Patent application title:

Method for production of C30-aldehyde carotenoids

Publication number:

-

Publication date:
Application number:

10/860,291

Filed date:

2004-06-03

✅ Patent granted

Patent number:

US 7,098,000 B2

Grant date:

2006-08-29

PCT filing:

-

PCT publication:

-

Examiner:

Rebecca E. Prouty | Kagnew Gebreyesus

Adjusted expiration:

2024-10-02

Abstract:

The present invention provides methods to engineer microorganisms for the production of C30-aldehyde carotenoids. Specifically, various combinations of crtM, sqs, crtN and crtN2 genes from Staphylococcus aureus and Methylomonas sp. 16a can be co-expressed in transformant hosts, leading to the production of diaponeurosporene monoaldehyde, diapocarotene monoaldehyde, and/or diapocarotene dialdehyde. In a preferred embodiment, the genetically engineered pathway is introduced into a strain of Escherichia coli that has been engineered for the expression of carotenoids, and the C30-carotenoid product is diapocarotene dialdehyde.

Inventors:

Assignee:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

A01H1/00 IPC

Processes for modifying genotypes ; Plants characterised by associated natural traits

A01H1/00 IPC

Processes

C12Q1/68 IPC

Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids

C07H21/04 IPC

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical

Description

This application claims the benefit of U.S. Provisional Application No. 60/475,743 filed Jun. 4, 2003.

FIELD OF THE INVENTION

This invention is in the field of microbiology. More specifically, this invention describes the production of C30-aldehyde carotenoids in genetically transformed microorganisms.

BACKGROUND OF THE INVENTION

Carotenoids represent one of the most widely distributed and structurally diverse classes of natural pigments, producing pigment colors of light yellow to orange to deep red. Eye-catching examples of carotenogenic tissues include carrots, tomatoes, red peppers, and the petals of daffodils and marigolds. All photosynthetic organisms, as well as some bacteria and fungi, synthesize carotenoids. These pigments have important functions in photosynthesis, nutrition, and protection against photooxidative damage. For example, animals do not have the ability to synthesize carotenoids but must instead obtain these nutritionally important compounds through their dietary sources.

Industrially, only a few carotenoids are used for food colors, animal feeds, pharmaceuticals, and cosmetics, despite the existence of more than 600 different carotenoids identified in nature. This is largely due to difficulties in production. Presently, most of the carotenoids used for industrial purposes are produced by chemical synthesis; however, these compounds are very difficult to make chemically (Nelis and Leenheer, Appl. Bacteriol. 70:181–191 (1991)). Natural carotenoids can either be obtained by extraction of plant material or by microbial synthesis, but only a few plants are widely used for commercial carotenoid production and the productivity of carotenoid synthesis in these plants is relatively low. As a result, carotenoids produced from these plants are very expensive.

Structurally, the most common carotenoids are 40-carbon (C40) terpenoids; however, carotenoids with only 30 carbon atoms (C30; diapocarotenoids) are detected in some species. Biosynthesis of carotenoids is derived from the isoprene biosynthetic pathway and its five-carbon universal isoprene building block, isopentenyl pyrophosphate (IPP). This biosynthetic pathway can be divided into two portions: 1) the upper isoprene pathway, which leads to the formation of farnesyl pyrophosphate (FPP); and 2) the lower carotenoid biosynthetic pathway, comprising various crt genes which convert FPP into long C30 and C40 carotenogenic compounds characterized by a long central chain of conjugated double bonds. Both portions of this pathway are shown in FIG. 1.

The degree of the carbon backbone's unsaturation, conjugation, isomerization and functionalization determines the specific carotenoids' unique absorption characteristics and colors. This variation in properties is the result of a suite of crt genes, such as the crtE, crtX, crtY, crtI, crtB, crtZ, crtW, crtO, crtR, crtM, crtN and cdtN2 genes shown in FIG. 1. Additionally, various other crt genes are known that enable the intramolecular conversion of linear C30 and C40 compounds to produce numerous other functionalized carotenoid compounds by: (i) hydrogenation, (ii) dehydrogenation, (iii) cyclization, (iv) oxidation, (v) esterification/glycosylation, or any combination of these processes.

The genetics of C40 carotenoid pigment biosynthesis has been extremely well studied in the Gram-negative pigmented bacteria of the genera Pantoea, formerly known as Erwinia. In both E. herbicola EHO-10 (ATCC 39368) and E. uredovora 20D3 (ATCC 19321), the crt genes are clustered in two genetic units, cdt Z and crt EXYIB (U.S. Pat. No. 5,656,472; U.S. Pat. No. 5,545,816; U.S. Pat. No. 5,530,189; U.S. Pat. No. 5,530,188; and U.S. Pat. No. 5,429,939) These genes have subsequently been sequenced and identified in a suite of other species of bacterial, fungal, plant and animal origin. Several reviews discuss the genetics of carotenoid pigment biosynthesis, such as those of G. Armstrong (J. Bact. 176: 4795–4802 (1994); Annu. Rev. Microbiol. 51:629–659 (1997)).

The abundant knowledge concerning the genetics of C40 biosynthesis has permitted production of a number of natural C40 carotenoids from genetically engineered microbial sources. Examples include:

    • 1.) Lycopene (Farmer, W. R. and Liao, J. C., Biotechnol. Prog. 17: 57–61(2001); Wang, C. et al., Biotechnol Prog. 16: 922–926 (2000); Misawa, N. and Shimada, H., J. Biotechnol. 59:169–181 (1998); Shimada, H. et al. Appl. Environ. Microbiol. 64:2676–2680 (1998));
    • 2.) β-carotene (Albrecht, M. et al., Biotechnol. Lett. 21: 791–795 (1999); Miura, Y. et al., Appl. Environ. Microbiol. 64:1226–1229 (1998); U.S. Pat. No. 5,691,190);
    • 3.) Zeaxanthin (Albrecht, M. et al., supra); Miura, Y. et al., supra); and
    • 4.) Astaxanthin (U.S. Pat Nos. 5,466,599; 6,015,684; 5,182,208; and U.S. Pat. No. 5,972,642).
      Further, genes encoding various elements of the lower C40 carotenoid biosynthetic pathway have been cloned and expressed in various microbes (e.g., U.S. Pat. Nos. 5,656,472; 5,545,816; 5,530,189; 5,530,188; 5,429,939; and U.S. Pat. No. 6,124,113).

Despite abundant knowledge and understanding of the C40 carotenoid pathway, C30 pigment biosynthesis is both less well-understood and less prevalent in nature. Early studies by Kleinig, H. et al. (Z. Naturforsch 34c: 181–185 (1979); Z. Naturforsch 37c: 758–760 (1982)) examined the structure and biosynthesis of C30 carotenoic acid glucosyl esters produced in Pseudomonas rhodos (subsequently renamed Methylobacterium rhodinum) by mutational analysis. To date, presence of diapocarotenoids has been discovered in Streptococcus faecium (Taylor, R. F. and Davies, B. H., J. Biochem. 139:751–760 (1974)), M. rhodinum (Kleinig, H. et al., supra; Taylor, R. F. Microbiol. Rev. 48:181–198 (1984)), genera of the photosynthetic heliobacteria (Takaichi, S. et al., Arch. Microbiol. 168: 277–281 (1997)), and Staphylococcus aureus (Marshall, J. H. and Wilmoth, G. J., J. Bacteriol. 147:900–913 (1981)). All appear to have a diapophytoene precursor, from which all subsequent C30 compounds are produced.

The relevant genes responsible for C30 carotenoid pigment biosynthesis are known to include crtM and crtN in Staphylococcus aureus. The diapophytoene desaturase CrtN can function to some extent in the C40 pathway, and the phytoene desaturase CrtI of the C40 carotenoids can also function in the C30 pathway (Raisig and Sandmann, Biochim. Biophys. Acta 1533:164–170 (2001)). Microbial genomic sequencing effort revealed several ORFs in other organisms with significant homology to crtM or crtN of S. aureus (Xiong et al., Proc. Natl. Acad. Sci. USA 95:14851–14856 (1998);Takami et al., Nucleic Acids Res, 30:3927–3935 (2002)). However, their roles in C30 carotenoid synthesis have not been determined. Investigators J. H. Marshall and G. J. Wilmonth (J. Bacteriol. 147:914–919 (1981)) suggested that mixed-function oxidases are responsible for the introduction of oxygen functions to produce the aldehyde and carboxylic acid of 4,4-diaponeurosporene. However, none of the genes responsible for the addition of functionality to the terminal methyl group of the linear C30 carotenoid molecule have been identified despite characterization of the resulting carotenoids. Methods for industrial production of C30 carotenoids are lacking. It would be desirable to develop methods to produce C30 carotenoids (and specifically, C30-aldehyde carotenoids such as diaponeurosporene monoaldehyde, diapocarotene monoaldehyde, and diapocarotene dialdehyde (shown in FIG. 2) to increase the number of carotenoids industrially available for use in food colors, animal feeds, pharmaceuticals, and cosmetics. Additionally, the presence of aldehyde group(s) within the C30-aldehyde carotenoids also provides active “handles” useful for cross-linking or chemical modification of the carotenoids to facilitate desired applications.

The microbial production of C30-aldehyde carotenoids to a significant level has not been previously reported and is especially problematic due to the toxicity of aldehydes to bacterial systems (see, for example: Ingram et al., Biotechnol. Bioeng. 65:24–33 (1999); Marnett et al., Proc. Natl. Acad. Sci. USA 94:8652–8657 (1997); Mee and O'Donovan, Mutagenesis 8:577–581 (1993); Kawazoe et al., Mutat. Res. 156:153–161(1985)). In light of these needs, the problem to be solved is to develop a system for production of C30-aldehyde carotenoids.

Applicants have solved the stated problem by engineering microorganisms for the production of C30-aldehyde carotenoids. Specifically, Applicants have identified two unique open reading frames encoding the enzymes CrtN and CrtN2 from a Methylomonas sp. and co-expressed these enzymes with the CrtM and CrtN C30-carotenoid biosynthesis enzymes from Staphylococcus aureus in Escherichia coli. This leads to the production of diapocarotene dialdehyde. Subsequent metabolic engineering of the host demonstrated that synthesis of this C30-carotenoid could be modified such that it would be produced in levels suitable for industrial purposes.

SUMMARY OF THE INVENTION

The invention relates to methods of producing C30-aldehyde carotenoid compounds via the engineering of a host cell expressing genes encoding a combination of the enzymes diapophytoene synthase, diapophytoene desaturase, and an oxidase for introducing an omega-aldehyde functional group on the omega carbon of a conjugated polyene carbon skeleton.

Accordingly, the invention provides a method for the production of C30-aldehyde carotenoid compounds comprising:

    • a) providing a transformed host cell comprising:
      • 1) suitable levels of farnesyl pyrophosphate;
      • 2) at least one isolated nucleic acid molecule encoding an enzyme having diapophytoene synthase activity under the control of suitable regulatory sequences;
      • 3) at least one isolated nucleic acid molecule encoding an enzyme having diapophytoene desaturase activity under the control of suitable regulatory sequences; and
      • 4) at least one isolated nucleic acid molecule encoding an enzyme having the ability to introduce an omega-aldehyde functional group on the omega carbon of a conjugated polyene carbon skeleton under the control of suitable regulatory sequences;
    • b) contacting the host cell of step (a) under suitable growth conditions with an effective amount of fermentable carbon substrate whereby a C30-aldehyde carotenoid compound is produced.

Preferred diapophytoene synthases for use in the present invention are those having the amino acid sequences as set forth in SEQ ID NO:2 and SEQ ID NO:10. Preferred diapophytoene desaturases for use in the present invention are those having the amino acid sequences as set forth in SEQ ID NO:4 and SEQ ID NO:12. Preferred aldehyde-introducing oxidases for use in the present invention are those having the amino acid sequences as set forth in SEQ ID NO:8 and SEQ ID NO:14.

The invention additionally encompasses methods for the production of C30-aldehyde carotenoid compound wherein various elements of the Upper and lower isoprenoid biosynthetic pathway are manipulated to optimize production.

BRIEF DESCRIPTION OF THE DRAWINGS, SEQUENCE DESCRIPTIONS, AND THE BIOLOGICAL DEPOSITS

FIG. 1 illustrates the upper isoprene pathway and lower carotenoid pathway.

FIG. 2 shows the chemical structures of the C30-aldehyde carotenoids: diaponeurosporene monoaldehyde, diapocarotene monoaldehyde, and diapocarotene dialdehyde.

FIGS. 3A and 3B schematically illustrates the organization of the crtN gene clusters in Methylomonas sp. 16a and Staphylococcus aureus NCTC 8325 (ATCC 35556).

FIG. 4A shows the proposed pathway for C30 carotenoid biosynthesis in Methylomonas sp. 16a, while FIG. 4B shows the proposed pathway for C30 carotenoid biosynthesis in Staphylococcus aureus.

FIG. 5 shows the strategy for chromosomally engineering promoters in E. coli, using the two linear PCR fragment method for triple homologous recombination.

FIG. 6 shows the engineered pathway for C30 dialdehyde carotenoid synthesis using a combination of genes derived from both Staphylococcus and Methylomonas.

The invention can be more fully understood from the following detailed description and the accompanying sequence descriptions, which form a part of this application.

The following sequences comply with 37 C.F.R. 1.821–1.825 (“Requirements for Patent Applications Containing Nucleotide Sequences and/or Amino Acid Sequence Disclosures—the Sequence Rules”) and are consistent with World Intellectual Property Organization (WIPO) Standard ST 0.25 (1998) and the sequence listing requirements of the EPO and PCT (Rules 5.2 and 49.5(a-bis), and Section 208 and Annex C of the Administrative Instructions). The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R. §1.822.

SEQ ID NOs: 1–14 are full-length genes or proteins as identified in the following table.

TABLE 1
Summary of Gene and Protein SEQ ID Numbers
SEQ ID NO: SEQ ID NO:
Description Organism Nucleic acid Peptide
Sqs Methylomonas sp. 16a 1 2
CrtN Methylomonas sp. 16a 3 4
Ald Methylomonas sp. 16a 5 6
CrtN2 Methylomonas sp. 16a 7 8
CrtM Staphylococcus aureus 9 10
CrtN Staphylococcus aureus 11 12
CrtN2 Staphylococcus aureus 13 14

SEQ ID NOs: 15 and 16 are the nucleotide sequences of primers crtM_F/Staphyl and crtM_R/Staphyl used for amplification of crtM from S. aureus.

SEQ ID NOs: 17 and 18 are the nucleotide sequences of primers crtN_FL and crtN_RL used for amplification of the crtN-ald-crtN2 gene cluster from Methylomonas 16a.

SEQ ID NOs: 19 and 20 are the nucleotide sequences of primers Tet-1 FP and crtN_R used for screening transposon insertions in pDCQ155.

SEQ ID NOs: 21 and 22 are the nucleotide sequences of primers crtM_F/NCTC and crtN_R/NCTC used for amplification of the crtM-crtN gene cluster of S. aureus.

SEQ ID NOs: 23 and 24 are the nucleotide sequences of primers crtN—5′/16a and crtN—3′/16a used for amplification of the Methylomonas 16a crtN gene.

SEQ ID NOs: 25 and 26 are the nucleotide sequences of primers crtN2_F3/16a and crtN2_R/16a used for amplification of the Methylomonas 16a crtN2 gene.

SEQ ID NOs: 27 and 28 are the nucleotide sequences of primers crtN—5′—2/16a and crtN—3′—2/16a used for amplification of the Methylomonas 16a crtN gene with a RBS.

SEQ ID NOs: 29 and 30 are the nucleotide sequences encode primers crtN2—5′—2/16a and crtN2—3′—2/16a for amplification of the Methylomonas 16a crtN2 gene with a RBS.

SEQ ID NOs: 31–38 are the nucleotide sequences of the primers used for insertion of the T5 promoter upstream from E. coli isoprenoid genes via the two-fragment-PCR method for triple homologous recombination.

SEQ ID NOs: 39 is the nucleotide sequence of plasmid pKD46.

Applicants made the following biological deposit under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure:

Depositor International
Identification Depository Date of
Reference Designation Deposit
Methylomonas 16a ATCC PTA 2402 Aug. 22, 2000
Plasmid pCP20 ATCC PTA 4455 Jun. 13, 2002

As used herein, “ATCC” refers to the American Type Culture Collection International Depository Authority located at ATCC, 10801 University Blvd., Manassas, Va. 20110-2209, U.S.A. The “International Depository Designation” is the accession number to the culture on deposit with ATCC.

The listed deposit will be maintained in the indicated international depository for at least thirty (30) years and will be made available to the public upon the grant of a patent disclosing it. The availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by government action.

DETAILED DESCRIPTION OF THE INVENTION

The present method is useful for the creation of recombinant organisms that have the ability to produce C30-aldehyde carotenoids. Microbial production of carotenoid compounds are favored, as these compounds are very difficult to make chemically (Nelis and Leenheer, Appl. Bacteriol. 70:181–191 (1991) and many of these carotenoids have potent antioxidant properties and are used as dietary supplements.

Nucleic acid fragments encoding the CrtN and CrtN2 enzymes have been isolated from Methylomonas 16a. Additionally, a gene homologous to crtN2 has been identified and characterized from Staphylococcus aureus. The instant genes, as well as a previously characterized crtM and crtN from S. aureus, have been expressed in Escherichia coli for high-level production of C30-aldehyde carotenoids, in particular a C30-dialdehyde identified as diapocarotene dialdehyde.

Definitions

In this disclosure, a number of terms and abbreviations are used. The following definitions are provided.

“Open reading frame” is abbreviated ORF.

“Polymerase chain reaction” is abbreviated PCR.

“Farnesyl pyrophosphate” is abbreviated FPP.

“Ribosomal binding site” is abbreviated RBS.

The term “isoprenoid compound” refers to compounds formally derived from isoprene (2-methylbuta-1,3-diene; CH2═C(CH3)CH═CH2), the skeleton of which can generally be discerned in repeated occurrence in the molecule. These compounds are produced biosynthetically via the isoprenoid pathway beginning with isopentenyl pyrophosphate (IPP) and formed by the head-to-tail condensation of isoprene units, leading to molecules which may be—for example—of 5, 10, 15, 20, 30, or 40 carbons in length.

The term “Dxs” refers to the enzyme D-1-deoxyxylulose 5-phosphate encoded by the dxs gene which catalyzes the condensation of pyruvate and D-glyceraldehyde 3-phosphate to D-1-deoxyxylulose 5-phosphate (DOXP).

The terms “Dxr” or “IspC” refer to the enzyme DOXP reductoisomerase encoded by the dxr or ispC gene that catalyzes the simultaneous reduction and isomerization of DOXP to 2-C-methyl-D-erythritol-4-phosphate. The names of the gene, dxr or ispC, are used interchangeably in this application. The names of gene product, Dxr or IspC are used interchangeably in this application.

The term “YgbP” or “IspD” and refers to the enzyme encoded by the ygbB or ispD gene that catalyzes the CTP-dependent cytidylation of 2-C-methyl-D-erythritol-4-phosphate to 4-diphosphocytidyl-2C-methyl-D-erythritol. The names of the gene, ygbP or ispD, are used interchangeably in this application. The names of gene product, YgbP or IspD are used interchangeably in this application.

The term “YchB” or “IspE” and refers to the enzyme encoded by the ychB or ispE gene that catalyzes the ATP-dependent phosphorylation of 4-diphosphocytidyl-2C-methyl-D-erythritol to 4-diphosphocytidyl-2C-methyl-D-erythritol-2-phosphate. The names of the gene, ychB or ispE, are used interchangeably in this application. The names of gene product, YchB or IspE are used interchangeably in this application.

The term “YgbB” or “IspF” refers to the enzyme encoded by the ybgB or ispF gene that catalyzes the cyclization with loss of CMP of 4-diphosphocytidyl-2C-methyl-D-erythritol to 4-diphosphocytidyl-2C-methyl-D-erythritol-2-phosphate to 2C-methyl-D-erythritol-2,4-cyclodiphosphate. The names of the gene, ygbB or ispF, are used interchangeably in this application. The names of gene product, YgbB or IspF are used interchangeably in this application.

The term “GcpE” or “IspG” refers to the enzyme encoded by the gcpE or ispG gene that is involved in conversion of 2C-methyl-D-erythritol-2,4-cyclodiphosphate to 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate. The names of the gene, gcpE or ispG, are used interchangeably in this application. The names of gene product, GcpE or IspG are used interchangeably in this application.

The term “LytB” or “IspH” refers to the enzyme encoded by the IytB or ispH gene and is involved in conversion of 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate to isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). The names of the gene, IytB or ispH, are used interchangeably in this application. The names of gene product, LytB or IspH are used interchangeably in this application.

The term “Idi” refers to the enzyme isopentenyl diphosphate isomerase encoded by the idi gene that converts isopentenyl diphosphate to dimethylallyl diphosphate.

The term “IspA” refers to the enzyme farnesyl pyrophosphate (FPP) synthase encoded by the ispA gene.

The term “IspB” refers to the enzyme octaprenyl diphosphate synthase, which supplies the precursor of the side chain of the isoprenoid quinones encoded by the ispB gene.

The term “PyrG” refers to the enzyme CTP synthase, encoded by the pyrG gene.

The term “crt gene cluster from Methylomonas 16a” refers to an open reading frame comprising crtN, ald, and crtN2, that is active in the native carotenoid biosynthetic pathway of Methylomonas sp. 16a.

The term “CrtN” refers to the enzyme diapophytoene desaturase (encoded by the crtN gene) responsible for desaturating diapophytoene. “CrtN” is optionally referred to as “CrtN1”. The “crtN” gene is optionally referred to as the “crtNI” gene.

The term “pKD46” refers to the plasmid (Datsenko and Wanner, supra) having GenBank® Accession number AY048746. Plasmid pKD46 expresses the components of the λ-Red Recombinase system.

The term “carotenoid biosynthetic pathway” refers to those genes comprising members of the upper isoprenoid pathway and/or lower carotenoid pathway, as defined below.

The terms “upper isoprenoid pathway” and “upper pathway” will be use interchangeably and will refer to the enzymes involved in converting pyruvate and glyceraldehyde-3-phosphate to farnesyl pyrophosphate (FPP). These enzymes include, but are not limited to: the “dxs” gene (encoding 1-deoxyxylulose-5-phosphate synthase); the “dxr” gene (encoding 1-deoxyxylulose-5-phosphate reductoisomerase); the “ispD” gene (encoding a 2C-methyl-D-erythritol cytidyltransferase enzyme; also known as ygbP); the “ispE” gene (encoding 4-diphosphocytidyl-2-C-methylerythritol kinase; also known as ychB); the “ispF” gene (encoding a 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase; also known as ygbB); the “pyrG” gene (encoding a CTP synthase); the “IytB” gene involved in the formation of dimethylallyl diphosphate; the “gcpE” gene involved in the synthesis of 2-C-methyl-D-erythritol 4-phosphate; the “idi” gene (responsible for the intramolecular conversion of IPP to dimethylallyl pyrophosphate); and the “ispA” gene (encoding geranyltransferase or farnesyl diphosphate synthase) in the isoprenoid pathway (FIG. 1).

The terms “lower carotenoid biosynthetic pathway” and “lower pathway” will be used interchangeably and refer to those enzymes which convert FPP to a suite of carotenoids. These include those genes and gene products that are involved in the immediate synthesis of either diapophytoene (whose synthesis represents the first step unique to biosynthesis of C30 carotenoids) or phytoene (whose synthesis represents the first step unique to biosynthesis of C40 carotenoids). All subsequent reactions leading to the production of various C30–C40 carotenoids are included within the lower carotenoid biosynthetic pathway (FIG. 1). These genes and gene products comprise the carotenoid biosynthesis genes including, but not limited to:sqs, aid, crtM, crtN, crtN2, crtE, crtX, crtY, crtI, crtB, crtZ, crtR, crtO, and crtW. Finally, the term “carotenoid biosynthetic enzyme” is an inclusive term referring to any and all of the enzymes in the present pathway including, but not limited to: Ald, Sqs, CrtM, CrtN, CrtN2, CrtE, CrtX, CrtY, CrtI, CrtB, CrtZ, CrtR, CrtW, and CrtO.

For the present application, the term “carotenoid compound” or “carotenoid” is defined as a class of hydrocarbons having a conjugated polyene carbon skeleton formally derived from isoprene, which is composed of triterpenes (C30 diapocarotenoids) and tetraterpenes (C40 carotenoids) and their oxygenated derivatives. These molecules typically have strong light absorbing properties and may range in length in excess of C200. Other “carotenoid compounds” are known which are C35, C50, C60, C70 and C80 in length, for example. Carotenoids can be produced either synthetically or naturally.

“Tetraterpenes” or “C40 carotenoids” consist of eight isoprenoid units joined in such a manner that the arrangement of isoprenoid units is reversed at the center of the molecule so that the two central methyl groups are in a 1,6-positional relationship and the remaining nonterminal methyl groups are in a 1,5-positional relationship. All C40 carotenoids may be formally derived from the acyclic C40H56 structure (Formula I below), having a long central chain of conjugated double bonds, by (i) hydrogenation, (ii) dehydrogenation, (iii) cyclization, (iv) oxidation, (v) esterification/glycosylation, or any combination of these processes. This class also includes certain compounds that arise from rearrangements of the carbon skeleton (Formula I), or by the (formal) removal of part of this structure.


For convenience, carotenoid formulae are often written in a shorthand form as shown below in Formula IA:


where the broken lines indicate formal division into isoprenoid units.

“Triterpenes” or “C30 diapocarotenoids” consist of six isoprenoid units joined in such a manner that the arrangement of isoprenoid units is reversed at the center of the molecule so that the two central methyl groups are in a 1,6-positional relationship and the remaining nonterminal methyl groups are in a 1,5-positional relationship. All C30 carotenoids may be formally derived from the acyclic C30H42 structure (Formula II below, hereinafter referred to as “diapophytoene” or “dehydrosqualene”), having a long central chain of conjugated double bonds, by (i) hydrogenation (ii) dehydrogenation, (iii) cyclization, (iv) oxidation, (v) esterification/glycosylation, or any combination of these processes.

The terms “diapolycopene” and “diapocarotene” are used interchangeably to refer to the fully unsaturated C30 carotenoid backbone, which may be derived from diapophytoene via dehydrogenation.

The terms “C30 aldehyde” or “C30-aldehyde carotenoid” will refer to any carotenoids which contain at least one omega-aldehyde functional group (i,.e., RC(═O)H) on the omega (i.e., end) carbon of the conjugated C30 carotenoid backbone. Examples of these types of carotenoids are diaponeurosporene monoaldehyde (or diaponeurosporene-al), diapocarotene monoaldehyde, and diapocarotene dialdehyde (or diapocarotene-dial), as shown in FIG. 2. Additionally, functional derivatives thereof are also included within the present definition of C30-aldehyde carotenoids (e.g., β, ψ-diapocarotene-aldehyde).

The term “functionalized” or “functionalization” refers to the (i) hydrogenation, (ii) dehydrogenation, (iii) cyclization, (iv) oxidation, or (v) esterification/glycosylation of any portion of the carotenoid backbone. This backbone is defined as the long central chain of conjugated double bonds. Functionalization may also occur by any combination of the above processes. The specific functionalization discussed in the present application refers to creation of aldehydes (compounds containing RC(═O)H, in which a carbonyl group is bonded to one hydrogen atom and to one R group).

The following table defines a suite of genes used within the present application, as well as the names of the enzymes that each gene encodes and a description of the enzyme's biochemical functionality.

TABLE 2
Genes and Enzymes Used in the Present Application
Gene Enzyme
Name Enzyme Name Functionality
sqs Sqs or Squalene Converts FPP to squalene;
synthase has partial diapophytoene
synthase activity
crtM CrtM or Converts FPP to
Diapophytoene diapophytoene
synthase
crtN CrtN, Diapophytoene Introduces additional double
dehydrogenase, or bonds to the C30 carotenoid
Diapophytoene precursor diapophytoene
desaturase
crtN2 CrtN2 or Aldehyde- Introduces an omega-aldehyde
introducing enzyme functional group on the omega
carbon(s) of a conjugated
polyene carbon skeleton
ald Ald or Aldehyde Oxidizes an omega-aldehyde
dehydrogenase group to an omega-carboxyl
functional group on the omega
carbon(s) of a conjugated
polyene carbon skeleton

The term “Methylomonas 16a” or “Methylomonas sp. 16a” is used interchangeably and refers to the Methylomonas sp. 16a strain ATCC PTA-2402.

The term “Staphylococcus aureus” is used interchangeably with “S. aureus” or “Staphylococcus” for the purposes of this application and is used to describe Staphylococcus aureus strain ATCC 35556.

The term “E. coli” refers to Escherichia coli strain K-12 derivatives, such as MG1655 (ATCC 47076) and MC1061 (ATCC 53338).

The term “triple homologous recombination” or “the two-fragment PCR method” each refers to a genetic recombination between two linear DNA fragments and the target chromosome via their homologous sequences, resulting in chromosomal integration of two linear DNA fragments into the target of chromosome. This method can optionally be used to stack multiple genetic traits into one E. coli host using bacteriophage P1 transduction in combination with a site-specific recombinase system for removal of selection markers (FIG. 5). Use of the two-fragment PCR method for chromosomally engineering changes to carotenoid production in E. coli has previously been reported (U.S. Ser. No. 10/734,936, hereby incorporated by reference). Use of the bacteriophage P1 transduction system for stacking multiple genetic traits in E. coli has also been previously reported (U.S. Ser. No. 10/734,778 and U.S. Ser. No. 10/735,442).

The terms “P1 donor cell” and “donor cell” are used interchangeably in the present invention and refer to a bacterial strain susceptible to infection by a bacteriophage or virus, and which serves as a source for the nucleic acid fragments packaged into the transducing particles. Typically the genetic make up of the donor cell is similar or identical to the “recipient cell” which serves to receive P1 lysate containing transducing phage or virus produced by the donor cell.

The terms “P1 recipient cell” and “recipient cell” are used interchangeably in the present invention and refer to a bacterial strain susceptible to infection by a bacteriophage or virus and which serves to receive lysate containing transducing phage or virus produced by the donor cell.

The term “homology arm” refers to a nucleotide sequence which enables homologous recombination between two nucleic acids having substantially the same nucleotide sequence in a particular region of two different nucleic acids. The preferred size range of the nucleotide sequence of the homology arm is from about 10 to about 50 nucleotides.

The terms “stacking”, “combinatorial stacking”, “chromosomal stacking”, and “trait stacking” are used interchangeably and refer to the repeated process of stacking multiple genetic traits into one E. coli host using the bacteriophage P1 in combination with the site-specific recombinase system for removal of selection markers.

The term “fermentable carbon substrate” refers to a carbon source capable of being metabolized by host organisms of the present invention and particularly carbon sources selected from the group consisting of monosaccharides, disaccharides, polysaccharides, one-carbon substrates (methane, methanol, formate and the like), and/or mixtures thereof.

The term “recombinase” refers to one or more enzymes, which either work alone or in combination to stimulate homologous recombination. The “λ-Red recombinase”, “λ-Red recombination system”, and “λ-Red system” are used interchangeably to describe a group of enzymes encoded by the bacteriophage λ genes exo, bet, and gam. The enzymes encoded by the three genes work together to increase the rate of homologous recombination in E. coli, an organism generally considered to have a relatively low rate of homologous recombination, especially when using linear recombination elements (Datsenko and Wanner, Proc. Natl. Acad. Sci. USA 97:6640–6645 (2000)).

The terms “site-specific recombinase system” and “site-specific recombinase” and “recombinase” are used interchangeably in the present invention to describe a system comprised of one or more enzymes which recognize specific nucleotide sequences (recombination target sites) and which catalyze recombination between the recombination target sites. Site-specific recombination provides a method to rearrange, delete, or introduce exogenous DNA. Examples of site-specific recombinases and their associated recombination target sites are flippase (FLP/FRT), Cre-lox, R/RS, Gin/gix, Xer/dif, and Int/att. In the present invention the Applicants illustrate the use of a site-specific recombinase to remove selectable markers. Antibiotic resistance markers, flanked on both sides by FRT recombination target sites, are removed by expression of the FLP site-specific recombinase. This method is used so that the numbers of chromosomal modifications necessary for microbial pathway engineering is not limited to the number of available selection markers (Huang et al., J. Bacteriol., 179(19): 6076–6083. (1997)).

The term “homology” as applied to recombination regions and corresponding regions on a bacterial chromosome means nucleotide sequences sharing identical or nearly identical sequences. Complementary sequences between regions on the bacterial chromosome and recombination regions can associate and undergo homologous recombination in the presence of a recombinase system. Preferred recombination regions, or “homology arms”, are those having identical sequences to the corresponding regions on the bacterial chromosome and that are from about 10–50 bp in length.

The terms “PT5 promoter”, “PT5”, and “T5 promoter” refer to the nucleotide sequence that comprises the −10 and −35 consensus sequences from phage T5, lactose operator (lacO), and ribosomal binding site (RBS) from E. coli.

The term “helper plasmid” refers to either pKD46 encoding the X-Red recombinase system or pCP20 encoding the FLP site-specific recombinase (Datsenko and Wanner, supra).

As used herein, an “isolated nucleic acid fragment” is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated nucleic acid fragment in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.

A nucleic acid molecule is “hybridizable” to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA molecule, when a single-stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength. Hybridization and washing conditions are well known and exemplified in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y. (1989), particularly Chapter 11 and Table 11.1 therein (hereinafter “Maniatis”). The conditions of temperature and ionic strength determine the “stringency” of the hybridization. Stringency conditions can be adjusted to screen for moderately similar fragments (such as homologous sequences from distantly related organisms), to highly similar fragments (such as genes that duplicate functional enzymes from closely related organisms). Post-hybridization washes determine stringency conditions. One set of preferred conditions uses a series of washes starting with 6×SSC, 0.5% SDS at room temperature for 15 min, then repeated with 2×SSC, 0.5% SDS at 45° C. for 30 min, and then repeated twice with 0.2×SSC, 0.5% SDS at 50° C. for 30 min. A more preferred set of stringent conditions uses higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2×SSC, 0.5% SDS was increased to 60° C. Another preferred set of highly stringent conditions uses two final washes in 0.1×SSC, 0.1% SDS at 65° C. An additional set of stringent conditions include hybridization at 0.1×SSC, 0.1% SDS, 65° C. and washed with 2×SSC, 0.1% SDS followed by 0.1×SSC, 0.1% SDS, for example.

Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible. The appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridization decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hybrids of greater than 100 nucleotides in length, equations for calculating Tm have been derived (see Maniatis, supra, 9.50–9.51). For hybridizations with shorter nucleic acids (i.e., oligonucleotides), the position of mismatches becomes more important and the length of the oligonucleotide determines its specificity (see Maniatis, supra, 11.7–11.8). In one embodiment, the length for a hybridizable nucleic acid is at least about 10 nucleotides. Preferably, a minimum length for a hybridizable nucleic acid is at least about 15 nucleotides; more preferably at least about 20 nucleotides; and most preferably the length is at least 30 nucleotides. Furthermore, the skilled artisan will recognize that the temperature and wash solution salt concentration may be adjusted as necessary according to factors such as length of the probe.

A “substantial portion” of an amino acid or nucleotide sequence is that portion comprising enough of the amino acid sequence of a polypeptide or the nucleotide sequence of a gene to putatively identify that polypeptide or gene, either by manual evaluation of the sequence by one skilled in the art, or by computer-automated sequence comparison and identification using algorithms such as BLAST (Basic Local Alignment Search Tool; Altschul, S. F., et al., J. Mol. Biol. 215:403–410 (1993)). In general, a sequence of ten or more contiguous amino acids or thirty or more nucleotides is necessary in order to putatively identify a polypeptide or nucleic acid sequence as homologous to a known protein or gene. Moreover, with respect to nucleotide sequences, gene specific oligonucleotide probes comprising 20–30 contiguous nucleotides may be used in sequence-dependent methods of gene identification (e.g., Southern hybridization) and isolation (e.g., in situ hybridization of bacterial colonies or bacteriophage plaques). In addition, short oligonucleotides of 12–15 bases may be used as amplification primers in PCR in order to obtain a particular nucleic acid fragment comprising the primers. Accordingly, a “substantial portion” of a nucleotide sequence comprises enough of the sequence to specifically identify and/or isolate a nucleic acid fragment comprising the sequence. The instant specification teaches partial or complete amino acid and nucleotide sequences encoding one or more particular microbial proteins. The skilled artisan, having the benefit of the sequences as reported herein, may now use all or a substantial portion of the disclosed sequences for purposes known to those skilled in this art.

The term “complementary” is used to describe the relationship between nucleotide bases that are capable of hybridizing to one another. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the instant invention also includes isolated nucleic acid fragments that are complementary to the complete sequences, as reported in the accompanying Sequence Listing, as well as those substantially similar nucleic acid sequences.

The term “percent identity”, as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art “identity” also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. “Identity” and “similarity” can be readily calculated by known methods, including but not limited to those described in: 1.) Computational Molecular Biology (Lesk, A. M., ed.) Oxford University: NY (1988); 2.) Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic: NY (1993); 3.) Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humania: NJ (1994); 4.) Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic (1987); and 5.) Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton: NY (1991). Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignment of the sequences was performed using the Clustal method of alignment (Higgins and Sharp, CABIOS 5:151–153 (1989)) with default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method were: KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.

Suitable nucleic acid fragments (isolated polynucleotides of the present invention) encode polypeptides that are at least about 70% identical, and preferably at least about 80% identical to the amino acid sequences reported herein. Preferred nucleic acid fragments encode amino acid sequences that are about 85% identical to the amino acid sequences reported herein. More preferred nucleic acid fragments encode amino acid sequences that are at least about 90% identical to the amino acid sequences reported herein. Most preferred are nucleic acid fragments that encode amino acid sequences that are at least about 95% identical to the amino acid sequences reported herein. Suitable nucleic acid fragments not only have the above homologies but typically encode a polypeptide having at least 50 amino acids, preferably at least 100 amino acids, more preferably at least 150 amino acids, still more preferably at least 200 amino acids, and most preferably at least 250 amino acids.

“Codon degeneracy” refers to the nature in the genetic code permitting variation of the nucleotide sequence without effecting the amino acid sequence of an encoded polypeptide. Accordingly, the present invention relates to any nucleic acid fragment that encodes all or a substantial portion of the amino acid sequence encoding the instant microbial polypeptides as set forth in SEQ ID NOs: 2, 4, 8, 10, 12 and 14. The skilled artisan is well aware of the “codon-bias” exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. Therefore, when synthesizing a gene for improved expression in a host cell, it is desirable to design the gene such that its frequency of codon usage approaches the frequency of preferred codon usage of the host cell.

“Synthetic genes” can be assembled from oligonucleotide building blocks that are chemically synthesized using procedures known to those skilled in the art. These building blocks are ligated and annealed to form gene segments that are then enzymatically assembled to construct the entire gene. “Chemically synthesized”, as related to a sequence of DNA, means that the component nucleotides were assembled in vitro. Manual chemical synthesis of DNA may be accomplished using well-established procedures, or automated chemical synthesis can be performed using one of a number of commercially available machines. Accordingly, the genes can be tailored for optimal gene expression based on optimization of nucleotide sequence to reflect the codon bias of the host cell. The skilled artisan appreciates the likelihood of successful gene expression if codon usage is biased towards those codons favored by the host. Determination of preferred codons can be based on a survey of genes derived from the host cell where sequence information is available.

“Gene” refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5′ non-coding sequences) and following (3′ non-coding sequences) the coding sequence. “Native gene” refers to a gene as found in nature with its own regulatory sequences. “Chimeric gene” refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. “Endogenous gene” refers to a native gene in its natural location in the genome of an organism. A “foreign” gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes. A “transgene” is a gene that has been introduced into the genome by a transformation procedure.

“Coding sequence” refers to a DNA sequence that codes for a specific amino acid sequence. “Suitable regulatory sequences” refer to nucleotide sequences located upstream (5′ non-coding sequences), within, or downstream (3′ non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites and stem-loop structures.

“Promoter” refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3′ to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity.

The “3′ non-coding sequences” refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal (normally limited to eukaryotes) is usually characterized by affecting the addition of polyadenylic acid tracts to the 3′ end of the mRNA precursor.

“RNA transcript” refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be an RNA sequence derived from post-transcriptional processing of the primary transcript and is referred to as the mature RNA. “Messenger RNA” or “mRNA” refers to the RNA that is without introns and that can be translated into protein by the cell. “cDNA” refers to a double-stranded DNA that is complementary to and derived from mRNA. “Sense” RNA refers to an RNA transcript that includes the mRNA and so can be translated into protein by the cell. “Antisense RNA” refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target gene (U.S. Pat. No. 5,107,065; WO 99/28508). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5′ non-coding sequence, 3′ non-coding sequence, or the coding sequence. “Functional RNA” refers to antisense RNA, ribozyme RNA, or other RNA that is not translated yet has an effect on cellular processes.

The term “operably linked” refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.

The term “expression”, as used herein, refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment(s) of the invention. Expression may also refer to translation of mRNA into a polypeptide.

“Transformation” refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as “transgenic”, “recombinant” or “transformed” organisms.

The terms “plasmid”, “vector” and “cassette” refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA fragments. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3′ untranslated sequences into a cell. “Transformation cassette” refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene(s) that facilitate transformation of a particular host cell. “Expression cassette” refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for enhanced expression of that gene in a foreign host.

The term “sequence analysis software” refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences. “Sequence analysis software” may be commercially available or independently developed. Typical sequence analysis software will include, but is not limited to: 1.) the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wis.); 2.) BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol. 215:403–410 (1990)); 3.) DNASTAR (DNASTAR, Inc. Madison, Wis.); 4.) the FASTA program incorporating the Smith-Waterman algorithm (W. R. Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 111–20. Editor(s): Suhai, Sandor. Plenum: New York, N.Y.); and 5.) the Vector NTI programs version 7.0 (Informax, Inc., Bethesda, Md.). Within the context of this application it will be understood that where sequence analysis software is used for analysis, the results of the analysis will be based on the “default values” of the program referenced, unless otherwise specified. As used herein “default values” will mean any set of values or parameters (set by the software manufacturer) which originally load with the software when first initialized.

Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described by Maniatis (supra); by Silhavy, T. J., Bennan, M. L. and Enquist, L. W., Experiments with Gene Fusions, Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y. (1984); and by Ausubel, F. M. et al., Current Protocols in Molecular Biology, published by Greene Publishing Assoc. and Wiley-Interscience (1987).

Genes Involved in Carotenoid Production

The enzyme pathway involved in the biosynthesis of carotenoid compounds can be conveniently viewed in two parts, the upper isoprenoid pathway (providing for the conversion of pyruvate and glyceraldehyde-3-phosphate to famesyl pyrophosphate) and the lower carotenoid biosynthetic pathway (which provides for the synthesis of either diapophytoene or phytoene and all subsequently produced carotenoids) (FIG. 1). The upper pathway is ubiquitous in many microorganisms and in these cases it will only be necessary to introduce genes that comprise the lower pathway for biosynthesis of the desired carotenoid. The division between the two pathways concerns the synthesis of farnesyl pyrophosphate (FPP). Where FPP is naturally present, only elements of the lower carotenoid pathway will be needed. However, it will be appreciated that for the lower pathway carotenoid genes to be effective in the production of carotenoids, it will be necessary for the host cell to have suitable levels of FPP within the cell. Where FPP synthesis is not provided by the host cell, it will be necessary to introduce the genes necessary for the production of FPP. Where FPP is synthesized at an unsuitable level in the host cell, it will be necessary to engineer modifications to genes involved in isoprenoid production. Examples of the genetic modifications include, but are not limited to, up-regulating expression of isoprenoid genes and/or down-regulating genes that divert carbon flow away from FPP synthesis. Each of these pathways will be discussed below in detail.

The Upper Isoprenoid Pathway

Isoprenoid biosynthesis occurs through either of two pathways, generating the common C5 isoprene subunit, isopentenyl pyrophosphate (IPP). First, IPP may be synthesized through the well-known acetate/mevalonate pathway. However, recent studies have demonstrated that the mevalonate-dependent pathway does not operate in all living organisms. An alternate mevalonate-independent pathway for IPP biosynthesis has been characterized in bacteria and in green algae and higher plants (Horbach et al., FEMS Microbiol. Lett. 111:135–140 (1993); Rohmer et al., Biochem. 295: 517–524 (1993); Schwender et al., Biochem. 316: 73–80 (1996); and Eisenreich et al., Proc. Natl. Acad. Sci. USA 93: 6431–6436 (1996)).

Many steps in the mevalonate-independent isoprenoid pathway are known. For example, the initial steps of the alternate pathway leading to the production of IPP have been studied in Mycobacterium tuberculosis by Cole et al. (Nature 393:537–544 (1998)). The first step of the pathway involves the condensation of two 3-carbon molecules (pyruvate and D-glyceraldehyde 3-phosphate) to yield a 5-carbon compound known as D-1-deoxyxylulose-5-phosphate. This reaction occurs by the DXS enzyme, encoded by the dxs gene. Next, the isomerization and reduction of D-1-deoxyxylulose-5-phosphate yields 2-C-methyl-D-erythritol4-phosphate. One of the enzymes involved in the isomerization and reduction process is D-1-deoxyxylulose-5-phosphate reductoisomerase (DXR), encoded by the gene dxr. 2-C-methyl-D-erythritol-4-phosphate is subsequently converted into 4-diphosphocytidyl-2C-methyl-D-erythritol in a CTP-dependent reaction by the enzyme encoded by the non-annotated gene ygbP (Cole et al., supra). Recently, however, the ygbP gene was renamed as ispD as a part of the isp gene cluster (SwissProtein Accession #Q46893).

Next, the 2nd position hydroxy group of 4-diphosphocytidyl-2C-methyl-D-erythritol can be phosphorylated in an ATP-dependent reaction by the enzyme encoded by the ychB gene. This product phosphorylates 4-diphosphocytidyl-2C-methyl-D-erythritol, resulting in 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate. The ychB gene was renamed as ispE, also as a part of the isp gene cluster (SwissProtein Accession #P24209). Finally, the product of the ygbB gene converts 4-diphosphocytidyl-2C-methyl-D-erythritol 2-phosphate to 2C-methyl-D-erythritol 2,4-cyclodiphosphate in a CTP-dependent manner. This gene has also been recently renamed, and belongs to the isp gene cluster. Specifically, the new name for the ygbB gene is ispF (SwissProtein Accession #P36663). The product of the pyrG gene is important in these reactions, as a CTP synthase.

The enzymes encoded by the IytB and gcpE genes (and perhaps others) are thought to participate in the reactions leading to formation of isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). IPP may be isomerized to DMAPP via IPP isomerase, encoded by the idi gene; however, this enzyme is not essential for survival and may be absent in some bacteria using the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. Recent evidence suggests that the MEP pathway branches before IPP and separately produces IPP and DMAPP via the IytB gene product. A IytB knockout mutation is lethal in E. coli except in media supplemented with both IPP and DMAPP.

The synthesis of FPP occurs via the isomerization of IPP to dimethylallyl pyrophosphate (DMAPP). This reaction is followed by a sequence of two prenyltransferase reactions catalyzed by IspA, leading to the creation of geranyl pyrophosphate (GPP; a 10-carbon molecule) and farnesyl pyrophosphate (FPP; a 15-carbon molecule).

Genes encoding elements of the upper pathway are known from a variety of plant, animal, and bacterial sources, as shown in Table 3.

TABLE 3
Sources of Genes Encoding the Upper Isoprene Pathway
GenBank Accession Number and
Gene Source Organism
dxs (D-1- AF035440, Escherichia coli
deoxyxylulose 5- Y18874, Synechococcus PCC6301
phosphate synthase) AB026631, Streptomyces sp. CL190
AB042821, Streptomyces griseolosporeus
AF111814, Plasmodium falciparum
AF143812, Lycopersicon esculentum
AJ279019, Narcissus pseudonarcissus
AJ291721, Nicotiana tabacum
dxr (ispC) (1- AB013300, Escherichia coli
deoxy-D- AB049187, Streptomyces griseolosporeus
xylulose 5- AF111813, Plasmodium falciparum
phosphate AF116825, Mentha x piperita
reductoisomerase) AF148852, Arabidopsis thaliana
AF182287, Artemisia annua
AF250235, Catharanthus roseus
AF282879, Pseudomonas aeruginosa
AJ242588, Arabidopsis thaliana
AJ250714, Zymomonas mobilis strain ZM4
AJ292312, Klebsiella pneumoniae,
AJ297566, Zea mays
ygbP (ispD) (2- AB037876, Arabidopsis thaliana
C-methyl-D- AF109075, Clostridium difficile
erythritol 4- AF230736, Escherichia coli
phosphate AF230737, Arabidopsis thaliana
cytidylyltransferase)
ychB (ispE) (4- AF216300, Escherichia coli
diphosphocytidyl- AF263101, Lycopersicon esculentum
2-C-methyl-D- AF288615, Arabidopsis thaliana
erythritol kinase)
ygbB (ispF) (2- AB038256, Escherichia coli mecs gene
C-methyl-D- AF230738, Escherichia coli
erythritol 2,4- AF250236, Catharanthus roseus (MECS)
cyclodiphosphate synthase) AF279661, Plasmodium falciparum
AF321531, Arabidopsis thaliana
gcpE (ispG) (1- O67496, Aquifex aeolicus
hydroxy-2- P54482, Bacillus subtilis
methyl-2-(E)- Q9pky3, Chlamydia muridarum
butenyl 4- Q9Z8H0, Chlamydophila pneumoniae
diphosphate synthase) O84060, Chlamydia trachomatis
P27433, Escherichia coli
P44667, Haemophilus influenzae
Q9ZLL0, Helicobacter pylori J99
O33350, Mycobacterium tuberculosis
S77159, Synechocystis sp.
Q9WZZ3, Thermotoga maritima
O83460, Treponema pallidum
Q9JZ40, Neisseria meningitidis
Q9PPM1, Campylobacter jejuni
Q9RXC9, Deinococcus radiodurans
AAG07190, Pseudomonas aeruginosa
Q9KTX1, Vibrio cholerae
lytB (ispH) AF027189, Acinetobacter sp. BD413
AF098521, Burkholderia pseudomallei
AF291696, Streptococcus pneumoniae
AF323927, Plasmodium falciparum gene
M87645, Bacillus subtillis
U38915, Synechocystis sp.
X89371, C. jejunisp O67496
IspA (FPP AB003187, Micrococcus luteus
synthase) AB016094, Synechococcus elongatus
AB021747, Oryza sativa FPPS1 gene for farnesyl
diphosphate synthase
AB028044, Rhodobacter sphaeroides
AB028046, Rhodobacter capsulatus
AB028047, Rhodovulum sulfidophilum
AF112881 and AF136602, Artemisia annua
AF384040, Mentha x piperita
D00694, Escherichia coli
D13293, B. stearothermophilus
D85317, Oryza sativa
X75789, A. thaliana
Y12072, G. arboreum
Z49786, H. brasiliensis
U80605, Arabidopsis thaliana farnesyl diphosphate
synthase precursor (FPS1) mRNA, complete cds
X76026, K. lactis FPS gene for farnesyl diphosphate
synthetase, QCR8 gene for bc1 complex, subunit VIII
X82542, P. argentatum mRNA for farnesyl diphosphate
synthase (FPS1)
X82543, P. argentatum mRNA for farnesyl diphosphate
synthase (FPS2)
BC010004, Homo sapiens, farnesyl diphosphate
synthase (farnesyl pyrophosphate synthetase,
dimethylallyltranstransferase, geranyltranstransferase),
clone MGC 15352 IMAGE, 4132071, mRNA, complete cds
AF234168, Dictyostelium discoideum farnesyl
diphosphate synthase (Dfps)
L46349, Arabidopsis thaliana farnesyl diphosphate
synthase (FPS2) mRNA, complete cds
L46350, Arabidopsis thaliana farnesyl diphosphate
synthase (FPS2) gene, complete cds
L46367, Arabidopsis thaliana farnesyl diphosphate
synthase (FPS1) gene, alternative products, complete cds
M89945, Rat farnesyl diphosphate synthase gene,
exons 1–8
NM_002004, Homo sapiens farnesyl diphosphate
synthase (farnesyl pyrophosphate synthetase,
dimethylallyltranstransferase, geranyltranstransferase)
(FDPS), mRNA
U36376, Artemisia annua farnesyl diphosphate
synthase (fps1) mRNA, complete cds
XM_001352, Homo sapiens farnesyl diphosphate
synthase (farnesyl pyrophosphate synthetase,
dimethylallyltranstransferase, geranyltranstransferase)
(FDPS), mRNA
XM_034497, Homo sapiens farnesyl diphosphate
synthase (farnesyl pyrophosphate synthetase,
dimethylallyltranstransferase, geranyltranstransferase)
(FDPS), mRNA
XM_034498, Homo sapiens farnesyl diphosphate
synthase (farnesyl pyrophosphate synthetase,
dimethylallyltranstransferase, geranyltranstransferase)
(FDPS), mRNA
XM_034499, Homo sapiens farnesyl diphosphate
synthase (farnesyl pyrophosphate synthetase,
dimethylallyltranstransferase, geranyltranstransferase)
(FDPS), mRNA
XM_0345002, Homo sapiens farnesyl diphosphate
synthase (farnesyl pyrophosphate synthetase,
dimethylallyltranstransferase, geranyltranstransferase)
(FDPS), mRNA

The Lower Carotenoid Biosynthetic Pathway

The division between the upper isoprenoid pathway and the lower carotenoid pathway is somewhat subjective. Because FPP synthesis is common in both carotenogenic and non-carotenogenic bacteria, the Applicants consider the first step in the lower carotenoid biosynthetic pathway to begin with the conversion of farnesyl pyrophosphate (FPP) to compounds that lead to the formation of either C30 diapocarotenoids or C40 carotenoids (FIG. 1).

The C40 Lower Carotenoid Biosynthetic Pathway

Within the C40 pathway, the first step in the biosynthetic pathway begins with the prenyltransferase reaction converting FPP to geranylgeranyl pyrophosphate (GGPP). The gene crtE, encoding GGPP synthetase, is responsible for this prenyltransferase reaction, leading to the synthesis of phytoene. This reaction adds IPP to FPP to produce a 20-carbon molecule, geranylgeranyl pyrophosphate (GGPP).

Finally, a condensation reaction of two molecules of GGPP occurs to form phytoene (PPPP), the first 40-carbon molecule of the lower carotenoid biosynthesis pathway. This reaction is catalyzed by phytoene synthase (encoded by the gene crtB).

From the compound phytoene, a spectrum of C40 carotenoids is produced by subsequent hydrogenation, dehydrogenation, cyclization, oxidation, or any combination of these processes. For example, lycopene, which imparts a “red”-colored spectra, is produced from phytoene through four sequential dehydrogenation reactions by the removal of eight atoms of hydrogen, catalyzed by the gene crtl (encoding phytoene desaturase). Lycopene cyclase (crtY) converts lycopene to β-carotene. β-carotene is converted to zeaxanthin via a hydroxylation reaction resulting from the activity of β-carotene hydroxylase (encoded by the crtZ gene). These examples are not limiting and many other carotenoid genes and products (e.g., crtX, crtW/O) exist within this C40 lower carotenoid biosynthetic pathway.

The C30 Lower Carotenoid Biosynthetic Pathway

Within the C30 pathway, the first unique step in the biosynthetic pathway begins with the conversion of FPP to diapophytoene.

This pathway is well-studied in Staphylococcus aureus. The first committed reaction is the head-to-head condensation of two molecules of farnesyl diphosphate (C15) by CrtM, forming dehydrosqualene (Wieland, B. et al., J. Bacteriol. 176(24): 7719–7726 (1994)). Subsequently, dehydrosqualene desaturase (CrtN) is successively dehydrogenated in three steps to produce 4,4′-diaponeurosporene (Wieland et al., supra). However, at present time public databases include only one single gene (GenBank® Accession Number X73889) and 4 genomic sequences (NC002745, NC002758, AP003137, and AP003365) of crtN and crtM, isolated from S. aureus strains N315 and Mu5O. A single report exists concerning the heterologous overexpression of crtN from S. aureus in E. coli (Raisig, A., and Sandmann, G., J. Bacteriol., 181(19):6184–6187 (1999)). Based on the identification of the carotenoid compounds produced, it is known that the next stages in the C30 metabolic pathway for S. aureus involve introduction of oxygen functions on the terminal methyl group to produce aldehyde and carboxylic acid forms of the carotenoid (Marshall, J. H., and Wilmoth, G. J., J. Bacteriol. 147: 900–913 (1981) and 147: 914–919 (1981)). We have recently identified genes (crtN2)which perform this function (U.S. Ser. No. 10/358,917 and corresponding WO 03/068917). Methylomonas 16a is a pink-pigmented methanotrophic prokaryote capable of utilizing methane as its sole carbon substrate (described in WO 02/20728 and WO 02/18617). Identification of genes crtN,crtN2 and ald contributed to the detailed understanding of the carotenoid synthesis pathway of conversion of FPP to a naturally-occurring C30 pigment produced by the organism.

Sequence Identification of Novel Genes from the C30 Lower Carotenoid Biosynthetic Pathway.

A variety of nucleotide sequences have been isolated from Methylomonas 16a encoding gene products involved in the native C30 lower carotenoid pathway (U.S. Ser. No. 10/358917). ORF's 1–4, for example, encode enzymes in the lower carotenoid biosynthetic pathway (see FIGS. 3A and 4A). Specifically:

    • Comparison of the sqs nucleotide base and deduced amino acid sequences (ORF 1) to public databases reveals that the most similar known sequences range from about 60% identical to the amino acid sequence of Sqs reported herein over a length of 363 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
    • Comparison of the crtN nucleotide base and deduced amino acid sequences (ORF 2) to public databases reveals that the most similar known sequences range from about 34% identical to the amino acid sequence of CrtN reported herein over a length of 511 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
    • Comparison of the ald nucleotide base and deduced amino acid sequences (ORF 3) to public databases reveals that the most similar known sequences range from about 33% identical to the amino acid sequence of Aid reported herein over a length of 530 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
    • Comparison of the crtN2 nucleotide base and deduced amino acid sequences (ORF 4) to public databases reveals that the most similar known sequences range from about 51% identical to the amino acid sequence of CrtN2 reported herein over a length of 497 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).

For each of the enzymes described above (i.e., Sqs, CrtN, Ald, and CrtN2), more preferred amino acid fragments are at least about 70%–80% identical to the sequences herein, where about 80%–90% is preferred. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.

Similarly, preferred nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred sqs, citN, ald, and crtN2 nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.

In addition to the nucleotide sequences isolated from Methylomonas 16a, a hypothetical protein in Staphylococcus aureus (ATCC 35556) was determined to encode a crtN2 gene. Comparison of the nucleotide base and deduced amino acid sequences (ORF 7; FIG. 3B) to public databases reveals that the most similar known sequences range from about 55% identical to the amino acid sequence of CrtN2 reported herein over a length of 497 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra). Additionally, this gene has 51% identity and 68% similarity to the CrtN2 of 16a. More preferred amino acid fragments are at least about 70%–80% identical to the sequences herein, where about 80%–90% is preferred. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein. Similarly, preferred crtN2 encoding nucleic acid sequences corresponding to the instant ORF are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences of reported herein. More preferred crtN2 nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are crtN2 nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.

Isolation of C30 Lower Carotenoid Biosynthetic Pathway Homologs

Each of the nucleic acid fragments of the C30 lower carotenoid biosynthetic pathway (crtM, sqs, crtN, aid and crtN2) may be used to isolate genes encoding homologous proteins from the same or other microbial (or plant) species. Isolation of homologous genes using sequence-dependent protocols is well known in the art. Examples of sequence-dependent protocols include, but are not limited to: 1.) methods of nucleic acid hybridization; 2.) methods of DNA and RNA amplification, as exemplified by various uses of nucleic acid amplification technologies (e.g., polymerase chain reaction (PCR), Mullis et al., U.S. Pat. No. 4,683,202; ligase chain reaction (LCR), Tabor, S. et al., Proc. Natl. Acad. Sci. USA 82:1074 (1985); or strand displacement amplification (SDA), Walker et al., Proc. Natl. Acad. Sci. USA, 89: 392 (1992)); and 3.) methods of library construction and screening by complementation.

For example, genes encoding similar proteins or polypeptides to those of the C30 lower carotenoid biosynthetic pathway, as described herein, could be isolated directly by using all or a portion of the instant nucleic acid fragments as DNA hybridization probes to screen libraries from any desired bacteria using methodology well known to those skilled in the art (wherein those bacteria producing C30 carotenoids would be preferred). Specific oligonucleotide probes based upon the instant nucleic acid sequences can be designed and synthesized by methods known in the art (Maniatis, supra). Moreover, the entire sequences can be used directly to synthesize DNA probes by methods known to the skilled artisan (e.g., random primers DNA labeling, nick translation, or end-labeling techniques), or RNA probes using available in vitro transcription systems. In addition, specific primers can be designed and used to amplify a part of (or full-length of) the instant sequences. The resulting amplification products can be labeled directly during amplification reactions or labeled after amplification reactions, and used as probes to isolate full-length DNA fragments under conditions of appropriate stringency.

Typically in PCR-type amplification techniques, the primers have different sequences and are not complementary to each other. Depending on the desired test conditions, the sequences of the primers should be designed to provide for both efficient and faithful replication of the target nucleic acid. Methods of PCR primer design are common and well known in the art (Thein and Wallace, “The use of oligonucleotide as specific hybridization probes in the Diagnosis of Genetic Disorders”, in Human Genetic Diseases: A Practical Approach, K. E. Davis Ed., (1986) pp 33–50 IRL: Herndon, V A; and Rychlik, W., In Methods in Molecular Biology, White, B. A. (Ed.), (1993) Vol.15, pp 31–39, PCR Protocols: Current Methods and Applications. Humania: Totowa, N.J.).

Generally two short segments of the instant sequences may be used in polymerase chain reaction protocols to amplify longer nucleic acid fragments encoding homologous genes from DNA or RNA. The polymerase chain reaction may also be performed on a library of cloned nucleic acid fragments wherein the sequence of one primer is derived from the instant nucleic acid fragments, and the sequence of the other primer takes advantage of the presence of the polyadenylic acid tracts to the 3′ end of the mRNA precursor encoding microbial genes.

Alternatively, the second primer sequence may be based upon sequences derived from the cloning vector. For example, the skilled artisan can follow the RACE protocol (Frohman et al., Proc. Natl. Acad. Sci. USA 85:8998 (1988)) to generate cDNAs by using PCR to amplify copies of the region between a single point in the transcript and the 3′ or 5′ end. Primers oriented in the 3′ and 5′ directions can be designed from the instant sequences. Using commercially available 3′ RACE or 5′ RACE systems (BRL, Gaithersburg, Md.), specific 3′ or 5′ cDNA fragments can be isolated (Ohara et al., Proc. Natl. Acad. Sci. USA 86:5673 (1989); Loh et al., Science 243:217 (1989)).

Alternatively, the instant sequences of the C30 lower carotenoid biosynthetic pathway may be employed as hybridization reagents for the identification of homologs. The basic components of a nucleic acid hybridization test include a probe, a sample suspected of containing the gene or gene fragment of interest, and a specific hybridization method. Probes of the present invention are typically single-stranded nucleic acid sequences that are complementary to the nucleic acid sequences to be detected. Probes are “hybridizable” to the nucleic acid sequence to be detected. The probe length can vary from 5 bases to tens of thousands of bases, and will depend upon the specific test to be done. Typically a probe length of about 15 bases to about 30 bases is suitable. Only part of the probe molecule need be complementary to the nucleic acid sequence to be detected. In addition, the complementarity between the probe and the target sequence need not be perfect. Hybridization does occur between imperfectly complementary molecules with the result that a certain fraction of the bases in the hybridized region are not paired with the proper complementary base.

Hybridization methods are well defined. Typically the probe and sample must be mixed under conditions which will permit nucleic acid hybridization. This involves contacting the probe and sample in the presence of an inorganic or organic salt under the proper concentration and temperature conditions. The probe and sample nucleic acids must be in contact for a long enough time that any possible hybridization between the probe and sample nucleic acid may occur. The concentration of probe or target in the mixture will determine the time necessary for hybridization to occur. The higher the probe or target concentration, the shorter the hybridization incubation time needed. Optionally, a chaotropic agent may be added. The chaotropic agent stabilizes nucleic acids by inhibiting nuclease activity. Furthermore, the chaotropic agent allows sensitive and stringent hybridization of short oligonucleotide probes at room temperature (Van Ness and Chen, Nucl. Acids Res. 19:5143–5151 (1991)). Suitable chaotropic agents include guanidinium chloride, guanidinium thiocyanate, sodium thiocyanate, lithium tetrachloroacetate, sodium perchlorate, rubidium tetrachloroacetate, potassium iodide, and cesium trifluoroacetate, among others. Typically, the chaotropic agent will be present at a final concentration of about 3 M. If desired, one can add formamide to the hybridization mixture, typically 30–50% (v/v).

Various hybridization solutions can be employed. Typically, these comprise from about 20 to 60% volume, preferably 30%, of a polar organic solvent. A common hybridization solution employs about 30–50% v/v formamide, about 0.15 to 1 M sodium chloride, about 0.05 to 0.1 M buffers (e.g., sodium citrate, Tris-HCI, PIPES or HEPES (pH range about 6–9)), about 0.05 to 0.2% detergent (e.g., sodium dodecylsulfate), or between 0.5–20 mM EDTA, FICOLL (Pharmacia Inc.) (about 300–500 kdal), polyvinylpyrrolidone (about 250–500 kdal), and serum albumin. Also included in the typical hybridization solution will be unlabeled carrier nucleic acids from about 0.1 to 5 mg/mL, fragmented nucleic DNA (e.g., calf thymus or salmon sperm DNA, or yeast RNA), and optionally from about 0.5 to 2% wt/vol glycine. Other additives may also be included, such as volume exclusion agents that include a variety of polar water-soluble or swellable agents (e.g., polyethylene glycol), anionic polymers (e.g., polyacrylate or polymethylacrylate), and anionic saccharidic polymers (e.g., dextran sulfate).

Nucleic acid hybridization is adaptable to a variety of assay formats. One of the most suitable is the sandwich assay format. The sandwich assay is particularly adaptable to hybridization under non-denaturing conditions. A primary component of a sandwich-type assay is a solid support. The solid support has adsorbed to it or covalently coupled to it immobilized nucleic acid probe that is unlabeled and complementary to one portion of the sequence.

Availability of the instant nucleotide and deduced amino acid sequences facilitates immunological screening of DNA expression libraries. Synthetic peptides representing portions of the instant amino acid sequences may be synthesized. These peptides can be used to immunize animals to produce polyclonal or monoclonal antibodies with specificity for peptides or proteins comprising the amino acid sequences. These antibodies can be then be used to screen DNA expression libraries to isolate full-length DNA clones of interest (Lerner, R. A. Adv. Immunol. 36:1 (1984); Maniatis, supra).

Enzyme Functionality Of C30 Lower Carotenoid Biosynthetic Genes

The hypothesized pathway for C30 carboxy-carotenoid synthesis in Methylomonas 16a and Staphylococcus aureus can be compared in FIGS. 4A and 4B. Both pathways require FPP as a precursor molecule; however, different genes are responsible for the formation of diapophytoene. Experimental studies (U.S. Ser. No. 10/358,917) confirmed that FPP is directly converted to diapophytoene in S. aureus (FIG. 4B), a reaction catalyzed by the well-known crtM gene encoding dehydrosqualene synthase (Wieland et al., J. Bacteriol. 176:7719–7726 (1994)). In contrast, the crtM homolog of diapophytoene synthase could not be identified in Methylomonas (FIG. 4A). In Methylomonas 16a, the condensation of FPP is catalyzed by the enzyme encoded by the sqs gene, to yield squalene. Sqs was also observed to produce low amount of diapophytoene in addition to squalene. This biosynthetic process whereby squalene acts as a key intermediate corresponds with that proposed by Kleinig, H. and R. Schmitt for Pseudomonas rhodos (Z. Naturforsch 37c: 758–760 (1982)).

The common substrate diapophytoene is then successively desaturated by a diapophytoene desaturase (CrtN) to form either diapocarotene in Methylomonas 16a, or 4,4′-diaponeurosporene in S. aureus. The subsequent reaction on each of these substrates appears to be catalyzed by the enzymes encoded by the crtN2 genes. As described in U.S. Ser. No. 10/358,917 and herein, crtN2 genes have been identified in both Methylomonas 16a and S. aureus (ATCC 35556) that possess great homology to one another (51% identity and 68% similarity, based on amino acid sequence comparison of the CrtN2 proteins). Previously, the crtN2 gene of S. aureus had been identified as a hypothetical protein.

Although the crtN2 gene acts on different natural substrates, careful analysis of its function revealed that both crtN2 genes possess the ability to produce omega-aldehyde functional groups on those carotenoid compounds which possess a 7-8 or 7′-8′ desaturated ψ group (wherein the term “ψ group” will refer to the end group of a carotenoid molecule possessing a C9H15 structure, as shown by the circled portion of the diaponeurosporene molecule in FIG. 4B; in contrast, a “desaturated ψ group” will refer to an end group, as represented by the formula C9H13 and shown as the boxed structure in FIGS. 4A and 4B). Diapocarotene is converted to diapocarotene-dial in 16a, while in S. aureus the CrtN2 enzyme is responsible for the conversion of diaponeurosporene to diaponeurosporene-al. The interchangeability of these genes, due to their common functionality, has been proven by studies that demonstrated that the Methylomonas crtN2 and Staphylococcus crtN2 genes both catalyzed the synthesis of diaponeurosporene-al from diaponeurosporene, and synthesis of diapocarotene-dial from diapocarotene in E. coli (U.S. Ser. No. 10/358,917; corresponding to WO 03/068917).

Finally, functional analysis of the Methylomonas aldehyde dehydrogenase gene (aid) confirmed that this enzyme was responsible for catalyzing the oxidation of the diapocarotene-dial aldehyde to its corresponding carboxylic acid (diapocarotene-diacid) (FIG. 4A), by formation of an omega-carboxyl functional group on the 7–8 and 7′-8′ desaturated ψ group of the conjugated polyene carbon skeleton of the carotenoid substrate. Although a similar chemical reaction occurs in the S. aureus C30 pathway, whereby carboxylation of diaponeurosporene-al occurs to produce diaponeurosporene-acid, the gene catalyzing this particular reaction has not yet been identified.

Construction of a Genetic Pathway Suitable for Producing C30-Aldehyde Carotenoids

Based on the above analyses of enzyme functionality of the C30 lower carotenoid biosynthetic genes sqs, crtM, crtN, crtN2, and ald from these two diverse microorganisms, an engineered pathway was designed that would enable production of C30-aldehyde carotenoids in a variety of host organisms which possess suitable levels of FPP as a precursor (of course, FPP synthesis can be engineered into the host by the introduction of the upper pathway isoprene genes). Specifically, this engineered pathway comprises a series of reactions catalyzed by the following enzymes:

    • 1. An enzyme(s) capable of converting FPP to diapophytoene (e.g., Staphylococcus CrtM (SEQ ID NO:10) or Methylomonas Sqs (SEQ ID NO:2) or a homologous enzyme thereof having similar enzymatic activity and functionality);
    • 2. An enzyme(s) capable of desaturating diapophytoene (e.g., Staphylococcus CrtN (SEQ ID NO:12) or Methylomonas CrtN (SEQ ID NO:4) or a homologous enzyme thereof having similar enzymatic activity and functionality);
    • 3. An enzyme(s) capable of introducing an omega-aldehyde functional group on the omega carbon of the conjugated polyene carbon skeleton of the carotenoid compound produced by the CrtN enzyme described above (e.g., the Staphylococcus CrtN2 (SEQ ID NO:14) or the Methylomonas CrtN2 (SEQ ID NO:8) or a homologous enzyme thereof having similar enzymatic activity and functionality).
      The specific C30-aldehyde carotenoid that one desires to produce will affect the choice of enzyme encoding each of the functions described above when creating an engineered pathway. For example, synthesis of diaponeurosporene-monoaldehyde would require use of the Staphylococcus CrtN, as opposed to the Methylomonas CrtN (since the Staphylococcus CrtN catalyzes a single desaturation step, to convert diapophytoene to diaponeurosporene). In contrast, for production of either the C30 diapocarotene monoaldehyde or diapocarotene dialdehyde, the Methylomonas CrtN must be utilized (since this enzyme catalyzes one additional desaturation step on diapophytoene [relative to the Staphylococcus CrtN] to form diapocarotene); however, if may also be desirable to include both the Staphylococcus CrtN and the Methylomonas CrtN, since this may increase desaturase activity for C30 diapocarotene aldehyde synthesis.

In a preferred embodiment, wherein the desired carotenoid product is C30 diapocarotene dialdehyde, the engineered pathway comprises the Staphylococcus CrtM (SEQ ID NO:10), both the Staphylococcus CrtN (SEQ ID NO:12) and the Methylomonas CrtN (SEQ ID NO:4), and the Methylomonas CrtN2 (SEQ ID NO:8).

Traditional Methods for Genetically Engineering Production of C30-Aldehyde Carotenoids in Recombinant Microorganisms

Methods for introduction of genes encoding the appropriate upper isoprene pathway genes (if necessary) and the lower carotenoid biosynthetic pathway genes of the engineered pathway for C30-aldehyde carotenoid synthesis into a suitable microbial host are common.

Microbial expression systems and expression vectors containing regulatory sequences that direct high-level expression of foreign proteins are well known to those skilled in the art. Any of these could be used to construct chimeric genes for production of C30-aldehyde carotenoids using the gene products of the present sequences. These chimeric genes could then be introduced into appropriate microorganisms via transformation to provide high-level expression of the enzymes.

Vectors or cassettes useful for the transformation of suitable host cells are well known in the art. Typically the vector or cassette contains sequences directing transcription and translation of the relevant gene(s), a selectable marker, and sequences allowing autonomous replication or chromosomal integration. Suitable vectors comprise a region 5′ of the gene which harbors transcriptional initiation controls and a region 3′ of the DNA fragment which controls transcriptional termination. It is most preferred when both control regions are derived from genes homologous to the transformed host cell, although it is to be understood that such control regions need not be derived from the genes native to the specific species chosen as a production host.

Initiation control regions or promoters which are useful to drive expression of the instant ORF's in the desired host cell are numerous and familiar to those skilled in the art. Virtually any promoter capable of driving these genes is suitable for the present invention including, but not limited to: CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PHO5, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TP1 (useful for expression in Saccharomyces); AOX1 (useful for expression in Pichia); and lac, ara, tet, trp, IPL, IPR, T7, tac, and trc (useful for expression in Escherichia coli) as well as the amy, apr, npr promoters and various phage promoters useful for expression in Bacillus. Additionally, the deoxy-xylulose phosphate synthase or methanol dehydrogenase operon promoter (Springer et al., FEMS Microbiol Lett 160:119–124 (1998)), the promoter for polyhydroxyalkanoic acid synthesis (Foellner et al., Appl. Microbiol. Biotechnol. 40:284–291 (1993)), promoters identified from native plasmids in methylotrophs (EP 296484), Plac (Toyama et al., Microbiology 143:595–602 (1997); EP 62971), Ptrc (Brosius et al., Gene 27:161–172 (1984)), promoters identified from methanotrophs (PCT/US03/33698), and promoters associated with antibiotic resistance [e.g., kanamycin (Springer et al., FEMS Microbiol Lett 160:119–124 (1998); Ueda et al., Appl. Environ. Microbiol. 57:924–926 (1991)) or tetracycline (U.S. Pat. No. 4,824,786)] are suitable for expression.

It is necessary to include an artificial ribosomal binding site (“RBS”) upstream of a gene to be expressed, when the RBS is not provided by the vector. This is frequently required for the second, third, etc. gene(s) of an operon to be expressed, when a single promoter is driving the expression of a first, second, third, etc. group of genes. Methodology to determine the preferred sequence of a RBS in a particular host organism will be familiar to one of skill in the art, as are means for creation of this synthetic site.

Termination control regions may also be derived from various genes native to the preferred hosts. Optionally, a termination site may be unnecessary; however, it is most preferred if included.

Merely inserting a gene into a cloning vector does not ensure that it will be successfully expressed at the level needed. In response to the need for a high expression rate, many specialized expression vectors have been created by manipulating a number of different genetic elements that control aspects of transcription, translation, protein stability, oxygen limitation, and secretion from the host cell. More specifically, the molecular features that have been manipulated to control gene expression include: 1.) the nature of the relevant transcriptional promoter and terminator sequences; 2.) the strength of the ribosome binding site; 3.) the number of copies of the cloned gene and whether the gene is plasmid-borne or integrated into the genome of the host cell; 4.) the final cellular location of the synthesized foreign protein; 5.) the efficiency of translation in the host organism; 6.) the intrinsic stability of the cloned gene protein within the host cell; and 7.) the codon usage within the cloned gene, such that its frequency approaches the frequency of preferred codon usage of the host cell. Each of these types of modifications are encompassed in the present invention, as means to further optimized expression of C30-aldehyde carotenoids.

Insertion of the present genes into the appropriate host cell will be sufficient for the production of C30-aldehyde carotenoids, provided however that the host cell comprises suitable levels of the substrate farnesyl pyrophosphate. As discussed above, farnesyl pyrophosphate is the end product of the upper isopreoid pathway and, in the present invention, is converted by the action of enzymes encoded by the sqs, crt N2 and crtN genes to the desired C30-aldehyde carotenoids of the invention. “Suitable levels” of farnesyl pyrophosphate may be provided by an endogenous upper isoprenoid pathway which is ubiquitous in many microorganisms and plants. Alternatively, the genes of the upper isoprenoid pathway are well know and highly characterized and the essential elements of the pathway could be introduced into a host cell for the production of farnesyl pyrophosphate. Finally, where no enzymatic system is available for the production of farnesyl pyrophosphate, it can be added directly to the medium of a cell culture or other growth system. The skilled person will appreciate that the levels of farnesyl pyrophosphate required will depend on a number of factors including the efficiency of the expression of the downstream pathways and the metabolic and physiological nature of the host cell.

Finally, to promote accumulation of C30-aldehyde carotenoids, it may be necessary to reduce or eliminate the expression of certain genes in the target pathway or in competing pathways that may serve as sinks for energy or carbon. Alternatively, it may be useful to over-express various genes upstream of desired carotenoid intermediates to enhance production. Methods of manipulating genetic pathways for the purposes described above are common and well known in the art.

For example, once a key genetic pathway has been identified and sequenced, specific genes may be up-regulated to increase the output of the pathway. For example, additional copies of the targeted genes may be introduced into the host cell on multicopy plasmids such as pBR322. Optionally, one or more targeted genes may be chromosomally-integrated into the host cell. Alternatively, the target genes may be modified so as to be under the control of non-native promoters. Where it is desired that a pathway operate at a particular point in a cell cycle or during a fermentation run, regulated or inducible promoters may used to replace the native promoter of the target gene. Similarly, in some cases the native or endogenous promoter may be modified to increase gene expression. For example, endogenous promoters can be altered in vivo by mutation, deletion, and/or substitution (see, U.S. Pat. No. 5,565,350; Zarling et al., PCT/US93/03868).

Alternatively, where sequence of the gene to be disrupted is known, one of the most effective methods for gene down-regulation is targeted gene disruption, where foreign DNA is inserted into a structural gene so as to disrupt transcription. This can be effected by the creation of genetic cassettes comprising the DNA to be inserted (often a genetic marker) flanked by sequences having a high degree of homology to a portion of the gene to be disrupted. Introduction of the cassette into the host cell results in insertion of the foreign DNA into the structural gene via the native DNA replication mechanisms of the cell. (See for example Hamilton et al., J. Bacteriol. 171:4617–4622 (1989); Balbas et al., Gene 136:211–213 (1993); Gueldener et al., Nucleic Acids Res. 24:2519–2524 (1996); and Smith et al., Methods Mol. Cell. Biol. 5:270–277(1996)).

Antisense technology is another method of down-regulating genes where the sequence of the target gene is known. To accomplish this, a nucleic acid segment from the desired gene is cloned and operably linked to a promoter such that the anti-sense strand of RNA will be transcribed. This construct is then introduced into the host cell and the antisense strand of RNA is produced. Antisense RNA inhibits gene expression by preventing the accumulation of mRNA encoding the protein of interest. The person skilled in the art will know that special considerations are associated with the use of antisense technologies in order to reduce expression of particular genes. For example, the proper level of expression of antisense genes may require the use of different chimeric genes utilizing different regulatory elements known to the skilled artisan.

Although targeted gene disruption and antisense technology offer effective means of down-regulating genes where the sequence is known, other less specific methodologies have been developed that are not sequence-based. For example, cells may be exposed to UV radiation and then screened for the desired phenotype. Mutagenesis with chemical agents is also effective for generating mutants and commonly used substances include chemicals that affect nonreplicating DNA (e.g., HNO2 and NH2OH), as well as agents that affect replicating DNA (e.g., acridine dyes, notable for causing frameshift mutations). Specific methods for creating mutants using radiation or chemical agents are well documented in the art. See, for example: Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, 2nd ed., (1989) Sinauer Associates: Sunderland, Mass.; or Deshpande, Mukund V., Appl. Biochem. Biotechnol., 36: 227–234 (1992).

Another non-specific method of gene disruption is the use of transposable elements or transposons. Transposons are genetic elements that insert randomly in DNA but can be later retrieved on the basis of sequence to determine where the insertion has occurred. Both in vivo and in vitro transposition methods are known. Both methods involve the use of a transposable element in combination with a transposase enzyme. When the transposable element or transposon is contacted with a nucleic acid fragment in the presence of the transposase, the transposable element will randomly insert into the nucleic acid fragment. The technique is useful for random mutagenesis and for gene isolation, since the disrupted gene may be identified on the basis of the sequence of the transposable element. Kits for in vitro transposition are commercially available (see, for example: The Primer Island Transposition Kit, available from Perkin Elmer Applied Biosystems, Branchburg, N.J., based upon the yeast Ty1 element; The Genome Priming System, available from New England Biolabs, Beverly, Mass., based upon the bacterial transposon Tn7; and the EZ::TN Transposon Insertion Systems, available from Epicentre Technologies, Madison, Wiss., based upon the Tn5 bacterial transposable element).

Within the context of the present invention, it may be useful to modulate the expression of the carotenoid biosynthetic pathway by any one of the methods described above. For example, the present invention provides methods leading to the production of C30-aldehyde carotenoids. In addition to over-expressing the sqs, crtM, crtN, and crtN2 genes to promote increased production of C30-aldehyde carotenoids, it may also be useful to up-regulate the initial condensation of 3-carbon compounds (pyruvate and D- glyceraldehyde 3-phosphate) to increase the yield of the 5-carbon compound D-1-deoxyxylulose-5-phosphate (mediated by the dxs gene). This would increase the flux of carbon entering the carotenoid biosynthetic pathway and permit increased production of C30-aldehyde carotenoids. Alternatively (or in addition to), it may be desirable to knockout the crtE genes leading to the synthesis of C40 carotenoids, if the microbial host is capable of synthesizing these types of compounds.

Triple Homologous Recombination Methods for Genetically Engineering Production of C30-Aldehyde Carotenoids in Recombinant Microorganisms

U.S. Ser. No. 10/734,936 teaches a method of targeted in vivo chromosomal engineering using triple homologous recombination to rapidly insert strong promoters upstream of desired elements for gene up-regulation (see FIG. 5). This methodology was used to increase C40 carotenoid (i.e., β-carotene) production in E. coli (U.S. Ser. No. 10/734,778 and U.S. Ser. No. 10/735,442).

This method requires use of: 1.) a recombinant proficient bacterial host (i.e., containing the phage λ-Red recombination system); and 2.) two linear, double-stranded, PCR-generated DNA fragments, wherein homologous recombination produces an “integration cassette” whose general structure is as follows: 5′-RR1-RS-SM-RS-X-RR3-3′, wherein: (i) RR1 is a first homology arm of about 10 to 50 bases having homology to an upstream portion (or first region) of a donor cell chromosome; (ii) RS is a recombination site (e.g., Frt) responsive to a site-specific recombinase (e.g., Flp); (iii) SM is a DNA fragment encoding a selectable marker (e.g., Kan); (iv) X is a first expressible DNA fragment; and (v) RR3 is a third homology arm, having homology to a downstream portion (or second region) of a donor cell chromosome (FIG. 5). Multiple genetic traits can be introduced into one host in a parallel combinatorial fashion, using the bacteriophage P1 in combination with a site-specific recombinase system for removal of selection markers (U.S. Ser. No. 10/734,778).

Expressible DNA fragments are those that will be useful in the genetic engineering of pathways. For example, it may be useful to engineer a strong promoter in place of a native promoter in certain pathways. Alternatively, different coding regions may be introduced downstream of existing native promoters, to thereby introduce new coding regions comprising a biosynthetic pathway to complete or enhance a pathway already in existence in the host cell. Thus, the phage T5 strong promoter is used in the present invention to replace endogenous promoters that modulate the activity of the native dxs, idi, and ispAdxs genes in E. coli, increasing overall carotenoid production.

Integration Cassettes

As used in the present invention, “integration cassettes” are the linear double-stranded DNA fragments chromosomally integrated by homologous recombination via two PCR-generated linear fragments as seen in FIG. 5. The integration cassette comprises a nucleic acid integration fragment that is a promoter and/or gene, a selectable marker bounded by specific recombinase sites responsive to a recombinase, and homology arms having homology to different portions of a donor cell chromosome. The homology arms, generally about 10 to 50 base pairs in length, are chosen so have homology with either a specific sequence on the bacterial chromosome or a specific sequence on another recombination element.

The native promoter of the isoprenoid genes is replaced with the phage T5 strong promoter in combination with a selection marker by using two linear, double-stranded DNA (dsDNA), PCR-generated fragments (FIG. 5).

Integration cassettes may contain one or more genes or coding sequences. These genes may be natural or foreign to the host cell and may include those that have undergone previous modification, such as transposon disruption. In the present method, genes useful in optimization of isoprenoid/carotenoid production are used.

Integration cassettes can include selectable markers, preferably flanked by site-specific recombination sequences, allowing for easy removal of the markers after selection. The selectable marker is selected from the group consisting of antibiotic resistance markers, enzymatic markers wherein the expressed marker catalyzes a chemical reaction creating a measurable difference in phenotypic appearance, and amino acid biosynthesis enzymes which enable a normally auxotrophic bacteria to grow without the exogenously supplied amino acid; the amino acid synthesized by the amino acid biosynthesis enzyme.

Îť-Red Recombinase System

The terms “recombinase” or “recombinase system” refer to one or more enzymes, which either work alone or in combination to stimulate homologous recombination. The “λ-Red recombinase”, “λ-Red recombination system”, and “λ-Red system” are used interchangeably to describe a group of enzymes encoded by the bacteriophage λ genes exo, bet, and gam. The enzymes encoded by the three genes work together to increase the rate of homologous recombination in E. coli, an organism generally considered to have a relatively low rate of homologous recombination; especially when using linear recombination elements.

Bacteriophage P1 Transduction System

Transduction is a phenomenon in which bacterial DNA is transferred from one bacterial cell (the donor) to another (the recipient) by a phage particle containing bacterial DNA. When a population of donor bacteria is infected with a phage, the events of the phage lytic cycle may be initiated. During lytic infection, the enzymes responsible for packaging viral DNA into the bacteriophage sometimes accidentally package host DNA. The resulting particle is called a transducing particle. Upon lysis of the cell these particles, called P1 lysate, are released along with normal virions, and so the lysate contains a mixture of normal virions and transducing particles. When this lysate is used to infect a population of recipient cells, most of the cells become infected with normal virus. However, a small proportion of the population receives transducing particles that inject the DNA they received from the previous host bacterium. This DNA can now undergo genetic recombination with the DNA of the another host. Conventional P1 transduction can move only one genetic trait (i.e. gene) at a time from one to another host. The Applicants used this method for stacking multiple genetic traits into one E. coli host in a parallel fashion using the bacteriophage P1 mixtures in combination with the site-specific recombinase system for removal of selection markers.

Preferred Microbial Hosts

Preferred heterologous host cells for expression of the C30 lower carotenoid biosynthetic pathway genes (i.e., crtM, sqs, crtN, crtN2) are microbial hosts that can be found broadly within the fungal or bacterial families and which grow over a wide range of temperature, pH values, and solvent tolerances. For example, it is contemplated that any bacteria, yeast, and filamentous fungi will be suitable hosts for expression of the present nucleic acid fragments. Because transcription, translation and the protein biosynthetic apparatus is the same irrespective of the cellular feedstock, functional genes are expressed irrespective of carbon feedstock used to generate cellular biomass. Large-scale microbial growth and functional gene expression may utilize a wide range of simple or complex carbohydrates, organic acids and alcohols, and/or saturated hydrocarbons such as methane or carbon dioxide in the case of photosynthetic or chemoautotrophic hosts. However, the functional genes may be regulated, repressed or depressed by specific growth conditions, which may include the form and amount of nitrogen, phosphorous, sulfur, oxygen, and carbon or any trace micronutrient including small inorganic ions. In addition, the regulation of functional genes may be achieved by the presence or absence of specific regulatory molecules that are added to the culture and are not typically considered nutrient or energy sources. Growth rate may also be an important regulatory factor in gene expression.

Examples of host strains include, but are not limited to: fungal or yeast species such as Aspergillus, Trichoderma, Saccharomyces, Pichia, Phaffia, Candida, Rhodotorula, Rhodosporidium, Hansenula; or bacterial species such as Salmonella, Bacillus, Acinetobacter, Zymomonas, Agrobacterium, Erythrobacter, Chlorobium, Chromatium, Flavobacterium, Cytophaga, Rhodobacter, Rhodococcus, Streptomyces, Brevibacterium, Corynebacteria, Mycobacterium, Deinococcus, Escherichia, Erwinia, Pantoea, Pseudomonas, Sphingomonas, Methylomonas, Methylobacter, Methylococcus, Methylosinus, Methylomicrobium, Methylocystis, Methylobacterium, Alcaligenes, Synechocystis, Synechococcus, Anabaena, Thiobacillus, Methanobacterium, Klebsiella, Myxococcus, and Staphylococcus.

In a preferred embodiment, E. coli is used as a host for heterologous carotenoid production since genes of the C30 lower carotenoid biosynthetic pathway can be functionally expressed in this organism, many genetic tools are available for use, and the organism is often used as a production host for large-scale bioprocesses.

Engineering E. coli for increased carotenoid production has frequently focused on overexpression of key isoprenoid pathway genes from multi-copy plasmids; however, engineering the supply of isoprenoid precursors for increased production of exogenous carotenoids is often necessary. It has been shown that a rate-limiting step in carotenoid biosynthesis is the isomerization of IPP to DMAPP (Kajiwara et al., Biochem. J. 423: 421–426 (1997)). It was also found that the conversion from FPP to GGPP is the first functional limiting step for the production of C40 carotenoids in E. coli (Wang et al., Biotchnol. Prog. 62: 235–241 (1999)). Transformation of E. coli with the genes for overexpression of isopentenyl diphosphate isomerase (idi), deoxy-D-xylulose-5-phosphate (DXP) synthase (dxs), and DXP reductoisomerase (dxr) from various sources was found to increase production of carotenoids by a factor of 3.5 (Albrecht et al., Biotechnol. Lett. 21:791–795 (1999)). Thus, numerous modifications via metabolic engineering are possible to increase the production of carotenoids in this host.

Industrial Production of C30-Aldehyde Carotenoids in a Recombinant Microbial Host

Where commercial production of the instant C30-aldehyde carotenoid compounds are desired, a variety of culture methodologies may be applied. For example, large-scale production of a specific gene product overexpressed from a recombinant microbial host may be produced by both batch and continuous culture methodologies.

A classical batch culturing method is a closed system where the composition of the media is set at the beginning of the culture and not subject to artificial alterations during the culturing process. Thus, at the beginning of the culturing process the media is inoculated with the desired organism or organisms and growth or metabolic activity is permitted to occur (while adding nothing to the system). Typically, however, a “batch” culture is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration. In batch systems the metabolite and biomass compositions of the system change constantly up to the time the culture is terminated. Within batch cultures cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase, where growth rate is diminished or halted. If untreated, cells in the stationary phase will eventually die. Cells in log phase are often responsible for the bulk of production of end product or intermediate in some systems. Stationary or post-exponential phase production can be obtained in other systems.

A variation on the standard batch system is the Fed-Batch system. Fed-Batch culture processes are also suitable in the present invention and comprise a typical batch system with the exception that the substrate is added in increments as the culture progresses. Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the media. Measurement of the actual substrate concentration in Fed-Batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as CO2. Batch and Fed-Batch culturing methods are common and well known in the art; examples may be found in Brock (supra) or Deshpande (supra).

Commercial production of the instant carotenoids may also be accomplished with a continuous culture. Continuous cultures are an open system where a defined culture media is added continuously to a bioreactor and an equal amount of conditioned media is removed simultaneously for processing. Continuous cultures generally maintain the cells at a constant high liquid phase density where cells are primarily in log phase growth. Alternatively, continuous culture may be practiced with immobilized cells where carbon and nutrients are continuously added and valuable products, by-products, or waste products are continuously removed from the cell mass. Cell immobilization may be performed using a wide range of solid supports composed of natural and/or synthetic materials.

Continuous or semi-continuous culture allows for the modulation of one factor or any number of factors that affect cell growth or end product concentration. For example, one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate. In other systems, a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant. Continuous systems strive to maintain steady state growth conditions and thus the cell loss due to media being drawn off must be balanced against the cell growth rate in the culture. Methods of modulating nutrients and growth factors for continuous culture processes, as well as techniques for maximizing the rate of product formation, are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, supra.

Fermentation media in the present invention must contain suitable fermentable carbon substrates. Suitable substrates may include, but are not limited to: monosaccharides (e.g., glucose and fructose), disaccharides (e.g., lactose or sucrose), polysaccharides (e.g., starch or cellulose or mixtures thereof), and unpurified mixtures from renewable feedstocks (e.g., cheese whey permeate, cornsteep liquor, sugar beet molasses, and barley malt). Additionally, the carbon substrate may also be one-carbon (single carbon) substrates such as carbon dioxide, methane or methanol for which metabolic conversion into key biochemical intermediates has been demonstrated. In addition to one and two carbon substrates, methylotrophic organisms are also known to utilize a number of other carbon-containing compounds such as methylamine, glucosamine and a variety of amino acids for metabolic activity. For example, methylotrophic yeast are known to utilize the carbon from methylamine to form trehalose or glycerol (Bellion et al., Microb. Growth C1 Compd., [Int. Symp.], 7th (1993), pp 415–32. Murrell, J. Collin and Don P. Kelly, Eds. Intercept: Andover, UK). Similarly, various species of Candida will metabolize alanine or oleic acid (Sulter et al., Arch. Microbiol. 153:485–489 (1990)). Hence it is contemplated that the source of carbon utilized in the present invention may encompass a wide variety of carbon-containing substrates and will only be limited by the choice of organism.

In vitro Bio-Conversion of Carotenoids

Alternatively, it is possible to carry out the bioconversions of the present application in vitro. Where substrates for the crtM, sqs, crtN and crtN2 enzymes are not synthesized endogenously by the host cell, it will be possible to add the substrate exogenously. In this embodiment the suitable carotenoid substrate may be solubilized with mild detergent (e.g., DMSO) or mixed with phospholipid vesicles. To assist in transport into the cell, the host cell may optionally be permeabilized with a suitable solvent such as toluene. Methods for this type of in-vitro bio-conversion of carotenoid substrates has basis in the art (see for example: Hundle, B. S., et al., FEBS 315:329–334 (1993); and Bramley, P. M., et al., Phytochemistry 26:1935–1939 (1987)).

Genetically Engineered Recombinant Plants for Production of C30-Aldehyde Carotenoids

Plants and algae are also known to produce carotenoid compounds. The nucleic acid fragments of the C30 lower carotenoid biosynthetic pathway (i.e., crtM, sqs, crtN, and crtN2) may be used to create transgenic plants having the ability to express these genes for the production of C30-aldehyde carotenoids.

Preferred plant hosts will be any variety that will support a high production level of the instant carotenoids. Thus, suitable green plants will include, but are not limited to: soybean, rapeseed (Brassica napus, B. campestris), pepper, sunflower (Helianthus annus), cotton (Gossypium hirsutum), corn, tobacco (Nicotiana tabacum), alfalfa (Medicago sativa), wheat (Triticum sp.), barley (Hordeum vulgare), oats (Avena sativa, L), sorghum (Sorghum bicolor), rice (Oryza sativa), Arabidopsis, cruciferous vegetables (e.g., broccoli, cauliflower, cabbage, parsnips, etc.), melons, carrots, celery, parsley, tomatoes, potatoes, strawberries, peanuts, grapes, grass seed crops, sugar beets, sugar cane, beans, peas, rye, flax, hardwood trees, softwood trees, marigold flower and forage grasses. Algal species include, but are not limited to commercially significant hosts such as Spirulina, Haemotacoccus, and Dunalliela.

Overexpression of C30-aldehyde carotenoid compounds in these hosts may be accomplished by first constructing chimeric genes of the present invention in which the coding regions are operably linked to promoters capable of directing expression of a gene in the desired plant tissues at the desired stage of development. For reasons of convenience, the chimeric genes may comprise promoter sequences and translation leader sequences derived from the same genes. 3′ Non-coding sequences encoding transcription termination signals must also be provided. The instant chimeric genes may also comprise one or more introns in order to facilitate gene expression.

Any combination of any promoter and any terminator capable of inducing expression of a coding region may be used in the chimeric genetic sequence. Some suitable examples of promoters and terminators include those from nopaline synthase (nos), octopine synthase (ocs) and cauliflower mosaic virus (CaMV) genes. One type of efficient plant promoter that may be used is a high-level plant promoter. Such promoters, in operable linkage with the genetic sequences of the present invention should be capable of promoting expression of the present gene product(s). High-level plant promoters that may be used in this invention, for example, include the promoter of the small subunit (ss) of the ribulose-1,5-bisphosphate carboxylase from soybean (Berry-Lowe et al., J. Molecular and App. Gen., 1:483–498 1982)) and the promoter of the chlorophyll a/b binding protein. These two promoters are known to be light-induced in plant cells (see, for example, Genetic Engineering of Plants, an Agricultural Perspective, A. Cashmore, Plenum: N.Y. (1983), pp 29–38; Coruzzi, G. et al., J. Biol. Chem. 258:1399 (1983); and Dunsmuir, P. et al., J. Mol. Appl. Genetics 2:285 (1983)).

Plasmid vectors comprising the instant chimeric genes can then be constructed. The choice of plasmid vector depends upon the method that will be used to transform host plants. The skilled artisan is well aware of the genetic elements that must be present on the plasmid vector in order to successfully transform, select and propagate host cells containing the chimeric gene. For example, techniques of transformation include: 1.) transformation with DNA employing A. tumefaciens or A. rhizogenes as the transforming agent; 2.) direct uptake of foreign DNA constructs (see EP 295959); 3.) techniques of electroporation (see Fromm et al., Nature (London) 319:791 (1986)); or 4.) high-velocity ballistic bombardment with metal particles coated with the nucleic acid constructs (see Kline et al., Nature (London) 327:70 (1987); U.S. Pat. No. 4,945,050). Once transformed, the cells can be regenerated by those skilled in the art. This typically requires the transgenic plant cells to be placed in an appropriate selective medium for selection of transgenic cells that are then grown to callus. Shoots are grown from callus and plantlets generated from the shoot by growing in rooting medium. The various constructs normally will be joined to a marker for selection in plant cells. Conveniently, the marker may be resistance to a biocide (particularly an antibiotic such as kanamycin, G418, bleomycin, hygromycin, chloramphenicol, herbicide, or the like). The particular marker used will allow for selection of transformed cells as compared to cells lacking the DNA that has been introduced.

The skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al., EMBO J. 4:2411–2418 (1985); De Almeida et al., Mol. Gen. Genetics 218:78–86 (1989)), and thus multiple events must be screened in order to obtain lines displaying the desired expression level and pattern. Such screening may be accomplished by Southern analysis of DNA blots (Southern, J. Mol. Biol. 98:503 (1975)), Northern analysis of mRNA expression (Kroczek, J. Chromatogr. Biomed. Appl. 618(1–2):133–145 (1993)), Western analysis of protein expression, or phenotypic analysis.

For some applications it will be useful to direct the instant proteins to different cellular compartments. It is thus envisioned that the chimeric genes encoding enzymes of the C30 lower carotenoid biosynthetic pathway may be further supplemented by altering the coding sequences to encode the enzymes with appropriate intracellular targeting sequences such as transit sequences (Keegstra, K., Cell 56:247–253 (1989)), signal sequences, sequences encoding endoplasmic reticulum localization (Chrispeels, J. J., Ann. Rev. Plant Phys. Plant Mol. Biol. 42:21–53 (1991)), or nuclear localization signals (Raikhel, N., Plant Phys. 100:1627–1632 (1992)) added and/or with targeting sequences that are already present removed. While the references cited give examples of each of these, the list is not exhaustive and more targeting signals of utility may be discovered in the future that will be useful in the invention.

EXAMPLES

The present invention is further defined in the following Examples. It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.

General Methods

Standard recombinant DNA and molecular cloning techniques used in the Examples are well known in the art and are described by Maniatis (supra), Silhavy et al. (supra), and Ausubel et al. (supra).

Materials and methods suitable for the maintenance and growth of bacterial cultures are well known in the art. Techniques suitable for use in the following examples may be found as set out in: Manual of Methods for General Bacteriology (Phillipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Eugene W. Nester, Willis A. Wood, Noel R. Krieg and G. Briggs Phillips, Eds), American Society for Microbiology: Washington, D.C. (1994)); Brock (supra); or by Deshpande (supra). All reagents, restriction enzymes and materials used for the growth and maintenance of bacterial cells were obtained from Aldrich Chemicals (Milwaukee, Wiss.), DIFCO Laboratories (Detroit, Mich.), GIBCO/BRL (Gaithersburg, Md.), or Sigma Chemical Company (St. Louis, Mo.), unless otherwise specified.

Manipulations of genetic sequences were accomplished using the suite of programs available from the Vector NTI version 7.0 (Informax, Inc., Bethesda, Md.) which default values were used.

The meaning of abbreviations is as follows: “sec” means second(s), “min” means minute(s), “h” means hour(s), “d” means day(s), “μL” means microliter(s), “mL” means milliliter(s), “L” means liter(s), “μM” means micromolar, “mM” means millimolar, “M” means molar, “mmol” means millimole(s), “μmol” mean micromole(s), “g” means gram(s), “μg” means microgram(s), “ng” means nanogram(s), “U” means unit(s), “bp” means base pair(s), and “kB” means kilobase(s).

Additionally, antibiotics used for selection of microbial strains will be abbreviated as follows: “Kan” means kanamycin, “Amp” means ampicillin, “Tet” means tetracycline, and “Cam” means chloramphenicol.

Plasmids

For ease of understanding, the following plasmids were used in these studies.

TABLE 4
Plasmids Used in this Application
Plasmid Backbone Expressed gene(s) and Organism1
pDCQ150 pCR2.1-TOPO crtN1 (16a)-ald (16a)-crtN2 (16a)
pDCQ153 pTrcHis2-TOPO crtM (S. aureus)
pDCQ155 pTrcHis2-TOPO crtM (S. aureus)-crtN (16a)-ald (16a)-
crtN2 (16a)
pDCQ155::T pTrcHis2-TOPO crtM (S. aureus)-crtN (16a)-[ald
n5 p33 (16a)]*-crtN2 (16a)
*ald(16a) knock-out
pDCQ165 pTrcHis2-TOPO crtM (S. aureus)-crtN (S. aureus)
pDCQ166 pBHR12 crtM (S. aureus)-crtN (S. aureus)
pDCQ167 pTrcHis2-TOPO crtN2 (16a)
pDCQ174 pTrcHis2-TOPO crtN (16a)
pDCQ175 pTrcHis2-TOPO crtN (16a) with artificial
ribosome binding site
pDCQ176 pTrcHis2-TOPO crtN2 (16a) with artificial
ribosome binding site
pDCQ177 pTrcHis2-TOPO crtN (16a)-crtN2 (16a)
pDCQ178 pTrcHis2-TOPO crtN2 (16a)-crtN (16a)
1Organism refers to that from which the gene was isolated (16a = Methylomonas 16a; S. aureus = Staphylococcus aureus).
2MoBiTec (Goettingen, Germany)

Microbial Cultivation for Methylomonas sp. 16a

The conditions described in published U.S. patent application US 2003003528 (herein incorporated by reference) were used throughout the experimental Examples for treatment of Methylomonas 16a, unless conditions were specifically mentioned to be different. Briefly, this involved growing Methylomonas 16a in serum stoppered Wheaton bottles (Wheaton Scientific, Wheaton Ill.) using a gas/liquid ratio of at least 8:1 (i.e., 20 mL of Nitrate liquid “BTZ-3” media in 160 mL total volume) at 30° C. with constant shaking. The standard gas phase for cultivation contained 25% methane in air.

Nitrate liquid medium, also referred to herein as “defined medium” or “BTZ-3” medium was comprised of various salts mixed with Solution 1 as indicated below (Tables 5 and 6) or where specified the nitrate was replaced with 15 mM ammonium chloride. Solution 1 provides the composition for 100-fold concentrated stock solution of trace minerals.

TABLE 5
Solution 1*
Conc.
MW (mM) g per L
Nitriloacetic acid 191.1 66.9 12.8
CuCl2 × 2H2O 170.48 0.15 0.0254
FeCl2 × 4H2O 198.81 1.5 0.3
MnCl2 × 4H2O 197.91 0.5 0.1
CoCl2 × 6H2O 237.9 1.31 0.312
ZnCl2 136.29 0.73 0.1
H3BO3 61.83 0.16 0.01
Na2MoO4 × 2H20 241.95 0.04 0.01
NiCl2 × 6H2O 237.7 0.77 0.184
*Mix the gram amounts designated above in 900 mL of H2O, adjust to pH = 7, and add H2O to an end volume of 1 L. Keep refrigerated.

TABLE 6
Nitrate liquid medium (BTZ-3)**
Conc.
MW (mM) g per L
NaNO3 84.99 10 0.85
KH2PO4 136.09 3.67 0.5
Na2SO4 142.04 3.52 0.5
MgCl2 × 6H2O 203.3 0.98 0.2
CaCl2 × 2H2O 147.02 0.68 0.1
1 M HEPES (pH 7) 238.3  50 mL
Solution 1  10 mL
**Dissolve in 900 mL H2O. Adjust to pH = 7, and add H2O to give 1 L. For agar plates: Add 15 g of agarose in 1 L of medium, autoclave, let cool down to 50° C., mix, and pour plates.

HPLC Analysis of Carotenoid Content

The following HPLC protocol was used for carotenoid analysis, unless otherwise indicated. A Beckman System Gold® HPLC with Beckman Gold Nouveau Software (Columbia, Md.) was used for the study, along with a 125×4 mm RP8 (5 μm particles) column with corresponding guard column (Hewlett-Packard, San Fernando, Calif.). The spectral data was collected by a Beckman photodiode array detector (Model 168).

For analysis of carotenoid content, the following HPLC parameters were used: flow rate: 1 mL/min; solvent program: 0–11.5 min linear gradient from 40% water/60% methanol to 100% methanol, 11.5–20 min 100% methanol, 20–30 min 40% water/60% methanol.

Example 1

Native Carotenoid of Methylomonas 16a

HPLC analysis of acetone extracts of the native carotenoids produced by Methylomonas 16a confirmed that one major carotenoid (net retention volume at about 6 mL) is responsible for the pink coloration of the wild-type Methylomonas 16a cells.

Specifically, for carotenoid determination, Methylomonas 16a was grown in 100 mL BTZ-3 medium under methane (25%) for three days to stationary phase. Cells were spun down, washed with distilled water, and freeze-dried (lyophilizer: Virtis, Gardiner, N.Y.) for 24 hr in order to determine dry-weights. After the dry-weight of each culture was determined, cells were extracted.

First, cells were welled with 0.4 mL of water and let stand for 15 min. After 15 min, 4 mL of acetone was added and thoroughly vortexed to homogenize the sample. The samples were then shaken at 30° C. for 1 h, and then centrifuged. Pink coloration was observed in the supernatant. The supernatant was collected and pellets were extracted again with 0.3 mL of water and 3 mL of acetone. The supernatants from the second extraction were lighter pink in color. The supernatants of both extractions were combined. Their volumes were measured and analyzed spectrophotometrically.

A crude acetone extract from Methylomonas 16a cells has a typical absorption spectrum 460 nm, 491 nm, 522 nm measured by spectrophotometer (Amersham Pharmacia Biotech, Piscataway, N.J.).

In order to confirm the structure of this major carotenoid, Methylobacterium rhodinum (formerly Pseudomonas rhodos; ATCC 14821) of which C30-carotenoid was identified was used as a reference strain (Kleinig et al., Z. Naturforsch 34c:181–185 (1979); Kleinig and Schmitt, Z. Naturforsch 37c:758–760 (1982)). A saponified extract of Methylobacterium rhodinum and of Methylomonas 16a were compared by HPLC analysis under the same conditions as described above. The results are shown as follows:

  • Saponified M. rhodinum:
    • Absorption maxima: 460 nm, 487 nm, 517 nm
  • Net retention volume=1.9 mL
    Saponified Methylomonas 16a:
    • Absorption maxima: 460 nm, 488 nm, 518 nm
    • Net retention volume=2.0 mL
      HPLC analysis results suggested that the carotenoid from Methylomonas 16a has the same C30 carotenoic acid backbone as that from Methylobacterium rhodinum. Chemical reduction experiments were also performed to verify the carboxylation of the 16a carotenoid. The carotenoid carboxylic acids or their esters can only be reduced by LiAIH4 to their primary corresponding carotenols. The carbonyl function of carotenoid aldehydes or ketones can be reduced by NaBH4 or LiAIH4 to alcohol.

Experiments showed that the 16a native carotenoid was reduced by LiAIH4 as indicated by color change from pink to yellow (as well as the HPLC analysis). However, it could not be reduced by NaBH4. The results were consistent with the presence of a carboxylic acid or ester in the native 16a carotenoid.

Example 2

Identification and Characterization of Bacterial Genes from Methylomonas

Genomic DNA was isolated from Methylomonas 16a, prepared and used for library construction and shotgun sequencing, according to the procedures described in WO 02/18617.

Subsequently, all sequences were identified by conducting BLAST (Basic Local Alignment Search Tool; Altschul, S. F., et al., J. Mol. Biol. 215:403–410 (1993); see also www.ncbi.nlm.nih.gov/BLAST/) searches for similarity to sequences contained in the BLAST “nr” database (comprising all non-redundant GenBank® CDS translations, sequences derived from the 3-dimensional structure Brookhaven Protein Data Bank, the SWISS-PROT protein sequence database, EMBL, and DDBJ databases). The sequences were analyzed for similarity to all publicly available DNA sequences contained in the “nr” database using the BLASTN algorithm provided by the National Center for Biotechnology Information (NCBI). The DNA sequences were translated in all reading frames and compared for similarity to all publicly available protein sequences contained in the “nr” database using the BLASTX algorithm (Gish, W. and States, D. J., Nature Genetics 3:266–272 (1993)) provided by the NCBI. All comparisons were done using either the BLASTNnr or BLASTXnr algorithm.

The results of these BLAST comparisons are given below in Table 7 for genes of the present invention. Table 7 summarizes the sequence to which each Methylomonas gene has the most similarity (presented as % similarities, % identities, and expectation values). The table displays data based on the BLASTXnr algorithm with values reported in Expect values. The Expect value estimates the statistical significance of the match, specifying the number of matches, with a given score, that are expected in a search of a database of this size absolutely by chance.

Two carotenoid biosynthesis gene clusters were identified in the genomic sequence of Methylomonas sp. 16a, as shown in FIG. 3A. The first gene cluster was identified containing 2 genes. The gene sqs (ORF 1) encodes a putative squalene synthase with the highest BLAST hit to squalene synthase from Methylococcus capsulatus (60% identity and 73% similarity). The second gene was identified as a squalene-hopene cyclase (Shc) encoded by the shc gene. Shc catalyzes the complex cyclization of squalene to the pentacyclic triterpene skeleton of hopanoids, a pathway that is not related to the lower carotenoid pathway.

In a second operon, three genes were encoded on this cluster (FIG. 3A). The first gene (designated crtN; ORF 2) encodes a putative diapophytoene dehydrogenase with the highest BLAST hit to a diapophytoene dehydrogenase from Heliobacillus mobilis (34% identity and 58% similarity). The middle gene (designated aid; ORF 3) encodes a putative aldehyde dehydrogenase with the highest BLAST hit to a betaine aldehyde dehydrogenase from Arabidopsis thaliana (33% identity and 50% similarity). The third gene (designated crtN2; ORF 4) also encodes a putative diapophytoene dehydrogenase with the highest BLAST hit to a hypothetical protein of a phytoene dehydrogenase family from Staphylococcus aureus (51% identity and 67% similarity).

TABLE 7
Identification of Methvlomonas sp. 16a Genes Based on Sequence Homology
ORF Gene Similarity SEQ ID % %
Name Name Identified SEQ ID peptide Identity a Similarity b E-value c Citation
1 sqs emb|CAA71097.1 1 2 60 73 e−109 Tippelt, A. et al.,
squalene synthase Biochim. Biophys. Acta
[Methylococcus 1391(2): 223–232 (1998)
capsulatus]
2 crtN pir|T31463|CrtN 3 4 34 58 e−93  Xiong, J. et al.,
diapophytoene P.N.A.S. 95(6685): 14851–
dehydrogenase 14856(1998)
[Heliobacillus mobilis]
3 ald gb|AAG50992.1|AC036 5 6 33 50 4e−66  Lin, X. et al.,
106_5 Unpublished
betaine aldehyde
dehydrogenase
[Arabidopsis thaliana]
4 crtN2 dbj|BAB43655.1| 7 8 51 67 e−133 Kuroda, M. et al.,
hypothetical protein Lancet 397(9264): 1225–
ORF SA2351 1240(1998)
[Staphylococcus
aureus]
a % Identity is defined as percentage of amino acids that are identical between the two proteins.
b % Similarity is defined as percentage of amino acids that are identical or conserved between the two proteins.
c Expect value. The Expect value estimates the statistical significance of the match, specifying the number of matches, with a
given score, that are expected in a search of a database of this size absolutely by chance.
% Identity, % similarity, and e-values are all reported according to BLAST analysis.

Example 3

Preliminary Synthesis of Diapocarotene Dialdehyde in Recombinant E. coli

The Methylomonas 16a carotenoid gene cluster crtN-ald-crtN2, in conjunction with the Staphylococcus aureus crtM, was expressed in an E. coli strain (E. coli is naturally able to synthesize FPP using the upstream isoprenoid pathway shown in FIG. 1). Upon disruption of the ald gene by transposon mutagenesis, diapocarotene dialdehyde was detected in the transformed host.

Synthesis of Plasmid pDCQ153 (Comprising Staphylococcus crtM)

First, the staphylococcal crtM gene (SEQ ID NO:9) was shown to encode a dehydrosqualene synthase (Wieland, et al., J. Bacteriol. 176:7719–7726 (1994)). Primers crtM_F/Staphyl (SEQ ID NO:15) and crtM_R/Staphyl (5′-ggatcctatattctatgatatttactatttatttc-3′; SEQ ID NO:16) (incorporated BamHI site is underlined) were used to amplify the 869 bp crtM gene from Staphylococcus aureus ATCC 35556. The amplified gene product was cloned into the pTrcHis2-TOPO expression vector (Invitrogen, Carlsbad, Calif.) and the resulted construct, with crtM gene in the forward orientation, was designated as pDCQ153 (Table 4).

Synthesis of Plasmid pDCQ155 (comprising the Methylomonas crtN-ald-crtN2 gene cluster) and Analysis of E. coli Transformants

Then, primers crtN_FL (5′-GGTCTCAAATTGCATCMCGGATCATC ATGGCCMC-3′; SEQ ID NO:17) and crtN_RL (5′-GGTCTCTAATTGCTAGCTTA TTGCA MTCCGCCACMTCTTGTC-3′; SEQ ID NO:18) (incorporated Bsal sites are underlined) were used to amplify the 4668 bp crtN-ald-crtN2 gene cluster from Methylomonas 16a. The amplified product was first cloned into the pCR2.1-TOPO vector (Invitrogen) to form pDCQ150. The Bsal fragment of pDCQ150 containing the crtN-ald-crtN2 cluster was then cloned into the EcoRI site downstream of the staphylococcal crtM gene in pDCQ153. The resulting construct, pDCQ155, contained the ciM gene and the crtN-ald-crtN2 genes in the same orientation and under the control of the trc promoter from the pTrcHis2-TOPO vector (Invitrogen).

HPLC analysis of the E. coli pink transformants of pDCQ155 showed the presence of a carotenoid with the same absorption spectra (465 nm, 489–491 nm, 518–520 nm) as the 16a native carotenoid, suggesting that C30 carboxy-carotenoid was produced in the recombinant E. coli strain. The retention time of the carotenoid from E. coli (11.4 min) was different from that of the 16a native carotenoid (12.7 min); however, this most likely resulted from the lack of ester formation in E. coli.

Transposon Mutagenesis of PDCQ155

The C30 dialdehyde carotenoid (“diapocarotene dialdehyde”) accumulated in E. coli following disruption of the aldehyde dehydrogenase (ald) gene by a transposon in pDCQ155. This was achieved as follows: in vitro transposon mutagenesis was performed on pDCQ155 DNA using EZ::TN™ <TET-1>Insertion Kit (Epicentre, Madison, Wiss.). The transposon treated pDCQ155 DNA was transformed into E. coil TOP10 competent cells (Invitrogen). Cells containing transposon insertions were selected on LB plates with 10 μg/mL tetracycline. Transposon mutations were screened by PCR and further sequenced to confirm the insertion sites. Primers for screening included Tet-1 FP (SEQ ID NO:19) and crtN_R (SEQ ID NO:20). E. coli cells carrying various transposon insertions in pDCQ155 were cultured in 200 mL LB medium with 100 μg/mL Amp or 10 μg/mL Tet at 30° C. for 2 days. Cells were pelleted by centrifugation at 4000 g for 15 min. Carotenoids were extracted from the cell pellets with 10 mL methanol followed by 10 mL acetone, then dried under nitrogen and redissolved in 1 mL of methanol. Each sample of 100 μL was analyzed via HPLC as described in the General Methods.

Mutant p33, with a transposon insertion in the ald gene, produced the 4,4′-diapocarotene dialdehyde (round-shaped absorption at 507 nm) as well as the precursor, diapophytoene (maxima: 286 nm, 298 nm). NaBH4 was added to the red-pigmented solution, causing a reduction to a yellow-pigmented solution whose pigment showed the absorption spectra of 442 nm, 468 nm, 498 nm. Reduction by NaBH4 suggested that the red pigment produced in mutant p33 is an aldehyde carotenoid and not a carboxyl-carotenoid.

Example 4

Assembly of an Engineered Pathway to Increase C30 Dialdehyde Synthesis in E. coli

Although the previous example demonstrated production of diapocarotene dialdehyde using the Staphylococcus crtM and the Methylomonas crtN-ald-crtN2 gene cluster, it was desirable to develop an engineered pathway to maximize production of the C30 dialdehyde. Since two sets of genes could conceivably be used to synthesize C30-aldehyde carotenoids in E. coli (derived from Methylomonas sp. 16a and/or Staphylococcus aureus), initial experimentation focused on determining which combinations of Staphylococcus and Methylomonas genes would permit maximal C30-dialdehyde production in E. coli.

The conversion of FPP to diapophytoene could be achieved with the Staphylococcus CrtM (SEQ ID NO: 10). The Methylomonas sqs (SEQ ID NO:1) encodes a squalene synthase that converts FPP mainly to squalene, although a small amount of diapophytoene may also be produced based on the enzyme's partial diapophytoene synthase activity.

Staphylococcus CrtN (SEQ ID NO: 12) catalyzes desaturation of diapophytoene to form diaponeurosporene. Methylomonas CrtN (SEQ ID NO:4) catalyzes one additional desaturation step on diapophytoene to form diapocarotene. Thus, for synthesis of the C30 monoaldehyde, the Staphylococcus CrtN is preferred. In contrast, synthesis of the C30 dialdehyde requires the Methylomonas CrtN. Despite this rationale, since the crtN genes from Staphylococcus (SEQ ID NO:11) and Methylomonas (SEQ ID NO:3) shared only 57% identity at the nucleotide level, both crtN genes were included in the engineered pathway to increase desaturase activity for C30 dialdehyde synthesis.

Finally, the conversion of diapocarotene to diapocarotene dialdehyde could be achieved with either the Methylomonas CrtN2 (SEQ ID NO:8) or the Staphylococcus CrtN2 (SEQ ID NO:14). In the preferred embodiment, the Methylomonas CrtN2 was used for the aldehyde group addition.

Thus, the Staphylococcus crtM gene (SEQ ID NO:9), Staphylococcus crtN gene (SEQ ID NO:11), Methylomonas crtN (SEQ ID NO:3) and Methylomonas crtN2 (SEQ ID NO:7) genes were chosen for the assembly of the engineered pathway, as shown in FIG. 6. Following determination of the “set” of genes which it would be desirable to express in E. coli for synthesis of the C30 dialdehyde, the engineered pathway was then created, as described below.

Synthesis of Plasmid PDCQ166 (Comprising the Staphylococcus crtM-crtN gene cluster)

First, the crtM-crtN gene cluster from Staphylococcus was PCR amplified from genomic DNA of Staphylococcus aureus NCTC 8325 (ATCC 35556) using forward primer crtM_F/NCTC (5′-gaattcaggaggaataaaccatgacaatgatggatatgaattttaaa-3′; SEQ ID NO:21) and reverse primer crtN_R/NCTC (5′-gaattcttatacgccccgctcaatatctt-3′; SEQ ID NO:22). Underlined in the primers are the incorporated EcoRI sites and the bold text indicates an artificial ribosome binding site. The 2410 bp PCR product was first cloned in the pTrcHis2-TOPO (Invitrogen) cloning vector, resulting in pDCQ165.

The 2.4 kb EcoRI fragment from pDCQ165 containing the Staphylococcus crtM and crtN genes was ligated into the EcoRI site of vector pBHR1 (MoBiTec, Goettingen, Germany) to create pDCQ166, in which the crtM and crtN genes are expressed under the control of the chloramphenicol resistant gene promoter.

Synthesis of Plasmids pDCQ177 and pDCQ178 (Comprising Methylomonas crtN-crtN2 Gene Clusters)

crtN and crtN2 from Methylomonas were first individually cloned with and without an artificial ribosomal binding site (RBS) in pTrcHis2-TOPO (Invitrogen) resulting in pDCQ174, pDCQ167, pDCQ175 and pDCQ176, respectively. The 1542 bp crtN was amplified from 16a genomic DNA using primers crtN—5′/16a (SEQ ID NO:23) and crtN—3′/16a (5′-ggatcctcaggctttggcttttttcagc-3′; SEQ ID NO:24). The 1499 bp crtN2 was amplified using primers crtN2_F3/16a (SEQ ID NO:25) and crtN2_R/16a (5′-gaattctattgcaaatccgccacaatct-3′; SEQ ID NO:26). The 1574 bp crtN with RBS was amplified using primers crtN—5′—2/16a (5′-ggatccaagcttaaggaggaataaacc atggccaacaccaaacacatca-3′; SEQ ID NO:27) and crtN—3′—2/16a (5′-ggatccaagcttcaggctttggcttttttcagc-3′; SEQ ID NO:28). The 1531 bp crtN2 with RBS was amplified using primers crtN2—5′—2/16a (5′-ggatccaagcttaaggaggaataaaccatgaactcaaatgacaaccaacgc-3′; SEQ ID NO:29) and crtN2—3′—2/16a (5′-ggatccaagcttattgcaaatccgccacaatctt-3′; SEQ ID NO:30). Underlined in the primers are incorporated restriction sites and the bold text indicates an artificial ribosome binding site (RBS).

The Methylomonas crtN and crtN2 were then strung together by subcloning. Specifically, the approximately 1.5 kb HindIII fragment from pDCQ176 or pDCQ175, containing the crtN2 or crtN gene with an artificial ribosome binding site, was subcloned into the unique HindIII site in pDCQ174 and pDCQ167, resulting in plasmids pDCQ177 and pDCQ178, respectively. pDCQ177 carries the crtN-crtN2 construct, in which crtN was closer to the trc promoter on the vector; in contrast, pDCQ178 carries the crtN2-crtN construct, in which crtN2 was closer to the trc promoter.

E. coli MG1655 cells were co-transformed with pDCQ166 (containing Staphylococcus crtM-citN genes) and either pDCQ177 or pDCQ178 (each containing the Methylomonas crtN-crtN2 genes). This co-transformation completed the assembly of the engineered pathway.

Example 5

Analysis of Carotenoids Produced from E. coli Carrying the Engineered Pathway

E. coli cells containing pDCQ166+pDCQ177 and E. coli cells containing pDCQ166+pDCQ178 were grown in 100 mL LB (Luria Broth) or TB (Terrific Broth) medium with 50 Οg/mL Kan and 100 Οg/mL Amp at 37° C. for 1 day and harvested by centrifugation. As a control, E. coli MG1655 (pDCQ155::Tn5 p33) cells were grown under the same conditions (except with 100 Οg/mL Amp). Carotenoids were extracted from the cell pellets with 3 volumes of 20 mL of methanol for 30 min at room temperature each time. The extracted pigments were dried under nitrogen and dissolved in 1 mL methanol. A volume of 0.1 mL of each sample was used for HPLC analysis, as described in the General Methods.

In each sample, the diapocarotene dialdehyde product eluted at 12.3 min with an absorption maximum of 506 nm. The E. coli MG1655 (pDCQ166/pDCQ177) trace indicated a minor intermediate was formed that eluted at 12.0 min with an absorption maximum of 469 nm. The E. coli MG1655 (pDCQ166/pDCQ178) trace indicated a minor intermediate was formed that eluted at 14.2 min with an absorption maximum of 413, 436, and 465 nm, corresponding to the diaponeurosporene absorption maxima.

The C30-dialdehyde production was compared in each strain grown in LB and TB media by integration of the pigment peak from the HPLC traces. Subsequently, the normalized relative pigment yield per gram of cell paste was calculated for each culture (Table 8).

TABLE 8
Comparison of the C30-dialdehyde pigment production in
E. coli Grown in Various Media
In LB In TB
Pigment/ In LB Pigment/ In TB
E. coli g cell Cell paste g cell Cell paste
MG1655 Strain paste (g) paste (g)
pDCQ155::Tn5 p33 1.0 0.55 2.4 2.42
pDCQ166/pDCQ177 23.4 0.51 47.1 2.12
pDCQ166/pDCQ178 15.0 0.44 24.8 2.01

As demonstrated in the Table 8 above, E. coli carrying the engineered pathway showed an approximately 20-fold increase in C30-dialdehyde production, as compared to the transposon mutant p33 (E. coli MG1655 (pDCQ155::Tn5 p33)). Cells grown in TB showed an approximately 2-fold higher level of C30-dialdehyde production per gram of cells, as compared to cells growing in LB. Since TB medium also produced an approximately 4-fold greater cell paste than LB medium, the total C30-dialdehyde produced in cells grown in TB was approximately 8-fold greater than that from the same strain grown in LB. The E. coli MG1655 (pDCQ166/pDCQ177) strain was also observed to be more stable than E. coli MG1655 (pDCQ166/pDCQ178). Thus, the pDCQ166/pDCQ177 combination was chosen for further optimization in E. coli, for the production of the C30-dialdehyde.

Example 6

Construction Of Optimized E. coli Host Strains WS100 and WS101

The native promoters of the E. coli isoprenoid genes dxs, idi, and ispAdxs (wherein ispAdxs is an operon comprising the ispA and dxs genes) were replaced with the phage T5 (PT5) strong promoter using a two PCR-fragment chromosomal integration method (U.S. Ser. No. 10/734,936). This occurred in a multi-step process, as shown below:

    • 1. First, using the two PCR fragment method, the kanamycin selectable marker and phage T5 promoter (kan-PT5) were integrated upstream of the dxs, idi, and ispAdxs genes, yielding E. coli kan-PT5-dxs, E. coli kan-PT5-idi, and E. coli kan-PT5-ispAdxs, respectively.
    • 2. The optimized host strain WS101 (E. coli MG1655 PT5-ispAdxs) was created by preparation of P1 lysate from E. coli kan-PT5-ispAdxs and infection of E. coli MG1655. The kanamycin selectable marker was then removed from the transformed recipient host cells, using a FLP recombinase expression system.
    • 3. The optimized host strain WS100 (E. coli MG1655 PT5-dxs PT5-idi) was created by transducing P1 lysate from E. coli kan-PT5-dxs into E. coli MG1655, removing the kanamycin selectable marker, subsequently transducing P1 lysate from E. coli kan-PT5-idi into the resultant bacteria, and removing the kanamycin selectable marker.
      Triple Homologous Recombination Using the Two PCR Fragment Method to Create E. coli Kan-PT5-dxs, E. coli Kan-PT5-idi, and E. coli Kan-PT5-ispAdxs

The method of promoter replacement, described in FIG. 5, is based on homologous recombination via the λ-Red recombinase, which is encoded on a helper plasmid pKD46 (Datsenko and Wanner, supra). Recombination occurs between the E. coli chromosome and two PCR fragments that contain 20–50 bp homology patches at both ends of each PCR fragment. In the present example, the two PCR fragments included:

  • 1.) a linear DNA fragment (1489 bp) containing a kanamycin selectable marker flanked by site-specific recombinase target sequences (FRT); and
  • 2.) a linear DNA fragment (154 bp) containing PT5, the −10 and −35 consensus promoter sequences, a lac operator (lacO), and a ribosomal binding site (RBS).

The 1489 bp linear DNA fragment containing a kanamycin selectable marker was synthesized by PCR from plasmid pKD4 (Datsenko and Wanner, supra) using the primer pairs shown below in Table 9.

TABLE 9
Primers for Amplification of the
Kanamycin Selectable Marker
SEQ ID
Primer Name Primer Sequence NO:
5′-kan(dxs) TGGAAGCGCTAGCGGACTACATCATCCAGCGTAATAA 31
ATAACGTCTTGAGCGATTGTGTAG1
5′-kan(idi) TCTGATGCGCAAGCTGAAGAAAAATGAGCATGGAGAA 32
TAATATGACGTCTTGAGCGATTGTGTAG1
5′- ACCATGACGGGGCGAAAAATATTGAGAGTCAGACATT 33
kan(ispAdxs) CATGTGTAGGCTGGAGCTGCTTC1
3′-kan GAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATA 34
GGTTATATGAATATCCTCC1TAGTTCC2
1The underlined sequences illustrate each respective homology arm (chosen to match sequences in the upstream region of the chromosomal integration site), while the remainder is the priming sequence.
2The sequences shown in bold illustrate the homology arm chosen to match sequences in the 5′-end region of the T5 promoter DNA fragment.

The 154 bp linear DNA fragment containing PT5 was synthesized by PCR from pQE30 (QIAGEN, Inc. Valencia, Calif.) with the primer pairs shown in Table 10.

TABLE 10
Primers for Amplification of the T5 Promoter
Primer SEQ ID
Name Primer Sequence NO:
5′-T5 CTAAGGAGGATATTCATATAACCTATAAAAATAGGC 35
GTATCACGAGGCCC1
3′-T5(dxs) GGAGTCGACCAGTGCCAGGGTCGGGTATTTGGCAA 36
TATCAAAACTCATAGTTAATTTCTCCTCTTTAATG2
3′-T5(idi) TGGGAACTCCCTGTGCATTCAATAAAATGACGTGTTC 37
CGTTTGCATAGTTAATTTCTCCTCTTTAATG2
3′-T5(ispAdxs) CCTGCTTAACGCAGGCTTCGAGTTGCTGCGGAAAGT 38
CCATAGTTAATTTCTCCTCTTTAATG2
1The sequences in bold text illustrate the homology arm chosen to match sequences in the 3′-end region of the kanamycin DNA fragment.
2The underlined sequences illustrate each respective homology arm chosen to match sequences in the downstream region of the chromosomal integration site.

Standard PCR conditions were used to amplify the linear DNA fragments with AmpliTaq Gold polymerase (Applied Biosystems, Foster City, Calif.). Specifically, PCR reaction mixtures were prepared comprising: 0.5 μL plasmid DNA, 5 μL 10× PCR buffer, 1 μL dNTP mixture (10 mM), 1 μL 5′-primer (20 μM), 1 μL 3′-primer (20 μM), 0.5 μL AmpliTaq Gold polymerase, and 41 μL sterilized distilled H2O. Amplification was carried out as follows: initial denaturation at 94° C. for 3 min, followed by 30 cycles of the following: 93° C. for 30 sec, 55° C. for 1 min, 72° C. for 3 min. A final extension cycle of 72° C. for 5 min was carried out.

After completing the PCR reactions, 50 μL of each PCR reaction mixture was run on a 1% agarose gel and the PCR products were purified using the QIAquick Gel Extraction Kit™, per the manufacturer's instructions (Cat. #28704, QIAGEN Inc., Valencia, Calif.). The PCR products were eluted with 10 μL of distilled water. The DNA Clean & Concentrator™ kit (Zymo Research, Orange, Calif.) was used to further purify the PCR product fragments. Subsequently, the PCR products were eluted with 6–8 μL of distilled water to a concentration of 0.5–1.0 mg/mL.

The host strain utilized for chromosomal integration of the PCR fragments described above was constructed by transforming E. coli strain MC1061 with the Ν-Red recombinase expression plasmid, pKD46 (ampR) (Datsenko and Wanner, supra; SEQ ID NO:39). Transformants were selected on 100 Οg/mL of Amp LB plates at 30° C.

For triple homologous recombination, electroporation into the ampicillin resistant E. coli strain MC1061 transformants was performed using 5–10 μg of the purified PCR products carrying the kanamycin marker and PT5. Approximately one-half of the cells transformed were spread on LB plates containing 25 μg/mL Kan. After incubating the plates at 37° C. overnight, antibiotic-resistance transformants were selected as follows: 10 colonies of E. coli kan-PT5-dxs, 12 colonies of E. coli kan-PT5-idi, and 19 colonies of E. coli kan-PT5-ispAdxs.

Construction of Optimized Host Strain WS101 (E. coli MG1655 PT5-ispA/dxs)

P1 lysate of the E. coli kan-PT5-ispAdxs strain was prepared as follows: The E. coli kan-PT5-ispAdxs strain was inoculated in 4 mL LB medium with 25 μg/mL Kan, grown at 37° C. overnight, and then sub-cultured with 1:100 dilution of an overnight culture in 10 mL LB medium containing 5 mM CaCl2. After 20–30 min of growth at 37° C., 107 P1vir phages were added. The cell-phage mixture was aerated for 2–3 h at 37° C. until lysed, several drops of chloroform were added and the mixture was vortexed for 30 sec and incubated for an additional 30 min at room temperature. The mixture was then centrifuged for 10 min at 4500 rpm, and the supernatant transferred into a new tube to which several drops of chloroform were added.

The P1 lysate produced from E. coli kan-PT5-ispAdxs was transduced into the recipient strain, E. coli MG1655. Specifically, the E. coli MG1655 recipient cells were grown to mid-log phase (1–2×108 cells/mL) in 4 mL LB medium at 37° C. Cells were spun down for 10 min at 4500 rpm and resuspended in 2 mL of 10 mM MgSO4 and 5 mM CaCl2. Recipient cells (100 mL) were mixed with 1 mL, 10 mL, or 100 mL of P1 lysate stock (107 pfu/mL) made from the E. coli kan-PT5-ispAdxs strain and incubated at 30° C. for 30 min. The recipient cell-lysate mixture was spun down at 6500 rpm for 30 sec, resuspended in 100 mL of LB medium with 10 mM of sodium citrate, and incubated at 37° C. for 1 h. Cells were plated on LB plates containing 25 μg/mL Kan in order to select for kanamycin-resistant transductants, and incubated at 37° C. for 1–2 days. Kanamycin-resistance transductants were selected.

The kanamycin selectable marker was eliminated from the chromosome of kanamycin-resistance transductants using a FLP recombinase expression plasmid pCP20 (ampR) (ATCC PTA-4455) (Cherepanov and Wackernagel, Gene 158:9–14 (1995)). This plasmid, which has a temperature-sensitive replication of origin, was transiently transformed into one of the kanamycin-resistant transductants by electroporation. Cells were spread onto LB agar containing 100 μg/mL Amp, and grown at 30° C. for 1 day. Colonies were picked and streaked on LB plates without Amp and incubated at 43° C. overnight (to enable curing of pCP20 from the host cells). The colonies were tested for Amp and Kan sensitivity (to test for loss of pCP20 and the Kan selectable marker) by streaking colonies onto 100 μg/mL Amp LB plates or 25 μg/mL Kan LB plates. In this manner, the WS101 (E. coli MG1655 PT5-ispAdxs) strain was constructed.

Construction of Optimized Host Strain WS100 (MG1655 PT5-dxs PT5 idi)

P1 lysate made with the E. coli kan-PT5-dxs strain was transduced into the recipient strain, E. coli MG1655 as described above. Sixteen kanamycin-resistance transductants were selected. The kanamycin selectable marker was eliminated from the chromosome of the transductants, using a FLP recombinase expression system as described above (i.e., pCP20), yielding E. coli PT5-dxs.

In order to stack kan-PT5-idi on the chromosome of E. coli PT5-dxs, P1 lysate made from E. coli kan-PT5-idi was transduced into the recipient strain, E. coli PT5-dxs, as described above. Approximately 450 kanamycin-resistance transductants were selected. After transduction, the kanamycin selectable marker was eliminated from the chromosome as described above, yielding E. coli PT5-dxs PT5-idi. Correct integration of the phage T5 promoter upstream of the dxs and idi genes on the E. coli chromosome, and elimination of the kanamycin selectable marker, were confirmed by PCR analysis. In this manner, the WS100 (E. coli MG1655 PT5-dxs PT5-idi) strain was constructed.

Example 7

Expression of the Engineered Pathway for C30 Dialdehyde Synthesis in Engineered E. coli Host Strains

Plasmids pDCQ166 and pDCQ177 (from Example 4) were co-transformed into WS100 and WS101 and transformants were selected on plates with Amp (100 Îźg/mL) and Kan (50 Îźg/mL). By visualization, WS100 transformants appeared darker-pigmented than wild type MG1655 containing the two plasmids, whereas WS101 transformants appeared lighter-pigmented. WS100 (pDCQ166/pDCQ177) and MG1655 (pDCQ166/pDCQ177) were grown in 100 mL LB with Amp and Kan overnight. Pigments from the two strains were extracted and analyzed as described previously. C30-dialdehyde synthesis in the WS100 host was approximately 50% greater than that of the MG1655 host. On this basis, the strain WS100 (pDCQ166/pDCQ177) was thus chosen for production of the C30-dialdehyde via fermentation.

Example 8

Fermentation Production of C30-Dialdehyde in Engineered E. coli Host Strain WS100 (MG1655 PT5-dxs PT5-idi)

Aldehydes are known to be toxic to biological cells; thus, a fermentation strategy was designed to decrease toxicity by delaying the production of the C30-dialdehyde until after cell mass reached a high level. Specifically, cells were initially grown with glucose feed as the carbon source to suppress carotenoid production; after accumulation of cell mass, the carbon source was switched to fructose to allow C30-production of the aldehyde.

A seed culture of WS100 (pDCQ166/pDCQ177) was started from a 1 mL frozen glycerol stock prepared from cells grown from a single colony. The seed culture was grown in 500 mL of 2XYT medium (10 g/L yeast extract, 16 g/L tryptone, and 10 g/L NaCl) in a 2-L Erlenmeyer flask, containing 10% glucose, 100 Οg/mL Amp and 50 Οg/mL Kan at 35° C. in a shaker at 300 rpm for 8 h. This initial culture with an optical density of 1.9 at 600 nm was used to inoculate a Braun Biostat C stirred tank fermentor with a 10-L working volume (B. Braun Biotech International GmbH, Melsungen, Germany).

The following components were sterilized together in the fermentor vessel: 10 mL/L Modified Balch's Trace element solution (which contained 4 g/L citric acid.H20, 3 g/L MnSO4.H20, 1 g/L NaCl, 0.1 g/L FeSO4.7H2O, 0.1 g/L ZnSO4.7H2O, 0.001 g/L CuSO4.5H2O, 0.001 g/L H3BO3, 0.001 g/L NaMoO4.2H2O), 5 g/L yeast extract, 0.2 g/L CaCl2.2H2O, 0.3 g/L ferric ammonium citrate, 2 g/L MgSO4.7H20, 2 g/L citric acid, 7.5 g/L KH2PO4, 1.2 g/L sulfuric acid, and 0.8 mUL Mazu DF204 as an antifoaming agent. After sterilization, the pH was raised to 6.8 with 40% NH4OH. The concentration of Amp was brought to 100 g/L and the concentration of Kan was brought to 50 mg/mL. A 65% glucose solution (246 g) was added post vessel sterilization to give a 20 g/L initial concentration in the fermentor.

The fermentation was started with an 8-L volume of medium as described above containing 20 g/L glucose. After 13 h, when the absorption at 600 nm of the culture was above 20, a 10% fructose bolus was added at a rate of 20 mL/min until 2 L was added. Glucose concentration was below 0.1 g/L at 17 h of fermentation. The temperature was controlled at 35° C. and the pH was maintained at 7.6 with 40% NH4OH and 20% H3PO4. Back pressure was manually controlled at 0.5 bar (7.5 psig or about 51.7 kPa). The dissolved oxygen set point was 10%. After 27 hours of fermentation, 9 L of cell culture was harvested. The cell paste was extracted and approximately 20 mg of C30-dialdehyde was produced from the 10-L fermentation.

Example 9

Confirmation of the C30-dialdehyde Produced by Fermentation in Engineered E. coli Host Strain WS100 (MG1655 PT5-dxs PT5-idi)

The carotenoid pigment extracted from the harvested cells (from Example 8) was subjected to HPLC analysis, NaBH4 reduction and mass spectrometry analysis. HPLC analysis was performed as described in the General Methods and indicated that the absorption spectrum was 504 nm 536 nm, which is consistent with that reported for C30-dialdehyde. The red pigment produced in the fermentation was reduced by NaBH4 to a yellow pigment that had an absorption spectrum of 444 nm, 470 nm, 501 nm. This reduction experiment suggested that the carotenoid had aldehyde functional group(s).

The molecular weight of this carotenoid was also determined by LC-MS. Each sample of 50 μL was run on a Zorbax 2.1×150 mm SB-C18 LC column (Agilent Technologies, CA) with solvent program of:

    • 0–30 min: linear gradient from 70% acetonitrile and 30% water to 100% acetonitrile;
    • 30–45 min: 100% acetonitrile.
      The mass spectrometer (Micromass Quattro LC triple quadrapole, Micromass Limited, UK) was scanned from 100 to 1000 AMU's in 0.9 sec with an 0.1 sec interscan delay in APCI (Atmospheric Pressure Chemical Ionization) mode with the corona discharge needle at 3KV and the APCI probe at 450° C. LC-MS analyses determined the molecular weight of the carotenoid to be 428, which agreed with that of diapocarotene-dialdehyde. Finally, an authentic standard of 4,4′-diapocarotene dialdehyde was synthesized by CaroteNature (Lupsingen, Switzerland). The LC retention time, absorption spectra and the molecular weight of the carotenoid produced by our fermentation all matched well with those of the synthetic standard. Based on these analyses, it was concluded that diapocarotene-dialdehyde was produced by the fermentation.

Claims

What is claimed is:

1. A method for the production of C30-aldehyde carotenoid compounds comprising:

(a) providing a transformed host cell comprising:

(i) suitable levels of farnesyl pyrophosphate;

(ii) at least one isolated nucleic acid molecule encoding an enzyme having diapophytoene synthase activity under the control of suitable regulatory sequences wherein the isolated nucleic acid molecule is selected from the group consisting of

1) an isolated nucleic acid molecule encoding the amino acid sequence as set forth in SEQ ID NO:2;

2) an isolated nucleic acid molecule encoding the amino acid sequence as set forth in SEQ ID NO:10; and

3) an isolated nucleic acid molecule that hybridizes with (1) or (2) under the following hybridization conditions:0.1× SSC, 0.1% SDS, 65° C. and washed with 2×SSC, 0.1% SDS followed by 0.1×SSC, 0.1% SDS;

(iii) at least one isolated nucleic acid molecule encoding an enzyme having diapophytoene desaturase activity under the control of suitable regulatory sequences wherein the isolated nucleic acid molecule is selected from the group consisting of;

1) an isolated nucleic acid molecule encoding the amino acid sequence as set forth in SEQ ID NO:4;

2) an isolated nucleic acid molecule encoding the amino acid sequence as set forth in SEQ ID NO:12; and

3) an isolated nucleic acid molecule that hybridizes with (1) or (2) under the following hybridization conditions: 0.1×SSC, 0.1% SDS, 65° C. and washed with 2×SSC, 0.1% SDS followed by 0.1×SSC, 0.1% SDS; and

(iv) at least one isolated nucleic acid molecule encoding an enzyme having the ability to introduce an omega-aldehyde functional group on the omega carbon of a conjugated polyene carbon skeleton under the control of suitable regulatory sequences; wherein the isolated nucleic acid molecule is selected from the group consisting of;

1) an isolated nucleic acid molecule encoding the amino acid sequence as set forth in SEQ ID NO:8;

2) an isolated nucleic acid molecule encoding the amino acid sequence as set forth in SEQ ID NO:14; and

3) an isolated nucleic acid molecule that hybridizes with (1) or (2) under the following hybridization conditions: 0.1×SSC, 0.1% SDS, 65° C. and washed with 2×SSC, 0.1% SDS followed by 0.1×SSC, 0.1% SDS; and

(b) contacting the host cell of step (a) under suitable growth conditions with an effective amount of fermentable carbon substrate whereby a C30-aldehyde carotenoid compound is produced.

2. A method according to claim 1 wherein the C30-aldehyde carotenoid compound is selected form the group consisting of: diaponeurosporene monoaldehyde, diapocarotene monoaldehyde, diapocarotene dialdehyde and functional derivatives thereof.

3. A method according to claim 1 wherein the suitable levels of farnesyl pyrophosphate are provided by the over-expression of heterologous upper pathway isoprenoid pathway genes.

4. A method according to claim 3 wherein said upper pathway isoprenoid genes are selected from the group consisting of D-1-deoxyxylulose-5-phosphate synthase (dxs), D-1-deoxyxylulose-5-phosphate reductoisomerase (dxr), 2C-methyl-D-erythritol cytidylyltransferase (ispD), 4-diphosphocytidyl-2-C-methylerythritol kinase (ispE), 2C-methyl-d-erythritol 2,4-cyclodiphosphate synthase (ispF), CTP synthase (pyrG), lytB, gcpE, idi, and farnesyl diphosphate synthase (ispA).

5. A method according to claim 4 wherein said over-expressed upper pathway isoprenoid genes are dxs and idi and wherein said over-expression is the result of up-regulating the promoter activity upstream of each gene.

6. A method according to claim 1 wherein the host cell is selected from the group consisting of bacteria, yeast, filamentous fungi, algae, and green plants.

7. The method according to claim 6, wherein the transformed host cell is selected from the group consisting of Aspergillus, Trichoderma, Saccharomyces, Phaffia, Pichia, Candida, Rhodotorula, Rhodosporidium, Hansenula, Salmonella, Bacillus, Acinetobacter, Zymomonas, Agrobacterium, Erythrobacter, Chlorobium, Chromatium, Flavobacterium, Cytophaga, Rhodobacter, Rhodococcus, Streptomyces, Brevibacterium, Corynebacteria, Mycobacterium, Deinococcus, Escherichia, Erwinia, Pantoea, Pseudomonas, Sphingomonas, Methylomonas, Methylobacter, Methylococcus, Methylosinus, Methylomicrobium, Methylocystis, Methylobacterium, Alcaligenes, Synechocystis, Synechococcus, Anabaena, Thiobacillus, Methanobacterium, Klebsiella, Myxococcus, and Staphylococcus.

8. The method according to claim 7, wherein the transformed host cell is Escherichia coli.

9. The method according to claim 6, wherein the transformed host cell is selected from the group consisting of soybean, rapeseed pepper, sunflower cotton corn, tobacco alfalfa wheat barley oats sorghum rice Arabidopsis, cruciferous vegetables, melons, carrots, celery, parsley, tomatoes, potatoes, strawberries, peanuts, grapes, grass seed crops, sugar beets, sugar cane, beans, peas, rye, flax, hardwood trees, softwood trees, marigold, and forage grasses.

10. The method according to claim 6, wherein the transformed host cell is selected from the group consisting of Spirulina, Haemotacoccus, and Dunalliela.

Resources

Images & Drawings included:

Sources:

Recent applications in this class: