-
2007-05-22
10/822,904
2004-04-12
US 7,220,852 B1
2007-05-22
-
-
Mary E. Mosher
2024-04-12
Disclosed herein is a newly isolated human coronavirus (SARS-CoV), the causative agent of severe acute respiratory syndrome (SARS). Also provided are the nucleic acid sequence of the SARS-CoV genome and the amino acid sequences of the SARS-CoV open reading frames, as well as methods of using these molecules to detect a SARS-CoV and detect infections therewith. Immune stimulatory compositions are also provided, along with methods of their use.
Get notified when new applications in this technology area are published.
C12N7/00 IPC
Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
This application claims the benefit of U.S. Provisional Patent Application No. 60/465,927 filed Apr. 25, 2003, which is incorporated herein by reference in its entirety.
This invention was made by the Centers for Disease Control and Prevention, an agency of the United States Government. Therefore, the U.S. Government has certain rights in this invention.
This invention relates to a newly isolated human coronavirus. More particularly, it relates to an isolated coronavirus genome, isolated coronavirus proteins, and isolated nucleic acid molecules encoding the same. The disclosure further relates to methods of detecting a severe acute respiratory syndrome-associated coronavirus and compositions comprising immunogenic coronavirus compounds.
The coronaviruses (order Nidovirales, family Coronaviridae, genus Coronavirus) are a diverse group of large, enveloped, positive-stranded RNA viruses that cause respiratory and enteric diseases in humans and other animals. At approximately 30,000 nucleotides (nt), their genome is the largest found in any of the RNA viruses. Coronaviruses are spherical, 100–160 nm in diameter with 20–40 nm complex club shaped surface projections surrounding the periphery. Coronaviruses share common structural proteins including a spike protein (S), membrane protein (M), envelope protein (E), and, in a subset of coronaviruses, a hemagglutinin-esterase protein (HE). The S protein, a glycoprotein which protrudes from the virus membrane, is involved in host cell receptor binding and is a target for neutralizing antibodies. The E and M proteins are involved in virion formation and release from the host cell. Coronavirus particles are found within the cisternae of the rough endoplasmic reticulum and in vesicles of infected host cells where virions are assembled. The coronavirus genome consists of two open reading frames (ORF1a and ORF1b) yielding an RNA polymerase and a nested set of subgenomic mRNAs encoding structural and nonstructural proteins, including the S, E, M, and nucleocapsid (N) proteins. The genus Coronavirus includes at least 13 species which have been subdivided into at least three groups (groups I, II, and III) on the basis of serological and genetic properties (deVries et al., Sem. Virol. 8:33–47, 1997; Fields et al. eds. Fields Virology, 3rd edition, Raven Press, Philadelphia, 1323–1341, 1996; Mahey and Collier eds. Microbiology and Microbial Infections, Volume 1 Virology, 9th edition, Oxford University Press, 463–479, 1998).
The three known groups of coronavirus are associated with a variety of diseases of humans and domestic animals (for example, cattle, pigs, cats, dogs, rodents, and birds), including gastroenteritis and upper and lower respiratory tract disease. Known coronaviruses include human Coronavirus 229E (HCoV-229E), canine coronavirus (CCoV), feline infectious peritonitis virus (FIPV), porcine transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), human coronavirus OC43 (HcoV-OC43), bovine coronavirus (BCoV), porcine hemagglutinating encephalomyelitis virus (HEV), rat sialodacryoadenitis virus (SDAV), mouse hepatitis virus (MHV), turkey coronavirus (TCoV), and avian infectious bronchitis virus (IBV-Avian) (Fields et al. eds. Fields Virology, 3rd edition, Raven Press, Philadelphia, 1323–1341, 1996; Mahey and Collier eds. Microbiology and Microbial Infections, Volume 1 Virology, 9th edition, Oxford University Press, 463–479, 1998).
Coronavirus infections are generally host specific with respect to infectivity and clinical symptoms. Coronaviruses further exhibit marked tissue tropism; infection in the incorrect host species or tissue type may result in an abortive infection, mutant virus production and altered virulence. Coronaviruses generally do not grow well in cell culture, and animal models for human coronavirus infection are lacking. Therefore, little is known about them (Fields et al. eds. Fields Virology, 3rd edition, Raven Press, Philadelphia, 1323–1341, 1996). The known human coronaviruses are notably fastidious in cell culture, preferring select cell lines, organ culture, or suckling mice for propagation. Coronaviruses grown in cell culture exhibit varying degrees of virulence and/or cytopathic effect (CPE) depending on the host cell type and culture conditions. The only human or animal coronavirus which has been shown to grow in Vero E6 cells is PEDV, and it requires the addition of trypsin to culture medium for growth in Vero E6 cells. Moreover, PEDV adapted to Vero E6 cell culture results in a strikingly different CPE, with cytoplasmic vacuoles and the formation of large syncytia (Hofmann and Wyler, J. Clin. Micro. 26:2235–39, 1988; Kusanagi et el., J. Vet. Med. Sci. 554:313–18, 1991).
Coronavirus have not previously been known to cause severe disease in humans, but have been identified as a major cause of upper respiratory tract illness, including the common cold. Repeat infections in humans are common within and across serotype, suggesting that immune response to coronavirus infection in humans is either incomplete or short lived. Coronavirus infection in animals can cause severe enteric or respiratory disease. Vaccination has been used successfully to prevent and control some coronavirus infections in animals. The ability of animal-specific coronaviruses to cause severe disease raises the possibility that coronavirus could also cause more severe disease in humans (Fields et al. eds. Fields Virology, 3rd edition, Raven Press, Philadelphia, 1323–1341, 1996; Mahey and Collier eds. Microbiology and Microbial Infections, Volume 1 Virology, 9th edition, Oxford University Press, 463–479, 1998).
In late 2002, cases of life-threatening respiratory disease with no identifiable etiology were reported from Guangdong Province, China, followed by reports from Vietnam, Canada, and Hong Kong of severe febrile respiratory illness that spread to household members and health care workers. The syndrome was designated “severe acute respiratory syndrome” (SARS) in February 2003 by the Centers for Disease Control and Prevention (MMWR, 52:241–48, 2003).
Past efforts to develop rapid diagnostics and vaccines for coronavirus infection in humans have been hampered by a lack of appropriate research models and the moderate course of disease in humans. Therefore, a need for rapid diagnostic tests and vaccines exists.
A newly isolated human coronavirus has been identified as the causative agent of SARS, and is termed SARS-CoV. The nucleic acid sequence of the SARS-CoV genome and the amino acid sequences of the SARS-CoV open reading frames are provided herein.
This disclosure provides methods and compositions useful in detecting the presence of a SARS-CoV nucleic acid in a sample and/or diagnosing a SARS-CoV infection in a subject. Also provided are methods and compositions useful in detecting the presence of a SARS-CoV antigen or antibody in a sample and/or diagnosing a SARS-CoV infection in a subject.
The foregoing and other features and advantages will become more apparent from the following detailed description of several embodiments, which proceeds with reference to the accompanying figures.
FIGS. 1A–B are photomicrographs illustrating typical early cytopathic effects seen with coronavirus isolates and serum from SARS patients. FIG. 1A is a photomicrograph of Vero E6 cells inoculated with an oropharyngeal specimen from a SARS patient (×40). FIG. 1B is a photomicrograph of infected Vero E6 cells reacting with the serum of a convalescent SARS patient in an indirect fluorescent antibody (IFA) assay (×400).
FIGS. 2A–B are electronmicrographs illustrating ultrastructural characteristics of the SARS-associated coronavirus (SARS-CoV). FIG. 2A is a thin-section electron-microscopical view of viral nucleocapsids aligned along the membrane of the rough endoplasmic reticulum (arrow) as particles bud into the cisternae. Enveloped virions have surface projections (arrowhead) and an electron-lucent center. Directly under the viral envelope lies a characteristic ring formed by the helical nucleocapsid, often seen in cross-section. FIG. 2B is a negative stain (methylamine tungstate) electronmicrograph showing stain-penetrated coronavirus particle with the typical internal helical nucleocapsid-like structure and club-shaped surface projections surrounding the periphery of the particle. Bars: 100 nm.
FIG. 3 is an estimated maximum parsimony tree illustrating putative phylogenetic relationships between SARS-CoV and other human and animal coronaviruses. Phylogenetic relationships are based on sequence alignment of 405 nucleotides of the coronavirus polymerase gene ORF1b (nucleic acid 15,173 to 15,578 of SEQ ID NO: 1). The three major coronavirus antigenic groups (I, II and III), represented by HcoV-229E, CCoV, FIPV, TGEV, PEDV, HcoV-OC43, BCoV, HEV, SDAV, MHV, TCoV, and IBV-Avian, are shown shaded. Bootstrap values (100 replicates) obtained from a 50% majority rule consensus tree are plotted at the main internal branches of the phylogram. Branch lengths are proportionate to nucleotide differences.
FIG. 4 is a pictorial representation of neighbor joining trees illustrating putative phylogenetic relationships between SARS-CoV and other human and animal coronaviruses. Amino acid sequences of the indicated SARS-CoV proteins were compared with those from reference viruses representing each species in the three groups of coronaviruses for which complete genomic sequence information was available [group 1: HCoV-229E (AF304460); PEDV (AF353511); TGEV (AJ271965); group 2: BCoV (AF220295); MHV (AF201929); group 3: infectious bronchitis virus (M95169)]. Sequences for representative strains of other coronavirus species, for which partial sequence information was available, were included for some of the structural protein comparisons [group 1: CCoV (D13096); FCoV (AY204704); porcine respiratory coronavirus (Z24675); group 2: HCoV-OC43 (M76373, L14643, M93390); HEV (AY078417); rat coronavirus (AF207551)]. Sequence alignments and neighbor-joining trees were generated by using Clustalx 1.83 with the Gonnet protein comparison matrix. The resulting trees were adjusted for final output using treetool 2.0.1.
FIGS. 5A–C are photomicrographs illustrating diffuse alveolar damage in a patient with SARS (FIGS. 5A–B), and immunohistochemical staining of SARS-CoV-infected Vero E6 cells (FIG. 5C). FIG. 5A is a photomicrograph of lung tissue from a SARS patient (×50). Diffuse alveolar damage, abundant foamy macrophages and multinucleated syncytial cells are present; hematoxylin and eosin stain was used. FIG. 5B is a higher magnification photomicrograph of lung tissue from the same SARS patient (×250). Syncytial cells show no conspicuous viral inclusions. FIG. 5C is a photomicrograph of immunohistochemically stained SARS-CoV-infected cells (×250). Membranous and cytoplasmic immunostaining of individual and syncytial Vero E6 cells was achieved using feline anti-FIPV-1 ascitic fluid. Immunoalkaline phosphatase with naphthol-fast red substrate and hematoxylin counter stain was used.
FIG. 6A–B are electronmicrographs illustrating ultrastructural characteristics of a coronavirus-infected cell in bronchoalveolar lavage (BAL) from a SARS patient. FIG. 6A is an electronmicrograph of a coronavirus-infected cell. Numerous intracellular and extracellular particles are present; virions are indicated by the arrowheads. FIG. 6B is a higher magnification electronmicrograph of the area seen at the arrow in FIG. 6A (rotated clockwise approximately 90°). Bars: FIG. 6A, 1 μm; FIG. 6B, 100 nm.
FIGS. 7A–C illustrate the organization of the SARS-CoV genome. FIG. 7A is a diagram of the overall organization of the 29,727-nt SARS-CoV genomic RNA. The 72-nt leader sequence is represented as a small rectangle at the left-most end. ORFs1a and 1b, encoding the nonstructural polyproteins, and those ORFs encoding the S, E, M, and N structural proteins, are indicated. Vertical position of the boxes indicates the phase of the reading frame (phase 1 for proteins above the line, phase two for proteins on the line and phase three for proteins below the line). FIG. 7B is an expanded view of the structural protein encoding region and predicted mRNA transcripts. Known structural protein encoding regions (dark grey boxes) and regions and reading frames for potential products X1–X5 (light gray boxes) are indicated. Lengths and map locations of the 3′-coterminal mRNAs expressed by the SARS-CoV are indicated, as predicted by identification of conserved transcriptional regulatory sequences. FIG. 7C is a digitized image of a nylon membrane showing Northern blot analysis of SARS-CoV mRNAs. Poly(A)+ RNA from infected Vero E6 cells was separated on a formaldehyde-agarose gel, transferred to a nylon membrane, and hybridized with a digoxigenin-labeled riboprobe overlapping the 3′-untranslated region. Signals were visualized by chemiluminescence. Sizes of the SARS-CoV mRNAs were calculated by extrapolation from a log-linear fit of the molecular mass marker. Lane 1, SARS-CoV mRNA; lane 2, Vero E6 cell mRNA; lane 3, molecular mass marker, sizes in kB.
The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. In the accompanying sequence listing:
SEQ ID NO: 1 shows the nucleic acid sequence of the SARS-CoV genome.
SEQ ID NO: 2 shows the amino acid sequence of the SARS-CoV polyprotein 1a (encoded by nucleic acid 265 to nucleic acid 13,398 of SEQ ID NO: 1).
SEQ ID NO: 3 shows the amino acid sequence of the SARS-CoV polyprotein 1b (encoded by nucleic acid 13,398 to 21,482 of SEQ ID NO: 1).
SEQ ID NO: 4 shows the amino acid sequence of the SARS-CoV S protein (encoded by nucleic acid 21,492 to 25,256 of SEQ ID NO: 1).
SEQ ID NO: 5 shows the amino acid sequence of the SARS-CoV X1 protein (encoded by nucleic acid 25,268 to 26,089 of SEQ ID NO: 1).
SEQ ID NO: 6 shows the amino acid sequence of the SARS-CoV X2 protein (encoded by nucleic acid 25,689 to 26,150 of SEQ ID NO: 1).
SEQ ID NO: 7 shows the amino acid sequence of the SARS-CoV E protein (encoded by nucleic acid 26,117 to 26,344 of SEQ ID NO: 1).
SEQ ID NO: 8 shows the amino acid sequence of the SARS-CoV M protein (encoded by nucleic acid 26,398 to 27,060 of SEQ ID NO: 1).
SEQ ID NO: 9 shows the amino acid sequence of the SARS-CoV X3 protein (encoded by nucleic acid 27,074 to 27,262 of SEQ ID NO: 1).
SEQ ID NO: 10 shows the amino acid sequence of the SARS-CoV X4 protein (encoded by nucleic acid 27,273 to 27,638 of SEQ ID NO: 1).
SEQ ID NO: 11 shows the amino acid sequence of the SARS-CoV X5 protein (encoded by nucleic acid 27,864 to 28,115 of SEQ ID NO: 1).
SEQ ID NO: 12 shows the amino acid sequence of the SARS-CoV N protein (encoded by nucleic acid 28,120 to 29,385 of SEQ ID NO: 1).
SEQ ID NOs: 13–15 show the nucleic acid sequence of several SARS-CoV-specific oligonucleotide primers.
SEQ ID NOs: 16–33 show the nucleic acid sequence of several oligonucleotide primers/probes used for real-time reverse transcription-polymerase chain reaction (RT-PCR) SARS-CoV assays.
SEQ ID NOs: 34–35 show the nucleic acid sequence of two degenerate primers designed to anneal to sites encoding conserved coronavirus amino acid motifs.
SEQ ID NOs: 36–38 show the nucleic acid sequence of several oligonucleotide primers/probe used as controls in real-time RT-PCR assays.
I. Abbreviations
| M: | coronavirus membrane protein |
| N: | coronavirus nucleoprotein |
| ORF: | open reading frame |
| PCR | polymerase chain reaction |
| RACE: | 5′ rapid amplification of cDNA ends |
| RT-PCR: | reverse transcription-polymerase chain reaction |
| S: | coronavirus spike protein |
| SARS: | severe acute respiratory syndrome |
| SARS-CoV: | severe acute respiratory syndrome-associated coronavirus |
| TRS: | transcriptional regulatory sequence |
Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes VII, published by Oxford University Press, 2000 (ISBN 019879276X); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341); and other similar references.
As used herein, the singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. Also, as used herein, the term “comprises” means “includes.” Hence “comprising A or B” means including A, B, or A and B. It is further to be understood that all nucleotide sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
In order to facilitate review of the various embodiments of this disclosure, the following explanations of specific terms are provided:
Adjuvant: A substance that non-specifically enhances the immune response to an antigen. Development of vaccine adjuvants for use in humans is reviewed in Singh et al. (Nat. Biotechnol. 17:1075–1081, 1999), which discloses that, at the time of its publication, aluminum salts and the MF59 microemulsion are the only vaccine adjuvants approved for human use.
Amplification: Amplification of a nucleic acid molecule (e.g., a DNA or RNA molecule) refers to use of a laboratory technique that increases the number of copies of a nucleic acid molecule in a sample. An example of amplification is the polymerase chain reaction (PCR), in which a sample is contacted with a pair of oligonucleotide primers under conditions that allow for the hybridization of the primers to a nucleic acid template in the sample. The primers are extended under suitable conditions, dissociated from the template, re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid. The product of amplification can be characterized by such techniques as electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing.
Other examples of amplification methods include strand displacement amplification, as disclosed in U.S. Pat. No. 5,744,311; transcription-free isothermal amplification, as disclosed in U.S. Pat. No. 6,033,881; repair chain reaction amplification, as disclosed in WO 90/01069; ligase chain reaction amplification, as disclosed in EP-A-320,308; gap filling ligase chain reaction amplification, as disclosed in U.S. Pat. No. 5,427,930; and NASBA™ RNA transcription-free amplification, as disclosed in U.S. Pat. No. 6,025,134. An amplification method can be modified, including for example by additional steps or coupling the amplification with another protocol.
Animal: Living multi-cellular vertebrate organisms, a category that includes, for example, mammals and birds. The term mammal includes both human and non-human mammals. Similarly, the term “subject” includes both human and veterinary subjects, for example, humans, non-human primates, dogs, cats, horses, and cows.
Antibody: A protein (or protein complex) that includes one or more polypeptides substantially encoded by immunoglobulin genes or fragments of immunoglobulin genes. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.
The basic immunoglobulin (antibody) structural unit is generally a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one “light” (about 25 kDa) and one “heavy” (about 50–70 kDa) chain. The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms “variable light chain” (VL) and “variable heavy chain” (VH) refer, respectively, to these light and heavy chains.
As used herein, the term “antibodies” includes intact immunoglobulins as well as a number of well-characterized fragments. For instance, Fabs, Fvs, and single-chain Fvs (SCFvs) that bind to target protein (or epitope within a protein or fusion protein) would also be specific binding agents for that protein (or epitope). These antibody fragments are defined as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab′, the fragment of an antibody molecule obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab′ fragments are obtained per antibody molecule; (3) (Fab′)2, the fragment of the antibody obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; (4) F(ab′)2, a dimer of two Fab′ fragments held together by two disulfide bonds; (5) Fv, a genetically engineered fragment containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains; and (6) single chain antibody, a genetically engineered molecule containing the variable region of the light chain, the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule. Methods of making these fragments are routine (see, for example, Harlow and Lane, Using Antibodies: A Laboratory Manual, CSHL, New York, 1999).
Antibodies for use in the methods and devices of this disclosure can be monoclonal or polyclonal. Merely by way of example, monoclonal antibodies can be prepared from murine hybridomas according to the classical method of Kohler and Milstein (Nature 256:495–97, 1975) or derivative methods thereof. Detailed procedures for monoclonal antibody production are described in Harlow and Lane, Using Antibodies: A Laboratory Manual, CSHL, New York, 1999.
Antigen: A compound, composition, or substance that can stimulate the production of antibodies or a T-cell response in an animal, including compositions that are injected or absorbed into an animal. An antigen reacts with the products of specific humoral or cellular immunity, including those induced by heterologous immunogens. In one embodiment, an antigen is a coronavirus antigen.
Binding or Stable Binding: An oligonucleotide binds or stably binds to a target nucleic acid if a sufficient amount of the oligonucleotide forms base pairs or is hybridized to its target nucleic acid, to permit detection of that binding. Binding can be detected by either physical or functional properties of the target:oligonucleotide complex. Binding between a target and an oligonucleotide can be detected by any procedure known to one skilled in the art, including functional or physical binding assays. Binding can be detected functionally by determining whether binding has an observable effect upon a biosynthetic process such as expression of a gene, DNA replication, transcription, translation, and the like.
Physical methods of detecting the binding of complementary strands of DNA or RNA are well known in the art, and include such methods as DNase I or chemical footprinting, gel shift and affinity cleavage assays, Northern blotting, Southern blotting, dot blotting, and light absorption detection procedures. For example, a method which is widely used, because it is so simple and reliable, involves observing a change in light absorption of a solution containing an oligonucleotide (or an analog) and a target nucleic acid at 220 to 300 nm as the temperature is slowly increased. If the oligonucleotide or analog has bound to its target, there is a sudden increase in absorption at a characteristic temperature as the oligonucleotide (or analog) and target dissociate or melt.
The binding between an oligomer and its target nucleic acid is frequently characterized by the temperature (Tm) at which 50% of the oligomer is melted from its target. A higher Tm means a stronger or more stable complex relative to a complex with a lower Tm.
cDNA (complementary DNA): A piece of DNA lacking internal, non-coding segments (introns) and regulatory sequences that determine transcription. cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.
Electrophoresis: Electrophoresis refers to the migration of charged solutes or particles in a liquid medium under the influence of an electric field. Electrophoretic separations are widely used for analysis of macromolecules. Of particular importance is the identification of proteins and nucleic acid sequences. Such separations can be based on differences in size and/or charge. Nucleotide sequences have a uniform charge and are therefore separated based on differences in size. Electrophoresis can be performed in an unsupported liquid medium (for example, capillary electrophoresis), but more commonly the liquid medium travels through a solid supporting medium. The most widely used supporting media are gels, for example, polyacrylamide and agarose gels.
Sieving gels (for example, agarose) impede the flow of molecules. The pore size of the gel determines the size of a molecule that can flow freely through the gel. The amount of time to travel through the gel increases as the size of the molecule increases. As a result, small molecules travel through the gel more quickly than large molecules and thus progress further from the sample application area than larger molecules, in a given time period. Such gels are used for size-based separations of nucleotide sequences.
Fragments of linear DNA migrate through agarose gels with a mobility that is inversely proportional to the log10 of their molecular weight. By using gels with different concentrations of agarose, different sizes of DNA fragments can be resolved. Higher concentrations of agarose facilitate separation of small DNAs, while low agarose concentrations allow resolution of larger DNAs.
Hybridization: Oligonucleotides and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases. Generally, nucleic acid consists of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as “base pairing.” More specifically, A will hydrogen bond to T or U, and G will bond to C. “Complementary” refers to the base pairing that occurs between to distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.
“Specifically hybridizable” and “specifically complementary” are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide (or its analog) and the DNA or RNA target. The oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide or analog is specifically hybridizable when binding of the oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide or analog to non-target sequences under conditions where specific binding is desired, for example under physiological conditions in the case of in vivo assays or systems. Such binding is referred to as specific hybridization.
Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na+ and/or Mg++ concentration) of the hybridization buffer will determine the stringency of hybridization, though wash times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1–3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, chapters 9 and 11; and Ausubel et al. Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons, Inc., 1999.
For purposes of the present disclosure, “stringent conditions” encompass conditions under which hybridization will only occur if there is less than 25% mismatch between the hybridization molecule and the target sequence. “Stringent conditions” may be broken down into particular levels of stringency for more precise definition. Thus, as used herein, “moderate stringency” conditions are those under which molecules with more than 25% sequence mismatch will not hybridize; conditions of “medium stringency” are those under which molecules with more than 15% mismatch will not hybridize, and conditions of “high stringency” are those under which sequences with more than 10% mismatch will not hybridize. Conditions of “very high stringency” are those under which sequences with more than 6% mismatch will not hybridize.
Immune Stimulatory Composition: A term used herein to mean a composition useful for stimulating or eliciting a specific immune response (or immunogenic response) in a vertebrate. In some embodiments, the immunogenic response is protective or provides protective immunity, in that it enables the vertebrate animal to better resist infection with or disease progression from the organism against which the vaccine is directed.
Without wishing to be bound by a specific theory, it is believed that an immunogenic response may arise from the generation of an antibody specific to one or more of the epitopes provided in the immune stimulatory composition. Alternatively, the response may comprise a T-helper or cytotoxic cell-based response to one or more of the epitopes provided in the immune stimulatory composition. All three of these responses may originate from naïve or memory cells. One specific example of a type of immune stimulatory composition is a vaccine.
In some embodiments, an “effective amount” or “immune-stimulatory amount” of an immune stimulatory composition is an amount which, when administered to a subject, is sufficient to engender a detectable immune response. Such a response may comprise, for instance, generation of an antibody specific to one or more of the epitopes provided in the immune stimulatory composition. Alternatively, the response may comprise a T-helper or CTL-based response to one or more of the epitopes provided in the immune stimulatory composition. All three of these responses may originate from naïve or memory cells. In other embodiments, a “protective effective amount” of an immune stimulatory composition is an amount which, when administered to a subject, is sufficient to confer protective immunity upon the subject.
Inhibiting or Treating a Disease: Inhibiting the full development of a disease or condition, for example, in a subject who is at risk for a disease such as SARS. “Treatment” refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop. As used herein, the term “ameliorating,” with reference to a disease, pathological condition or symptom, refers to any observable beneficial effect of the treatment. The beneficial effect can be evidenced, for example, by a delayed onset of clinical symptoms of the disease in a susceptible subject, a reduction in severity of some or all clinical symptoms of the disease, a slower progression of the disease, a reduction in the number of relapses of the disease, an improvement in the overall health or well-being of the subject, or by other parameters well known in the art that are specific to the particular disease.
Isolated: An “isolated” microorganism (such as a virus, bacterium, fungus, or protozoan) has been substantially separated or purified away from microorganisms of different types, strains, or species. Microorganisms can be isolated by a variety of techniques, including serial dilution and culturing.
An “isolated” biological component (such as a nucleic acid molecule, protein or organelle) has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, such as other chromosomal and extra-chromosomal DNA and RNA, proteins, and organelles. Nucleic acids and proteins that have been “isolated” include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell, as well as chemically synthesized nucleic acids or proteins, or fragments thereof.
Label: A detectable compound or composition that is conjugated directly or indirectly to another molecule to facilitate detection of that molecule. Specific, non-limiting examples of labels include fluorescent tags, enzymatic linkages, and radioactive isotopes.
Nucleic Acid Molecule: A polymeric form of nucleotides, which may include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. A nucleotide refers to a ribonucleotide, deoxynucleotide or a modified form of either type of nucleotide. A “nucleic acid molecule” as used herein is synonymous with “nucleic acid” and “polynucleotide.” A nucleic acid molecule is usually at least 10 bases in length, unless otherwise specified. The term includes single- and double-stranded forms of DNA. A polynucleotide may include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages.
Oligonucleotide: A nucleic acid molecule generally comprising a length of 300 bases or fewer. The term often refers to single-stranded deoxyribonucleotides, but it can refer as well to single- or double-stranded ribonucleotides, RNA:DNA hybrids and double-stranded DNAs, among others. The term “oligonucleotide” also includes oligonucleosides (that is, an oligonucleotide minus the phosphate) and any other organic base polymer. In some examples, oligonucleotides are about 10 to about 90 bases in length, for example, 12, 13, 14, 15, 16, 17, 18, 19 or 20 bases in length. Other oligonucleotides are about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60 bases, about 65 bases, about 70 bases, about 75 bases or about 80 bases in length. Oligonucleotides may be single-stranded, for example, for use as probes or primers, or may be double-stranded, for example, for use in the construction of a mutant gene. Oligonucleotides can be either sense or anti-sense oligonucleotides. An oligonucleotide can be modified as discussed above in reference to nucleic acid molecules. Oligonucleotides can be obtained from existing nucleic acid sources (for example, genomic or cDNA), but can also be synthetic (for example, produced by laboratory or in vitro oligonucleotide synthesis).
Open Reading Frame (ORF): A series of nucleotide triplets (codons) coding for amino acids without any internal termination codons. These sequences are usually translatable into a peptide/polypeptide/protein/polyprotein.
Operably Linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence is the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame. If introns are present, the operably linked DNA sequences may not be contiguous.
Pharmaceutically Acceptable Carriers: The pharmaceutically acceptable carriers useful in this disclosure are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, Pa., 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds or molecules, such as one or more SARS-CoV nucleic acid molecules, proteins or antibodies that bind these proteins, and additional pharmaceutical agents.
In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
Polypeptide: A polymer in which the monomers are amino acid residues which are joined together through amide bonds. When the amino acids are alpha-amino acids, either the L-optical isomer or the D-optical isomer can be used, the L-isomers being preferred. The terms “polypeptide” or “protein” as used herein are intended to encompass any amino acid sequence and include modified sequences such as glycoproteins. The term “polypeptide” is specifically intended to cover naturally occurring proteins, as well as those which are recombinantly or synthetically produced.
Conservative amino acid substitutions are those substitutions that, when made, least interfere with the properties of the original protein, that is, the structure and especially the function of the protein is conserved and not significantly changed by such substitutions. Examples of conservative substitutions are shown below.
| Original Residue | Conservative Substitutions | |
| Ala | Ser | |
| Arg | Lys | |
| Asn | Gln, His | |
| Asp | Glu | |
| Cys | Ser | |
| Gln | Asn | |
| Glu | Asp | |
| His | Asn; Gln | |
| Ile | Leu, Val | |
| Leu | Ile; Val | |
| Lys | Arg; Gln; Glu | |
| Met | Leu; Ile | |
| Phe | Met; Leu; Tyr | |
| Ser | Thr | |
| Thr | Ser | |
| Trp | Tyr | |
| Tyr | Trp; Phe | |
| Val | Ile; Leu | |
Conservative substitutions generally maintain (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
The substitutions which in general are expected to produce the greatest changes in protein properties will be non-conservative, for instance changes in which (a) a hydrophilic residue, for example, seryl or threonyl, is substituted for (or by) a hydrophobic residue, for example, leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, for example, lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, for example, glutamyl or aspartyl; or (d) a residue having a bulky side chain, for example, phenylalanine, is substituted for (or by) one not having a side chain, for example, glycine.
Probes and Primers: A probe comprises an isolated nucleic acid attached to a detectable label or other reporter molecule. Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, for example, in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1–3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989 and Ausubel et al. Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons, Inc., 1999.
Primers are short nucleic acid molecules, for instance DNA oligonucleotides 10 nucleotides or more in length, for example that hybridize to contiguous complementary nucleotides or a sequence to be amplified. Longer DNA oligonucleotides may be about 15, 20, 25, 30 or 50 nucleotides or more in length. Primers can be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then the primer extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, for example, by the PCR or other nucleic-acid amplification methods known in the art, as described above.
Methods for preparing and using nucleic acid probes and primers are described, for example, in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1–3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; Ausubel et al. Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons, Inc., 1999; and Innis et al. PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, Calif., 1990. Amplification primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, © 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.). One of ordinary skill in the art will appreciate that the specificity of a particular probe or primer increases with its length. Thus, in order to obtain greater specificity, probes and primers can be selected that comprise at least 20, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides of a target nucleotide sequences.
Protein: A biological molecule, particularly a polypeptide, expressed by a gene and comprised of amino acids. A “polyprotein” is a protein that, after synthesis, is cleaved to produce several functionally distinct polypeptides.
Purified: The term “purified” does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified protein preparation is one in which the subject protein is more pure than in its natural environment within a cell. Generally, a protein preparation is purified such that the protein represents at least 50% of the total protein content of the preparation.
Recombinant Nucleic Acid: A sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, for example, by genetic engineering techniques such as those described in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1–3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. The term recombinant includes nucleic acids that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid.
Sample: A portion, piece, or segment that is representative of a whole. This term encompasses any material, including for instance samples obtained from an animal, a plant, or the environment.
An “environmental sample” includes a sample obtained from inanimate objects or reservoirs within an indoor or outdoor environment. Environmental samples include, but are not limited to: soil, water, dust, and air samples; bulk samples, including building materials, furniture, and landfill contents; and other reservoir samples, such as animal refuse, harvested grains, and foodstuffs.
A “biological sample” is a sample obtained from a plant or animal subject. As used herein, biological samples include all samples useful for detection of viral infection in subjects, including, but not limited to: cells, tissues, and bodily fluids, such as blood; derivatives and fractions of blood (such as serum); extracted galls; biopsied or surgically removed tissue, including tissues that are, for example, unfixed, frozen, fixed in formalin and/or embedded in paraffin; tears; milk; skin scrapes; surface washings; urine; sputum; cerebrospinal fluid; prostate fluid; pus; bone marrow aspirates; BAL; saliva; cervical swabs; vaginal swabs; and oropharyngeal wash.
Sequence Identity: The similarity between two nucleic acid sequences, or two amino acid sequences, is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.
Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman (Adv. Appl. Math., 2:482, 1981); Needleman and Wunsch (J. Mol. Biol., 48:443, 1970); Pearson and Lipman (Proc. Natl. Acad. Sci., 85:2444, 1988); Higgins and Sharp (Gene, 73:237–44, 1988); Higgins and Sharp (CABIOS, 5:151–53, 1989); Corpet et al. (Nuc. Acids Res., 16:10881–90, 1988); Huang et al. (Comp. Appls Biosci., 8:155–65, 1992); and Pearson et al. (Meth. Mol. Biol., 24:307–31, 1994). Altschul et al. (Nature Genet., 6:119–29, 1994) presents a detailed consideration of sequence alignment methods and homology calculations.
The alignment tools ALIGN (Myers and Miller, CABIOS 4:11–17, 1989) or LFASTA (Pearson and Lipman, 1988) may be used to perform sequence comparisons (Internet Program© 1996, W. R. Pearson and the University of Virginia, “fasta20u63” version 2.0u63, release date December 1996). ALIGN compares entire sequences against one another, while LFASTA compares regions of local similarity. These alignment tools and their respective tutorials are available on the Internet at the NCSA website. Alternatively, for comparisons of amino acid sequences of greater than about 30 amino acids, the “Blast 2 sequences” function can be employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the “Blast 2 sequences” function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). The BLAST sequence comparison system is available, for instance, from the NCBI web site; see also Altschul et al., J. Mol. Biol., 215:403–10, 1990; Gish. and States, Nature Genet., 3:266–72, 1993; Madden et al., Meth. Enzymol., 266:131–41, 1996; Altschul et al., Nucleic Acids Res., 25:3389–402, 1997; and Zhang and Madden, Genome Res., 7:649–56, 1997.
Orthologs (equivalent to proteins of other species) of proteins are in some instances characterized by possession of greater than 75% sequence identity counted over the full-length alignment with the amino acid sequence of specific protein using ALIGN set to default parameters. Proteins with even greater similarity to a reference sequence will show increasing percentage identities when assessed by this method, such as at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, or at least 98% sequence identity. In addition, sequence identity can be compared over the full length of one or both binding domains of the disclosed fusion proteins.
When significantly less than the entire sequence is being compared for sequence identity, homologous sequences will typically possess at least 80% sequence identity over short windows of 10–20, and may possess sequence identities of at least 85%, at least 90%, at least 95%, or at least 99% depending on their similarity to the reference sequence. Sequence identity over such short windows can be determined using LFASTA; methods are described at the NCSA website. One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is entirely possible that strongly significant homologs could be obtained that fall outside of the ranges provided. Similar homology concepts apply for nucleic acids as are described for protein.
An alternative indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions. Representative hybridization conditions are discussed above.
Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences, due to the degeneracy of the genetic code. It is understood that changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid sequences that each encode substantially the same protein.
Specific Binding Agent: An agent that binds substantially only to a defined target. Thus a protein-specific binding agent binds substantially only the defined protein, or to a specific region within the protein. As used herein, a protein-specific binding agent includes antibodies and other agents that bind substantially to a specified polypeptide. The antibodies may be monoclonal or polyclonal antibodies that are specific for the polypeptide, as well as immunologically effective portions (“fragments”) thereof.
The determination that a particular agent binds substantially only to a specific polypeptide may readily be made by using or adapting routine procedures. One suitable in vitro assay makes use of the Western blotting procedure (described in many standard texts, including Harlow and Lane, Using Antibodies: A Laboratory Manual, CSHL, New York, 1999).
Transformed: A “transformed” cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques. The term encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration.
Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. A vector may also include one or more selectable marker genes and other genetic elements known in the art.
Virus: Microscopic infectious organism that reproduces inside living cells. A virus typically consists essentially of a core of a single nucleic acid surrounded by a protein coat, and has the ability to replicate only inside a living cell. “Viral replication” is the production of additional virus by the occurrence of at least one viral life cycle. A virus may subvert the host cells' normal functions, causing the cell to behave in a manner determined by the virus. For example, a viral infection may result in a cell producing a cytokine, or responding to a cytokine, when the uninfected cell does not normally do so.
“Coronaviruses” are large, enveloped, RNA viruses that cause respiratory and enteric diseases in humans and other animals. Coronavirus genomes are non-segmented, single-stranded, positive-sense RNA, approximately 27–31 kb in length. Genomes have a 5′ methylated cap and 3′ poly-A tail, and function directly as mRNA. Host cell entry occurs via endocytosis and membrane fusion, and replication occurs in the cytoplasm. Initially, the 5′ 20 kb of the positive-sense genome is translated to produce a viral polymerase, which then produces a full-length negative-sense strand used as a template to produce subgenomic mRNA as a “nested set” of transcripts. Assembly occurs by budding into the golgi apparatus, and particles are transported to the surface of the cell and released.
III. Overview of Several Embodiments
A newly isolated human coronavirus (SARS-CoV) is disclosed herein. The entire genomic nucleic acid sequence of this virus is also provided herein. Also disclosed are the nucleic acid sequences of the SARS-CoV ORFs, and the polypeptide sequences encoded by these ORFs. Pharmaceutical and immune stimulatory compositions are also disclosed that include one or more SARS-CoV viral nucleic acids, polypeptides encoded by these viral nucleic acids and antibodies that bind to a SARS-CoV polypeptide or SARS-CoV polypeptide fragment.
In one embodiment, a method is provided for detecting the presence of SARS-CoV in a sample. This method includes contacting the sample with a pair of nucleic acid primers that hybridize to a SARS-CoV nucleic acid, wherein at least one primer is 5′-end labeled with a reporter dye, amplifying the SARS-CoV nucleic acid or a fragment thereof from the sample utilizing the pair of nucleic acid primers, electrophoresing the amplified products, and detecting the 5′-end labeled reporter dye, thereby detecting a SARS-CoV. In a specific, non-limiting example, the amplification utilizes RT-PCR. In a further specific example of the provided method, at least one of the nucleic acid primers that hybridize to a SARS-CoV nucleic acid includes a sequence as set forth in any one of SEQ ID NOs: 13–15.
In another example of the provided method, detecting the presence of SARS-CoV in a sample includes contacting the sample with a pair of nucleic acid primers that hybridize to a SARS-CoV nucleic acid, amplifying the SARS-CoV nucleic acid or a fragment thereof from the sample utilizing the pair of nucleic acid primers, adding to the amplified SARS-CoV nucleic acid or the fragment thereof a TaqMan SARS-CoV probe that hybridizes to the SARS-CoV nucleic acid, wherein the TaqMan SARS-CoV probe is labeled with a 5′-reporter dye and a 3′-quencher dye, performing one or more additional rounds of amplification, and detecting fluorescence of the 5′-reporter dye, thereby detecting a SARS-CoV. In a specific, non-limiting example, the amplification utilizes RT-PCR. In a further specific example of the provided method, at least one of the nucleic acid primers that hybridize to a SARS-CoV nucleic acid and/or the TaqMan SARS-CoV probe that hybridizes to the SARS-CoV nucleic acid includes a sequence as set forth in any one of SEQ ID NOs: 16–33.
In another embodiment, a method is provided for detecting a SARS-CoV in a biological sample that contains antibodies. This method includes contacting the biological sample with a SARS-CoV-specific antigen, wherein the antigen includes a SARS-CoV organism and determining whether a binding reaction occurs between the SARS-CoV-specific antigen and an antibody in the biological sample if such is present, thereby detecting SARS-CoV.
In a further embodiment, a method is provided for detecting a SARS-CoV in a biological sample that contains polypeptides and/or fragments thereof. This method includes contacting the biological sample with a SARS-CoV-specific antibody and determining whether a binding reaction occurs between the SARS-CoV-specific antibody and a SARS-CoV polypeptide or fragment thereof in the biological sample if such is present, thereby detecting SARS-CoV. In a specific, non-limiting example, determining whether a binding reaction occurs between the SARS-CoV-specific antibody and a SARS-CoV polypeptide or fragment thereof is carried out in situ or in a tissue sample. In a further specific example, determining whether a binding reaction occurs between the SARS-CoV-specific antibody and a SARS-CoV polypeptide or fragment thereof includes an immunohistochemical assay.
An additional embodiment includes a kit for detecting a SARS-CoV in a sample, including a pair of nucleic acid primers that hybridize under stringent conditions to a SARS-CoV nucleic acid, wherein one primer is 5′-end labeled with a reporter dye. In a specific, non-limiting example, at least one of the nucleic acid primers that hybridize to a SARS-CoV nucleic acid includes a sequence as set forth in any one of SEQ ID NOs: 13–15.
Another example of the provided kit includes a pair of nucleic acid primers that hybridize under high stringency conditions to a SARS-CoV nucleic acid and a TaqMan SARS-CoV probe that hybridizes to the SARS-CoV nucleic acid, wherein the TaqMan SARS-CoV probe is labeled with a 5′-reporter dye and a 3′-quencher dye. In a specific, non-limiting example, at least one of the nucleic acid primers that hybridize to a SARS-CoV nucleic acid and/or the TaqMan SARS-CoV probe that hybridizes to the SARS-CoV nucleic acid includes a sequence as set forth in any one of SEQ ID NOs: 16–33.
Also disclosed herein is a composition including an isolated SARS-CoV organism. In one embodiment, the isolated SARS-CoV organism is an inactive isolated SARS-CoV organism. In another embodiment, the composition includes at least one component selected from the group consisting of pharmaceutically acceptable carriers, adjuvants and combinations of two or more thereof. In yet another embodiment, the composition is introduced into a subject, thereby eliciting an immune response against a SARS-CoV antigenic epitope in a subject.
IV. SARS-CoV Nucleotide and Amino Acid Sequences
The current disclosure provides an isolated SARS-CoV genome, isolated SARS-CoV polypeptides, and isolated nucleic acid molecules encoding the same. In one embodiment, the isolated SARS-CoV genome has a sequence as shown in SEQ ID NO: 1 or an equivalent thereof. Polynucleotides encoding a SARS-CoV polypeptide (encoded by an ORF from within the genome) are also provided, and are termed SARS-CoV nucleic acid molecules. These nucleic acid molecules include DNA, cDNA and RNA sequences which encode a SARS-CoV polypeptide. Specific, non-limiting examples of a SARS-CoV nucleic acid molecule encoding an ORF are nucleic acid 265 to nucleic acid 13,398 of SEQ ID NO: 1 (encoding SARS-CoV 1a, SEQ ID NO: 2), nucleic acid 13,398 to 21,482 of SEQ ID NO: 1 (encoding SARS-CoV 1b, SEQ ID NO: 3), nucleic acid 21,492 to 25,256 of SEQ ID NO: 1 (encoding SARS-CoV S, SEQ ID NO: 4), nucleic acid 25,268 to 26,089 of SEQ ID NO: 1 (encoding SARS-CoV X1, SEQ ID NO: 5), nucleic acid 25,689 to 26,150 of SEQ ID NO: 1 (encoding SARS-CoV X2, SEQ ID NO: 6), nucleic acid 26,117 to 26,344 of SEQ ID NO: 1 (encoding SARS-CoV E, SEQ ID NO: 7), nucleic acid 26,398 to 27,060 of SEQ ID NO: 1 (encoding SARS-CoV M, SEQ ID NO: 8), nucleic acid 27,074 to 27,262 of SEQ ID NO: 1 (encoding SARS-CoV X3, SEQ ID NO: 9), nucleic acid 27,273 to 27,638 of SEQ ID NO: 1 (encoding SARS-CoV X4, SEQ ID NO: 10), nucleic acid 27,864 to 28,115 of SEQ ID NO: 1 (encoding SARS-CoV X5, SEQ ID NO: 11), and nucleic acid 28,120 to 29,385 of SEQ ID NO: 1 (encoding SARS-CoV N, SEQ ID NO: 12).
Oligonucleotide primers and probes derived from the SARS-CoV genome (SEQ ID NO: 1) are also encompassed within the scope of the present disclosure. Such oligonucleotide primers and probes may comprise a sequence of at least about 15 consecutive nucleotides of the SARS-CoV nucleic acid sequence, such as at least about 20, 25, 30, 35, 40, 45, or 50 or more consecutive nucleotides. These primers and probes may be obtained from any region of the disclosed SARS-CoV genome (SEQ ID NO: 1), including particularly from any of the ORFs disclosed herein. Specific, non-limiting examples of oligonucleotide primers derived from the SARS-CoV genome (SEQ ID NO: 1) include: Cor-p-F2 (SEQ ID NO: 13), Cor-p-F3 (SEQ ID NO: 14), Cor-p-R1 (SEQ ID NO: 15), SARS1-F (SEQ ID NO: 16), SARS1-R (SEQ ID NO: 17), SARS2-F (SEQ ID NO: 19), SARS2-R (SEQ ID NO: 20), SARS3-F (SEQ ID NO: 22), SARS3-R (SEQ ID NO: 23), N3-F (SEQ ID NO: 25), N3-R (SEQ ID NO: 26), 3′NTR-F (SEQ ID NO: 28), 3′NTR-R (SEQ ID NO: 29), M-F (SEQ ID NO: 31), and M-R (SEQ ID NO: 32). Specific, non-limiting examples of oligonucleotide probes derived from the SARS-CoV genome (SEQ ID NO: 1) include: SARS1-P (SEQ ID NO: 18), SARS2-P (SEQ ID NO: 21), SARS3-P (SEQ ID NO: 24), N3-P (SEQ ID NO: 27), 3′NTR-P (SEQ ID NO: 30), and M-P (SEQ ID NO: 33).
Nucleic acid molecules encoding a SARS-CoV polypeptide can be operatively linked to regulatory sequences or elements. Regulatory sequences or elements include, but are not limited to promoters, enhancers, transcription terminators, a start codon (for example, ATG), stop codons, and the like.
Additionally, nucleic acid molecules encoding a SARS-CoV polypeptide can be inserted into an expression vector. Specific, non-limiting examples of vectors include, plasmids, bacteriophages, cosmids, animal viruses and yeast artificial chromosomes (YACs) (Burke et al., Science 236:806–12, 1987). Such vectors may then be introduced into a variety of hosts including somatic cells, and simple or complex organisms, such as bacteria, fungi (Timberlake and Marshall, Science 244:1313–17, 1989), invertebrates, plants (Gasser et al., Plant Cell 1:15–24, 1989), and animals (Pursel et al., Science 244:1281–88, 1989).
Transformation of a host cell with an expression vector carrying a nucleic acid molecule encoding a SARS-CoV polypeptide may be carried out by conventional techniques, as are well known to those skilled in the art. By way of example, where the host is prokaryotic, such as E. coli, competent cells that are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaCl2 method using procedures well known in the art. Alternatively, MgCl2 or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell if desired, or by electroporation.
When the host is a eukaryote, methods of transfection of DNA, such as calcium phosphate coprecipitates, conventional mechanical procedures such as microinjection, electroporation, insertion of a plasmid encased in liposomes, or virus vectors, may be used. Eukaryotic cells can also be cotransformed with SARS-CoV nucleic acid molecules, and a second foreign DNA molecule encoding a selectable phenotype, such as the herpes simplex thymidine kinase gene. Another method is to use a eukaryotic viral vector, such as simian virus 40 or bovine papilloma virus, to transiently infect or transform eukaryotic cells and express the protein (see, for example, Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982).
The SARS-CoV polypeptides of this disclosure include proteins encoded by any of the ORFs disclosed herein, and equivalents thereof. Specific, non-limiting examples of SARS-CoV proteins are provided in SEQ ID NOs: 2–12. Fusion proteins are also contemplated that include a heterologous amino acid sequence chemically linked to a SARS-CoV polypeptide. Exemplary heterologous sequences include short amino acid sequence tags (such as six histidine residues), as well a fusion of other proteins (such as c-myc or green fluorescent protein fusions). Epitopes of the SARS-CoV proteins, that are recognized by an antibody or that bind the major histocompatibility complex, and can be used to induce a SARS-CoV-specific immune response, are also encompassed by this disclosure.
Methods for expressing large amounts of protein from a cloned gene introduced into E. coli may be utilized for the purification and functional analysis of proteins. For example, fusion proteins consisting of amino terminal peptides encoded by a portion of the E. coli lacZ or trpE gene linked to SARS-CoV proteins may be used to prepare polyclonal and monoclonal antibodies against these proteins.
Intact native protein may also be produced in E. coli in large amounts for functional studies. Methods and plasmid vectors for producing fusion proteins and intact native proteins in bacteria are described by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1–3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. Such fusion proteins may be made in large amounts, are easy to purify, and can be used to elicit antibody response. Native proteins can be produced in bacteria by placing a strong, regulated promoter and an efficient ribosome-binding site upstream of the cloned gene. If low levels of protein are produced, additional steps may be taken to increase protein production; if high levels of protein are produced, purification is relatively easy. Suitable methods are presented by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1–3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, and are well known in the art. Often, proteins expressed at high levels are found in insoluble inclusion bodies. Methods for extracting proteins from these aggregates are described by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1–3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.
Isolation and purification of recombinantly expressed proteins may be carried out by conventional means including preparative chromatography and immunological separations. Additionally, the proteins can be chemically synthesized by any of a number of manual or automated methods of synthesis known in the art.
V. Specific Binding Agents
The disclosure provides specific binding agents that bind to SARS-CoV polypeptides disclosed herein. The binding agent may be useful for purifying and detecting the polypeptides, as well as for detection and diagnosis of SARS-CoV. Examples of the binding agents are a polyclonal or monoclonal antibody, and fragments thereof, that bind to any of the SARS-CoV polypeptides disclosed herein.
Monoclonal or polyclonal antibodies may be raised to recognize a SARS-CoV polypeptide described herein, or a fragment or variant thereof. Optimally, antibodies raised against these polypeptides would specifically detect the polypeptide with which the antibodies are generated. That is, antibodies raised against a specific SARS-CoV polypeptide will recognize and bind that polypeptide, and will not substantially recognize or bind to other polypeptides or antigens. The determination that an antibody specifically binds to a target polypeptide is made by any one of a number of standard immunoassay methods; for instance, the Western blotting technique (Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1–3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989).
Substantially pure SARS-CoV recombinant polypeptide antigens suitable for use as immunogen may be isolated from the transformed cells described above, using methods well known in the art. Monoclonal or polyclonal antibodies to the antigens may then be prepared.
Monoclonal antibodies to the polypeptides can be prepared from murine hybridomas according to the classic method of Kohler & Milstein (Nature 256:495–97, 1975), or a derivative method thereof. Briefly, a mouse is repetitively inoculated with a few micrograms of the selected protein immunogen (for example, a polypeptide comprising at least one SARS-CoV-specific epitope, a portion of a polypeptide comprising at least one SARS-CoV-specific epitope, or a synthetic peptide comprising at least one SARS-CoV-specific epitope) over a period of a few weeks. The mouse is then sacrificed, and the antibody-producing cells of the spleen isolated. The spleen cells are fused by means of polyethylene glycol with mouse myeloma cells, and the excess unfused cells destroyed by growth of the system on selective media comprising aminopterin (HAT media). The successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate where growth of the culture is continued. Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall (Meth. Enzymol., 70:419–39, 1980), or a derivative method thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use. Detailed procedures for monoclonal antibody production are described in Harlow and Lane, Using Antibodies: A Laboratory Manual, CSHL, New York, 1999.
Polyclonal antiserum containing antibodies can be prepared by immunizing suitable animals with a polypeptide comprising at least one SARS-CoV-specific epitope, a portion of a polypeptide comprising at least one SARS-CoV-specific epitope, or a synthetic peptide comprising at least one SARS-CoV-specific epitope, which can be unmodified or modified, to enhance immunogenicity.
Effective antibody production (whether monoclonal or polyclonal) is affected by many factors related both to the antigen and the host species. For example, small molecules tend to be less immunogenic than others and may require the use of carriers and adjuvant. Also, host animals vary in response to site of inoculations and dose, with either inadequate or excessive doses of antigen resulting in low titer antisera. Small doses (ng level) of antigen administered at multiple intradermal sites appear to be most reliable. An effective immunization protocol for rabbits can be found in Vaitukaitis et al. (J. Clin. Endocrinol. Metab., 33:988–91, 1971).
Booster injections can be given at regular intervals, and antiserum harvested when the antibody titer thereof, as determined semi-quantitatively, for example, by double immunodiffusion in agar against known concentrations of the antigen, begins to fall. See, for example, Ouchterlony et al., Handbook of Experimental Immunology, Wier, D. (ed.), Chapter 19, Blackwell, 1973. A plateau concentration of antibody is usually in the range of 0.1 to 0.2 mg/ml of serum (about 12 μM). Affinity of the antisera for the antigen is determined by preparing competitive binding curves, as described, for example, by Fisher (Manual of Clinical Immunology, Ch. 42, 1980).
Antibody fragments may be used in place of whole antibodies and may be readily expressed in prokaryotic host cells. Methods of making and using immunologically effective portions of monoclonal antibodies, also referred to as “antibody fragments,” are well known and include those described in Better & Horowitz, Methods Enzymol. 178:476–96, 1989; Glockshuber et al., Biochemistry 29:1362–67, 1990; and U.S. Pat. No. 5,648,237 (Expression of Functional Antibody Fragments); U.S. Pat. No. 4,946,778 (Single Polypeptide Chain Binding Molecules); and U.S. Pat. No. 5,455,030 (Immunotherapy Using Single Chain Polypeptide Binding Molecules), and references cited therein. Conditions whereby a polypeptide/binding agent complex can form, as well as assays for the detection of the formation of a polypeptide/binding agent complex and quantitation of binding affinities of the binding agent and polypeptide, are standard in the art. Such assays can include, but are not limited to, Western blotting, immunoprecipitation, immunofluorescence, immunocytochemistry, immunohistochemistry, fluorescence activated cell sorting (FACS), fluorescence in situ hybridization (FISH), immunomagnetic assays, ELISA, ELISPOT (Coligan et al., Current Protocols in Immunology, Wiley, NY, 1995), agglutination assays, flocculation assays, cell panning, and the like, as are well known to one of skill in the art.
Binding agents of this disclosure can be bound to a substrate (for example, beads, tubes, slides, plates, nitrocellulose sheets, and the like) or conjugated with a detectable moiety, or both bound and conjugated. The detectable moieties contemplated for the present disclosure can include, but are not limited to, an immunofluorescent moiety (for example, fluorescein, rhodamine), a radioactive moiety (for example, 32P, 125I, 35S), an enzyme moiety (for example, horseradish peroxidase, alkaline phosphatase), a colloidal gold moiety, and a biotin moiety. Such conjugation techniques are standard in the art (for example, see Harlow and Lane, Using Antibodies: A Laboratory Manual, CSHL, New York, 1999; Yang et al., Nature, 382:319–24, 1996).
VI. Detection and Diagnosis of SARS-CoV
A. Nucleic Acid Based Methods of Detection and Diagnosis
A major application of the SARS-CoV sequence information presented herein is in the area of detection and diagnostic testing for SARS-CoV infection. Methods for screening a subject to determine if the subject has been or is currently infected with SARS-CoV are disclosed herein.
One such method includes providing a sample, which sample includes a nucleic acid such as DNA or RNA, and providing an assay for detecting in the sample the presence of a SARS-CoV nucleic acid molecule. Suitable samples include all biological samples useful for detection of viral infection in subjects, including, but not limited to, cells, tissues (for example, lung and kidney), bodily fluids (for example, blood, serum, urine, saliva, sputum, and cerebrospinal fluid), bone marrow aspirates, BAL, and oropharyngeal wash. Additional suitable samples include all environmental samples useful for detection of viral presence in the environment, including, but not limited to, a sample obtained from inanimate objects or reservoirs within an indoor or outdoor environment. The detection in the sample of a SARS-CoV nucleic acid molecule may be performed by a number of methodologies, non-limiting examples of which are outlined below.
In one embodiment, detecting in the sample the presence of a SARS-CoV nucleic acid molecule includes the amplification of a SARS-CoV nucleic acid sequence (or a fragment thereof). Any nucleic acid amplification method can be used. In one specific, non-limiting example, PCR is used to amplify the SARS-CoV nucleic acid sequence(s). In another non-limiting example, RT-PCR can be used to amplify the SARS-CoV nucleic acid sequences. In an additional non-limiting example, transcription-mediated amplification can be used to amplify the SARS-CoV nucleic acid sequences.
In some embodiments, a pair of SARS-CoV-specific primers are utilized in the amplification reaction. One or both of the primers can be end-labeled (for example, radiolabeled, fluoresceinated, or biotinylated). In one specific, non-limiting example, at least one of the primers is 5′-end labeled with the reporter dye 6-carboxyfluorescein (6-FAM). The pair of primers includes an upstream primer (which binds 5′ to the downstream primer) and a downstream primer (which binds 3′ to the upstream primer). In one embodiment, either the upstream primer or the downstream primer is labeled. Specific, non-limiting examples of SARS-CoV-specific primers include, but are not limited to: Cor-p-F2 (SEQ ID NO: 13), Cor-p-F3 (SEQ ID NO: 14), Cor-p-R1 (SEQ ID NO: 15), SARS1-F (SEQ ID NO: 16), SARS1-R (SEQ ID NO: 17), SARS2-F (SEQ ID NO: 19), SARS2-R (SEQ ID NO: 20), SARS3-F (SEQ ID NO: 22), SARS3-R (SEQ ID NO: 23), N3-F (SEQ ID NO: 25), N3-R (SEQ ID NO: 26), 3′NTR-F (SEQ ID NO: 28), 3′NTR-R (SEQ ID NO: 29), M-F (SEQ ID NO: 31), and M-R (SEQ ID NO: 32). Additional primer pairs can be generated, for instance, to amplify any of the specific ORFs described herein, using well known primer design principles and methods.
In one specific, non-limiting example, electrophoresis is used to detect amplified SARS-CoV-specific sequences. Electrophoresis can be automated using many methods well know in the art. In one embodiment, a genetic analyzer is used, such as an ABI 3100 Prism Genetic Analyzer (PE Applied Biosystems, Foster City, Calif.), wherein the bands are analyzed using GeneScan software (PE Applied Biosystems, Foster City, Calif.).
In another specific, non-limiting example, hybridization assays are used to detect amplified SARS-CoV-specific sequences using distinguishing oligonucleotide probes. Such probes include “TaqMan” probes. TaqMan probes consist of an oligonucleotide with a reporter at the 5′-end and a quencher at the 3′-end. In one specific, non-limiting example, the reporter is 6-FAM and the quencher is Blackhole Quencher (Biosearch Tech., Inc., Novato, Calif.). When the probe is intact, the proximity of the reporter to the quencher results in suppression of reporter fluorescence, primarily by fluorescence resonance energy transfer. If the target of interest is present, the TaqMan probe specifically hybridizes between the forward and reverse primer sites during the PCR annealing step. In the process of PCR elongation, the 5′-3′ nucleolytic activity of the Taq DNA polymerase cleaves the hybridized probe between the reporter and the quencher. The probe fragments are then displaced from the target, and polymerization of the strand continues. Taq DNA polymerase does not cleave non-hybridized probe, and cleaves the hybridized probe only during polymerization. The 3′-end of the probe is blocked to prevent extension of the probe during PCR. The 5′-3′ nuclease cleavage of the hybridized probe occurs in every cycle and does not interfere with the exponential accumulation of PCR product. Accumulation of PCR products is detected directly by monitoring the increase in fluorescence of the released reporter. The increase in fluorescence signal is detected only if the target sequence is complementary to the probe and is amplified during PCR. Therefore, non-specific amplification is not detected. SARS-CoV-specific TaqMan probes of the present disclosure include, but are not limited to: SARS1-P (SEQ ID NO: 18), SARS2-P (SEQ ID NO: 21), SARS3-P (SEQ ID NO: 24), N3-P (SEQ ID NO: 27), 3′NTR-P (SEQ ID NO: 30), and M-P (SEQ ID NO: 33), and hybridization assays include, but are not limited to, a real-time RT-PCR assay.
B. Protein Based Methods of Detection and Diagnosis
The present disclosure further provides methods of detecting a SARS-CoV antigen in a sample, and/or diagnosing SARS-CoV infection in a subject by detecting a SARS-CoV antigen. Examples of such methods comprise contacting the sample with a SARS-CoV-specific binding agent under conditions whereby an antigen/binding agent complex can form; and detecting formation of the complex, thereby detecting SARS-CoV antigen in a sample and/or diagnosing SARS-CoV infection in a subject. It is contemplated that at least certain antigens will be on an intact SARS-CoV virion, will be a SARS-CoV-encoded protein displayed on the surface of a SARS-CoV-infected cell expressing the antigen, or will be a fragment of the antigen. Contemplated samples subject to analysis by these methods can comprise any sample, such as a clinical sample, useful for detection of viral infection in a subject.
Methods for detecting antigens in a sample are discussed, for example, in Ausubel et al. Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons, Inc., 1999. Enzyme immunoassays such as IFA, ELISA and immunoblotting can be readily adapted to accomplish the detection of SARS-CoV antigens according to the methods of this disclosure. An ELISA method effective for the detection of soluble SARS-CoV antigens is the direct competitive ELISA. This method is most useful when a specific SARS-CoV antibody and purified SARS-CoV antigen are available. Briefly: 1) coat a substrate (for example, a microtiter plate) with a sample suspected of containing a SARS-CoV antigen; 2) contact the bound SARS-CoV antigen with a SARS-CoV-specific antibody bound to a detectable moiety (for example, horseradish peroxidase enzyme or alkaline phosphatase enzyme); 3) add purified inhibitor SARS-CoV antigen; 4) contact the above with the substrate for the enzyme; and 5) observe/measure inhibition of color change or fluorescence and quantitate antigen concentration (for example, using a microtiter plate reader).
An additional ELISA method effective for the detection of soluble SARS-CoV antigens is the antibody-sandwich ELISA. This method is frequently more sensitive in detecting antigen than the direct competitive ELISA method. Briefly: 1) coat a substrate (for example, a microtiter plate) with a SARS-CoV-specific antibody; 2) contact the bound SARS-CoV antibody with a sample suspected of containing a SARS-CoV antigen; 3) contact the above with SARS-CoV-specific antibody bound to a detectable moiety (for example, horseradish peroxidase enzyme or alkaline phosphatase enzyme); 4) contact the above with the substrate for the enzyme; and 5) observe/measure color change or fluorescence and quantitate antigen concentration (for example, using a microtiter plate reader).
An ELISA method effective for the detection of cell-surface SARS-CoV antigens is the direct cellular ELISA. Briefly, cells suspected of exhibiting a cell-surface SARS-CoV antigen are fixed (for example, using glutaraldehyde) and incubated with a SARS-CoV-specific antibody bound to a detectable moiety (for example, horseradish peroxidase enzyme or alkaline phosphatase enzyme). Following a wash to remove unbound antibody, substrate for the enzyme is added and color change or fluorescence is observed/measured.
The present disclosure further provides methods of detecting a SARS-CoV-reactive antibody in a sample, and/or diagnosing SARS-CoV infection in a subject by detecting a SARS-CoV-reactive antibody. Examples of such methods comprise contacting the sample with a SARS-CoV polypeptide of this disclosure under conditions whereby a polypeptide/antibody complex can form; and detecting formation of the complex, thereby detecting SARS-CoV antibody in a sample and/or diagnosing SARS-CoV infection in a subject. Contemplated samples subject to analysis by these methods can comprise any sample, such as a clinical sample, as described herein as being useful for detection of viral infection in a subject.
Methods for detecting antibodies in a sample are discussed, for example, in Ausubel et al. Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons, Inc., 1999. Enzyme immunoassays such as IFA, ELISA and immunoblotting can be readily adapted to accomplish the detection of SARS-CoV antibodies according to the methods of this disclosure. An ELISA method effective for the detection of specific SARS-CoV antibodies is the indirect ELISA method. Briefly: 1) bind a SARS-CoV polypeptide to a substrate (for example, a microtiter plate; 2) contact the bound polypeptide with a sample suspected of containing SARS-CoV antibody; 3) contact the above with a secondary antibody bound to a detectable moiety which is reactive with the bound antibody (for example, horseradish peroxidase enzyme or alkaline phosphatase enzyme); 4) contact the above with the substrate for the enzyme; and 5) observe/measure color change or fluorescence.
Another immunologic technique that can be useful in the detection of SARS-CoV antibodies uses monoclonal antibodies for detection of antibodies specifically reactive with SARS-CoV polypeptides in a competitive inhibition assay. Briefly, a sample suspected of containing SARS-CoV antibodies is contacted with a SARS-CoV polypeptide of this disclosure which is bound to a substrate (for example, a microtiter plate). Excess sample is thoroughly washed away. A labeled (for example, enzyme-linked, fluorescent, radioactive, and the like) monoclonal antibody specific for the SARS-CoV polypeptide is then contacted with any previously formed polypeptide-antibody complexes and the amount of monoclonal antibody binding is measured. The amount of inhibition of monoclonal antibody binding is measured relative to a control (no monoclonal antibody), allowing for detection and measurement of antibody in the sample. The degree of monoclonal antibody inhibition can be a very specific assay for detecting SARS-CoV. Monoclonal antibodies can also be used for direct detection of SARS-CoV in cells or tissue samples by, for example, IFA analysis according to standard methods.
As a further example, a micro-agglutination test can be used to detect the presence of SARS-CoV antibodies in a sample. Briefly, latex beads, red blood cells or other agglutinable particles are coated with a SARS-CoV polypeptide of this disclosure and mixed with a sample, such that antibodies in the sample that are specifically reactive with the antigen crosslink with the antigen, causing agglutination. The agglutinated polypeptide-antibody complexes form a precipitate, visible with the naked eye or measurable by spectrophotometer. In a modification of the above test, SARS-CoV-specific antibodies of this disclosure can be bound to the agglutinable particles and SARS-CoV antigen in the sample thereby detected.
VII. Pharmaceutical and Immune Stimulatory Compositions and Uses Thereof
Pharmaceutical compositions including SARS-CoV nucleic acid sequences, SARS-CoV polypeptides, or antibodies that bind these polypeptides, are also encompassed by the present disclosure. These pharmaceutical compositions include a therapeutically effective amount of one or more SARS-CoV polypeptides, one or more nucleic acid molecules encoding a SARS-CoV polypeptide, or an antibody that binds a SARS-CoV polypeptide, in conjunction with a pharmaceutically acceptable carrier.
Disclosed herein are substances suitable for use as immune stimulatory compositions for the inhibition or treatment of SARS. Particular immune stimulatory compositions are directed against SARS-CoV, and include antigens obtained from SARS-CoV. In one embodiment, an immune stimulatory composition contains attenuated SARS-CoV. Methods of viral attenuation are well know in the art, and include, but are not limited to, high serial passage (for example, in susceptible host cells under specific environmental conditions to select for attenuated virions), exposure to a mutagenic agent (for example, a chemical mutagen or radiation), genetic engineering using recombinant DNA technology (for example, using gene replacement or gene knockout to disable one or more viral genes), or some combination thereof.
In another embodiment, the immune stimulatory composition contains inactivated SARS-CoV. Methods of viral inactivation are well known in the art, and include, but are not limited to, heat and chemicals (for example, formalin, β-propiolactone, and ehtylenimines).
In yet another embodiment, the immune stimulatory composition contains a nucleic acid vector that includes SARS-CoV nucleic acid molecules described herein, or that includes a nucleic acid sequence encoding an immunogenic polypeptide or polypeptide fragment of SARS-CoV or derived from SARS-CoV, such as a polypeptide that encodes a surface protein of SARS-CoV.
In a further embodiment, the immune stimulatory composition contains a SARS-CoV subunit, such as glycoprotein, major capsid protein, or other gene products found to elicit humoral and/or cell mediated immune responses.
The provided immune stimulatory SARS-CoV polypeptides, constructs or vectors encoding such polypeptides, are combined with a pharmaceutically acceptable carrier or vehicle for administration as an immune stimulatory composition to human or animal subjects. In some embodiments, more than one immune stimulatory SARS-CoV polypeptide may be combined to form a single preparation.
The immunogenic formulations may be conveniently presented in unit dosage form and prepared using conventional pharmaceutical techniques. Such techniques include the step of bringing into association the active ingredient and the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers. Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of a sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets commonly used by one of ordinary skill in the art.
In certain embodiments, unit dosage formulations are those containing a dose or unit, or an appropriate fraction thereof, of the administered ingredient. It should be understood that in addition to the ingredients particularly mentioned above, formulations encompassed herein may include other agents commonly used by one of ordinary skill in the art.
The compositions provided herein, including those for use as immune stimulatory compositions, may be administered through different routes, such as oral, including buccal and sublingual, rectal, parenteral, aerosol, nasal, intramuscular, subcutaneous, intradermal, and topical. They may be administered in different forms, including but not limited to solutions, emulsions and suspensions, microspheres, particles, microparticles, nanoparticles, and liposomes.
The volume of administration will vary depending on the route of administration. By way of example, intramuscular injections may range from about 0.1 ml to about 1.0 ml. Those of ordinary skill in the art will know appropriate volumes for different routes of administration.
A relatively recent development in the field of immune stimulatory compounds (for example, vaccines) is the direct injection of nucleic acid molecules encoding peptide antigens (broadly described in Janeway & Travers, Immunobiology: The Immune System In Health and Disease, page 13.25, Garland Publishing, Inc., New York, 1997; and McDonnell & Askari, N. Engl. J. Med. 334:42–45, 1996). Vectors that include nucleic acid molecules described herein, or that include a nucleic acid sequence encoding an immunogenic SARS-CoV polypeptide may be utilized in such DNA vaccination methods.
Thus, the term “immune stimulatory composition” as used herein also includes nucleic acid vaccines in which a nucleic acid molecule encoding a SARS-CoV polypeptide is administered to a subject in a pharmaceutical composition. For genetic immunization, suitable delivery methods known to those skilled in the art include direct injection of plasmid DNA into muscles (Wolff et al., Hum. Mol. Genet. 1:363, 1992), delivery of DNA complexed with specific protein carriers (Wu et al., J. Biol. Chem. 264:16985, 1989), co-precipitation of DNA with calcium phosphate (Benvenisty and Reshef, Proc. Natl. Acad. Sci. 83:9551, 1986), encapsulation of DNA in liposomes (Kaneda et al., Science 243:375, 1989), particle bombardment (Tang et al., Nature 356:152, 1992; Eisenbraun et al., DNA Cell Biol. 12:791, 1993), and in vivo infection using cloned retroviral vectors (Seeger et al., Proc. Natl. Acad. Sci. 81:5849, 1984). Similarly, nucleic acid vaccine preparations can be administered via viral carrier.
The amount of immunostimulatory compound in each dose of an immune stimulatory composition is selected as an amount that induces an immunostimulatory or immunoprotective response without significant, adverse side effects. Such amount will vary depending upon which specific immunogen is employed and how it is presented. Initial injections may range from about 1 μg to about 1 mg, with some embodiments having a range of about 10 μg to about 800 μg, and still other embodiments a range of from about 25 μg to about 500 μg. Following an initial administration of the immune stimulatory composition, subjects may receive one or several booster administrations, adequately spaced. Booster administrations may range from about 1 μg to about 1 mg, with other embodiments having a range of about 10 μg to about 750 μg, and still others a range of about 50 μg to about 500 μg. Periodic boosters at intervals of 1–5 years, for instance three years, may be desirable to maintain the desired levels of protective immunity.
It is also contemplated that the provided immunostimulatory molecules and compositions can be administered to a subject indirectly, by first stimulating a cell in vitro, which stimulated cell is thereafter administered to the subject to elicit an immune response. Additionally, the pharmaceutical or immune stimulatory compositions or methods of treatment may be administered in combination with other therapeutic treatments.
VIII. Kits
Also provided herein are kits useful in the detection and/or diagnosis of SARS-CoV. This includes kits for use with nucleic acid and protein detection methods, such as those disclosed herein.
The SARS-CoV-specific oligonucleotide primers and probes described herein can be supplied in the form of a kit for use in detection of SARS-CoV. In such a kit, an appropriate amount of one or more of the oligonucleotides is provided in one or more containers, or held on a substrate. An oligonucleotide primer or probe can be provided in an aqueous solution or as a freeze-dried or lyophilized powder, for instance. The container(s) in which the oligonucleotide(s) are supplied can be any conventional container that is capable of holding the supplied form, for instance, microfuge tubes, ampoules, or bottles. In some applications, pairs of primers are provided in pre-measured single use amounts in individual (typically disposable) tubes or equivalent containers. With such an arrangement, the sample to be tested for the presence of a SARS-CoV nucleic acid can be added to the individual tubes and amplification carried out directly.
The amount of each oligonucleotide supplied in the kit can be any appropriate amount, and can depend on the market to which the product is directed. For instance, if the kit is adapted for research or clinical use, the amount of each oligonucleotide primer provided would likely be an amount sufficient to prime several PCR amplification reactions. General guidelines for determining appropriate amounts can be found, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001; Ausubel et al. (eds.), Short Protocols in Molecular Biology, John Wiley and Sons, New York, N.Y., 1999; and Innis et al., PCR Applications, Protocols for Functional Genomics, Academic Press, Inc., San Diego, Calif., 1999. A kit can include more than two primers, in order to facilitate the amplification of a larger number of SARS-CoV nucleotide sequences.
In some embodiments, kits also include one or more reagents necessary to carry out in vitro amplification reactions, including DNA sample preparation reagents, appropriate buffers (for example, polymerase buffer), salts (for example, magnesium chloride), and deoxyribonucleotides (dNTPs).
Kits can include either labeled or unlabeled oligonucleotide primers and/or probes for use in detection of SARS-CoV nucleotide sequences. The appropriate sequences for such a probe will be any sequence that falls between the annealing sites of the two provided oligonucleotide primers, such that the sequence that the probe is complementary to is amplified during the amplification reaction.
One or more control sequences for use in the amplification reactions also can be supplied in the kit. In other particular embodiments, the kit includes equipment, reagents, and instructions for extracting and/or purifying nucleotides from a sample.
Kits for the detection of SARS-CoV antigen include for instance at least one SARS-CoV antigen-specific binding agent (for example, a polyclonal or monoclonal antibody or antibody fragment). The kits may also include means for detecting antigen:specific binding agent complexes, for instance the specific binding agent may be detectably labeled. If the specific binding agent is not labeled, it may be detected by second antibodies or protein A, for example, which may also be provided in some kits in one or more separate containers. Such techniques are well known.
Another example of an assay kit provided herein is a recombinant SARS-CoV-specific polypeptide (or fragment thereof) as an antigen and an enzyme-conjugated anti-human antibody as a second antibody. Examples of such kits also can include one or more enzymatic substrates. Such kits can be used to test if a sample from a subject contains antibodies against a SARS-CoV-specific protein.
The subject matter of the present disclosure is further illustrated by the following non-limiting Examples.
Virus Isolation and Ultrastructural Characterization
This example describes the original isolation and characterization of a new human coronavirus from patients with SARS.
A variety of clinical specimens (blood, serum, material from oropharyngeal swabs or washings, material from nasopharyngeal swabs, and tissues of major organs collected at autopsy) from patients meeting the case definition of SARS were sent to the Centers for Disease Control and Prevention (CDC) as part of the etiologic investigation of SARS. These samples were inoculated onto a number of continuous cell lines, including Vero E6, NCI-H292, MDCK, LLC-MK2, and B95-8 cells, and into suckling ICR mice by the intracranial and intraperitoneal routes. All cultures were observed daily for CPE. Maintenance medium was replenished at day seven, and cultures were terminated fourteen days after inoculation. Any cultures exhibiting identifiable CPE were subjected to several procedures to identify the cause of the effect. Suckling mice were observed daily for fourteen days, and any sick or dead mice were further tested by preparing a brain suspension that was filtered and subcultured. Mice that remained well after fourteen days were killed, and their test results were recorded as negative.
Two cell lines, Vero E6 cells and NCI-H292 cells, inoculated with oropharyngeal specimens from Patient 16 (a 46 year old male physician with an epidemiologic link to a hospital with multiple SARS patients) initially showed CPE (Table 1)
| TABLE 1 |
| Specimens from patients with SARS that were positive for SARS-CoV by one or more methods*. |
| Exposure | Findings | |||||||
| Patient | and | on Chest | Hospital- | Serologic | ||||
| No. | Setting | Age/Sex | Radiograph | ization | Results | Specimen | Isolation | RT-PCR |
| 1 | Singapore, | 53 yr/F | Pneumonia | Yes | + | Nasal, | − | Not done |
| hospital | oropharyngeal | |||||||
| swabs | ||||||||
| 2† | Hong | 36 yr/F | Pneumonia | Yes | + | Nasal, swab | − | Not done |
| Kong, | ||||||||
| hotel | ||||||||
| 3 | Hong | 22 yr/M | Pneumonia | Yes | + | Swab | − | − |
| Kong, | ||||||||
| hotel | ||||||||
| 4† | Hong | 39 yr/M | Pneumonia | Yes | + | Nasal, | − | − |
| Kong, | pharyngeal | |||||||
| hotel | swab | |||||||
| 5 | Hong | 49 Yr/M | Pneumonia | Yes | Not done | Sputum | + | + |
| Kong, | ||||||||
| hotel | ||||||||
| 6‡ | Hong | 46 yr/M | Pneumonia | Yes | + | Kidney, lung, | +§ | + |
| Kong, | bronchoalveolar | |||||||
| hotel | lavage | |||||||
| 7 | Vietnam, | Adult/ | Pneumonia | Yes | − | Oropharyngeal | + | + |
| hospital | unknown | wash | ||||||
| 8 | Vietnam, | Adult/ | Pneumonia | Yes | − | Oropharyngeal | − | + |
| hospital | unknown | wash | ||||||
| 9 | Vietnam, | Adult/ | Pneumonia | Yes | − | Oropharyngeal | − | + |
| hospital | unknown | wash | ||||||
| 10 | Vietnam, | Adult/ | Pneumonia | Yes | − | Oropharyngeal | − | + |
| hospital | unknown | wash | ||||||
| 11 | Vietnam, | Adult/ | Pneumonia | Yes | − | Oropharyngeal | − | + |
| hospital | unknown | wash | ||||||
| 12 | Vietnam, | Adult/ | Pneumonia | Yes | − | Oropharyngeal | − | + |
| hospital | unknown | wash | ||||||
| 13 | Vietnam, | Adult/ | Pneumonia | Yes | − | Oropharyngeal | + | + |
| hospital | unknown | wash | ||||||
| 14 | Vietnam, | Adult/ | Pneumonia | Yes | − | Oropharyngeal | − | + |
| hospital | unknown | wash | ||||||
| 15 | Vietnam, | Adult/ | Pneumonia | Yes | − | Oropharyngeal | − | + |
| hospital | unknown | wash | ||||||
| 16 | Vietnam, | 46 yr/M | Pneumonia | Yes | + | Nasal, | +¶ | + |
| hospital | oropharyngeal | |||||||
| swabs | ||||||||
| 17 | Canada, | 43 yr/M | Pneumonia | Yes | Not done | Lung, bone | − | |
| family | marrow | |||||||
| 18 | Taiwan, | 51 yr/F | Pneumonia | Yes | − | Sputum | − | + |
| family | ||||||||
| 19 | Hong | Adult/F | Pneumonia | Yes | + | Oropharyngeal | − | + |
| Kong, | wash | |||||||
| hotel | ||||||||
| *Plus signs denote positive results, and minus signs negative results. The serologic and RT-PCR assays were not necessarily performed on samples obtained at the same time. | ||||||||
| †This was a late specimen, antibody positive at first sample. | ||||||||
| ‡Travel included China, Hong Kong (hotel), and Hanoi (the patient was the index patient in the French Hospital). | ||||||||
| §Isolation was from the kidney only. | ||||||||
| ¶Isolation was from the oropharyngeal only. |
The CPE in the Vero E6 cells was first noted on the fifth day post-inoculation; it was focal, with cell rounding and a refractive appearance in the affected cells that was soon followed by cell detachment (FIG. 1A). The CPE spread quickly to involve the entire cell monolayer within 24 to 48 hours. Subculture of material after preparation of a master seed stock (used for subsequent antigen production) resulted in the rapid appearance of CPE, as noted above, and in complete destruction of the monolayer in the inoculated flasks within 48 hours. Similar CPE was also noted in four additional cultures: three cultures of respiratory specimens (two oropharyngeal washes and one sputum specimen) and one culture of a suspension of kidney tissue obtained at autopsy. In these specimens, the initial CPE was observed between day two and day four and, as noted above, the CPE rapidly progressed to involve the entire cell monolayer.
Tissue culture samples showing CPE were prepared for electron-microscopical examination. Negative-stain electron-microscopical specimens were prepared by drying culture supernatant, mixed 1:1 with 2.5% paraformaldehyde, onto Formvarcarbon-coated grids and staining with 2% methylamine tungstate. Thin-section electron-microscopical specimens were prepared by fixing a washed cell pellet with 2.5% glutaraldehyde and embedding the cell pellet in epoxy resin. In addition, a master seed stock was prepared from the remaining culture supernatant and cells by freeze-thawing the culture flask, clarifying the thawed contents by centrifugation at 1000×g, and dispensing the supernatant into aliquots stored in gas phase over liquid nitrogen. The master seed stock was subcultured into 850-cm2 roller bottles of Vero E6 cells for the preparation of formalin-fixed positive control cells for immunohistochemical analysis, mixed with normal Vero E6 cells, and gamma-irradiated for preparation of spot slides for IFA tests or extracted with detergent and gamma-irradiated for use as an ELISA antigen for antibody tests.
Examination of CPE-positive Vero E6 cells by thin-section electron microscopy revealed characteristic coronavirus particles within the cisternae of the rough endoplasmic reticulum and in vesicles (FIG. 2A) (Becker et al., J. Virol. 1:1019–27, 1967; Oshiro et al. J. Gen. Virol. 12:161–8, 1971). Extracellular particles were found in large clusters and adhering to the surface of the plasma membrane. Negative-stain electron microscopy identified coronavirus particles, 80 to 140 nm in diameter, with 20- to 40-nm complex surface projections surrounding the periphery (FIG. 2B). Hemagglutinin esterase-type glycoprotein projections were not seen.
The isolation and growth of a human-derived coronavirus in Vero E6 cells were unexpected. The previously known human coronaviruses are notably fastidious, preferring select cell lines, organ culture, or suckling mice for propagation. The only human or animal coronavirus which has been shown to grow in Vero E6 cells is PEDV, and it requires the addition of trypsin to culture medium for growth in the cells. Moreover, PEDV adapted to growth in Vero E6 cells results in a strikingly different CPE, with cytoplasmic vacuoles and the formation of large syncytia. Syncytial cells were only observed occasionally in monolayers of Vero E6 cells infected with the SARS-CoV; they clearly do not represent the dominant CPE.
Reverse Transcription-Polymerase Chain Reaction and Sequencing
For RT-PCR assays, cell-culture supernatants were placed in lysis buffer. RNA extracts were prepared from 100 μl of each specimen (or culture supernatant) with the automated NucliSens extraction system (bioMérieux, Durham, N.C.). Initially, degenerate, inosine-containing primers IN-2 (+) 5′GGGTTGGGACTA TCCTAAGTGTGA3′ (SEQ ID NO: 34) and IN-4 (−) 5′TAACACACAACICCATCA TCA3′ (SEQ ID NO: 35) were designed to anneal to sites encoding conserved amino acid motifs that were identified on the basis of alignments of available coronavirus ORF1a, ORF1b, S, HE, M, and N gene sequences. Additional, SARS-specific, primers Cor-p-F2 (+) 5′CTAACATGCTTAGGATAATGG3′ (SEQ ID NO: 13), Cor-p-F3 (+) 5′GCCTCTCTTGTTCTTGCTCGC3′ (SEQ ID NO: 14), and Cor-p-R1 (−) 5′CAGGTAAGCGTAAAACTCATC3 (SEQ ID NO: 15) were designed as sequences were generated from RT-PCR products amplified with the degenerate primers. These SARS-specific primers were used to test patient specimens for SARS (see below). Primers used for specific amplification of human metapneumovirus have been described by Falsey et al. (J. Infect. Dis. 87:785–90, 2003).
For RT-PCR products of less than 3 kb, cDNA was synthesized in a 20 μl reaction mixture containing 500 ng of RNA, 200 U of Superscript™ II reverse transcriptase (Invitrogen Life Technologies, Carlsbad, Calif.), 40 U of RNasin (Promega Corp., Madison, Wis.), 100 mM each dNTP (Roche Molecular Biochemicals, Indianapolis, Ind.), 4 μl of 5× reaction buffer (Invitrogen Life Technologies, Carlsbad, Calif.), and 200 pmol of the reverse primer. The reaction mixture, except for the reverse transcriptase, was heated to 70° C. for 2 minutes, cooled to 4° C. for 5 minutes and then heated to 42° C. in a thermocycler. The mixture was held at 42° C. for 4 minutes, and then the reverse transcriptase was added, and the reactions were incubated at 42° C. for 45 minutes. Two microliters of the cDNA reaction was used in a 50 μl PCR reaction containing 67 mM Tris-HCl (pH 8.8), 1 mM each primer, 17 mM ammonium sulfate, 6 mM EDTA, 2 mM MgCl2, 200 mM each dNTP, and 2.5 U of Taq DNA polymerase (Roche Molecular Biochemicals, Indianapolis, Ind.). The thermocycler program for the PCR consisted of 40 cycles of denaturation at 95° C. for 30 seconds, annealing at 42° C. for 30 seconds, and extension at 65° C. for 30 seconds. For SARS-CoV-specific primers, the annealing temperature was increased to 55° C.
For amplification of fragments longer than 3 kb, regions of the genome between sections of known sequence were amplified by means of a long RT-PCR protocol and SARS-CoV-specific primers. First-strand cDNA synthesis was performed at 42° C. or 50° C. using Superscript™ II RNase H reverse transcriptase (Invitrogen Life Technologies, Carlsbad, Calif.) according to the manufacturer's instructions with minor modifications. Coronavirus-specific primers (500 ng) and SARS-CoV RNA (350 ng) were combined with the PCR Nucleotide Mix (Roche Molecular Biochemicals, Indianapolis, Ind.), heated for 1 minute at 94° C., and cooled to 4° C. in a thermocycler. The 5× first-strand buffer, dithiothreitol (Invitrogen Life Technologies, Carlsbad, Calif.), and Protector RNase Inhibitor (Roche Molecular Biochemicals, Indianapolis, Ind.) were added, and the samples were incubated at 42° C. or 50° C. for 2 minutes. After reverse transcriptase (200 U) was added, the samples were incubated at 42° C. or 50° C. for 1.5 to 2 hours. Samples were inactivated at 70° C. for 15 minutes and subsequently treated with 2 U of RNase H (Roche Molecular Biochemicals, Indianapolis, Ind.) at 37° C. for 30 minutes. Long RT-PCR amplification of 5- to 8-kb fragments was performed using Taq Plus Precision (Stratagene, La Jolla, Calif.) and AmpliWax PCR Gem 100 beads (Applied Biosystems; Foster City, Calif.) for “hot start” PCR with the following thermocycling parameters: denaturation at 94° C. for 1 minute followed by 35 cycles of 94° C. for 30 seconds, 55° C. for 30 seconds, an increase of 0.4 degrees per second up to 72° C., and 72° C. for 7 to 10 minutes, with a final extension at 72° C. for 10 minutes. RT-PCR products were separated by electrophoresis on 0.9% agarose TAE gels and purified by use of a QIAquick Gel Extraction Kit (Qiagen, Inc., Santa Clarita, Calif.).
In all cases, the RT-PCR products were gel-isolated and purified for sequencing by means of a QIAquick Gel Extraction kit (Qiagen, Inc., Santa Clarita, Calif.). Both strands were sequenced by automated methods, using fluorescent dideoxy-chain terminators (Applied Biosystems; Foster City, Calif.).
The sequence of the leader was obtained from the subgenomic mRNA coding for the N gene and from the 5′ terminus of genomic RNA. The 5′ rapid amplification of cDNA ends (RACE) technique (Harcourt et al., Virology 271:334–49, 2000) was used with reverse primers specific for the N gene or for the 5′ untranslated region. RACE products were either sequenced directly or were cloned into a plasmid vector before sequencing. A primer that was specific for the leader of SARS-CoV was used to amplify the region between the 5′-terminus of the genome and known sequences in the rep gene. The 3′-terminus of the genome was amplified for sequencing by use of an oligo-(dT) primer and primers specific for the N gene.
Once the complete SARS-CoV genomic sequence had been determined, it was confirmed by sequencing a series of independently amplified RT-PCR products spanning the entire genome. Positive- and negative-sense sequencing primers, at intervals of approximately 300 nt, were used to generate a confirmatory sequence with an average redundancy of 9.1. The confirmatory sequence was identical to the original sequence. The genomic sequence (SEQ ID NO: 1) was published in the GenBank sequence database (Accession No. AY278741) on Apr. 21, 2003.
Sequence Analysis
Predicted amino acid sequences were compared with those from reference viruses representing each species for which complete genomic sequence information was available: group 1 representatives included human coronavirus 229E (GenBank Accession No. AF304460), porcine epidemic diarrhea virus (GenBank Accession No. AF353511), and transmissible gastroenteritis virus (GenBank Accession No. AF271965); group 2 representatives included bovine coronavirus (GenBank Accession No. AF220295) and mouse hepatitis virus (GenBank Accession No. AF201929); group 3 was represented by infectious bronchitis virus (GenBank Accession No. M95169). Sequences for representative strains of other coronavirus species for which partial sequence information was available were included for some of the structural protein comparisons: group 1 representative strains included canine coronavirus (GenBank Accession No. D13096), feline coronavirus (GenBank Accession No. AY204704), and porcine respiratory coronavirus (GenBank Accession No. Z24675); and group 2 representatives included three strains of human coronavirus OC43 (GenBank Accession Nos. M76373, L14643 and M93390), porcine hemagglutinating encephalomyelitis virus (GenBank Accession No. AY078417), and rat coronavirus (GenBank Accession No. AF207551).
Partial nucleotide sequences of the polymerase gene were aligned with published coronavirus sequences, using CLUSTAL W for Unix (version 1.7; Thompson et al., Nucleic Acids Res. 22:4673–80, 1994). Phylogenetic trees were computed by maximum parsimony, distance, and maximum likelihood-based criteria analysis with PAUP (version 4.0.d10; Swofford ed., Phylogenetic Analysis using Parsimony and other Methods, Sinauer Associates, Sunderland, Mass.). When compared with other human and animal coronaviruses, the nucleotide and deduced amino acid sequence from this region had similarity scores ranging from 0.56 to 0.63 and from 0.57 to 0.74, respectively. The highest sequence similarity was obtained with group II coronaviruses. The maximum-parsimony tree obtained from the nucleotide-sequence alignment is shown in FIG. 3. Bootstrap analyses of the internal nodes at the internal branches of the tree provided strong evidence that the SARS-CoV is genetically distinct from other known coronaviruses.
Microarray analyses (using a long oligonucleotide DNA microarray with array elements derived from highly conserved regions within viral families) of samples from infected and uninfected cell cultures gave a positive signal for a group of eight oligonucleotides derived from two virus families: Coronaviridae and Astroviridae (Wang et al., PNAS 99:15687–92, 2002). All of the astroviruses and two of the coronavirus oligonucleotides share a consensus sequence motif that maps to the extreme 3′-end of astroviruses and two members of the coronavirus family: avian infectious bronchitis and turkey coronavirus (Jonassen et al., J. Gen. Virol. 79:715–8, 1998). Results were consistent with the identity of the isolate as a coronavirus.
Additional sequence alignments and neighbor-joining trees were generated by using ClustalX (Thompson et al., Nucleic Acids Res. 25:4876–82, 1997), version 1.83, with the Gonnet protein comparison matrix. The resulting trees were adjusted for final output by using treetool version 2.0.1. Uncorrected pairwise distances were calculated from the aligned sequences by using the Distances program from the Wisconsin Sequence Analysis Package, version 10.2 (Accelrys, Burlington, Mass.). Distances were converted to percent identity by subtracting from 100. The amino acid sequences for three well-defined enzymatic proteins encoded by the rep gene and the four major structural proteins of SARS-CoV were compared with those from representative viruses for each of the species of coronavirus for which complete genomic sequence information was available (FIG. 4, Table 2). The topologies of the resulting phylograms are remarkably similar (FIG. 4). For each protein analyzed, the species formed monophyletic clusters consistent with the established taxonomic groups. In all cases, SARS-CoV sequences segregated into a fourth, well-resolved branch. These clusters were supported by bootstrap values above 90% (1000 replicates). Consistent with pairwise comparisons between the previously characterized coronavirus species (Table 2), there was greater sequence conservation in the enzymatic proteins (3CLpro, polymerase (POL), and helicase (HEL)) than among the structural proteins (S, E, M, and N). These results indicate that SARS-CoV is not closely related to any of the previously characterized coronaviruses and forms a distinct group within the genus Coronavirus.
| TABLE 2 |
| Pairwise amino acid identities of coronavirus proteins. |
| Group | Virus | 3CLPRO | POL | HEL | S | E | M | N |
| Pairwise Amino Acid Identity (Percent) |
| G1 | HCoV-229E | 40.1 | 58.8 | 59.7 | 23.9 | 22.7 | 28.8 | 23.0 |
| PEDV | 44.4 | 59.5 | 61.7 | 21.7 | 17.6 | 31.8 | 22.6 | |
| TGEV | 44.0 | 59.4 | 61.2 | 20.6 | 22.4 | 30.0 | 25.6 | |
| G2 | BCoV | 48.8 | 66.3 | 68.3 | 27.1 | 20.0 | 39.7 | 31.9 |
| MHV | 49.2 | 66.5 | 67.3 | 26.5 | 21.1 | 39.0 | 33.0 | |
| G3 | IBV | 41.3 | 62.5 | 58.6 | 21.8 | 18.4 | 27.2 | 24.0 |
| Predicted Protein Length (aa) |
| SARS-CoV | 306 | 932 | 601 | 1255 | 76 | 221 | 422 | |
| CoV Range | 302–307 | 923–940 | 506–600 | 1173–1452 | 76–108 | 225–262 | 377–454 | |
This example demonstrates the detection of SARS-CoV in patient specimens using SARS-CoV-specific primers.
The SARS-specific primers Cor-p-F2 (SEQ ID NO: 13), Cor-p-F3 (SEQ ID NO: 14) and Cor-p-R1 (SEQ ID NO: 15) were used to test patient specimens for SARS. One primer for each set was 5′-end-labeled with 6-FAM to facilitate GeneScan analysis. One-step amplification reactions were performed with the Access RT-PCR System (Promega, Madison, Wis.) as described by Falsey et al., J. Infect. Dis. 87:785–90, 2003. Positive and negative RT-PCR controls, containing standardized viral RNA extracts, and nuclease-free water were included in each run. Amplified 6-FAM-labeled products were analyzed by capillary electrophoresis on an ABI 3100 Prism Genetic Analyzer with GeneScan software (version 3.1.2; Applied Biosystems; Foster City, Calif.). Specimens were considered positive for SARS-CoV if the amplification products were within one nucleotide of the expected product size (368 nucleotides for Cor-p-F2 or Cor-p-R1 and 348 nucleotides for Cor-p-F3 or Cor-p-R1) for both specific primer sets, as confirmed by a second PCR reaction from another aliquot of RNA extract in a separate laboratory. Where DNA yield was sufficient, the amplified products were also sequenced. Additionally, as described above, microarray-based detection of SARS-CoV in patient specimens was carried out (Wang et al., PNAS 99:15687–92, 2002 and Bohlander et al., Genomics 13:1322–24, 1992).
This example illustrates immunohistochemical, histopathological and electron-microscopical analysis of Vero E6 cells infected with the SARS-CoV and tissue samples from SARS patients.
Formalin-fixed, paraffin-embedded Vero E6 cells infected with the SARS-CoV and tissues obtained from patients with SARS were stained with hematoxylin and eosin and various immunohistochemical stains. Immunohistochemical assays were based on a method described previously for hantavirus (Zaki et al., Amer. J. Pathol. 146:552–79, 1995). Briefly, 4-μm sections were deparaffinized, rehydrated, and digested in Proteinase K for 15 minutes. Slides were then incubated for 60 minutes at room temperature with monoclonal antibodies, polyclonal antiserum or ascitic fluids derived from animal species with reactivities to various known coronaviruses, and with a convalescent-phase serum specimen from a patient with SARS.
Optimal dilutions of the primary antibodies were determined by titration experiments with coronavirus-infected cells from patients with SARS and with noninfected cells or, when available, with concentrations recommended by the manufacturers. After sequential application of the appropriate biotinylated link antibody, avidin-alkaline phosphatase complex, and naphthol-fast red substrate, sections were counterstained in Mayer's hematoxylin and mounted with aqueous mounting medium. The following antibody and tissue controls were used: serum specimens from noninfected animals, various coronavirus-infected cell cultures and animal tissues, noninfected cell cultures, and normal human and animal tissues. Tissues from patients were also tested by immunohistochemical assays for various other viral and bacterial pulmonary pathogens. In addition, a BAL specimen was available from one patient for thin-section electron-microscopical evaluation.
Lung tissues were obtained from the autopsy of three patients and by open lung biopsy of one patient, 14–19 days following onset of SARS symptoms. Confirmatory laboratory evidence of infection with coronavirus was available for two patients (patients 6 and 17) and included PCR amplification of coronavirus nucleic acids from tissues, viral isolation from BAL fluid or detection of serum antibodies reactive with coronavirus (Table 1). For two patients, no samples were available for molecular, cell culture, or serological analysis; however, both patients met the CDC definition for probable SARS cases and had strong epidemiologic links with laboratory-confirmed SARS cases. Histopathologic evaluation of lung tissues of the four patients showed diffuse alveolar damage at various levels of progression and severity. Changes included hyaline membrane formation, interstitial mononuclear inflammatory infiltrates, and desquamation of pneumocytes in alveolar spaces (FIG. 5A). Other findings identified in some patients included focal intraalveolar hemorrhage, necrotic inflammatory debris in small airways, and organizing pneumonia. Multinucleated syncytial cells were identified in the intraalveolar spaces of two patients who died 14 and 17 days, respectively, after onset of illness. These cells contained abundant vacuolated cytoplasm with cleaved and convoluted nuclei. No obvious intranuclear or intracytoplasmic viral inclusions were identified (FIG. 5B), and electron-microscopical examination of a limited number of these syncytial cells revealed no coronavirus particles. No definitive immunostaining was identified in tissues from SARS patients with the use of a battery of immunohistochemical stains reactive with coronaviruses from antigenic groups I, II, and III. In addition, no staining of patient tissues was identified with the use of immunohistochemical stains for influenzaviruses A and B, adenoviruses, Hendra and Nipah viruses, human metapneumovirus, respiratory syncytial virus, measles virus, Mycoplasma pneumoniae, and Chlamydia pneumoniae.
Evaluation of Vero E6 cells infected with coronavirus isolated from a patient with SARS revealed viral CPE that included occasional multinucleated syncytial cells but no obvious viral inclusions (FIG. 5C). Immunohistochemical assays with various antibodies reactive with coronaviruses from antigenic group I, including HCoV-229E, FIPV and TGEV, and with an immune serum specimen from a patient with SARS, demonstrated strong cytoplasmic and membranous staining of infected cells (FIG. 5C and Table 3); however, cross-reactivity with the same immune human serum sample and FIPV antigen was not observed. No staining was identified with any of several monoclonal or polyclonal antibodies reactive with coronaviruses in antigenic group II (HCoV-OC43, BCoV and MHV) or group III (TCoV and IBV-Avian). Electron microscopical examination of a BAL fluid from one patient revealed many coronavirus-infected cells (FIGS. 6A–B).
| TABLE 3 |
| Immunohistochemical reactivities of various polyclonal group I anti- |
| coronavirus reference antiserum samples with a coronavirus isolated from |
| a patient with SARS and with selected antigenic group I coronaviruses. |
| Immunohistochemical reactivity of antiserum with | |
| coronavirus-infected culture cells |
| HCoV-229E | |||
| SARS-CoV | (mouse 3T3- | FIPV-1 | |
| Antiserum | (Vero E6) | hAPN) | (BHK-fAPN) |
| Convalescent- | + | + | − |
| phase SARS | |||
| (patient 3) | |||
| Guinea pig anti- | + | + | − |
| HCoV-229E | |||
| Rabbit anti- | + | + | + |
| HCoV-229E | |||
| Feline anti- | + | + | + |
| FIPV-1 | |||
| Porcine anti- | + | − | + |
| TGEV | |||
This example illustrates representative methods of performing serological analysis of SARS-CoV.
Spot slides were prepared by applying 15 μl of the suspension of gamma-irradiated mixed infected and noninfected cells onto 12-well Teflon-coated slides. Slides were allowed to air dry before being fixed in acetone. Slides were then stored at −70° C. until used for IFA tests (Wulff and Lange, Bull. WHO 52:429–36, 1975). An ELISA antigen was prepared by detergent extraction and subsequent gamma irradiation of infected Vero E6 cells (Ksiazek et al., J. Infect. Dis. 179 (suppl. 1):S191–8, 1999). The optimal dilution (1:1000) for the use of this antigen was determined by checkerboard titration against SARS patient serum from the convalescent phase; a control antigen, similarly prepared from uninfected Vero E6 cells, was used to control for specific reactivity of tested sera. The conjugates used were goat antihuman IgG, IgA, and IgM conjugated to fluorescein isothiocyanate and horseradish peroxidase (Kirkegaard and Perry, Gaithersburg, Md.), for the IFA test and ELISA, respectively. Specificity and cross-reactivity of a variety of serum samples to the newly identified virus were evaluated by using the tests described herein. For this evaluation, serum from SARS patients in Singapore, Bangkok and Hong Kong was used, along with serum from healthy blood donors from the CDC serum bank and from persons infected with known human coronavirus (human coronaviruses OC43 and 229E) (samples provided by E. Walsh and A. Falsey, University of Rochester School of Medicine and Dentistry, Rochester, N.Y.).
Spot slides with infected cells reacted with serum from patients with probable SARS in the convalescent phase (FIG. 1B). Screening of a panel of serum from patients with suspected SARS from Hong Kong, Bangkok, Singapore as well as the United States showed a high level of specific reaction with infected cells, and conversion from negative to positive reactivity or diagnostic rises in the IFA test by a factor of four. Similarly, tests of these same serum samples with the ELISA antigen showed high specific signal in the convalescent-phase samples and conversion from negative to positive antibody reactivity or diagnostic increases in titer (Table 4).
| TABLE 4 |
| Results of serological testing with both IFA assay and ELISA in SARS |
| patients tested against the newly isolated human coronavirus. |
| Source | Serum No. | Days After Onset | ELISA Titer* | IFA Titer* |
| Hong Kong | 1.1 | 4 | <100 | <25 |
| Hong Kong | 1.2 | 13 | ≧6400 | 1600 |
| Hong Kong | 2.1 | 11 | 400 | 100 |
| Hong Kong | 2.2 | 16 | 1600 | 200 |
| Hong Kong | 3.1 | 7 | <100 | <25 |
| Hong Kong | 3.2 | 17 | ≧6400 | 800 |
| Hong Kong | 4.1 | 8 | <100 | <25 |
| Hong Kong | 4.2 | 13 | 1600 | 50 |
| Hong Kong | 5.1 | 10 | 100 | <25 |
| Hong Kong | 5.2 | 17 | ≧6400 | 1600 |
| Hong Kong | 6.1 | 12 | 1600 | 200 |
| Hong Kong | 6.2 | 20 | ≧6400 | 6400 |
| Hong Kong | 7.1 | 17 | 400 | 50 |
| Hong Kong | 7.2 | 24 | ≧6400 | 3200 |
| Hong Kong | 8.1 | 3 | <100 | <25 |
| Hong Kong | 8.2 | 15 | ≧6400 | 200 |
| Hong Kong | 9.1 | 5 | <100 | <25 |
| (Hanoi) | ||||
| Hong Kong | 9.2 | 11 | ≧6400 | 1600 |
| Bangkok | 1.1 | 2 | <100 | <25 |
| Bangkok | 1.2 | 4 | <100 | <25 |
| Bangkok | 1.3 | 7 | <100 | <25 |
| Bangkok | 1.4 | 15 | 1600 | 200 |
| United States | 1.1 | 2 | <100 | <25 |
| United States | 1.2 | 6 | 400 | 50 |
| United States | 1.3 | 13 | ≧6400 | 800 |
| Singapore | 1.1 | 2 | 100 | <25 |
| Singapore | 1.2 | 11 | ≧6400 | 800 |
| Singapore | 2.1 | 6 | 100 | <25 |
| Singapore | 2.2 | 25 | ≧6400 | 400 |
| Singapore | 3.1 | 6 | 100 | <25 |
| Singapore | 3.2 | 14 | ≧6400 | 400 |
| Singapore | 4.1 | 5 | 100 | <25 |
| Singapore | 4.2 | 16 | 1600 | 400 |
| *Reciprocal of dilution |
Information from the limited numbers of samples tested suggests that antibody is first detectable by IFA assay and ELISA between one and two weeks after the onset of symptoms in the patient. IFA testing and ELISA of a panel of 384 randomly selected serum samples (from U.S. blood donors) were negative for antibodies to the new coronavirus, with the exception of one specimen that had minimal reactivity on ELISA. A panel of paired human serum samples with diagnostic increases (by a factor of four or more) in antibody (with very high titers to the homologous viral antigen in the convalescent-phase serum) to the two known human coronaviruses, OC43 (13 pairs) and 229E (14 pairs), showed no reactivity in either acute- or convalescent-phase serum with the newly isolated coronavirus by either the IFA test or the ELISA.
This example illustrates a representative method of Northern hybrididization to detect SARS-CoV messages in Vero E6 cells.
Total RNA from infected or uninfected Vero E6 cells was isolated with Trizol reagent (Invitrogen Life Technologies, Carlsbad, Calif.) used according to the manufacturer's recommendations. Poly(A)+ RNA was isolated from total RNA by use of the Oligotex Direct mRNA Kit (Qiagen, Inc., Santa Clarita, Calif.), following the instructions for the batch protocol, followed by ethanol precipitation. RNA isolated from 1 cm2 of cells was separated by electrophoresis on a 0.9% agarose gel containing 3.7% formaldehyde, followed by partial alkaline hydrolysis (Ausubel et al. eds. Current Protocols in Molecular Biology, vol. 1, John Wiley & Sons, Inc., NY, N.Y., Ch. 4.9, 1996). RNA was transferred to a nylon membrane (Roche Molecular Biochemicals, Indianapolis, Ind.) by vacuum blotting (Bio-Rad, Hercules, Calif.) and fixed by UV cross-linking. The DNA template for probe synthesis was generated by RT-PCR amplification of SARS-CoV nt 29,083 to 29,608 (SEQ ID NO: 1), by using a reverse primer containing a T7 RNA polymerase promoter to facilitate generation of a negative-sense riboprobe. In vitro transcription of the digoxigenin-labeled riboprobe, hybridization, and detection of the bands were carried out with the digoxigenin system by using manufacturer's recommended procedures (Roche Molecular Biochemicals, Indianapolis, Ind.). Signals were visualized by chemiluminescence and detected with x-ray film.
This example illustrates the genomic organization of the SARS-CoV genome, including the location of SARS-CoV ORFs.
The genome of SARS-CoV is a 29,727-nucleotide, polyadenylated RNA, and 41% of the residues are G or C (range for published coronavirus complete genome sequences, 37% to 42%). The genomic organization is typical of coronaviruses, having the characteristic gene order [5′-replicase (rep), spike (S), envelope (E), membrane (M), nucleocapsid (N)-3′] and short untranslated regions at both termini (FIG. 7A, Table 5). The SARS-CoV rep gene, which comprises approximately two-thirds of the genome, encodes two polyproteins (encoded by ORF1a and ORF1b) that undergo co-translational proteolytic processing. There are four ORFs downstream of rep that encode the structural proteins, S, E, M, and N, which are common to all known coronaviruses. The hemagglutinin-esterase gene, which is present between ORF1b and S in group 2 and some group 3 coronaviruses (Lai and Holmes, in Fields Virology, eds. Knipe and Howley, Lippincott Williams and Wilkins, New York, 4th edition, 2001, Ch. 35), was not found in SARS-CoV.
Coronaviruses also encode a number of non-structural proteins that are located between S and E, between M and N, or downstream of N. These non-structural proteins, which vary widely among the different coronavirus species, are of unknown function and are dispensable for virus replication (Lai and Holmes, in Fields Virology, eds. Knipe and Howley, Lippincott Williams and Wilkins, New York, 4th edition, 2001, Ch. 35). The genome of SARS-CoV contains ORFs for five non-structural proteins of greater than 50 amino acids (FIG. 7B, Table 5). Two overlapping ORFs encoding proteins of 274 and 154 amino acids (termed X1 (SEQ ID NO: 5) and X2 (SEQ ID NO: 6), respectively) are located between S (SEQ ID NO: 4) and E (SEQ ID NO: 7). Three additional non-structural genes, X3 (SEQ ID NO: 9), X4 (SEQ ID NO: 10), and X5 (SEQ ID NO: 11) (encoding proteins of 63, 122, and 84 amino acids, respectively), are located between M (SEQ ID NO: 8) and N (SEQ ID NO: 12). In addition to the five ORFs encoding the non-structural proteins described above, there are also two smaller ORFs between M and N, encoding proteins of less than 50 amino acids. Searches of the GenBank database (BLAST and FastA) indicated that there is no significant sequence similarity between these non-structural proteins of SARS-CoV and any other proteins.
The coronavirus rep gene products are translated from genomic RNA, but the remaining viral proteins are translated from subgenomic mRNAs that form a 3′-coterminal nested set, each with a 5′-end derived from the genomic 5′-leader sequence. The coronavirus subgenomic mRNAs are synthesized through a discontinuous transcription process, the mechanism of which has not been unequivocally established (Lai and Holmes, in Fields Virology, eds. Knipe and Howley, Lippincott Williams and Wilkins, New York, 4th edition, 2001, Ch. 35; Sawicki and Sawicki, Adv. Exp. Med. Biol. 440:215–19, 1998). The SARS-CoV leader sequence was mapped by comparing the sequence of 5′-RACE products synthesized from the N gene mRNA with those synthesized from genomic RNA. A sequence, AAACGAAC (nucleotides 65–72 of SEQ ID NO: 1), was identified immediately upstream of the site where the N gene mRNA and genomic sequences diverged. This sequence was also present upstream of ORF1a and immediately upstream of five other ORFs (Table 5), suggesting that it functions as the conserved core of the transcriptional regulatory sequence (TRS).
In addition to the site at the 5′-terminus of the genome, the TRS conserved core sequence appears six times in the remainder of the genome. The positions of the TRS in the genome of SARS-CoV predict that subgenomic mRNAs of 8.3, 4.5, 3.4, 2.5, 2.0, and 1.7 kb, not including the poly(A) tail, should be produced (FIGS. 7A–B, Table 5). At least five subgenomic mRNAs were detected by Northern hybridization of RNA from SARS-CoV-infected cells, using a probe derived from the 3′-untranslated region (FIG. 7C). The calculated sizes of the five predominant bands correspond to the sizes of five of the predicted subgenomic mRNAs of SARS-CoV; the possibility that other, low-abundance mRNAs are present cannot be excluded. By analogy with other coronaviruses (Lai and Holmes, in Fields Virology, eds. Knipe and Howley, Lippincott Williams and Wilkins, New York, 4th edition, 2001, Ch. 35), the 8.3-kb and 1.7-kb subgenomic mRNAs are monocistronic, directing translation of S and N, respectively, whereas multiple proteins are translated from the 4.5-kb (X1, X2, and E), 3.4-kb (M and X3), and 2.5-kb (X4 and X5) mRNAs. A consensus TRS is not found directly upstream of the ORF encoding the predicted E protein, and a monocistronic mRNA that would be predicted to code for E could not be clearly identified by Northern blot analysis. It is possible that the 3.6-kb band contains more than one mRNA species or that the monocistronic mRNA for E is a low-abundance message.
| TABLE 5 |
| Locations of SARS-CoV ORFs and sizes of proteins and mRNAs |
| Genome Location | Predicted Size |
| ORF | TRSa | ORF Start | ORF End | Protein (aa) | mRNA (nt)b |
| 1a | 72 | 265 | 13,398 | 4,378 | 29,727 |
| 1b | 13,398 | 21,482 | 2,695 | ||
| S | 21,491 | 21,492 | 25,256 | 1,255 | 8,308c |
| X1 | 25,265 | 25,268 | 26,089 | 274 | 4,534c |
| X2 | 25,689 | 26,150 | 154 | ||
| E | 26,117 | 26,344 | 76 | ||
| M | 26,353 | 26,398 | 27,060 | 221 | 3,446c |
| X3 | 27,074 | 27,262 | 63 | ||
| X4 | 27,272 | 27,273 | 27,638 | 122 | 2,527c |
| X5 | 27,778 | 27,864 | 28,115 | 84 | 2,021d |
| N | 28,111 | 28,120 | 29,385 | 422 | 1,688c |
| aThe location is the 3′-most nucleotide in the consensus TRS, AAACGAAC. | |||||
| bNot including poly(A). Predicted size is based on the position of the conserved TRS. | |||||
| cCorresponding mRNA detected by Northern blot analysis (FIG. 7C) | |||||
| dNo mRNA corresponding to utilization of this consensus TRS was detected by Northern blot analysis (FIG. 7C) |
This example demonstrates the use of SARS-CoV-specific primers and probes in a real-time RT-PCR assay to detect SARS-CoV in patient specimens.
A variant of the real-time format, based on TaqMan probe hydrolysis technology (Applied Biosystems, Foster City, Calif.), was used to analyze a total of 340 clinical specimens collected from 246 persons with confirmed or suspected SARS-CoV infection. Specimens included oro- and nasopharyngeal swabs (dry and in viral transport media), sputa, nasal aspirates and washes, BAL, and lung tissue specimens collected at autopsy.
Nucleic Acid Extraction
SARS-CoV nucleic acids were recovered from clinical specimens using the automated NucliSens extraction system (bioMérieux, Durham, N.C.). Following manufacturer's instructions, specimens received in NucliSens lysis buffer were incubated at 37° C. for 30 min with intermittent mixing, and 50 μL of silica suspension, provided in the extraction kit, was added and mixed. The contents of the tube were then transferred to a nucleic acid extraction cartridge and processed on an extractor workstation. Approximately 40–50 μL of total nucleic acid eluate was recovered into nuclease-free vials and either tested immediately or stored at −70° C.
Primers and Probes
Multiple primer and probe sets were designed from the SARS-CoV polymerase 1b (nucleic acid 13,398 to 21,482 of SEQ ID NO: 1) and nucleocapsid gene (nucleic acid 28,120 to 29,385 of SEQ ID NO: 1) sequences by using Primer Express software version 1.5 or 2.0.0 (Applied Biosystems, Foster City, Calif.) with the following default settings: primer melting temperature (TM) set at 60° C.; probe TM set at 10° C. greater than the primers at approximately 70° C.; and no guanidine residues permitted at the 5′ probe termini. All primers and probes were synthesized by standard phosphoramidite chemistry techniques. TaqMan probes were labeled at the 5′-end with the reporter 6-FAM and at the 3′-end with the quencher Blackhole Quencher 1 (Biosearch Technologies, Inc., Novato, Calif.). Optimal primer and probe concentrations were determined by cross-titration of serial twofold dilutions of each primer against a constant amount of purified SARS-CoV RNA. Primer and probe concentrations that gave the highest amplification efficiencies were selected for further study (Table 6).
| TABLE 6 |
| Primers and probes used for real-time RT-PCR assaysa |
| Genomic | |||
| Assay ID | Primer/probe | Sequence | Region |
| Primary diagnostic assay |
| SARS1 | F | CATGTGTGGCGGCTCACTATAT (SEQ ID NO: 16) | RNA Pol |
| R | GACACTATTAGCATAAGCAGTTGTAGCA (SEQ ID NO: 17) | ||
| P | TTAAACCAGGTGGAACATCATCCGGTG (SEQ ID NO: 18) | ||
| SARS2 | F | GGAGCCTTGAATACACCCAAAG (SEQ ID NO: 19) | Nucleocapsid |
| R | GCACGGTGGCAGCATTG (SEQ ID NO: 20) | ||
| P | CCACATTGGCACCCGCAATCC (SEQ ID NO: 21) | ||
| SARS3 | F | CAAACATTGGCCGCAAATT (SEQ ID NO: 22) | Nucleocapsid |
| R | CAATGCGTGACATTCCAAAGA (SEQ ID NO: 23) | ||
| P | CACAATTTGCTCCAAGTGCCTCTGCA (SEQ ID NO: 24) |
| To confirm positive results |
| N3 | F | GAAGTACCATCTGGGGCTGAG (SEQ ID NO: 25) | Nucleocapsid |
| R | CCGAAGAGCTACCCGACG (SEQ ID NO: 26) | ||
| P | CTCTTTCATTTTGCCGTCACCACCAC (SEQ ID NO: 27) | ||
| 3′-NTR | F | AGCTCTCCCTAGCATTATTCACTG (SEQ ID NO: 28) | 3′-NTR |
| R | CACCACATTTTCATCGAGGC (SEQ ID NO: 29) | ||
| P | TACCCTCGATCGTACTCCGCGT (SEQ ID NO: 30) | ||
| M | F | TGTAGGCACTGATTCAGGTTTTG (SEQ ID NO: 31) | M protein |
| R | CGGCGTGGTCTGTATTTAATTTA (SEQ ID NO: 32) | ||
| P | CTGCATACAACCGCTACCGTATTGGAA (SEQ ID NO: 33) | ||
| aRT-PCR, reverse transcription-polymerase chain reaction; F, forward primer; R, reverse primer; P, probe; NTR, nontranslated region. |
The real-time RT-PCR assay was performed by using the Real-Time One-Step RT-PCR Master Mix (Applied Biosystems, Foster City, Calif.). Each 25-μL reaction mixture contained 12.5 μL of 2× Master Mix, 0.625 μL of the 40× MultiScribe and RNase Inhibitor mix, 0.25 μL of 10 μM probe, 0.25 μL each of 50 μM forward and reverse primers, 6.125 μL of nuclease-free water, and 5 μL of nucleic acid extract. Amplification was carried out in 96-well plates on an iCycler iQ Real-Time Detection System (Bio-Rad, Hercules, Calif.). Thermocycling conditions consisted of 30 minutes at 48° C. for reverse transcription, 10 minutes at 95° C. for activation of the AmpliTaq Gold DNA polymerase, and 45 cycles of 15 seconds at 95° C. and 1 minute at 60° C. Each run included one SARS-CoV genomic template control and at least two no-template controls for the extraction (to check for contamination during sample processing) and one no-template control for the PCR-amplification step. As a control for PCR inhibitors, and to monitor nucleic acid extraction efficiency, each sample was tested by real-time RT-PCR for the presence of the human ribonuclease (RNase) P gene (GenBank Accession No. NM—006413) by using the following primers and probe: forward primer 5′-AGATTTGGACCTGCGAGCG-3′ (SEQ ID NO: 36); reverse primer 5′-GAGCGGCTGTCTCCACAAGT-3′ (SEQ ID NO: 37); probe 5′-TTCTGACC TGAAGGCTCTGCGCG-3′ (SEQ ID NO: 38). The assay reaction was performed identically to that described above except that primer concentrations used were 30 μM each. Fluorescence measurements were taken and the threshold cycle (CT) value for each sample was calculated by determining the point at which fluorescence exceeded a threshold limit set at the mean plus 10 standard deviations above the baseline. A test result was considered positive if two or more of the SARS genomic targets showed positive results (CT≦45 cycles) and all positive and negative control reactions gave expected values.
While this disclosure has been described with an emphasis upon preferred embodiments, it will be obvious to those of ordinary skill in the art that variations and equivalents of the preferred embodiments may be used and it is intended that the disclosure may be practiced otherwise than as specifically described herein. Accordingly, this disclosure includes all modifications encompassed within the spirit and scope of the disclosure as defined by the claims below.
1. An isolated nucleic acid molecule consisting of the nucleotide sequence as set forth in SEQ ID NO: 1.