enucleated zygote. Such a procedure is capable of generating a non-chimeric embryo, i.e., an embryo in which all nuclei are mitotic descendants of the fused ES cell/PGC nucleus. The resulting embryos are implanted in a recipient female, or surrogate mother, and allowed to develop to term.
When eggs, as opposed to ES cells or PGC's, are directly injected with a nucleic acid construct effective for inactivating the α-1,3 galactosyltransferase gene, the eggs can be manipulated to form an embryo by implanting into a recipient female.
The invention also includes a mammal, produced through human intervention, that lacks a functional α-1,3 galactosyltransferase gene. The mammal belongs to a species in which the α-1,3 galactosyltransferase gene is normally present and functional. The mammal can be, without limitation, a mouse or a pig.
The invention further includes a purified and isolated nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of (1) the nucleic acid sequence depicted in FIG. 26 (SEQ ID NO: 25), (2) a sequence corresponding to the sequence of (1) within the scope of the degeneracy of the genetic code, and (3) a sequence that encodes murine T-LIF and that hybridizes under standard high stringency conditions with a sequence complementary to the sequence of (1) or (2). The complementary strands to the above-described nucleic acid sequences are readily determined by standard methods, and are also within the scope of the present invention.
The present invention also includes a host cell transformed with any of the purified and isolated nucleic acid molecules described in the preceding paragraph, as well as a T-LIF polypeptide encoded by such transforming nucleic acid molecules and expressed from the host cell.
The invention further includes a purified and isolated nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of (1) the nucleic acid sequence depicted in FIG. 27 (SEQ ID NO: 31), (2) a sequence corresponding to the sequence of (1) within the scope of the degeneracy of the genetic code, and (3) a sequence that encodes human T-LIF and that hybridizes under standard high stringency conditions with a sequence complementary to the sequence of (1) or (2). The complementary strands to the above-described nucleic acid sequences are readily determined by standard methods, and are also within the scope of the present invention.
The present invention also includes a host cell transformed with any of the purified and isolated nucleic acid molecules described in the preceding paragraph, as well as a T-LIF polypeptide encoded by such transforming nucleic acid molecules and expressed from the host cell.
The invention further includes a method for eliminating or reducing hyperacute rejection of non-primate mammalian cells by human serum, comprising adding, to the human serum, a physiologically acceptable amount of galactose or a saccharide in which the terminal carbohydrate is an a galactose linked at position 1, prior to exposure of the human serum to the non-primate cells. The amount of galactose or saccharide added is sufficient to reduce or eliminate the hyperacute rejection response. The saccharide can be, without limitation, melibiose, galactose α1-3 galactose or stachyose. Alternatively, the human serum can be treated so as to be substantially depleted of immunoglobulin, IgM antibodies, anti-GAL IgM and IgG antibodies, or anti-GAL IgM antibodies. The invention further includes affinity-treated human serum substantially free of anti-GAL antibodies or of anti-GAL IgM antibodies.
FIG. 1 is a graphical representation of fluorescence intensity following immunofluorescent-staining of porcine aortic endothelial cells with anti-GAL antibody alone or with anti-GAL antibody that was preincubated with selected saccharides.
FIG. 2 shows the results of an experiment in which lysis of porcine aortic endothelial cells by human serum and by purified anti-GAL antibodies was determined using a 51CR release assay.
FIG. 3 depicts physiograph tracings of perfused rat heart contractions in the presence of human serum with or without selected saccharides.
FIG. 4 is a comparison of the porcine α-1,3 galactosyltransferase cDNA sequence with the corresponding murine and bovine sequences. PGTCD=porcine sequence (SEQ ID NO:7). BOVGSTA=bovine sequence (SEQ ID NO:8). MUSGLYTNG=murine sequence (SEQ ID NO:9).
FIG. 5 is a comparison of the porcine α-1,3 galactosyltransferase amino acid sequence with the corresponding murine and bovine amino acid sequences. PGT=porcine sequence (SEQ ID NO:10). BGT=bovine sequence (SEQ ID NO:11). MGT=murine sequence (SEQ ID NO:12).
FIG. 6 depicts the Sal1 restriction sites in four overlapping phage clones spanning a portion of the murine α-1,3 galactosyltransferase genomic region.
FIG. 7 is a detailed restriction map of murine α-1,3 galactosyltransferase subclone pαGT-S5.5.
FIG. 8 is a detailed restriction map of murine α-1,3 galactosyltransferase subclone pαGT-S4.0.
FIG. 9 is a detailed restriction map of murine α-1,3 galactosyltransferase subclone pαGT-S11.
FIG. 10 is a detailed restriction map of murine α-1,3 galactosyltransferase subclone pαGT-S13.
FIG. 11 is an additional detailed restriction map of murine α-1,3 galactosyltransferase subclone pαGT-S5.5.
FIG. 12 is an additional detailed restriction map of murine α-1,3 galactosyltransferase subclone pαGT-S4.0.
FIG. 13 is a diagram of a knockout construct carrying the 4.0 and 5.5 kb Sal1 fragments from pαGT-S5.5 and pαGT-S4.0, which flank the Exon 9 Sal1 site.
FIG. 14 depicts the 8.3 kb and 6.4 kb BglII fragments that are diagnostic for the uninterrupted α-1,3 galactosyltransferase gene and the targeted (inactivated) α-1,3 galactosyltransferase gene, respectively, using the probes identified in the text.
FIG. 15 is a schematic representation of the generation of a knockout construct using the vector pαGT-S5.5 as the starting vector.
FIG. 16 sets out the nucleotide sequence (SEQ ID NO:13) of a neomycin resistance cassette used in the construction of a DNA construct for interrupting the α-1,3-GalT gene in mice
FIG. 17 is a diagram of one example of a final knockout construct that has been sequenced to confirm the identity, copy number and orientation of the various inserts.
FIG. 18 is a Southern blot of genomic DNA from various murine ES cell lines transformed with the knockout construct of FIG. 16, probed to reveal the diagnostic fragments depicted in FIG. 14.
FIG. 19 depicts the “long” PCR products derived from wild type and interrupted α-1,3-GalT genes using the designated primers.
FIG. 20 is a Southern blot of long PCR products obtained from wild type and knockout mice.
FIG. 21 depicts the PCR products used for identification of the interrupted (targeted) galT locus.
FIG. 22 shows PCR products generated from mice carrying interrupted (inactivated) GalT alleles.
FIG. 23 depicts the PCR products expected from PCR analysis of cDNA generated from α-1,3-GalT mA in normal and knockout mice. The ferrochelatase primers and PCR fragment represent a control demonstrating that cDNA synthesis had occurred.
FIG. 24 shows the PCR fragments generated from cDNA obtained from RNA isolated from kidney (K), heart (H) and liver (L) of a wild-type mouse (+/+), a mouse heterozygous for the interrupted α-1,3-GalT allele (+/−) and a mouse homozygous for the interrupted α-1,3-GalT allele (−/−).
FIG. 25 is a graphical representation of the relative protection of spleen cells, derived from GalT knockout mice, from lysis by human serum.
FIG. 26 is a representation of the nucleotide sequence (SEQ ID NO:25) and deduced amino acid sequence (SEQ ID NO:26) for murine T-LIF.
FIG. 27 is a representation of the nucleotide sequence (SEQ ID NO:31) and deduced amino acid sequence (SEQ ID NO:32) for human T-LIF.
FIG. 28 is a Western blot of LIF polypeptides expressed from transfected COS cells.
FIG. 29 is a diagram of the expression plasmid used for transfection of the COS cells of FIG. 27.
FIG. 30 is a Southern blot of PCR-amplified cDNA from murine ES cells, using a LIF-specific probe.
Evidence presented herein establishes that a substantial portion of human pre-formed, anti-pig xenoantibodies recognize a specific terminal galactose linkage on the surface of pig endothelial cells. As demonstrated in experiments carried out by the present inventors, it is possible to reduce the titers of preformed xenoantibodies by adsorption with immobilized antigens containing the appropriate epitopes. This leads to reduction or elimination of cellular responses associated with the hyperacute rejection response. Conversely, it is demonstrated to be possible to neutralize such antibodies by addition of appropriate carbohydrate antigens to human serum. In demonstrating the usefulness of these approaches, it was necessary to identify the relevant carbohydrate moieties and to demonstrate their efficacy in cultured cell systems and, importantly, in whole organs. As such, one approach to reducing or eliminating the hyperacute rejection response is identified as treatment of the recipient by eliminating or neutralizing the relevant antibody populations.
An alternative approach to xenotransplantation would be elimination of the relevant epitope(s) in the donor organ. This could be accomplished, for example, by reducing or eliminating expression of the gene(s) encoding the metabolic machinery responsible for formation of the epitopes. The epitope defined by the α-1,3 galactose linkage (termed the GAL epitope) is generated by the enzyme UDP-galactose: β-D-galactosyl-1,4-N-acetyl-D-glucosaminide α-1,3 galactosyl-transferase (“α-1,3 galactosyltransferase” or “α-1,3-GalT”). This enzyme transfers galactose to the terminal galactose residue of N-acetyllactosamine-type carbohydrate chains and lactosaminoglycans. The reaction catalyzed by α-1,3-GalT may be summarized as follows:
UDP-Gal+Galβ-1,4-GlcNAc-R→Galα-1,3-Galβ-1,4-GlcNAc-R+UDP
The α-1,3-Gal T enzyme is found in most mammals, but is not present in Old World monkeys and humans. For purposes of xenotransplantation, it is significant that humans and Old World monkeys have naturally occurring xenoantibodies directed against the GAL epitope. The use of pig organs lacking the GAL epitope could reduce or eliminate the hyperacute rejection of such organs by human recipients. The utility of such an approach is buttressed by the present inventors' demonstration that the GAL epitope is, in fact, central to the hyperacute rejection phenomenon in cells and whole organs. One approach to obtaining such organs would be to generate pigs in which the gene encoding the α-1,3-GalT enzyme is “knocked out” by homologous recombination.
The present inventors have affinity purified antibodies directed against the GAL epitope (anti-GAL antibodies) from human serum. This was accomplished with affinity columns comprising the appropriate epitopes (e.g., galactosyl-galactose or melibiose) attached to a solid phase. Total anti-GAL IgG and IgM were obtained in one set of experiments. In an alternative approach, anti-GAL IgG was obtained by passage of serum over an affinity column with specificity for all proteins except albumin and IgG. The wash-through from this column was then applied to a galactosyl-galactose affinity column and purified anti-GAL IgG was collected as the eluate. The obtained anti-GAL IgG can be further purified by passage over a protein G column, which specifically binds IgG but not other antibody isotypes. Conversely, the wash-through from the above-described columns can be used as sources of total anti-GAL (IgG+IgM)-depleted serum or of anti-GAL IgG-depleted serum in further experiments. Preferably, the anti-GAL antibody preparations are characterized for protein content, molecular weight and purity, and for antibody class and isotype.
To demonstrate the role of the GAL epitope in the hyperacute rejection response, it is necessary, first, to establish that IgG and IgM anti-GAL antibodies react with porcine cells and tissues. The present inventors investigated the binding of human anti-GAL antibodies to porcine cells and tissues using immunofluorescent staining. In this technique, selected human antibody preparations are reacted with intact porcine cells and then reacted with signal antibody comprising non-human anti-human IgG or IgM labeled with fluorescein isothiocyanate (FITC). Stained cells may be detected and quantified with a fluorescence-activated cell sorter (FACS) or other appropriate detection means. Other methods for detecting the presence of a bound antibody on a cell surface, for example through use of enzyme-labeled signal antibody reagents, are known to the skilled artisan.
Total anti-GAL (IgM and IgG), as well as purified anti-GAL IgG, stained cells from a porcine epithelial cell line (PK1) as well as cells from a porcine aortic endothelial cell line (PAE). Neither anti-GAL (total IgM+IgG) antibody-depleted serum nor anti-GAL IgG-depleted serum gave detectable staining. To further investigate the specificity of the response, it is desirable to determine whether or not reactivity of the antibodies with porcine cells can be diminished or eliminated by prior exposure to one or more molecules suspected of comprising the epitope(s) in question. In this regard, the present inventors have established that antibody binding is inhibited by galactose and by disaccharides having terminal galactose residues in the α1 configuration. Staining was not inhibited with sugars having a terminal galactose in a β1→4 configuration. These results demonstrate the specificity of the antibody binding and the ability of appropriate sugars to inhibit such binding.
Reactivity of anti-GAL antibodies with cultured pig cells was confirmed using tissue sections of pig organs. Again, using a fluorescent signal antibody system, staining was seen with total anti-GAL IgM+IgG and with purified anti-GAL IgG but not with the anti-GAL antibody-depleted sera. Staining was particularly-strong with kidney, heart and liver endothelium, with heart endocardium and with bile duct epithelium. The tissue binding was inhibited with melibiose but was not inhibited by other disaccharides not representative of the GAL epitope.
These data clearly indicate that the GAL epitope is expressed at high levels on the endothelial cells of arteries, veins and capillaries of porcine kidney, heart and liver. In a xenograft situation, the endothelial cells of these vessels come into direct contact with the anti-GAL antibodies in human serum. The above results are consistent with evidence that binding of these antibodies (with attendant complement activation) is a key component of the hyperacute rejection response.
To further investigate the specificities of naturally occurring xenoantibodies in human serum directed against porcine antigens, the ability of human serum to cause agglutination of pig red blood cells was investigated. These studies revealed the presence of high levels of such antibodies in human serum. Moreover, sugars such as melibiose, stachyose, galactose and fucose, having terminal residues in the α1-6 configuration, were found to inhibit agglutination in the μM to mM range. Sugars with other configurations were only inhibitory at very high doses, where the observed effects are likely due to simple changes in osmolarity or other non-specific mechanisms.
The above investigations establish a potential role for naturally occurring, human anti-GAL xenoantibodies in the complement-mediated destruction underlying hyperacute rejection. However, it is preferable to directly examine complement-mediated destruction of porcine cells in order to confirm the specificity of the GAL epitope and of anti-GAL antibodies in the process of lysis. To this end, the present inventors have examined the ability of human serum to cause lysis of porcine cells.
To investigate complement-mediated destruction of cells, it is necessary to employ one or more assays that provide quantitative data on cell lysis. Preferably, such assays measure a cell-sequestered component that is released into the medium upon complement-mediated cell lysis. Such experiments should control for involvement of complement in the induced lysis by employing both native complement proteins as well as heat-inactivated complement. The present inventors have used a 51Cr-release assay and a lactate dehydrocenase (LDH)-release assay to investigate the complement-mediated lysis of porcine epithelial and endothelial cells by human serum.
In the 51Cr-release assay, porcine cells were pre-labeled with 51Cr and then incubated in the presence of heat-inactivated human serum plus rabbit complement (PAE's) or human complement in non-heat-inactivated normal human serum (PK1's). Release of 51Cr into the medium was measured with a gamma counter following addition of scintillation fluid. In the LDH-release assay, cells were labeled with LDH as per the manufacturer's instructions (Promega, USA). Release of LDH into the medium was measured using an ELISA format, with absorbance read at 492 nm. For both assays, the ability of various sugars to inhibit the complement-induced lysis was also tested.
Similar results were obtained with the two unrelated porcine cell lines, PAE and PK1, using both types of assays. The results clearly demonstrate that naturally occurring xenoantibodies (NXAb's) are responsible for initiating the complement-induced lysis of porcine-cells. The present inventors have also established that IgM and not IgG antibodies are responsible for the lysis in this system. Moreover, heat inactivation of the complement preparations prevented lysis, providing further evidence that lysis of the porcine cells is a complement-dependent phenomenon. The present inventors have also shown that melibiose, but not lactose, protects the porcine cells from lysis. Importantly, the concentrations of sugar found to be effective in these studies covered the physiological range of blood sugar, i.e., about 10 mM.
These results indicate that the anti-GAL NXAb's in normal human serum are primarily responsible for lysis of the porcine cells. As such, the binding of anti-GAL NXAb's to the endothelial cells lining the blood vessels of a porcine xenograft, with attendant activation of the complement cascade, is likely to be a key component of the hyperacute rejection of porcine xenografts. This would also be the case with organs from other discordant species, such as rodents, sheep, cows and goats, all of which have active α-1,3-GalT genes in their genomes.
These conclusions are further supported in a whole-organ study performed by the present inventors. For this study, isolated and perfused rat hearts were used to further demonstrate the involvement of anti-GAL xenoantibodies in hyperacute rejection. Rat hearts were connected to a Langendorf perfusion apparatus, as described in Doring and Dehnert, The Isolated Perfused Heart According to Langendorf, Bionesstechnik-Verlag March GmbH, D7806, West Germany. The connected hearts were then stabilized by perfusion with a physiological buffer system, and perfused with the same buffer containing either melibiose or lactose (10 mM). Human plasma was then added to a final concentration of 13% and the effect of the added sugar on heart rate, strength of contraction and output were measured.
These results demonstrate in a whole-organ system that:
1) Perfusion with unmodified human plasma causes rapid loss of function.
2) Perfusion of a rat heart with human plasma in the presence of melibiose, which competes for binding with the anti-GAL antibodies, prolongs heart survival and output. Lactose, however, which does not compete for binding with the anti-GAL antibodies, does-not prolong heart survival.
3) Perfusion of a rat heart with anti-GAL antibody-depleted plasma prolongs heart survival and output.
4) If purified anti-GAL antibodies are added back to anti-GAL antibody-depleted plasma, the heart rapidly loses function
The present inventors' experiments with cultured cells, tissues and whole organs provide important confirmation that anti-GAL antibodies are a critical element in the hyperacute rejection response. Moreover, the disclosed results point to various approaches that can be employed to eliminate or reduce the hyperacute rejection of xenogeneic mammalian organs by humans.
For example, the intravenous administration of the specific disaccharide galactose α 1-3 galactose will block the naturally occurring anti-GAL antibodies of all classes and prevent them binding to their specific epitopes on the surface of the endothelial cells of the xenograft, thus preventing them from initiating or participating in hyperacute rejection. The present inventors' results indicate that the concentration of galactose α 1-3 galactose required to achieve this effect is in a physiologically tolerated range. The experiments also indicate that various other carbohydrates can be substituted for the specific disaccharide. These include the monosaccharide galactose and various other di-, tri- or tetra-saccharides in which there is a terminal α galactose linked to the next sugar via position 1. These other sugars include, but are not limited to, melibiose and stachyose.
Likewise, prior to xenotransplantation, all or a substantial portion of total IgM (that is, IgM of all specificities) can be removed from the serum of the patient by extracorporeal immunoabsorption. Alternatively, anti-GAL antibodies of all classes can be removed by extracorporeal immunoabsorption. Most preferably, the patient's pre-formed natural anti-GAL IgM antibodies can be removed. In this way, many or most of the primary immunological agents of the hyperacute response are eliminated, resulting in reduction or elimination of the response following xenotransplantation.
The α-1,3-GalT Gene as a Target for Suppressing the GAL Epitope
The present inventors have succeeded in cloning the entire coding region of the porcine α-1,3-GalT gene. This is desirable for full exploitation of the gene in genetic engineering of pigs for purposes of human xenotransplantation. Previous attempts to obtain the entire coding region of the porcine gene have, to the knowledge of the inventors, failed to generate the 5′ coding regions. See, e.g., Dabkowski et al., Transplant. Proc. 25: 2921 (1993). The present inventors have employed a PCR-based approach to generate the full sequence. In designing the primers and experimental conditions-required to obtain the 5′ and 3′ regions of the gene, the present inventors overcame significant theoretical and practical obstacles to success.
Primers were selected on the basis of careful analysis of published sequences for the murine, bovine and human α-1,3-GalT genes, the only published sequences available for this purpose. The present inventors' analysis revealed that in the reported sequence of the bovine cDNA, exon 3 (which is in the 5′-untranslated region) is missing. This had not been reported in the literature. Thus, in order to find appropriate regions for deriving useful primer sequences, the mouse and bovine sequences had to be realigned. Even with the appropriate realignment, however, only one island of about 20 base pairs (bp) in the 5′ untranslated region displayed the desired homology (19 out of 20 bp) for design of a PCR oligonucleotide. The fact that the 5′ untranslated regions of the mouse and bovine genes do not seem substantially related even upon optimal alignment would not be considered unusual by the ordinary skilled artisan. This is because the 5′ untranslated regions are often not well conserved between species. As such, the natural inclination would be to perform a less-than-exhaustive analysis and to conclude that design of PCR oligonucleotides based on homology from this region was unlikely to be successful.
In the downstream 3′-untranslated region, the homology is less than obvious again. Various insertions and deletions had to be made in order to obtain proper alignment of the mouse and bovine sequences. Moreover, to obtain a region of appropriate homology for design of PCR oligonucleotides, it was necessary to select a region approximately 200 bp downstream of the stop codon. Finally, to get the 5′ and 3′ primers to work properly, the present inventors found it necessary to drop the annealing temperature by 9° C. These technical and theoretical hurdles to successful use of a PCR-based approach were overcome by the present inventors and allowed the entire coding sequence to be determined.
Analysis of the nucleotide sequence indicates that a counterpart to murine exon 3 in the 5′ untranslated region is not found in the porcine gene. The porcine sequence is similar to the bovine sequence in this regard. Analysis of the amino acid sequence demonstrates that the structure of the porcine α-1,3-GalT is similar to that of other glycosyltransferases, and in particular is closely related to bovine and murine α-1,3-GalTs. In each of these enzymes a short cytoplasmic amino-terminal domain of about 6 residues precedes a hydrophobic membrane-anchoring domain (extending from residues 7 to 22). The stem region, which serves as a flexible tether, and the catalytic domain, which catalyses the synthesis of α-1,3-GAL linkages, are located in the lumen of the Golgi and extend from amino acid 23 to the carboxyl terminus at amino acid 371. The precise boundary between the stem and catalytic domains is not well-defined. Based on the suggested characteristics of the stem region, it appears to be the least conserved region and is rich in glycine and proline residues. Paulson and Colley, J. Biol. Chem. 264: 17615 (1989); Joziasse et al., J. Biol. Chem. 267: 5534 (1992). The stem/catalytic boundary may occur around amino acid 60.
To generate constructs for inactivating genes by homologous recombination, the gene is preferably interrupted within an appropriate coding exon by insertion of an additional DNA fragment. Upon analysis of the full-length porcine nucleic acid sequence, the present inventors have identified exons 4, 7, 8 and 9 as preferred locations for disruption of the gene by homologous recombination. However, identification of these exons as preferred sites should not be construed as limiting the scope of the present invention, as interruptions in exons 5 and 6 may be useful in particular cell types or in situations where less-than-complete inhibition of α-1,3-GalT gene expression is desired. Moreover, regulatory elements associated with the coding sequence may also present useful targets for inactivation.
In a preferred embodiment, a Sal1 site located within exon 9 of the mouse α-1,3-GalT gene at codons 221–222 is chosen as the site for disruption of the murine coding sequence. For disruption of the porcine sequence, it is noted that the amino acids encoded by the corresponding porcine nucleotides are conserved, although the Sal1 site is not. In a preferred embodiment for inactivation of the porcine gene, a Sal1 site is engineered into the corresponding location of the pig sequence for convenient construction of a knockout sequence. Sal1 cuts only rarely in genomic DNA. Since multiple restriction sites can be a problem in manipulating large fragments of DNA, the presence of a Sal1 site in the exon is very useful since it is not likely that other Sal1 sites will be present at other locations in the knockout constructs.
A gene coding for a selectable marker is generally used to interrupt the targeted exon site by homologous recombination. Preferably, the selectable marker is flanked by sequences homologous to the sequences flanking the desired insertion site. Thomas and Capecchi, Cell 51: 503–12 (1987); Capecchi, Trends in Genetics 5: 70–76 (1989). It is not necessary for the flanking sequences to be immediately adjacent to the desired insertion site. The gene imparting resistance to the antibiotic G418 (a neomycin derivative) frequently is used, although other antibiotic resistance markers (e.g., hygromycin) also may be employed. Other selection systems include negative-selection markers such as the thymidine kinase (Tk) gene from herpes simplex. Any selectable marker suitable for inclusion in a knockout vector is within the scope of the present invention.
However, it is possible that in some circumstances it will not be desirable to have an expressed antibiotic resistance gene incorporated into the cells of a transplanted organ. Therefore, in a preferred embodiment, one or more genetic elements are included in the knockout construct that permit the antibiotic resistance gene to be excised once the construct has undergone homologous recombination with the α-1,3-GalT gene.
The FLP/FRT recombinase system from yeast represents one such set of genetic elements. O'Gorman et al., Science 251, 1351–1355 (1991). FLP recombinase is a protein of approximately 45 kD molecular weight. It is encoded by the FLP gene of the 2 micron plasmid of the yeast Saccharomyces cerevisiae. The protein acts by binding to the FLP Recombinase Target site, or FRT; the core region of the FRT is a DNA sequence of approximately 34 bp. FLP can mediate several kinds of recombination reactions including excision, insertion and inversion, depending on the relative orientations of flanking FRT sites. If a region of DNA is flanked by direct repeats of the FRT, FLP will act to excise the intervening DNA, leaving only a single FRT. FLP has been shown to function in a wide range of systems, including in the cultured mammalian cell lines CV-1 and F9, O'Gorman et al., Science 251: 1351 (1991), and in mouse ES cells, Jung et al., Science 259: 984 (1993).
Targeted cells carrying a genomic copy of an antibiotic resistance gene flanked by direct repeats of the FRT are supplied with FLP recombinase by 1) introduction into cells of partially purified FLP protein by electroporation, or 2) transfection with expression plasmids containing the FLP gene. In this way, the antibiotic resistance gene is deleted by action of the FLP recombinase, and cells are generated that contain the inactivated α-1,3-GalT gene and are free of the exogenous antibiotic resistance gene.
Due to the relative infrequency of homologous recombination in targeted cells, most such cells will carry only one inactivated allele of the target gene. That is, the great majority of cells taken through a single round of transformation with an appropriate knockout construct will be heterozygotes. As used herein, the term “transformed” is defined as introduction of exogenous DNA into the target cell by any means known to the skilled artisan. These methods of introduction can include, without limitation, transfection, microinjection, infection (with, for example, retroviral-based vectors), electroporation and microballistics. The term “transformed,” unless otherwise indicated, is not intended herein to indicate alterations in cell behavior and growth patterns accompanying immortalization, density-independent growth, malignant transformation or similar acquired states in culture.
Although heterozygous cells can be used in the methods of the present invention, various manipulations can be employed to generate homozygous cells in culture. For example, homozygous cells can be generated by performing a second homologous recombination procedure on cells heterozygous for the inactivated allele. If the knockout construct used in the initial transformation carried the neoR gene, a second construct may be employed in a second round of transformation in which the neoR gene is replaced with a gene conferring resistance to a separate antibiotics (e.g., hygromycin). Cells resistant to both G418 and hygromycin can be screened by Southern blots in order to detect any “double knockouts” (i.e., homozygotes). Both antibiotic resistance genes can be removed subsequently in a single procedure using FLP recombinase. By maintaining selection with G418, this approach ensures that the second construct does not simply replace the previously knocked-out allele, leaving the cells heterozygous.
Alternatively, the neoR gene can be deleted from an original heterozygous cell using FLP recombinase and a second knockout procedure conducted using the original neoR gene-containing construct. Double knockouts could be detected by Southern analysis. The newly introduced neoR gene then could be deleted by FLP recombinase. This alternative approach does not allow one to direct the knockout construct specifically to the non-inactivated allele. Nevertheless, screening of appropriate numbers of targeted cells can lead to identification of cells homozygous for the inactivated locus.
To create animals having a particular gene inactivated in all cells, it is necessary to introduce a knockout construct into the germ cells (sperm or eggs, i.e., the “germ line”) of the desired species. Genes or other DNA sequences can be introduced into the pronuclei of fertilized eggs by a microinjection. Following pronuclear fusion, the developing embryo may carry the introduced gene in all its somatic and germ cells since the zygote is the mitotic progenitor of all cells in the embryo. Since targeted insertion of a knockout construct is a relatively rare event, it is desirable to generate and screen a large number of animals when employing such an approach. Because of this, it can be advantageous to work with the large cell populations and selection criteria that are characteristic of cultured cell systems. However, for production of knockout animals from an initial population of cultured cells, it is necessary that a cultured cell containing the desired knockout construct be capable of generating a whole animal. This is generally accomplished by placing the cell into a developing embryo environment of some sort.
Cells capable of giving rise to at least several differentiated cell types are hereinafter termed “pluripotent” cells. Pluripotent cells capable of giving rise to all cell types of an embryo, including germ cells, are hereinafter termed “totipotent” cells. Totipotent murine cell lines (embryonic stem, or “ES” cells) have been isolated by culture of cells derived from very young embryos (blastocysts). Such cells are capable, upon incorporation into an embryo, of differentiating into all cell types, including germ cells, and can be employed to generate animals lacking a functional α-1,3-GalT gene. That is, cultured ES cells can be transformed with a knockout construct and cells selected in which the α-1,3-GalT gene is inactivated through insertion of the construct within, for example, an appropriate exon. In fact, ES cell lines have been derived for both mice and pigs. See, e.g., Robertson, Embryo-Derived Stem Cell Lines. In: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach (E. J. Robertson, ed.), IRL Press, Oxford (1987); PCT Publication No. WO/90/03432; PCT Publication No. 94/26884. Generally these cells lines must be propagated in a medium containing a differentiation-inhibiting factor (DIF) to prevent spontaneous differentiation and loss of mitotic capability. Leukemia Inhibitory Factor (LIF) is particularly useful as a DIF. Other DIF's useful for prevention of ES cell differentiation include, without limitation, Oncostatin M (Gearing and Bruce, The New Biologist 4: 61–65 (1992); personal communication from A. Smith), interleukin 6 (IL-6) with soluble IL-6 receptor (sIL-6R) (Taga et al., Cell 58: 573–81 (1989); personal communication from A. Smith), and ciliary neurotropic factor (CNTF) (Conover et al., Development 19: 559–65 (1993). Other known cytokines may also function as appropriate DIF's, alone or in combination with other DIF's.
As a useful advance in maintenance of ES cells in an undifferentiated state, the present inventors have identified a novel variant of LIF. In contrast to the previously identified forms of LIF which are extracellular, this new form of LIF (hereinafter T-LIF) is intracellularly localized. The transcript was cloned from murine ES cells using the RACE technique, Frohman et al., Proc. Natl. Acad. Sci. USA 85: 8998–9002 (1988), and subjected to sequence analysis. Analysis of the obtained nucleic acid sequence and deduced amino acid sequence indicates that T-LIF is a truncated form of the LIF sequence previously reported in the literature. Expression of the T-LIF nucleic acid in an appropriate host cell yields a 17 kD protein that is unglycosylated. This protein is useful for inhibiting differentiation of murine ES cells in culture. The protein is expected to have a similar activity with porcine cells, since murine D-LIF is effective at inhibiting both murine and porcine ES cell differentiation. The present inventors have also determined the sequence of the human form of T-LIF.
To generate a knockout animal, ES cells having at least one inactivated α-1,3-GalT allele are identified and incorporated into a developing embryo. This can be accomplished through injection into the blastocyst cavity of a murine blastocyst-stage embryo, by injection into a morula-stage embryo, by co-culture of ES cells with a morula-stage embryo, or through fusion of the ES cell with an enucleated zygote. The resulting embryo is raised to sexual maturity and bred in order to obtain animals, all of whose cells (including germ cells) carry the inactivated α-1,3-GalT allele. If the original ES cell was heterozygous for the inactivated α-1,3-GalT allele, several of these animals must be bred with each other in order to generate animals homozygous for the inactivated allele.
Although direct microinjection of DNA into eggs does not generate the large numbers of recombination events obtained through transfecting large numbers of cultured cells, nevertheless direct injection of eggs can be a useful approach since this avoids the special manipulations (see above) required to turn a cultured cell into an animal. This is because fertilized eggs are, of course, quintessentially “totipotent”—i.e., capable of developing into an adult without further substantive manipulation other than implantation into a surrogate mother. To enhance the probability of homologous recombination when eggs are directly injected with knockout constructs, it is useful to incorporate at least about 8 kb of homologous DNA into the targeting construct. In addition, it is also useful to prepare the knockout constructs from isogenic DNA. For example, for injection of porcine eggs, it is useful to prepare the constructs from DNA isolated from the boar whose sperm are employed to fertilize the eggs used for injection.
Embryos derived from microinjected eggs can be screened for homologous recombination events in several ways. For example, if the GalT gene is interrupted by a coding region that produces a detectable (e.g., fluorescent) gene product, then the injected eggs are cultured to the blastocyst stage and analyzed for presence of the indicator polypeptide. Embryos with fluorescing cells, for example, are then implanted into a surrogate mother and allowed to develop to term. Alternatively, injected eggs are allowed to develop and the resulting piglets analyzed by polymerase chain reaction (PCR) or reverse transcription PCR (RT/PCR) for evidence of homologous recombination.
Animals having either one (heterozygous) or two (homozygous) inactivated GalT genes are characterized to confirm the expected alterations in gene expression and phenotypic effect. For example, GalT mRNA should be absent from homozygous knockout animals. This can be confirmed, for example, with reverse transcription PCR (RT-PCR) using appropriate GalT-specific primers. In addition, various tests can be performed to evaluate expression of the GAL epitope in homozygous knockout animals. For example, anti-GAL antibodies and IB4 Lectin (which has an exclusive affinity for terminal α-D-galactosyl residues) can be used in various assay or immunohistological formats to test for the presence of the GAL epitope in an array of tissues. As another indication of GAL epitope status, lysis of cells by human serum can be tested through use of a 51chromium release assay.
Anti-GAL antibodies were purified from normal heat inactivated AB serum (from CS1 Parkville, Victoria, Australia) using the following sets of procedures.
A. Preparation of Total Anti-GAL (IgG+IgM) Antibodies
The following procedures are performed at 4° C.
The following procedures are performed at 4° C.
In some cases anti-GAL IgG was further purified using a protein G column, which efficiently binds IgG but not other antibody isotypes. IgG was then eluted from the protein G column using glycine pH 2.4.
All anti-GAL antibody preparations were analyzed for the following:
I. Cells
Reactivity of IgG and IgM anti-GAL antibodies was assessed using either porcine aortic endothelial cells (prepared by the inventors as described below) or porcine epithelial cell line LLC PK1 (PK1), obtained from the American Type Culture Collection (ATCC), Accession No. CRL1392.
A. Isolation and Culture of Porcine Aortic Endothelial Cells (PAE's)
Pigs were blood typed (using human typing reagents) to identify “O-type” pigs, i.e, pigs unreactive with antibodies to A or B human red blood cell antigens. Aortas were excised from “O-type” pigs, then transported from the abattoir to the laboratory on ice. PAE's were isolated by collagenase treatment as described by Gimbrone et al., J. Cell Biol. 60: 673–84 (1974). PAE's were cultured in RPMI medium containing 10% fetal calf serum (FCS), supplemented with 150 g/ml endothelial cell supplement (Sigma) and 50 g/ml heparin (Sigma). The cells were identified as endothelial cells by their typical cobblestone morphology and by their immunoreactivity with Factor VIII antibodies, as identified using immunofluorescence. In all the assays described below, the PAE's were used between the 8th and 12th passages.
B. Tissue Culture: Maintenance of PK-1 and PAE Cell Lines
All tissue culture was performed in a laminar flow hood, using appropriate tissue culture sterile technique. All tissue culture reagents, unless otherwise indicated, were purchased from CSL, Melbourne, Australia. Media were constituted as follows:
| PK-1 Culture Medium: | ||
| DMEM (Cytosystems, Castle Hill, Australia) | 500 | ml |
| FCS (CSL, Melbourne, Australia) | 37.5 | ml |
| Glutamine (200 mM) (Cytosystems) | 5 | ml |
| Hepes (1 M) (CSL) | 7.5 | ml |
| Penicillin (CSL) | 0.5 | ml (105 U/ml final) |
| Streptomycin (CSL) | 0.5 | ml (105 μg/ml final) |
| PAE - Culture Medium: | ||
| RPMI (CSL) | 90 | ml |
| FCS (CSL) | 10 | ml |
| Endothelial cell | ||
| supplement (3 mg/ml) (Sigma) | 1.5 | ml |
| Heparin (10 mg/ml) (CSL) | 0.5 | ml |
Endothelial cell supplement was purchased from Sigma Chem. Co. (St. Louis, Mo., USA) as a lyophilized powder, resuspended in sterile HBBS, and 3 ml aliquots stored at 4° C.
| Heparin (Sigma, Missouri, USA) | dissolved in PBS | |
| (10 mg/ml) | ||
| (0.22 νm) | filter sterilized | |
| Hanks Buffer | purchased from | |
| Cytosystems | ||
The following general procedures were used in propagating the cell lines.
C. Antibody Staining and FACS Analysis
The specificity of the anti-GAL antibody binding to porcine cells was determined by examining the ability of sugars of various structures to inhibit antibody binding. In these competition studies the anti-GAL antibodies were pre-incubated with sugar (0.1 M) at 37° C. for 30 min before adding to the cells.
D. Results
Using immunofluorescence it was found that total anti-GAL (IgM & IgG) and purified anti-GAL IgG stained both PK-1 and PAE's cells. On the other hand, neither the total anti-GAL antibody-depleted serum nor the anti-GAL IgG-depleted serum gave-detectable staining over background. The staining with anti-GAL IgM and/or IgG was inhibited with purified galactose and with disaccharides having terminal galactose residues in the α1-configuration such as melibiose (6-O-α-D-galactopyranosyl-D-glucose) and stachyose (α-D-Gal-[1 →6]-α-D-Glc-[1→2]-β-D-Fru). Staining was not inhibited with sugars such as lactose (4-O-β-D galatopyranosyl-α-D-glucose), which has a terminal galactose residue, but in a β1->4 configuration. The results of one such experiment are represented in FIG. 1. PAE's were stained with anti-GAL antibody alone (GAL:PBS) or with anti-GAL antibody that had been pre-incubated with either melibiose (GAL:MELIBIOSE), galactose (GAL:GALACTOSE) or lactose (GAL:LACTOSE). Anti-GAL antibody staining was approximately 10 fold less in the samples:containing melibiose and galactose, but was not affected significantly by lactose.
II. Tissues
A. Methods
Pig kidney was fixed in formalin and dehydrated before embedding in Paraplast. Pig heart and liver were fixed in paraformaldehyde-lysine-periodate fixative and snap frozen in O.C.T. embedding compound (10.24% w/w polyvinyl alcohol, 4.26% w/w polyethylene glycol, 85.50% w/w nonreactive ingredients; Tissue Tek®, Miles, Inc., Elkhart, Ind., USA). Four μm-thick sections of pig heart and liver and 2 μm-thick sections of kidney were incubated with purified anti-GAL antibodies (undiluted, 1:2 and 1:4) for 60 min. and then incubated with a fluorescein isothiocyanate (FITC)-conjugated sheep anti-human immunoglobulin F(ab′) fragment. (Silenus Laboratories, Hawthorn, Australia) (1:100) for 30 min. or a peroxidase-conjugated rabbit anti-human IgG (Dakopatts, Glostrup, Denmark) (1:50) for 60 min. Control sections were analyzed for autofluorescence, with the secondary antibody alone, or with the anti-GAL-depleted IgG or normal pig serum as the primary antibody. No staining was detected. The specificity of the anti-GAL antibodies was tested by pre-incubating sections of pig renal cortex with a variety of sugars, including melibiose, lactose, sucrose and glucose at 0.1 M.
B. Results
As with the analyses performed on the pig cells using immunofluorescence, total anti-GAL IgM+IgG, purified anti-GAL IgG, but not the anti-GAL IgM and/or IgG-depleted sera, stained all pig tissues examined. The individual staining parameters varied from organ to organ as set out below:
| Immunostaining of Pig Tissues with Anti-GAL Antibodies: |
| Staining | ||
| Tissue | Anti-GAL Reactivity | Intensity |
| Kidney | Proximal and distal convoluted tubules | Variable |
| Endothelium: Intertubular sinusoids | Variable | |
| Endothelium: Arteries and veins | Strong | |
| Glomerular capillaries | Variable | |
| Heart | Endothelium: Arteries, veins, capillaries | Strong |
| Endocardium | Strong | |
| Myocardium | Perinuclear | |
| Liver | Small Bile Ducts (lining cells) | Strong |
| Endothelium: Arteries, veins | Strong | |
| Intertubular sinusoids | Negative | |
The specificity of the binding of anti-GAL antibodies was tested on sections of pig renal cortex by inhibition with 0.1 M melibiose, lactose, sucrose and glucose. Reactivity of the anti-GAL antibodies with proximal tubule brush borders was reduced to near background by preincubation of antibody with melibiose, but was not inhibited by the other saccharides.
The methods used to investigate the hemagglutination of pig red blood cells (RBC's) by human serum was adapted from the methods described by Galili, J. Exp. Med. 160: 1579–81 (1984) and Severson, Immunol. 96: 785–789 (1966).
I. Methods
A. Media/Solution Preparation
| α-Lactose (4-O-β-D.galactopyranosyl-α-D-glucose | 36.0 g | |
| D(+)galactose | 18.0 g | |
| Stachyose (α-D-gal-[1->6]-α-D-Glc-[1->2]-β-D-Fru) | 66.6 g | |
| Melibiose (6-O-α-D-galactopyranosyl-D-glucose) | 34.2 g | |
| Sucrose (α-D-Glucopyranosyl β-D-fructofuranoside) | 34.2 g | |
| D-(+)-Glucose | 18.0 g | |
| α-D-(+)-Fucose (6-Deoxy-D-galactopyranose) | 16.4 g | |
All sugars were purchased from Sigma (St. Louis, Mo., USA). Sugar solutions were diluted in PBS to the appropriate concentration as required.
B. Preparation of Pig RBC'S
C. Preparation of 96-well Microtitre Plates (Titretek. USA)
Human serum caused the agglutination of pig RBC's at a titre of between 1/32– 1/64, which is consistent with the presence of high levels of naturally occurring xenoantibody (NXAb) in human serum. To examine the specificity of the NXAb response, sugar inhibition studies were performed. Sugars such as melibiose, stachyose, galactose and fucose which have terminal galactose residues in the α1-6 configuration were found to inhibit agglutination in the μM to mM range. Sugars with other structures, such as lactose and sucrose, were only inhibitory when very high concentrations were used. At these high concentrations, the observed effects are most probably non-specific, due, for example, to changes in osmolarity. Results are summarized below:
| Pig RBC Hemagglutination by Human Serum: Sugar Inhibition |
| Inhibitory | |||
| Sugar | Linkage | Concentration | |
| Melibiose | Gal α1-6Glc | 5 × 10−4M | |
| Stachyose | Gal α1-6Gal | 2 × 10−3M | |
| Galactose | 2 × 10−3M | ||
| Fucose | 6-Deoxy-α-L-Gal | 1 × 10−3M | |
| Lactose | Galβ1-4-Glc | >10−1M | |
| Sucrose | α-D-Glc-β-D-Fruc | >10−1M | |
The ability of human serum to cause the lysis of porcine cells was examined using both pig epithelial (PK1) and aortic endothelial (PAE's) cells, the isolation and culture of which is described in Example 2. Cell lysis was determined using either the 51Chromium release assay as described by Cerottini and Brunner, Nature New Biol. 237:272, 1972 or the Cytotox LDH release assay according to the manufacturer's instructions (Promega, USA).
I. Methods
A. 51CR Release Assay
In a 96-well test plate, mix the following:
| Plate Layout: |
| Plate 1 | Plate 2 |
| 5% | 10% | 15% | 20% | |
| Rows: | 1–4 | 5–8 | 1–4 | 5–8 |
| Columns: | 1. Spontaneous Release | ||
| 2. Maximum Release | |||
| 3. Melibiose | |||
| 4. Lactose | |||
B. LDH Release Assay
| Plate 1 |
| Columns: | 1. spontaneous release | Rows: | 1–4: | cells + no sugar |
| 2. maximum release | 5–8: | no cells + no sugar | ||
| 3. 5% serum | ||||
| 4. 10% serum | ||||
| 5. 25% serum | ||||
| 6. RF10 alone | ||||
| Plate 2 | melibiose | |||
| Plate 3 | galactose | |||
| Plate 4 | lactose | |||
| Plate 5 | sucrose | |||
| Plates 6–9 | same as plates | |||
| 2–5 but no cells added | ||||
| Sugar Conc. | |||||
| Columns: | 1–2 | 1 × 10−1M | Rows: | 1–2 | 0% serum |
| 3–4 | 5 × 10−2M | 3–4 | 5% serum | ||
| 5–6 | 1 × 10−2M | 5–6 | 10% serum | ||
| 7–8 | 5 × 10−3M | 7–8 | 25% serum | ||
| 9–10 | 2 × 10−3M | ||||
| 11–12 | 1 × 10−3M | ||||
Comparable results were obtained with both cell types (PAE's and PK1's) using both lysis assays. The results of a typical lysis experiment are represented in FIG. 2, in which the lysis of PAE's by human serum and by purified anti-GAL antibodies was determined using the 51CR release assay. Comparable results were also obtained with PK1 cells using the 51CR release assay and with both cell lines using the LDH release assay. The results of these assays can be summarized as follows:
1. Xenoantibodies (NXAb) in human serum in the presence of complement are capable of lysing porcine cells. Lysis increases with increasing concentrations of serum.
2. Pre-absorption of NHS with pig spleen cells (which removes the NXAb): No lysis.
3. Use of heat-inactivated complement: No lysis.
4. Use of NHS depleted of anti-GAL antibodies: No lysis.
5. Use of purified total anti-GAL antibodies (IgG+IgM): Lysis.
6. Use of purified anti-GAL IgG: No lysis.
7. Use of purified total anti-GAL antibodies (IgG+IgM) and dithiothreitol (DTT): No lysis. (DTT is a reducing agent that disrupts the multimeric structure of IgM antibodies without affecting IgG.)
Together these results demonstrate that the anti-GAL antibodies are responsible for the observed lysis. Purified anti-GAL IgG and DTT-treated total (IgG+IgM) anti-GAL antibodies failed to elicit lysis, indicating that IgM, but not IgG, antibodies are causative agents in this system. Preliminary attempts to verify this observation using purified IgM prepared either in crude form by euglobulin fractionation or by α-IgM affinity chromatography were unsuccessful. The inventors believe this reflects inactivation of the IgM during preparation, rather than a true reflection of the capacity of anti-GAL IgM to cause lysis of porcine cells heat inactivation of the complement prevented lysis, indicating that lysis of porcine cells is a complement-dependent phenomenon.
The effect of adding the disaccharide sugars melibiose (Gal α1→6 Gal) and lactose (Gal β1→4 Glu) on the lysis of PAE's by human serum was assessed using the Cytotox non-radioactive LDH release assay. PAE's were incubated in the presence of 50% human serum as the source of xenoantibody and complement, together with various concentrations of each sugar (1 mM to 100 mM). Under these conditions, melibiose, which has the Gal α1→6 Gal configuration, but not lactose, which has the terminal Gal moiety by in a β1→4 configuration, protected the pig cells from lysis.
The Langendorf isolated perfused ex vivo heart model was used to further demonstrate the involvement of anti-GAL xenoantibodies in hyperacute rejection.
I. Methods
A. Preparation and Storage of Human Plasma
B. Assessment of Complement Activity
C. Preparation of Plasma for Heart Perfusions
Plasma prepared from different blood packs is thawed at 37° C., pooled and filtered (100 μm steel mesh, 8.0 μm and 4.5 μm Millipore filters, sequentially). Cacl2 is added at 0.58 mg/ml plasma, and the plasma kept on ice until ready for perfusion.
D. Ex Vivo Isolated Perfused Rodent Heart Model
1. Anesthetize rats with Nembutal (1 μl sodium pentobarbitone (60 mg/ml)/g body weight) and mice with ether.
2. Surgically expose the heart and inject heparin (Porcine Mucous, 10,000 U/ml) into the femoral vein (rats: 0.3 ml injected).
3. Remove heart and place in ice-cold Krebs-Henseleit buffer containing heparin (0.2 ml/50 ml buffer.
4. Connect aorta to the canula of the Langendorf perfusion apparatus and tie firmly. The apparatus was assembled by the present inventors according to experimental requirements of the Langendorf heart model as described in Doring & Dehnerrt, The Isolated Perfused Heart According to Langendorf, Bionesstechnik-Verlag March GmbH, D7806, West Germany.
5. Perfuse with Krebs-Henseleit buffer (made fresh each day), which is gassed continuously with carbogen (95% O2, 5% CO2) at a pressure of 100 mmHg, at 37° C.
6. Attach a hook, connected to a transducer (Physiograph MK-111-S, Narco Bio-Systems) to the apex of the heart.
7. Perfuse heart for 20 min. with Krebs-Henseleit buffer to enable heart to stabilize (reservoir volume: 270 ml).
8. Add plasma (pre-warmed to 37° C.) as follows:
9. Monitor heart for a further 30 min. and record heart flow and contraction rate.
E. Sugar Perfusion
F. Large-Scale Preparation of Anti-GAL Antibody-Depleted Plasma
Rat hearts were connected to the Langendorf apparatus and then stabilized by perfusion with Krebs Henseleit buffer for 10 min., and then a further 10 min. with the same buffer containing either melibiose or lactose (10 mM). Human plasma was then added in stages as described above to a final concentration of 13% and the effect of the added sugar on cardiac function was assessed. The parameters measured were heart rate, amplitude (strength) of contraction and output (FIG. 3).
In the presence of human serum alone (lower trace), the heart essentially stopped beating within minutes. The same result was obtained if lactose was added. In the presence of melibiose (upper trace) or anti-GAL antibody-depleted plasma, however, the heart was able to maintain a strong beat. When the purified anti-GAL antibody was added back to the anti-GAL antibody-depleted plasma, the heart again stopped beating within minutes.
cDNA's encoding porcine α-1,3-GalT were generated by Polymerase Chain Reaction (PCR) technology. Total RNA of pig liver was isolated by homogenizing liver slices in. 7 M guanidinium thiocyanate, as described by Chomczynski & Sacchi, Anal. Biochem 162, 156–159 (1987); Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd Edition), Cold Spring Harbor Laboratory Press (1989). Sixteen μg of the RNA, together with 1 g oligo dT primer, were heat denatured for 5 minutes at 65° C. prior to being transcribed into cDNA using avian myeloblastosis virus (AMV) reverse transcriptase in a 100 μl reaction carried out at 37° C. for 90 minutes. Three μl of the cDNA synthesis reaction was used in the subsequent PCR amplifications. General procedures used for generation of cDNA are provided in Sambrook et al (1989), supra.
Primers for PCR were synthesized using phosphoramidite technology, on an Applied Biosystems DNA synthesizer. The sequence of the PCR primers was based on identifying conserved regions within the published sequences for murine and bovine α-1,3-GalT genes. Joziazze et al., J. Biol. Chem 264: 14290–97 (1989); Joziazze et al., Biol. Chem 267: 5534–5541 (1992). All primers were synthesized with EcoR1 linkers at the 5′ end for ease of cloning. In the following listing of the primers used in the present study, nucleotide positions varying between bovine and murine sequences are single-underlined; nucleotide positions varying between bovine and human sequences are double-underlined:
Exon 2 primer (forward): 5′-GTGAATTCAGCCCTGCCTCCTTCTGCAG-3′ (SEQ ID NO: 1)
The PCR fragments were subcloned into EcoR1-restricted ρBluescript II KS+ (Stratagene, Cat, # 2 12206) and the DNA sequence was determined using the chain termination method. The DNA sequence was assembled and analyzed using DNASIS-Mac v2.01 (Hitachi)
The nucleotide sequence of porcine α-1,3-GalT (SEQ ID NO: 7) and the derived amino acid sequence (SEQ ID NO: 10) of the enzyme are shown in FIGS. 4 and 5. A single large open reading frame extends from the initiating methionine at nucleotide 91 to a stop codon located at nucleotide 1204. The sequence surrounding the putative initiating methionine conforms to the consensus eukaryotic initiation sequence. Kozak, Cell 44, 283–92 (1986).
The porcine cDNA sequence is compared to the corresponding murine (SEQ ID NO: 9) and bovine (SEQ ID NO: 8) sequences in FIG. 4. The locations of introns within the murine gene are also shown. Joziazze et al., J. Biol. Chem 267: 5534 (1992). This alignment demonstrates that exon 3, located within the 5′ untranslated region of the mouse gene, is not found in either the porcine or bovine cDNAs. The overall sequence identities between the coding sequences are as follows:
a) pig compared to mouse:—75.02% (exon 3 not considered)
b) pig compared to bovine:—85.15%
The amino acid sequences of the porcine (SEQ ID NO: 10), murine (SEQ ID NO: 12) and bovine (SEQ ID NO: 11) α-1,3-GalT enzymes are depicted in FIG. 5. The locations of introns are also shown, based on their positions within the mouse gene (Joziasse et al., 1992). This alignment illustrates that the overall amino acid homologies are:
a) pig compared to mouse: 71.98%
b) pig compared to bovine: 82.87%
c) bovine compared to mouse: 73.72%
The present inventors' choice of a site for interrupting the α-1,3-GalT gene has been influenced by several characteristics of the gene and its expression. In particular, several mRNAs for α-1,3-GalT have been detected in the mouse. Joziazze et al., J. Biol. Chem. 267: 5534 (1992). These mRNAs are products of alternative splicing events in which exons 5 and/or 6 may be deleted. Hence, these exons are not appropriate interruption sites in the mouse, since a transcript encoding a functional α-1,3-GalT enzyme presumably could be formed when exons 5 or 6 are spliced out. Moreover, the present inventors have isolated two different classes of α-1,3-GalT cDNA clones from the pig—one that includes exon 5 and one with exon 5 deleted. It is possible that mRNA's with and without exon 6 are also formed by alternative splicing in the pig. Thus, for initial experiments the present inventors have not chosen-these exons as sites for interruption.
Insertion of an interrupting-DNA fragment into exon 4 (which encodes the cytoplasmic NH2-terminal domain and the membrane-anchoring domain; see FIG. 5) would disturb production of a transcript encoding an active α-1,3-GalT. Hence this exon is an appropriate site to disrupt the α-1,3-GalT gene. Similarly, exons 7 and 8, which encode the NH2-terminal region of the catalytic domain, are suitable disruption sites. Insertion of a interrupting DNA fragment within these exons would prevent the synthesis of an active catalytic domain.
A preferred site for interrupting the mouse gene is located at a Sal1 site found within exon 9 of the mouse α-1,3-GalT gene, at codons 221+222 (see FIG. 5). This site is positioned 150 amino acids from the COOH-terminus, within the catalytic domain. The mouse gene within the present inventors' constructs for homologous recombination is interrupted at this Sal1 site. The amino acids encoded by nucleotides at this Sal1 site are conserved in the pig and bovine sequences, although the Sal1 site itself is not. Construction of a Sal1 site at this position in the pig gene (e.g., by in vitro mutagenesis) provides a useful construct to inactivate the gene.
The present inventors have used both the neomycin resistance (neoR) gene and the hygromycin resistance gene (hygR) to interrupt the α-1,3-GalT gene. In one set of “knockout” constructs the neoR and hygR genes are linked to the murine phosphoglycerate kinase (PGK) promoter (Adra et al., Gene 60: 65–74 (1987) and are both bordered by polylinker sequences that include restriction sites for EcoRV and ClaI.
In another construct, expression of the neoR gene is directed by an altered polyoma virus promoter (PMC1; Thomas and Cappechi, cell 51: 503–12 (1987)). In this construct the present inventors have addressed the problem of including an antibiotic resistance gene within the genome of transplant organs. That is, in some circumstances it may not be desirable to have genes conferring resistance to antibiotics present in the organ to be transplanted. The FLP/FRT recombinase system of yeast has been used to eliminate the neoR gene from the sequence that interrupts the α-1,3-GalT gene.
In a construct of the present invention, the neoR gene is bordered at both the 5′ and 3′ ends by FRT DNA elements. In addition, stop codons for each of three reading frames have been inserted 3′ to the neoR gene, and these stop codons, together with a single FRT sequence, will remain within the α-1,3-GalT gene after the neoR gene has been excised by FLP. Targeted cells carrying a genomic copy of the neo gene flanked by direct repeats of the FRT could be supplied with FLP recombinase in two ways:
1). Introduction into cells of partially purified FLP protein:
FLP protein (0.1–10 μg) is introduced (“transfected”) into approximately 107 cells using standard electroporation conditions. The cells are plated out into gelatinized tissue culture dishes in appropriate medium, at a sufficient dilution to result in individual colonies. Approximately 200 of these colonies are then picked for further analysis.
2) Transfection with plasmids containing the FLP gene:
A plasmid containing the FLP gene under control of a promoter able to drive FLP expression, e.g., the human interferon-inducible 6–16 promoter, is constructed according to standard methods. Porter et al., EMBO J. 7: 85 (1988). Approximately 10 μg of FLP expression plasmid is transfected into approximately 107 cells using standard electroporation conditions. With a plasmid containing the human 6–16 promoter, interferon is added at approximately 500 units/ml, in order to induce expression of FLP. The cells are then treated as in (1) above.
The procedure to knock out the α-1.,3-GalT gene in ES cells using an FRT-containing construct is:
a) electroporate the complete construct into ES cells
b) select neoR cells, and identify those ES cells having an interrupted α-1,3-GalT gene
c) delete the neoR gene using FLP recombinase, as described above; cells are tested for the excision event as follows:
First, samples of each selected cell line are tested for the absence of the neoR gene by treatment with the chemical G418. The cells will die in the presence of approximately 200 μg/ml G418 unless the neoR gene is still present in the genome. Cell lines that are G418 sensitive are then tested further to confirm that excision of neoR has occurred. This is done by Southern analysis or PCR analysis, both described in Sambrook et al. (1989). For Southern analysis, genomic DNA is isolated from the cells, digested with an appropriate restriction enzyme, subjected to agarose gel electrophoresis, and the digested DNA transferred to a membrane. The DNA is hybridized with a labeled probe, the label is detected (e.g., with X-ray film or color development), and the pattern of bands indicates whether or not an excision event had occurred in the cell line. For PCR analysis, genomic DNA is isolated from the cells and subjected to PCR reaction with suitable oligonucleotide primers.
d) following confirmation of neoR excision, the manipulated ES cells or PGC's are used to generate chimeric animals.
Gene targeting (homologous recombination) is more efficient if the cloned cDNA fragments used for targeting are isolated from the cell line which is used for the gene knockout (i.e., the DNA is “isogeneic”). Accordingly, DNA was isolated from the E14 ES cell line (Hooper et al., Nature 326: 292–95 (1987)) and used to construct a mouse genomic library. The DNA was digested partially with the restriction enzyme Sau 3A, and fragments 12 kb–20 kb in size were isolated by glycerol gradient fractionation. The size-fractionated DNA was ligated into the Bam H1 site of λEMBL3 (Sambrook et al. 1989, supra), and packaged in vitro to form lambda phage particles. The lambda library was plated by infection of E. coli strain PMC103 host cells (Doherty et al., Gene 124: 29–35 (1993)) at a density of 4×104 phage per plate. A bovine cDNA clone, about 900 bp in length and containing a portion of the α-1,3-GalT gene corresponding to exons 7–9, was used to probe a total of 5.6×105 independent recombinant phage. Four overlapping clones containing α-1,3-GalT gene sequences were isolated and purified. The Sal1 restriction sites within these clones were mapped (FIG. 6), and the 4.0 kb, 5.5 kb, 11 kb and 12 kb SalI fragments from two of the clones (λ3 and λ5) were subcloned into pBlueScript KS+ (Stratagene) or pUBS (pUC19 carrying the pBlueScript KS+ polylinker) to facilitate further detailed mapping of restriction sites.
These four subclones (designated pαGT-S4.0, pαGT-S5.5, pαGT-S11 and pαGT-S13) were mapped for restriction sites with restriction enzymes BamHI, EcoRI, HindIII, XbaI, XhoI, KpnI SacI, SacII, EcoRV, PstI, SmaI, NotI and BglII. pαGT-S4.0 and pαGT-S5.5 were also checked for PvuI, PvuII, NdeI and SphI restriction sites. Detailed restriction maps of the 4 subclones were drawn from these data (FIGS. 7–12).
On the basis of these maps a knockout strategy was conceived. Basically the strategy is to insert a resistance gene (either neoR or hygR) into the SalI site which lies within Exon 9. The knockout construct carries the 4.0 and 5.5 kb SalI fragments from pαGT-S4.0 and pαGT-S5.5 which flank the Exon 9 SalI site (FIG. 13). Screening for homologous recombination events then can be carried out using a DNA fragment representing the genomic region but lying outside the DNA included in the knockout construct, i.e., outside the 9.5 kb covered by pαGT-S4.0 and pαGT-S5.5. A 0.7 kb EcoRI/XmnI fragment from pαGT-S11 is used to screen Southern blots of BglII digested ES cell DNA for homologous recombinant events. An 8.3 kb band should appear on these Southerns when the uninterrupted α1,3-GalT gene is probed with this EcoR1/XmnI fragment (FIG. 14). Insertion of the neoR gene after a homologous recombination event will give rise to a 6.4 kb band, due to the presence of a BglII site just flanking the Exon 9 SalI site within the knockout construct. Thus the presence of the 6.4 kb band is diagnostic for a homologous recombination event.
To carry out this strategy, the present inventors prepared a series of knockout constructs. The generation of one such construct is outlined in detail in FIG. 15. The vector pαGT-S5.5, which carries the 5.5 kb fragment immediately 3′ to the Exon 9 SalI site, was chosen as the starting vector pαGT-S5.5 was digested with EcoRV and ClaI, generating a vector with a blunt end and a ClaI compatible end. A 1.3 kb fragment carrying the PMC1 promoter-driven neoR gene flanked by FRT sites was excised from plasmid pNeo2FRT (previously constructed by the present inventors) by digesting with BamHI, filling in the restriction site and then digesting with ClaI to generate a fragment with one blunt end and one ClaI compatible end. The nucleotide sequence of this 1.3 kb fragment is provided in FIG. 16 (SEQ ID NO: 13). This fragment was then ligated into the ClaI/EcoRV digested pαGT-S5.5, the ligation mix transformed and colonies screened for recombinants. One colony was recovered that contained the NeoR fragment inserted into the EcoRV/ClaI of pαGT-S5.5, based on the restriction pattern after digestion with diagnostic restriction enzymes ClaI, EcoRV, XbaI and EcoRI. This construct was designated PNeoαGT6.8.
pNeoαGT6.8 was digested with SmaI, generating a vector with blunt ends. The 4.0 kb Sal1 fragment was excised from pαGT-S4.0 and the ends filled. This fragment was then ligated into the SmaI digested pαGT-S5.5, the ligation mix transformed and colonies screened for recombinants. Four colonies were recovered which contained the 4.0 kb SalI fragment inserted into the SmaI sites of pNeoαGT6.8 with the 5′ portion of Exon 9 lying near the 3′ portion of the exon in the nearby SalI 5.5 kb fragment. The identity and orientation of the insert was confirmed by the restriction pattern after digestion with diagnostic restriction enzymes XbaI, EcoRI, HindIII, BamHI, EcoRV and others. This construct was designated pNeoαGT10.8.
pNeoαGT10.8 was digested with ClaI, generating a vector with ClaI compatible ends. Two complementary oligomers were synthesized that, when annealed, generated a linker containing translation termination codons in all three reading frames and a BglII site. The linker has ClaI compatible ends. The linker was ligated into the ClaI digested pNeoαGT10.8, the ligation mix transformed and colonies screened for recombinants. Many colonies were recovered that contained the linker inserted into the ClaI sites within pNeoαGT10.8 based on the restriction pattern after digestion with diagnostic restriction enzymes BglII, Cla and BglII/NotI. This construct has been sequenced to confirm the identity, copy number and orientation of the insert. This construct is called pNeoαGT10.8B (FIG. 17).
Procedures for the isolation and culturing of all cell lines (embryonic stem, primordial germ and fetal fibroblast cell lines) require aseptic conditions to prevent growth of contaminating organisms:
| Media/Solution Preparation |
| DULBECCOS MODIFIED EAGLE MEDIUM (DMEM) |
| 10.0 | g | DMEM powder-Gibco (the low-glucose or |
| high-glucose formulation, with or without | ||
| pyruvate, may be used; L-glutamine is | ||
| included) | ||
| 1.0 | liter | Milli-Q-Water |
| 3.7 | g | NaHCO3 |
| Stir slowly until dissolved |
| Adjust pH~7.2 |
| Filter sterilize (following filter sterilization pH to |
| rises to 7.4) |
| Keep at 4° C. |
| STO CELL MEDIUM |
| 83.0 | ml | DMEM |
| 15.0 | ml | 15% fetal bovine serum (FBS); batch tested |
| before use | ||
| 1.0 | ml | Pen/Strep 1:100 |
| 1.0 | ml | Glutamine 1:100 (if needed) (see note below) |
| Filter sterilize and keep at 4° C. |
| Note: |
| Replenish complete medium (DMEM medium) (STO or |
| ES) with glutamine. |
| *This step is only required if medium is older than 1 |
| week–10 days, as the glutamine breaks down after this |
| time. |
| ES CELL MEDIUM WITH OR WITHOUT LIF |
| up to | ml | DMEM |
| 100.0 | ||
| 15.0 | ml | 15% FBS (batch tested before use; |
| see below) | ||
| 1.0 | ml (from 0.01M | β-mercaptoethanol (0.1 mM |
| stock) | final concentration) | |
| 1.0 | ml | Pen Strep. 1:100 |
| 0–1.0 | ml | Glutamine 1:100 (if needed) |
| 1.0 | ml | Nystatin 1:100 |
| 0–2.5 | ml | Recombinant murine LIF (from 4 × 104 U/ml; |
| 1000 U/ml stock); activity-tested | ||
| using LIF Assay (see below) | ||
| 0.4 | ml | Gentamicin |
| 1.0 | ml | Nucleotides |
| 1.0 | ml | Non-essential amino acids |
| PENICILLIN/STREPTOMYCIN ANTIBIOTIC |
| SOLUTION (1:100) - |
| Commonwealth Serum Laboratories, Australia; |
| Catalogue No. 05081901 |
| Penicillin G | 5000 U/ml | |
| Streptomycin Sulphate | 5000 μg/ml. |
| MITOMYCIN-C SOLUTION |
| 2.0 | mg | Mitomycin-C (Sigma Chemical Co. (“Sigma”); |
| Catalogue No. M0503) | ||
| 200.0 | ml | STO Cell Medium |
| Filter sterilize, divide into 20 × 10 ml aliquot's and |
| store at −20° C. |
| PHOSPHATE BUFFERED SALINE (PBS) |
| For 100 ml | (Ca++ and | (Ca++ and | |
| Milli-Q Water: | Mg++ - containing) | Mg++ - free) | |
| NaCl | 0.89 | 0.80 | |
| KCl | 0.02 | 0.02 | |
| KH2PO4 | 0.02 | 0.02 | |
| Na2HPO412H2O | 0.289 | 1.115 | |
| CaCl2—2H2O | 0.014 | — | |
| MgCl2—6H2O | 0.01 | — | |
| Na pyruvate | 0.0036 | — | |
| D-glucose | 0.1 g | — | |
| Adjust to pH 7.4 and filter sterilize |
| (Ca++ and Mg++ - free PBS is purchased from ICN Cell |
| Biology and Tissue Culture, Cat. No. 18-604-54) |
| TRYPSIN/VERSENE (TV) WORKING SOLUTION (TV × 1) |
| In PBS (Ca++ and Mg++ - free): |
| 0.25% (w/v) trypsin (lyophilized) |
| 0.04% (w/v) EDTA or EGTA |
| or: |
| To 1 liter of milli-Q water add the following: |
| Trypsin powder (Porcine, Difco) | 2.5 | g | |
| EDTA or EGTA | 0.4 | g | |
| NaCl | 7.0 | g | |
| Na2HPO412H2O | 0.3 | g | |
| KH2PO4 | 0.24 | g | |
| KCl | 0.37 | g | |
| D-Glucose | 1.0 | g | |
| Tris | 3.0 | g | |
| Phenol red | 1.0 | ml |
| Adjust to pH 7.6, filter sterilize, aliquot and store |
| frozen. |
| EGTA: | Ethylene-glycol-bis(β-amino-ethyl ether) N,N,N′,N−- |
| tetra-acetic acid [Ethylene-bis (oxy- | |
| ethylenenitrilo)]tetraacetic acid | |
| EDTA: | Ethylenediaminetetraacetic Acid |
| Milli-Q Water | 100 | ml | |
| Adenosine (Sigma) | 80 | mg | |
| Guanosine (Sigma) | 85 | mg | |
| Cytidine (Sigma) | 73 | mg | |
| Uridine (Sigma) | 73 | mg | |
| Thymidine (Sigma) | 24 | mg | |
| Glycine | 7.5 | |
| L-Alanine | 8.9 | |
| L-Asparagine.H2O | 15.0 | |
| L-Aspartic Acid | 13.3 | |
| L-Glutamic Acid | 14.7 | |
| L-Proline | 11.5 | |
| L-Serine | 10.5 | |
| KCl | 0.0356 | ||
| KH2PO4 | 0.0162 | ||
| MgSO4.7H2O | 0.0294 | ||
| NaCl | 0.4 | ||
| NaHCO3 | 0.2106 | ||
| Glucose | 0.1 | ||
| Na Pyruvate | 0.0036 | ||
| Ca Lactate 5H2O | 0.0527 | ||
| Na Lactate | 0.2416 | ml | |
| Milli-Q-H2O | 100 | ml | |
The solution is adjusted to a final milliosmolarity of 250–280 by addition of H2O or NaCl.
Filter sterilize and store at 4° C. for two weeks.
Working Solution:
| 10 | ml | Whitten's medium |
| 1.5 | g | BSA fraction V (Miles Pentex, |
| Diagnostic division, Kankakee, Il., USA; | ||
| Code No. 81-001-4) | ||
Filter Sterilize and equilibrate in 5%O2:5% CO2:90% N2 at 39.5° C., 95% humidity.
FBS Batch Trials
Batches of FBS vary in the ability to support growth of ES cells, and in the ability to maintain the undifferentiated state of such cells. The following procedure is used to identify suitable batches of FBS. Use ES cells from between 2 & 20 passages:
| Dish | Batch FBS | Control Serum |
| Number | No. Cells | A | B | (Batch Tested) | ||
| Non-Inactivated |
| Serum |
| 1 | 2 | 250 | 5 ml | — | — | |
| 3 | 4 | 250 | — | 5 ml | — | |
| 5 | 6 | 250 | — | — | 5 ml | |
| 7 | 8 | 2000 | 5 ml | — | — | |
| 9 | 10 | 2000 | — | 5 ml | — | |
| 11 | 12 | 2000 | — | — | 5 ml |
| Inactivated Serum, as |
| control (56° C. for 15 min.) |
| 13 | 14 | 250 | 5 ml | — | — | |
| 15 | 16 | 250 | — | 5 ml | — | |
| 17 | 18 | 250 | — | — | 5 ml | |
| 19 | 20 | 2000 | 5 ml | — | — | |
| 21 | 22 | 2000 | — | 5 ml | — | |
| 23 | 24 | 2000 | — | — | 5 ml | |
There are duplicate plates for each treatment.
This procedure is used to assay the potency of Leukaemic Inhibitory Factor (LIF).
| Presumed | ||||||
| No. | Medium | 1000 | Medium | LIF | ||
| Dish | Cells | C.M. | LIF | U/ml | w/o LIF | Content |
| 1, 2, 3 | 250 | 0.1 ml | 4.9 ml | — | — | 200 U/ml |
| 4, 5, 6 | 250 | 0.25 ml | 4.75 ml | — | — | 500 U/ml |
| 7, 8, 9 | 250 | 0.5 ml | 4.5 ml | — | — | 1000 U/ml |
| 10, 11, 12 | 250 | 1.0 ml | 4.0 ml | — | — | 2000 U/ml |
| 13, 14, 15 | 250 | — | — | 5 ml | — | |
| 16, 17, 18 | 250 | — | — | — | 5 ml | |
There are triplicate plates for each treatment.
Fix and stain for alkaline phosphatase.
Embryonic pluripotential cells are cultured in vitro on a layer of fetal fibroblast cells. The fibroblast cells provide a wide range of factors necessary for the growth of pluripotential embryonic cells (e.g. growth factors, cytokines, factors that are essential for maintenance of ES cell pluripotency).
Isolation of Porcine Fetal Fibroblasts:
Several different types of mouse feeder (STO cells) and porcine and bovine fetal fibroblasts can be used to form feeder layers. These include:
The procedure for producing feeder layers is as follows:
This procedure is used to expand the number of cells from a single confluent plate/dish; cells are detached from the confluent plate and transferred to fresh plates at sub-confluent densities.
The present inventors use two alternative methods for inactivating feeder layers, which stops the cells from dividing:
(1) Mitomycin Treatment:
(2) Gamma Irradiation:
A. Blastocyst Injection
The ability of embryonic cell lines to form germline chimeric animals is a conclusive test for their totipotency. This can be accomplished by blastocyst injection experiments, using techniques for various mammalian species substantially the same as those established for the mouse. See Example 14, below. See also, e.g., Bradley, Production and Analysis of Chimeric Mice, In: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach (E. J. Robertson, ed.), IRL Press, Oxford, pp. 113–52 (1987). However, for porcine manipulations the holding pipette must be somewhat larger as porcine embryos are larger than mouse embryos.
B. Co-Culture of ES Cells/PGC's and Morula Embryos
Embryos at the morula stage of development are surgically collected from superovulated animals. For porcine embryos, for example, the zona pellucida is then disrupted using Acid Tyrodes solution and ES cells/PGC's are cultured in the presence of the zona pellucida-disrupted morulae. ES/PGC cells adhere to the exposed morula cells and, following overnight culture in Whitten's medium, the embryos are transferred to synchronized recipients. Preferably, the zona pellucida-disrupted morula is completely free of the zona pellucida. However, this need not be the case as long as the ES cells/PGC's can gain direct access to at least some of the morula cells.
C. Morula Injection
ES cells and PGC's can be injected into a morula embryo prior to formation of the blastocyst cavity. The technique is similar to blastocyst injection. ES cells or PGC's are drawn into an injection pipette, which is inserted beneath the zona pellucida. Then, the cells are expelled so that they are in contact with the cells of the morula embryo. The injected morula is then cultured overnight in Whitten's medium (porcine) or other appropriate medium to allow blastocyst formation.
D. Nuclear Transfer and Embryo Cloning
ES cells and PGC's can be fused to enucleated zygotes that have been derived by in vitro maturation, in vitro culture, in vitro fertilization or collected surgically. Following successful fusion the embryos can be transferred to synchronized recipients. In vitro or in vivo-collected porcine oocytes, for example, are manipulated in Whitten's medium supplemented with 1.5% BSA Fraction V and 7 μg/ml cytochalasin B (Sigma). A bevelled micropipette is used to remove the metaphase plate from the oocyte. A single ES cell or PGC (after trypsin treatment to form a single-cell suspension) is inserted through the zona using a bevelled micropipette, such that the cell comes in contact with the oocyte plasma membrane. Fusion is achieved in a 28 V/cm AC field for 5 sec. followed by an 80 V/cm DC pulse of 100 μsec. duration. Subsequent to observed fusion, embryos are incubated at 39° C. in 5% CO2, 5% O2, 90% N2 in microdrops of Whitten's medium supplemented with 1.5%-BSA, until transfer to a synchronized recipient.
Murine ES Cell Culture
ES cells are able to differentiate spontaneously into many different cell types, and culture conditions which prevent this differentiation are critical for the continuous passage of these cells in an undifferentiated form, capable of contribution to chimeric mice.
I. Culture Conditions
ES cells are grown in polystyrene cell culture dishes treated with 0.1% gelatin (made up in PBS or Milli-Q water) for 10 minutes. A feeder layer of mitotically inactivated fibroblasts provides a source of cytokines. The fibroblasts are either primary mouse embryo fibroblasts (PMEFs), or STO fibroblasts, an immortal line. The medium used is DMEM supplemented with glucose, amino acids and nucleosides. Robertson, Embryo-Derived Stem Cell Lines. In: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach (E. J. Robertson, ed.), IRL Press, Oxford (1987). To this medium is added LIF (final concentration of 103 U/ml Esgro, AMRAD). FBS is added to 15%. The batch of FBS is chosen on the basis of its ability to support ES cell growth with low levels of differentiation (i.e, only rare individual cells undergo differentiation. The ES cells are grown in an atmosphere of 5–10% CO2, at 37° C.
II. Routine Passage
ES cells must be passaged frequently to prevent the colonies from growing too large and differentiating. This is achieved by splitting the cells at a ratio of 1:10 to 1:40, every two to four days.
The general procedures set out in this Example provide guidelines that are readily adaptable to individual experimental situations that might employ, for example, different cell lines or equipment supplied by different manufacturers. This Example also provides specific procedures used and results obtained in generating a set of mouse ES cell lines in which the α 1-3-galactosyltransferase gene was disrupted by homologous recombination. The general procedures provided in this Example are adapted for mouse ES cells. However, the procedures are substantially similar for porcine-ES cells.
I. Introduction of DNA into ES Cells by Electroporation
A. Coat required number of plates with 0.1% gelatin (in PBS or Milli-Q water). (Usually 2×6 well plates and 8 well plate)
B. Thaw 107 embryonic fibroblasts into DMEES (equivalent to ES Cell Medium); inactivate by irradiating at 3000 Rad.
C. Count irradiated cells, spin down and resuspend in DMEES to 106 cells/ml.
D. Aspirate gelatin from plates and plate cells at: 7×105 cells/well (6 well plate) in 2.5 ml medium; 7×104 cells/well (24 well plate) in 1 ml medium. Incubate at 37° C., 5–10% CO2 for 3–4 hr.
E. Wash ES cells in 5 ml (250 ml flask) PBS-EGTA- and let sit at room temperature for 4 min.
F. Remove PBS, add 5 ml trypsin (CSL) and leave at room temperature for 2–4 min. Wash down cells, add 10 ml DMEES and count. Approximately 5×106 to 2×107 ES cells are needed for experiments.
G. Centrifuge cells and resuspend in 10 ml PBS. Centrifuge again and resuspend in 540 μl PBS. Dilute 50 μl into 10 ml DMEES and culture to determine plating efficiency.
H. Add 5–10 μg DNA to cells in 10 ul PBS (total volume, 500 ml) and transfer to sterile electroporation cuvette (e.g. Biorad).
I. Electroporate at 0.22 kV, 500 μFD (time constant should be ˜8.4). This is achieved using a Biorad Gene Pulser unit (Biorad Catalogue No. 1652078) with capacitance extender (Biorad Catalogue No. 1652087), or similar device.
J. Resuspend in 10 ml DMEES with constant pipetting to break up clumps of DNA from lysed cells.
K. Centrifuge cells and resuspend in 5 ml DMEES.
L. Take 50 μl, add 50 μl trypan blue solution and count for viability.
M. Culture by dilution plating to determine plating efficiency.
II. Selection Conditions
ES cells that do not express a neomycin resistance gene are selectively killed by treatment with G418 at 200–500 μg per ml of medium. Antibiotic-containing medium is changed daily. A population of cells that has not been electroporated also is treated in order to see how genuinely sensitive cells respond to the G418 treatment. After 6 to 10 days, cells resistant to the antibiotic will be evident as healthy colonies. These cells will have been transformed by the targeting construct and can be screened for homologous recombination (i.e., screened for gene targeting versus random integration).
Resistant colonies are picked from the selection dish with a mouth pipette and dispersed into a single cell suspension. Half of these cells are frozen away while the other half is expanded and used to determine whether or not homologous recombination has occurred. If the colonies are small, it is sometimes preferable to expand the whole colony in a 24 well dish, and then to freeze half while further expanding the other half for genetic analysis.
III. Picking ES Cell Colonies for Genetic Analysis After Selection
A. Method 1: Freezing Half Colonies
Cells that have been identified to have the desired genetic alteration are recovered from a duplicate plate frozen at −70° C. The plate is taken to the laminar flow hood and removed from the plastic bag. Each well is filled with warm medium, and feeder cells are Added to the well(s) of interest. The plate is placed in a 37° C. incubator for 60 min., then the medium is replaced colonies will appear after two or three days. These colonies are expanded for establishment of new frozen stocks, and tested for 1) karyotype analysis; 2) confirmation of the desired genetic alteration; 3) mycoplasma infection; and 4) ability to form chimeras.
I. Transformation
A total of 1×107 E14 ES cells was electroporated with 5 μl of 1 μg/μl pNeoαGT10.8B DNA (linearized by XhoI digestion) (see Example 9 and FIG. 17). Electroporation was carried out in 600 μl in a wide cuvette at 25 μF, 350V for 0.5 msec. Cells were recovered in 6 ml. ES complete medium and plated into 6×100 mm petri dishes, each containing a feeder layer of NeoR STO cells.
Cells were cultured in ES complete medium for 3 days and then medium containing 200–350 g/ml G418 was substituted. This medium was changed every second day. After 9 days, individual NeoR colonies were sufficiently large to be identified and recovered. Colonies were picked in 201 PBS and 201 of trypsin solution were added. Forty μl of 60% BRL conditioned medium in ES complete medium were then added. Aliquots of 40 μl were transferred to single wells of each of two 24-well plates. One plate contained a feeder layer of STO cells in 100 μl ES complete medium. 140 μl of 2×DMSO freezing mix was added to this plate, which was stored at −80° C. Each of the wells of the second 24-well plate contained 1 ml of 60% BRL conditioned medium in ES complete medium. This plate was incubated at 37° C. until the colonies were confluent.
II. Confirmation of Homologous Recombination
Medium was aspirated off confluent colonies and 400 μl lysis buffer (10 mM Tris pH 7.8, 100 mM NaCl, 1 mM EDTA, 1% SDS, and 500 g/ml Proteinase K) added. The cells were lysed at 37° C. overnight, extracted with 400 μl 1:1 phenol/chloroform and transferred to Eppendorf tubes containing 1 ml 95% ethanol and 0.2M NaAc. DNA was pelleted by centrifuging at 13,000 rpm in an Eppendorf centrifuge, the pellet washed twice with 80% ethanol and redissolved in 30 μl water.
Southern analysis (see, e.g., Sambrook et al., supra) was used to identify ES cell clones where homologous recombination had occurred at the 3′ end of the construct. Aliquots of 15 μl of DNA were digested with 20 units of the restriction enzyme BglII according to the manufacturer's recommendations. After incubation at 37° C. overnight, the DNA was electrophoresed through a 0.8% agarose gel (in a Tris acetate, EDTA buffer) at 1–2V/cm overnight, using 750 ng of HindIII-digested lambda DNA as markers. The DNA was transferred to a Zetaprobe nylon membrane using a Hybaid vacublotter at a vacuum of 80 cm Hg for 1 hour.
The membrane was prehybridised in a Hybaid hybridization bottle in 10 ml of the following hybridization mix for 3 hours at 65° C.:
Radioactively labeled probe DNA was prepared using a BRESATEC gigaprime oligo labeling kit (Cat. No. GPK-1) according to the manufacturer's recommendations. Approximately 50 ng of a 0.7 kb EcoRI/XmnI DNA fragment from beyond the 3′ terminus of the construct pNeoαGT10.8B (see Example 9 and FIG. 17) were labeled with 32P-dATP to a specific activity of 5×108 cpm/μg. The denatured probe was added to the prehybridising membrane in the Hybaid bottle and incubated overnight at 65° C.
The membrane was removed from the Hybaid bottle, rinsed with 0.5×SSC, 0.1% SDS prewarmed to 65° C., and then washed 2–3 times with 0.1×SSC, 6.1% SDS at 65° C. for 30 min each wash. Excess moisture was then blotted from the membrane, the membrane wrapped in plastic wrap and exposed to a phospho-imager screen for 16 hours up to 3 days. The image was visualized on an Imagequant phospho-imager.
Results are shown in FIG. 18, which is a Southern blot of DNA from 15 ES cell lines probed with the diagnostic 0.7 kb EcoRI/XmnI DNA fragment described above and in Example 9. The 6.4 kb band, diagnostic for a homologous recombination event in the α 1-3 galactosyltransferase gene (α 1-3 Gal T) (see Example 9), is seen in 6 of the 15 ES cell lines examined. All of the 6 knockout cell lines appeared to be heterozygous for the inactivated allele since the 8.3 kb band, diagnostic for the uninterrupted α-1,3-Gal T gene (see Example 9), was also present in all six lanes.
Two cell lines, designated hereinafter “8D1” and “7C2,” were chosen for further analysis. Cell lines 8D1 and 7C2 were identified by Southern analysis to contain an α-1,3-Gal T allele where homologous recombination had occurred at the 3′ boundary of the construct.
Long range PCR was then used to determine whether or not homologous recombination had occurred at the 5′ boundary of the construct within these cell lines. Two sets of primers were used in separate PCR experiments:
1) Wild-type Primers:
MGT-KOex8F and MGT-KOR1 span the intron between exons 8 & 9, and amplify a 5.5 kb fragment from the wild-type α-1,3-GalT gene (FIG. 19)
Sequences:
MGT-KOex8F
5′TGCTGGAAAAGTACTACGCCACACAGAAACTCA-3′ (SEQ ID NO: 14)
(Nucleotides 1014–1046 in FIG. 4)
MGT-KOR1
5′AGCCAGAGTAATAGTGTCAAGTTTCCATCACAA-3′ (SEQ ID NO: 15)
(Nucleotides 1779–1811 in FIG. 4)
2) Knockout Primers:
MGT-KOex8F and MGT-KONeoR span exon 8 to the NeoR gene cassette in the “knock-out” allele and amplify a 5.5 kb fragment from the knocked out allele (FIG. 19)
Sequence:
MGT-KONeoR
5′-GCCACACGCGTCACCTTAATATGCCAAGTGGAC-3′ (SEQ ID NO: 16)
(Nucleotides 323–355; FIG. 16)
Each reaction contained ˜100 ng genomic DNA as template in a reaction volume of 50 μl and contained 25mM Tris HCl (pH9.1), 16 mM (NH4)2SO4, 250 μM dNTPs, 3.5 mM MgCl2, 100 ng each primer, 2 units Taq polymerase and 0.025 units Pfu polymerase. The reactions were heated at 94° C. for 1 min, then 45 cycles of 94° C. for 15 sec, 68° C. for 6 min, followed by a single step of 72° C. for 10 min. Genomic DNAs from putative “knock-out” ES cell lines from CBA/C mice (homozygous for the wild-type α-1,3-Gal T allele) were amplified in separate reactions using each set of primers. A 101 aliquot of each PCR was analyzed by Southern blotting (Sambrook et al., 1989).
The results are illustrated in FIG. 20:
Knockout Primers:
The procedures provided in this Example are adapted for mouse ES cells. However, the general strategy is substantially the same for porcine ES cells and PGC's.
I. Preparation of ES Cells for Injection
ES cells are split into wells of a 24-well dish at cell densities of 1:2, 1:4, 1:8 and 1:16, relative to the initial density, two and three days before injection. The most vigorous and least differentiated cultures are chosen on the basis of morphology.
II. Embryo Injection and Production of Chimeric Mice
Mouse embryos are collected from either superovulated or naturally mated female mice, approximately 3.5 days after mating. After overnight culture in M16 medium (Bradley, Production and Analysis of Chimaeras. In Teratocarcinomas and Embryonic Stem Cells a Practical Approach (E. J. Robertson, ed.) IRL Press, Oxford, pp. 113–52 (1987)), those that have cavitated to form blastocysts are microinjected with about 12 to 20 ES cells. This microsurgical procedure is performed with instruments drawn from capillary glass, and injection is controlled with micrometer syringe-based hydraulic devices. A differential interference contrast-equipped inverted microscope is used to view the procedure.
After injection, blastocysts are transferred to the uterus of pseudopregnant female mice. Chimeric mice are identified by coat color contribution by the ES cells. Chimeric mice show agouti coat colour derived from the host blastocyst, and chinchilla contributed by the ES cells.
Chimeric mice were generated from ES cells carrying the interrupted α-1,3-Gal T allele (including 8D1, 7C2 cells) by injection into C57Bl/6J x CBA F2 blastocysts. The ability of individual chimaeric mice to transmit the ES cell characteristics through the germ-line was estimated by glucose phosphate isomerase (Gpi) analysis of sperm (Bradley, supra, (i987)); Mann et al., J. Reprod & Fert. 99, 505–512 (1993). Glucose phosphate isomerase catalyses the interconversion of glucose-6-phosphate to fructose-6-phosphate. Mice have a single structural Gpi locus with two main alleles Gpi 1A and Gpi 1B. Gpi 1A codes for protein which appears as a slow cathodically migrating band during electrophoresis and occurs in strains such as BALB/c and C129. (The ES cells used here were derived from strain 129 mice). Gpi 1B determines an enzyme that moves faster than Gpi 1A and occurs in the wild and in strains such as C57 and CBA (used here to derive host blastocysts).
Heterozygotes have the two parental bands plus an intermediate band which indicates the dimeric structure of the enzyme. Multiple electrophoretic forms occasionally observed are due to oxidation of sulfyhdryl groups and not due to tissue-specific expression. In chimaeric mice, the ratio of Gpi 1A (strain 129-derived) to Gpi 1B (derived from the host blastocyst) indicates the proportion of cells with the ES cell genotype within different tissues. The appearance of Gpi 1A (derived from the ES cells) in the sperm suggests that the mouse is able to transmit the ES cell genotype through the germ-line.
III. Generation of Mice Homozygous for the Genetic Change Introduced into the ES Cells.
Chimeric mice with sperm derived from ES cells were mated to BALB/c mice. Offspring with the 129/Ola X BALB/c genotype (i.e. heterozygous for the ES cell genotype) are grey. Half of these grey mice were expected to carry the interrupted allele. Mice heterozygous for the interrupted allele were identified by PCR analysis of genomic DNA obtained from blood.
To generate mice homozygous for the inactivated α-1,3-Gal T gene, the heterozygous mice were mated to each other. One quarter of the offspring were expected to be homozygous for the interrupted gene. Homozygotes were identified by PCR analysis of genomic DNA obtained from blood. The PCR strategy was based on the insertion of a NeoR gene in the Sal I site of exon 9 of the α-1,3-Gal T gene (FIG. 13).
Wild-type Primers:
E9F: 5′TCAGCATGATGCGCATGAAGAC 3′ (SEQ ID NO: 17)
(homologous to sequence about 40 to 60 bp 5′ to the Sal I site of exon 9, corresponding to nucleotides 1257–1278; FIG. 4)
E9R2: 5′TGGCCGCGTGGTAGTAAAAA 3′ (SEQ ID NO: 18)
(homologous to a region about 175 to 195 bp 3′ to the Sal I site of exon 9, corresponding to nucleotides 1511–1492; FIG. 4)
The expected fragment size generated from the wild-type allele is 255 bp (FIG. 21). These primers also can potentially generate a 1596 bp PCR fragment from the interrupted allele. In practice this fragment was not generated when both the wild-type and interrupted alleles were present, probably because the smaller 255 bp product is amplified preferentially.
Knock-out Primers:
NeoF1: 5′ TCTTGACGAGTTCTTCTGAG 3′ (SEQ ID NO: 19)
(corresponding to nucleotides 1170–1189; FIG. 16)
E9R2: (the same primer described above to detect the wild-type allele)
The expected fragment size is 364 bp (FIG. 21).
Mice were grown to weaning age and bled from the tail. Sodium Heparin was added to about 10 U/ml. PCR amplification was conducted on 1 μl of heparinised blood (˜104 nucleated cells) in a 50 μl reaction volume containing 100 mM Tris-Acetate pH 8.8, 3.5 mM MgCl2, 0.2 mM dNTPs, and 2 units Tth DNA polymerase. Each reaction contained both the wild-type and knock-out primers at a concentration of 2 ng/μl for each primer. To ensure that Tth polymerase was not inhibited by heparinized blood, each reaction was performed in duplicate.
One of the reactions was spiked with two DNA samples:
i) 10 fg (˜600 molecules) of linearized KO plasmid pNeoαGT10.8B.
ii) 1 fg (˜1000 molecules) of a 983 bp RT-PCR product that includes Exon 9.
The other reaction was not spiked. Thus, two separate PCR reactions were set up for each blood sample. In addition, control PCR reactions with no genomic DNA template and with or without spikes were conducted. Each reaction mix was heated at 94° C. for 3 min., then incubated for 40 cycles at 94° C. for 40 sec., 53° C. for 40 sec., and 72° C. for 40 sec. Aliquots of 5 μl of each reaction mix were electrophoresed on a 3% agarose gel, and DNA fragments were visualized on a UV light box after staining with ethidium bromide. HpaII-digested pUC19 plasmid DNA was used for markers.
Results of the PCR analysis for three mice, and a “no DNA” control, are shown in FIG. 22. For mouse #42, the KO primers generated a 364 bp band in the + spike reaction only. The wild-type primers generated a 255 bp band in the + spike and − spike reactions. These results demonstrate that mouse #42 is homozygous for the wild-type allele. For mouse #43, the wild-type primers generated a 255 bp band in the + spike reaction only. The KO primers generated a 364 bp band in the + spike and − spike reactions. These results demonstrate that mouse #43 is homozygous for the interrupted allele. For mouse #44, the KO primers generated a 364 bp band in the + spike and − spike reactions. The wild-type primers generated a 255 bp band in the + spike and − spike reactions. These results demonstrate that mouse #44 is heterozygous for the interrupted allele. In the control PCR reactions, no product was evident when template was not included. PCR products of 364 bp and 255 bp were evident when pNeoαGT10.8B and Exon 9 RT-PCR DNA were the only templates included in the control reactions.
I. Absence of Gal T mRNA in Gal T Knockout Mice
A. RNA Isolation
Total RNA was extracted using the RNAzol™ B kit (BIOTECX Laboratories, Inc., 6023 South Loop East, Houston, Tex. 77033, USA.), supplied by Bresatec. This extraction procedure is based on the method described by Chomczynski et al., Anal. Biochem. 162: 156–159 (1987), and involves homogenization in a guanidinium/phenol solution, a chloroform extraction, 2 isopropanol precipitations, and 75% EtOH washes. The RNA was stored as an EtOH precipitate at −20° C. and quantitated by measuring absorption at wavelength 260 nm in water. The integrity and quantitation was confirmed by electrophoresis in agarose/formaldehyde gels. Sambrook et al. Molecular Cloning, A Laboratory Manual. Second Edition. (1989)
B. RT-PCR
First strand cDNA synthesis involved:
C. PCR Analysis of cDNA
α-1,3-Gal T cDNA was detected by PCR amplification of oligo dT-primed cDNA template. Failure to generate this PCR fragment, in conjunction with the control PCR results, indicated that α-1,3-Gal T mRNA was absent from the RNA preparation. To demonstrate that the α-1,3-Gal T primers supported amplification of the α-1,3-Gal T template, each reaction was assembled in duplicate, and one of the reactions was spiked with 0.1 fg (˜100 molecules) of a 983 bp mouse α-1,3-Gal T cDNA product (generated by primers 7F and mGT-3UR, spanning exon 7 to the 3′ untranslated region). As a second control to demonstrate that cDNA synthesis had occurred, a ferrochelatase PCR fragment was generated from the cDNA template.
1. Primers:
Primers to detect α-1,3-Gal T cDNA:
7F: 5′-TGGAGATCGCATTGAAGAGC 3′ (SEQ ID NO: 20)
Primers 7F and 9R2 were expected to generate a fragment of ˜619 bp (FIG. 23) from the cDNA template. These primers will not generate a fragment from genomic DNA possibly present in the cDNA preparation, since the primers span two large introns.
mGT-3UR: 5′-GGGTTTTGGTTTTGATTGTT 3′ (SEQ ID NO: 22)
These primers were expected to generate a 709 bp fragment (FIG. 23). These primers will not generate a fragment from genomic DNA possibly present in the cDNA preparation, since the primers span five introns.
Reaction volumes were 50 μl, consisting of 4 μl of the first strand cDNA synthesis reaction, 100 ng of each primer, 2 mM MgCl2, 0.3 mM dNTPS, 2 U of Taq-Polymerase (Bresatec) and Taq reaction buffer (Bresatec) at 1× concentration. Reactions were heated at 94° C. for 2 min, then 29 cycles of 94° C. for 15 sec, 58° C. for 30 sec and 72° C. for 1 min followed by single steps of 72° C. for 4 min and 4° C. for 5 min. A 10 μl aliquot of each PCR was electrophoresed on a 2% agarose gel and DNA fragments were visualized on a UV light box after staining the gel with ethidium bromide.
FIG. 24 shows the PCR fragments generated from RNA isolated from kidney (K), heart (H) and liver (L) of a wild-type mouse, and mice heterozygous or homozygous for the interrupted α-1,3-Gal T allele. FIG. 24(i) shows that the 709 bp ferrochelatase fragment was generated from each of the cDNA preparations, indicating that cDNA template was produced from the reverse transcription reaction, and was available for the α-1,3-Gal T gene primers. The 619 bp α-1,3-Gal T fragment was present in each of the reactions spiked with the 983 bp α-1,3-Gal T cDNA product (FIG. 24(ii)), indicating that amplification of the α-1,3-Gal T cDNA (spike) template had occurred.
In the reactions that were not spiked (FIG. 24 (iii)), the 619 bp α-1,3-Gal T fragment was detected in cDNAs synthesized from the wild-type and heterozygous RNAs. This indicates that α-1,3-Gal T mRNA is present in the kidney, heart and liver of the wild-type and heterozygous mice. The 619 bp fragment was not detected in the unspiked homozygous KO reactions, indicating that α-1,3-Gal T mRNA is not synthesized in the homozygous KO mice.
II. Test for Expression of the GAL Epitope in Homozygous Knockout Mice Using Anti-Gal Antibodies with Fluorescence-Activated Cell Sorting (FACS)
A. Solutions
Solutions 1 to 5 are 10× isotonic.
1. 1.68 M NaCl (948.21 g/l) Dry salts overnight in hot oven before weighing
2. 1.68 M KCl (125 g/l) Dry salts overnight in hot oven before weighing
3. 1.12 M CaCl2 (165 g/l CaCl22H2O) Dry salts overnight in hot oven before weighing
4. 1.68 M MgSO4(414 g/l MgSO47H2O) Do not dry in hot oven
5. Potassium phosphate buffer pH 7.2:
Potassium phosphate buffer is prepared by mixing together equal volumes of solutions a) and b). To pH the buffer, remove a small sample, dilute 1:50 and read on pH meter.
6. Hepes buffer 1 M (CSL, Melbourne Australia)
7. KDS BSS:
Add stock solutions in the following order to double-distilled water (DDW):
| Stock | Ratio of Solutions | |
| DDW | 1210 | |
| NaCl | 121 | |
| KCL | 3 | |
| CaCl2 | 3 | |
| MgSO4 | 1 | |
| Potassium phosphate buffer | 2 | |
| Hepes | 20 | |
Filter Sterlise, store at 4° C.
8. KDS/BSS/2% HSA/0.02% azide:
| KDS/BSS | 244.5 ml | |
| Human serum albumin | 5 ml | |
| (CSL, Melbourne, Australia) | ||
| 10% Na azide in MT-PBS | 0.5 ml | |
9. FITC dilution: Dilute 7.5 ul FITC-IgG to 600 ul with KDS/BSS
10. Red cell lysis buffer:
11. 4% paraformaldehyde (PFA)
| Solutions: |
| A. | NaH2PO42H2O | 22.6 g/L |
| B. | NaOH | 25.2 g/L |
| C. | 40% paraformaldehyde: | |
| 1) 4 g paraformaldehyde (BDH, Kilsyth, | ||
| Australia, #29447) dissolved in 10 ml | ||
| double distilled water. Heat 70° C. 2 hours | ||
| on stirrer in fume hood and a few drops of | ||
| 2M NaOH are added until the solution | ||
| becomes clear. | ||
| 2) 0.54 g glucose is then added. | ||
| 3) Store RT in light proof bottle. | ||
| D. | Add together 83 ml of A + 17 ml of B. | |
| E. | Final 4% PFA fixative solution: 90 ml of D + 10 ml | |
| of C. pH 7.4–7.6; adjust pH with | ||
| 1M HCl. | ||
12. Hanks Balanced Salt Solution (Ca and Mg free)(HBBS):
| KCL | 400 | mg | |
| KH2PO4 | 60 | mg | |
| NaCl | 8 | g | |
| NaHCO3 | 350 | mg | |
| Na2HPO42H2O | 68 | mg | |
| Glucose | 1 | g | |
| H2O | to 1 | liter | |
| adjust to pH 7.0; filter sterilize |
13. Sheep antihuman IgG and IgM fluorescein isothiocyanate (FITC) F(ab)2 fragments (Silenus, Hawthorn, Australia):
B. Methods
1. Eye bleed mice, collect 300–400 ul into pre-chilled Ependorf tube, store on ice, add EDTA 20 mg/ml to give final concentration of 2 mg/ml.
2. Transfer blood (including appropriate human controls) to 10 ml plain tube and add 10 ml red cell lysis buffer (0.168 M NH4Cl) pre-warmed to 42° C.; incubate for several minutes or until cells have lysed.
3. Pellet cells by centrifugation (800×g, 7 min, 4° C.).
4. Resuspend cells in 10 ml KDS/BSS/2% HSA/0.02% NaN3
5. Pellet cells as above; repeat steps 4 & 5.
6. Resuspend cells in 1000 ul KDS/BSS/2% HSA/0.1% NaN3; transfer aliquots to V bottom FACS tubes.
7 Pellet cells as above.
8. Resuspend cells in 100 ul KDS/BSS/2% HSA/0.1% NaN3
9. Add 50 ul of purified anti-GAL antibody (see Example 1, above), normal human serum (NHS) or HBBS/2% HSA/0.1% NaN3 and incubate 45 min.
10. Add 2 ml KDS/BSS/2% HSA/0.02% NaN3; centrifuge cells as above.
11. Add 50 ul of a 1:80 dilution of sheep antihuman IgG or IgM FITC F(ab)2 fragment (Silenus).
12. Add 2 ml KDS/BSS/2% HSA/0.02% NaN3; centrifuge cells as above.
13. Resuspend cells in 300 ul KDS/BSS/2% HSA/0.02% NaN3.
14. Transfer samples to plastic round-bottom FACS tubes and add 3 ul of propidium iodide (100 ug/ml); samples are now ready for analysis; keep on ice.
15. Analyse on Beckman FACS scan using peripheral blood lymphocyte settings.
C. Results
The results of these experiments are given below:
| median channel | peak channel | |
| fluorescence | fluorescence | |
| (log scale) | (log scale) | |
| MOUSE 129 (Normal) | 9 | 9 | |
| PBL + FITC anti- | |||
| IgG alone | |||
| (neg. control) | |||
| MOUSE 19 PBL | 197 | 286 | |
| (wild type) | |||
| GAL IgG | |||
| MOUSE 21 PBL | 22 | 15 | |
| (Gal KO) | |||
| GAL IgG | |||
| MOUSE 129 (Normal) | 7 | 1 | |
| PBL + FITC anti- | |||
| IgM alone | |||
| (neg. control) | |||
| MOUSE 19 PBL | 185 | 167 | |
| (wild type) | |||
| GAL IgM | |||
| MOUSE 21 PBL | 34 | 18 | |
| (Gal KO) | |||
| GAL IgM | |||
| MOUSE 129 PBL (normal) | 8 | 9 | |
| PBL + FITC IgG alone | |||
| (neg. control) | |||
| MOUSE 129 PBL (normal) | 120 | 328 | |
| GAL IgG | |||
| MOUSE 9 PBL | 10 | 9 | |
| (Gal KO) | |||
| GAL IgG | |||
The results of human anti-Gal binding to human peripheral blood lymphocytes (negative control) are not shown but were negative. These experiments demonstrate that human anti-Gal (IgG and IgM) antibodies bind to peripheral blood cells of the homozygous α1,3 galactosyltransferase knockout mice (mouse 21 and mouse 9) very weakly if at all. This confirms the expected lack of the galactose α1,3 galactose (GAL) epitope in such mice. In contrast, peripheral blood cells of normal mice (mouse 129 and mouse 19) of the same strain display clear binding of anti-Gal antibodies.
III. Test for Expression of the GAL Epitope in Homozygous Knockout Mice Using IB4 Lectin with FACS
IB4 Lectin has an exclusive affinity for terminal α-D-galactosyl residues, and is demonstrated below to be useful for characterizing the knockout mice.
A. Solutions
| Na2HPO4 | 2.27 g | |
| NaH2PO42H2O | 0.62 g | |
| NaCl | 8.7 g | |
| Make up to 1 liter with DDW |
B. Methods
1. Remove spleen, hold with curved forceps and collect splenocytes by injecting with a 27 gauge needle bent at 90° C., injecting (2.5 ml syringe) 100–200 ul buffer into the spleen two or three times. Using the flat surface of the bent needle massage cells out of holes made in spleen. Repeat injections and removal of cells until no cells remain in capsule.
2. Transfer splenocytes to 10 ml tube and centrifuge to pellet cells (500×g, 7 min, 4° C.).
3. Remove supernatant and add 3 ml red cell lysis buffer pre-warmed to 42° C.; incubate for several minutes or until cells have lysed. Underlay with 1 ml HIFCS (heat inactivated fetal calf serum) and stand on ice 5 minutes. Top to 10 ml with KDS BSS/10% HIFCS.
4. Centrifuge as above.
5. Resuspend cells in 3 ml dead cell removal buffer; mix well with pipette.
6. Pass through a glass pipette plugged with cotton wool and collect cells into a 10 ml tube. Don't force cells through, allow to drain under gravity.
7. Underlay cells with 1 ml BSS/10% HIFCS.
8. Centrifuge as above.
9. Remove supernatant.
10. Centrifuge as above; repeat steps 4 & 5.
11. Add 0.5 ml cold 4% paraformaldehyde (PFA).
12. Incubate on ice for 5 min with intermittent mixing.
13. Add 2 ml ice cold HBBS and centrifuge as above.
14. Repeat washings with 2 ml and then 1 ml HBBS.
15. Resuspend cells in 10 ul KDS/BSS/2% HSA/01.% NaN3; transfer to V bottom FACS tubes.
16. Add FITC IB4 lectin (Sigma, Cat. No. L 2895), 50 ul at 20 ug/ml, or 50 ul HBBS; incubate on ice for 30 min.
17. Add 2 ml KDS/BSS/2% HSA/0.1% NaN3; spin cells as above.
18. Resuspend cells in 300 ul KDS/BSS/2% HSA/0.1% NaN3.
19. Transfer samples to plastic round-bottom FACS tubes; samples are now ready for analysis; keep on ice.
20. Analyse on FACS scanner using peripheral blood lymphocyte setting.
C. Samples
1. Mouse 129 splenocytes alone
2. Mouse 129 splenocytes+IB4 lectin
3. human PBL alone
4. Human PBL+IB4 lectin
D. Results
Results of these experiments are given below:
| mean | median | peak | |
| fluorescence | fluorescence | fluorescence | |
| channel | channel | channel | |
| (log scale) | (log scale) | (log scale) | |
| splenocytes alone | 1 | 1 | 1 |
| (autofluorescence) | |||
| mouse 19 | 252 | 58 | 16 |
| (wild type) | |||
| splenocytes | |||
| mouse 21 | 3 | 2 | 1 |
| (KO mouse) | |||
| splenocytes | |||
The results demonstrate that IB4 lectin binds spleen cells of the homozygous α1,3 galactosyltransferase gene targeted (Gal KO) mouse (mouse 21) very weakly if at all. This confirms the expected lack of the galactose α1,3 galactose (GAL) epitope in such mice. In contrast, peripheral blood cells of a normal mouse (mouse 19) of the same strain binds IB4 lectin strongly.
IV. Immunohistological Assessment of Mouse Tissues for the Presence of the Gal Epitope Using ANTI-GAL Antibodies.
A. Reagents
| 1. TBS: Tris Buffered Saline |
| NaCl | 8 g | |
| KCl | 0.2 g | |
| Tris base | 3 g | |
2. Blocking Buffer:
3. Peroxidase Conjugates:
DAKO (Denmark) peroxidase (POD) conjugated to rabbit anti-human IgG(fragment) and DAKO (Denmark) peroxidase (POD) conjugated to rabbit anti-human IgM (fragment).
Conjugates were both separately pre-absorbed on 10% mouse liver powder at 4° C. overnight, then centrifuged at 18,000×g for 10 minutes in a Biofuge and then at 30 psi for 30 min in a Beckman airfuge. Conjugated antisera were diluted 1/50 in 2% blocking buffer (TBS+0.2% BSA+2% rabbit serum) with 16% normal mouse serum.
4. Mouse Liver Powder Preparation:
As modified from Antibodies, a Laboratory Manual Ed Harber and David Lane, Cold Spring Harbour Laboratories (1988) p663:
a) Prepare a fine suspension of mouse liver in mouse tonicity phosphate buffered saline (MT-PBS). Mash liver through a sieve with a 5 ml plunger. Discard any fibrous tissue. One gram of tissue should be resuspended in approximately 1 ml MT-PBS.
b) Transfer the tissue/saline suspension to ice for 5 min.
c) Add 8 ml of acetone (−20° C.) (Univar 6, Ajax Chemicals) for 10 minutes. Mix vigorously. Incubate on ice for 30 minutes with occasional vigorous mixing.
d) Collect the precipitate by centrifugation at 10,000 g (9,000 rpm in Sorvall RC-5B refrigerated superspeed centrifuge). Spin for 10 minutes.
e) Resuspend the pellet with fresh acetone (−20° C.) and mix vigorously. Allow to sit on ice for 10 minutes.
f) Centrifuge at 10,000 g for 10 minutes. Transfer the pellet to a clean piece of filter paper. Spread the precipitate and allow to air-dry at room temperature.
g) After the pellet is dry, transfer it to an airtight container. Remove any large pieces that will not break into a fine powder. Dessicate and store at 4° C. Yield as approximately 10–20% of the original wet weight. To use acetone powders, add to a final concentration of 1%. Incubate for 30 min at 4° C. Spin at 10,000 g for 10 minutes. (13,000 rpm in Biofuge)
5. DAB/H2O2/Imidazole:
Peroxidase substrate: 3,3′-Diaminobenzidine tetrahydrochloride (DAB) (Sigma, Missouri)
6. Tris HCL:
1.211 g Tris in 200 ml double distilled water pH 7.6
7. Animal Serum Sources:
Mouse and rabbit sera were obtained in-house (St. Vincent's Hospital, Dept, of Clinical Immunology).
Sheep serum was obtained from the University of Melbourne Veterinary Clinic and Hospital, Werribee, Australia.
8. Harris Haematoxylin:
9.
| 9. Scott's Tap Water: |
| Sodium hydrogen carbonate | 14 | g | |
| MgSO4 | 80 | g | |
| Tap water | 4 | liters | |
B. Methods
C. Results
| KIDNEY |
| GLOMERULI | ENDOTHELIUM | comments | |
| MOUSE 129 | POSITIVE | POSITIVE | |
| anti-IgM | |||
| MOUSE 9 | NEGATIVE | NEGATIVE | weak adventitial |
| anti-IgM | staining | ||
| MOUSE 21 | NEGATIVE | NEGATIVE | weak adventitial |
| anti-IgM | staining | ||
| MOUSE 129 | POSITIVE | POSITIVE | |
| anti-IgG | |||
| MOUSE 9 | NEGATIVE | NEGATIVE | |
| anti-IgG | |||
| MOUSE 21 | NEGATIVE | NEGATIVE | |
| anti-IgG | |||
| POD conjugated | ALL | ALL | |
| antibody alone | NEGATIVE | NEGATIVE | |
These results indicate that human anti-Gal IgG and IgM antibodies do not bind kidney tissue of the α1,3 galactosyltransferase gene targeted (Gal KO) mice (mouse 21 and mouse 9). This confirms that lack of the galactose α1,3 galactose (GAL) epitope in the gene targeted (KO) mice. In contrast, these antibodies react strongly with the endothelium of blood vessels and the glomeruli of a normal mouse of the same strain (129).
V. Immunohistological Examination of Mouse Tissues Using IB4 Lectin
A. Reagents
B. Methods
20 μg/ml, incubate in a humidified chamber for 30 minutes.
C. Results
| Kidney |
| GLOMERULI | ENDOTHELIUM | |
| HUMAN | NEGATIVE | NEGATIVE | |
| PIG | POSITIVE | POSITIVE | |
| 129 MOUSE | POSITIVE | POSITIVE | |
| MOUSE 6 | POSITIVE | POSITIVE | |
| MOUSE 7 | POSITIVE | POSITIVE | |
| MOUSE 9 | NEGATIVE | NEGATIVE | |
| MOUSE 19 | POSITIVE | POSITIVE | |
| MOUSE 20 | POSITIVE | POSITIVE | |
| MOUSE 21 | NEGATIVE | NEGATIVE | |
| anti-FITC alone | ALL NEGATIVE | ALL NEGATIVE | |
| Liver |
| ENDOTHELIUM | BILE DUCT | |
| 129 MOUSE | POSITIVE | POSITIVE | |
| MOUSE 6 | POSITIVE | POSITIVE | |
| MOUSE 7 | POSITIVE | POSITIVE | |
| MOUSE 9 | NEGATIVE | NEGATIVE | |
| MOUSE 19 | POSITIVE | POSITIVE | |
| MOUSE 20 | POSITIVE | POSITIVE | |
| MOUSE 21 | NEGATIVE | NEGATIVE | |
| anti-FITC alone | ALL | ALL | |
| NEGATIVE | NEGATIVE | ||
| Heart |
| ENDO- | |||
| ENDOTHELIUM | PERINUCLEAR | MYOCARDIUM | |
| 129 MOUSE | POSITIVE | POSITIVE | POSITIVE |
| MOUSE 6 | POSITIVE | POSITIVE | POSITIVE |
| MOUSE 7 | POSITIVE | POSITIVE | POSITIVE |
| MOUSE 9 | NEGATIVE | NEGATIVE | NEGATIVE |
| MOUSE 19 | POSITIVE | POSITIVE | POSITIVE |
| MOUSE 20 | POSITIVE | POSITIVE | POSITIVE |
| MOUSE 21 | NEGATIVE | NEGATIVE | NEGATIVE |
| anti-FITC | ALL NEGATIVE | ALL NEGATIVE | ALL NEGATIVE |
| alone | |||
| Lung |
| ENDOTHELIUM | BRONCHI | PARENCHYMA | |
| 129 MOUSE | POSITIVE | POSITIVE | POSITIVE |
| MOUSE 6 | POSITIVE | POSITIVE | POSITIVE |
| MOUSE 7 | POSITIVE | POSITIVE | POSITIVE |
| MOUSE 9 | NEGATIVE | NEGATIVE | NEGATIVE |
| MOUSE 19 | POSITIVE | POSITIVE | POSITIVE |
| MOUSE 20 | POSITIVE | POSITIVE | POSITIVE |
| MOUSE 21 | NEGATIVE | NEGATIVE | NEGATIVE |
| anti-FITC | ALL NEGATIVE | ALL NEGATIVE | ALL NEGATIVE |
| alone | |||
These results indicate that IB4 lectin does not bind kidney, heart, liver or lung tissue of the α1,3 galactosyltransferase gene targeted (Gal KO) homozygous mice (mouse 21 and mouse 9). This confirms the lack of the galactose α1,3 galactose (GAL) epitope in the gene targeted (KO) mice. In contrast these antibodies react strongly with the tissues of a normal mouse and heterozygous KO mice (mouse 129, mouse 6, mouse 7, mouse 19, mouse 20) of the same strain.
VI. Resistance of Spleen Cells from Knockout Mice to Lysis by Human Serum
Lysis of spleen cells by human serum was tested through use of a 51 chromium release assay. See in general Example 4, above.
A. Preparation of Mouse Splenocytes—Shortman, K. J. et al, Immunological Methods. 1:273–287 (1972).:
B. Preparation of Serum:
C. Cell Counting:
D. 51Chromium Labelling:
| Incubation conditions |
| Cell Type | Time | Amount51Cr/107 cells | |
| Freshly prepared cells: | ~2 hours | ~150–300 μCl | |
| (eg., splenocytes or | |||
| lymphocytes) | |||
| Cultured Cells: | ~1 hour | ~100 μCl | |
Combine:
Incubate at 37° C. for time shown above with gentle agitation every 15 min.
E. Washing
F. Release Assay:
| Assay: |
| RPMI/ | |||||
| NHS | *HI-NHS | 16% SDS | CELLS | 2% HIFCS | |
| MAX Release | — | 90 μl | 22.5 μl | 25 μl | 42.5 μl |
| Spont. Release | — | 90 | 25 | 65 μl | |
| 5% NHS | 9 μl | 81 | 25 | 65 | |
| 10% NHS | 18 | 72 | 25 | 65 | |
| 20% NHS | 36 | 54 | 25 | 65 | |
| 30% NHS | 54 | 36 | 25 | 65 | |
| 40% NHS | 72 | 18 | 25 | 65 | |
| 50% NHS | 90 | — | 25 | 65 | |
| *HI = heat inactivated |
%
Specific
Lysis
=
(
Test
cpm
-
Spontaneous
release
cpm
)
(
Maximal
release
cpm
-
Spontaneous
release
cpm
)
×
100
Calculate mean and standard deviation for each experimental point. Graph % Human serum (X axis) against % Specific lysis (Y axis) for each type of cell (wild type, heterozygote KO and homozygous KO)
The results of these experiments are depicted in FIG. 25. The results indicate that spleen cells from a homozygous knockout mouse are relatively resistant to lysis by human serum, in comparison to spleen cells derived from mice heterozygous for the interrupted allele or from wild-type mice.
Transgenic animals are generated routinely by microinjection of DNA into the pronuclei of fertilised eggs. Generally this technology results in the random integration of the transgene in the genome. However, conventional transgenic technology has resulted in homologous recombination between the injected transgene and the endogenous gene. See, for example, Brinster et al., Proc. Nat. Acad. Sci. USA 86: 1087–91 (1989). Described below are procedures for inactivating the α-1,3-Gal T gene in pigs through microinjection of eggs with gene targeting constructs.
I. Gene Targeting Constructs
The frequency of homologous recombination in embryos is improved if the gene targeting constructs are prepared with isogenic DNA. Therefore the “knock out” constructs are prepared from DNA isolated from the boar used to fertilize the oocytes used for microinjection. DNA is isolated from the tail or ear tissue, and genomic fragments from both α-1,3-Gal T alleles of the boar, encompassing exons 8 & 9 are cloned using long range PCR or conventional genomic library technologies. Clones for each of the α-1,3-Gal T alleles are identified using restriction fragment length polymorphism identification and DNA sequencing. Constructs to target both alleles are made by interrupting the coding sequence of exon 9, either by deletion or by inserting a heterologous DNA fragment. The constructs contain at least 8 kb of homologous DNA to promote efficient homologous recombination.
Various approaches can be used to detect gene targeting events, depending on the strategies used in designing the knockout constructs. Several such approaches, and the corresponding strategies for construction of constructs, are provided below:
a) PCR of Genomic DNA:
b) Reverse Transcription/PCR:
c) Green Fluorescent Protein (GFP) Gene Expression:
Fertilized embryos are generated as described by Nottle et al., (1993). Proc Aust Soc for Reproductive Biol 26, 33. The protocol involves:
a) Sperm from the boar providing DNA for the targeting construct is collected and stored frozen in liquid N2.
b) Superovulation of Donor Gilts:
c) Fertilization:
d) Embryo Collection:
Embryos are centrifuged at 12000×g for 8 min to stratify the cytoplasm and allow the pronuclei to be visualised, and held in Dulbecco's Minimal Essential Medium with 25 mM Hepes and 5 mg/ml bovine serum albumin. Pronuclei are injected, using differential interference contrast optics, with 4–10 picolitres of DNA (10 ng/μl) in PBS. Gene targeting with isogenic DNA is maximized by coinjecting both allelic constructs derived from the boar into the male pronucleus.
IV. Transfer of Injected Embryos to Recipient Gilts
The oestrus cycles of recipient gilts are synchronized with those of donors. The recipients are mated and aborted using the protocol described above, and injected with 500 i.u. eCG. Injected embryos are transferred surgically (20–40 per oviduct) to recipients on the same day that they are collected from donor gilts.
V. Screening for Homologous Recombination
Homologous recombinants can be detected by analysis of tissue from the born piglets. Screening procedures involve PCR technology, the precise strategy depending on the design of the gene targeting construct. Because many α-1,3-Gal T mRNA molecules are synthesized from a single α-1,3-Gal T gene in expressing cells, the RT/PCR approach can be more sensitive than PCR amplification of genomic DNA. The RT/PCR screening strategy relies on successful transcription of the interrupted gene and relative stability of the shortened mRNA.
Alternatively, constructs that promote expression of heterologous genes (eg: GFP) in correctly targeted cells allow embryos to be screened at the blastocyst stage for marker gene expression (i.e.: GFP expression can be detected by measuring fluorescence within blastocysts at 509 nm). The microinjected embryos are cultured in vitro until blastocyst development, screened for fluorescence, and fluorescing embryos transferred into recipients.
Previous reports have demonstrated the existence of two forms of murine LIF. The original form (from the D transcript) was expressed and commercialized by AMRAD Corporation Ltd (Kew Victoria, Australia). The protein product derived from this transcript (hereinafter “D-LIF”) is sold commercially by AMRAD as “ESGRO™”. Another form of LIF (hereinafter “M-LIF”), derived from an alternative transcript, is described in U.S. patent application Ser. No. 07/994,099 and in Rathjen et al., Cell 62: 1105–14 (1990). The present inventors have now found a third transcript of LIF (hereinafter “D-LIF”) which is found in ES cells and in human teratocarcinoma-derived cell lines such as the GCT 27 teratocarcinoma-derived cell lines described by Pera et al., Differentiation 42: 10 (1989).
The T-LIF protein is found intracellularly in contrast to the other two forms of LIF which are both extracellular. The transcript was cloned using the RACE PCR technique (see below) from murine ES cells and human GCT 27 teratocarcinoma-derived cell lines, and sequenced using standard methods. The presence of the T-LIF transcript was confirmed by PCR analysis of ES cell mRNA and RNA' ase protection on GCT 27 RNA. The transcript comprises a novel first exon, located in the first intron of the LIF gene, spliced to the known exon 2 and exon 3 sequences. The mouse nucleotide sequence (SEQ ID NO: 25) and deduced amino acid sequence (SEQ ID NO: 26) are set out in FIG. 26. The human nucleotide sequence (SEQ ID NO: 31) and deduced amino acid sequence (SEQ ID NO: 32) are set out in FIG. 27.
When expressed in a COS cell expression system, the murine T-LIF transcript produces a 17 kD protein that is unglycosylated (D-LIF is glycosylated in the Golgi during the secretion process) (FIG. 28). Translation of T-LIF initiates at the first in-frame initiation codon (ATG) in exon 2 to produce a protein of 158 amino acids. The protein is 45 amino acids shorter than the unprocessed D-LIF protein and 22 amino acids shorter than the mature D-LIF product generated by cleavage of the signal sequence. Because the T-LIF protein does not contain a signal sequence, it does not leave the cell and is unglycosylated. The T form of LIF is efficacious in preventing the differentiation of ES cells in culture.
Cytoplasmic RNA (10 μg) from CP1 murine ES cells (Bradley et al., Nature 309: 255–56 (1984) was reverse transcribed from the oligonucleotide 5′ ACACGGTACTTGTTGCA-3′ (SEQ ID NO: 27), which hybridizes to residues 500–484 of the murine LIF cDNA. The RNA was added to 20 pmol of primer and 2 μl of 10×annealing buffer (500 mM Tris-HCl. (pH 8.0), 60 mM MgCl2, 400 mM KCl) in a total volume of 16 μl, heated to 85° C. for 0.5 min, and cooled slowly to room temperature. The elongation reaction was carried out as described by Frohman et al. (Proc. Natl. Acad. Sci. USA 85: 8998–9002 (˜1988)). Excess oligonucleotide was removed by gel filtration through a 2 ml Sephacryl S-400 (Pharmacia) column equilibrated with 0.05×TE (TE=10 mM Tris-HCl pH 7.6, 1.0 mM EDTA). Fractions of 5011 corresponding to the cDNA radioactive peak were pooled, concentrated by vacuum centrifugation, and resuspended in 23 μl of H2O. To tail the 3′-end of the cDNA with dG residues, 3 μl of 10 mM dGTP and 6 μl of 5×tailing buffer (Bethesda Research Laboratories) were added and the mixture was incubated at 37° C. for 60 min. and then at 70° C. for 15 min. After ethanol precipitation, the cDNA template was resuspended in 500 μl H2O.
PCR was carried out using a mouse LIF specific oligonucleotide, 5′-TTCTGGTCCCGGGTGATATTGGTCA-3′ (residues 389–365) (SEQ ID NO: 28), and an anchor oligonucleotide, 5′-CCATGGCCTCGAGGGCCCCCCCCCCCCCC-3′ (SEQ ID NO: 29). PCR was carried out in a final volume of 50 μl containing 7 μl of the cDNA template and 34 pmol of each oligonucleotide. Reaction conditions were as recommended by Perkin-Elmer Cetus, with a final concentration of 1.5 mM MgCl2. DNA was denatured prior to the addition of Taq polymerase (Perkin-Elmer Cetus) by heating the reaction mixture to 94° C. for 5 min. Each PCR cycle (35 in total) consisted of denaturation for 2 min at 94° C., annealing for 2 min at 55° C., and elongation for 3 min at 72° C. After the final elongation (30 min at 72° C.), samples were ethanol precipitated, digested with SmaI and XhoI and analyzed by agarose gel electrophoresis. DNA was purified from agarose gels using Geneclean and cloned into SalI- and SmaI-digested TST7 19U (Stratagene). Suitable recombinant plasmids were purified by the rapid boiling method.
Double-stranded sequencing was performed with Sequenase version 2.0 (USB) according to the manufacturers recommendations.
An undifferentiated, murine ES cell culture (MBL5; Pease et al., Dev. Biol. 141: 344–52 (1990), between passages 15 and 30) is trypsinized and made into a single cell suspension. The cells are pelleted by centrifugation and resuspended in complete ES Cell Medium without LIF (DMEM (without Hepes), 10% FCS, 1 mM βME, 1 mM glutamine). The cells are then seeded into 24-well microtitre plates at 5×102 cells/16 mm well containing 1 ml of ES Cell Medium without LIF.
The complete T-LIF open reading frame was reconstructed from the PCR product and inserted into the COS cell expression vector pXMT2 as described by Rathjen et al., Cell 62: 1105–14 (1990). The plasmid used for transfection of COS cells is shown in FIG. 29. The COS cells were transfected by electroporation. Supernatants from COS cells expressing T-LIF were added to the above ES cells in various dilutions (1/5, 1/10, 1/50, 1/100, 1/50, 1/1000) and incubated for 4 days in an incubator with 10% CO2. Controls used supernatants from COS cells expressing D-LIF (pDR1, Rathjen et al., Cell 62: 1105–14 (1990)).
LIF activity is assessed as present if cells morphologically resemble ES-cells after 4 days and are distinct from the controls incubated without any form of LIF. The ES-cells are also stained for alkaline phosphatase as undifferentiated ES-cells are positive for this marker.
Even though T-LIF is produced intracellularly, sufficient numbers of cells lyse to give significant amounts of LIF activity in the culture supernatants. If the COS cells expressing T-LIF are lysed, more LIF activity is released.
PCR was carried but on ES cell cDNA (prepared as described above except that the cDNA was not tailed with dG). PCR conditions were as described above except that 2 mM MgCl2 was used in the reactions. The oligonucleotides 5′-CACCTTTCGCTTTCCT-3′ (SEQ. ID NO. 30) and 5′-TTCTGGTCCCGGGTGATATTGGTCA-3′ (SEQ. ID. NO 28) were used at 80 picograms/reaction. Products of the PCR reaction were ethanol precipitated as described above, separated electrophoretically on a 2% agarose gel and transferred to a nylon membrane for detection using Southern hybridization (FIG. 30). The probe was the full length D-LIF transcript isolated from pDR1 (Rathjen et al., Cell 62: 1105–14 (1990). The control experiment is designed to detect all LIF transcripts using internal primers 5′-TTCTGGTCCCGGGTGATATTGGTCA-3′ (SEQ. ID. NO 28) and 5′-CTGTTGGTTCTGCACTGGA-3′ (SEQ. ID. NO. 33).
The foregoing detailed description has been provided for a better understanding of the invention only and no unnecessary limitation should be understood therefrom as some modifications will be apparent to those skilled the art without deviating from the spirit and scope of the appended claims.
1. A method for generating a porcine cell comprising at least one inactivated α-1,3 galactosyltransferase gene, the method comprising:
(a) providing a plurality of porcine cells;
(b) introducing, in vitro, into said cells a DNA construct comprising a disrupted porcine α-1,3 galactosyltransferase gene, wherein the disruption is by insertion of an exogenous sequence into said gene such that disruption prevents expression of functional α-1,3 galactosyltransferase, wherein the gene, prior to disruption, encodes a porcine α-1,3 galactosyltransferase with the amino acid sequence of SEQ ID NO:10;
(c) incubating said cells such that homologous recombination occurs between the chromosomal sequence encoding α-1,3 galactosyltransferase and the introduced DNA construct comprising the disrupted α-1,3 galactosyltransferase gene; and
(d) identifying a porcine cell comprising at least one inactivated α-1,3 galactosyltransferase gene,
wherein the gene, prior to disruption, encodes a porcine α-1,3 galactosyltransferase with the amino acid sequence of SEQ ID NO:10.
2. The method of claim 1, wherein said disruption is within exon 4, exon 7, exon 8, or exon 9 of the porcine α-1,3 galactosyltransferase gene.
3. The method of claim 1, wherein said exogenous sequence is a selectable marker.
4. The method of claim 3, wherein said selectable marker is selected from the group consisting of the neoR gene and the hygR gene.
5. The method of claim 1, wherein said exogenous sequence is flanked at its 5′ and 3′ ends by FRT DNA elements, and wherein stop codons have been inserted 3′ to the selectable marker for each of the three reading frames for the porcine α-1,3 galactosyltransferase gene.
6. A porcine cell comprising at least one disrupted α-1,3 galactosyltransferase gene, wherein the disruption is by insertion of an exogenous sequence into said gene such that the disruption prevents expression of functional α-1,3 galactosyltransferase and wherein the gene, prior to disruption, encodes the porcine α-1,3 galactosyltransferase with the amino acid sequence of SEQ ID NO:10, wherein the cell is in vitro.
7. The porcine cell of claim 6, wherein said disruption is within exon 4, exon 7, exon 8, or exon 9 of the porcine α-1,3 galactosyltransferase gene.
8. The porcine cell of claim 6, wherein said exogenous sequence is a selectable marker.
9. The porcine cell of claim 8, wherein said selectable marker is selected from the group consisting of the neoR gene and the hygR gene.
10. The porcine cell of claim 6, wherein said exogenous sequence is flanked at its 5′ and 3′ ends by FRT DNA elements, and wherein stop codons have been inserted 3′ to the selectable marker for each of the three reading frames for the porcine α-1,3 galactosyltransferase gene.