Patent application title:

Ab initio generation of single copy genomic probes

Publication number:

-

Publication date:
Application number:

11/324,102

Filed date:

2005-12-30

✅ Patent granted

Patent number:

US 7,734,424 B1

Grant date:

2010-06-08

PCT filing:

-

PCT publication:

-

Examiner:

Karlheinz R Skowronek

Adjusted expiration:

2025-12-30

Abstract:

Single copy sequences suitable for use as DNA probes can be defined by computational analysis of genomic sequences. The present invention provides an ab initio method for identification of single copy sequences for use as probes which obviates the need to compare genomic sequences with existing catalogs of repetitive sequences. By dividing a target reference sequence into a series of shorter contiguous sequence windows and comparing these sequences with the reference genome sequence, one can identify single copy sequences in a genome. Probes can then be designed and produced from these single copy intervals.

Inventors:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

G01N33/00 IPC

Investigating or analysing materials by specific methods not covered by groups -

Description

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Ser. No. 60/687,945, filed Jun. 7, 2005. The contents of U.S. Ser. No. 60/687,945 and of Disclosure Document No. 576,582, filed May 3, 2005, are each hereby incorporated herein by reference.

This invention was made with Government support under Grant No. 1R41CA112692-01 awarded by the National Institutes of Health. The Government has certain rights in the invention.

COMPUTER PROGRAM CONTAINING SEQUENCE LISTING ON CD-ROM

The file of this patent includes duplicate copies of a read-only compact disc (CD-ROM) with a memory file entitled PHY9990.ST25.TXT which is in ASCII file format. The file was created on Dec. 29, 2005, using PatentIn Version 3.1 and is a size of 395 KB. This text document contains the Sequence Listing for this application. This Patent Application includes references to the Sequence Listing contained on the CD-ROM. The CD-ROM and the PHY9990.ST25.TXT file contained thereon are hereby incorporated herein by reference into this Patent Application.

FIELD OF THE INVENTION

The present invention generally relates to ab initio methods of computationally determining the locations of single copy intervals in genomes for use as probes.

BACKGROUND

Conventional hybridization studies with genome-derived nucleic acid probes require unlabeled Cot-1 DNA fractions to block cross-hybridization of repetitive sequences contained within these probes in eukaryotic genomes. This is necessary, because to achieve the specificity needed to identify, detect or quantify unique sequences contained in nucleic acid probes, confounding hybridization from repetitive sequences must be eliminated. Repetitive sequences comprise at least 50% of the human genome and contain a diverse set of distinct families (Smit, Curr Opin Genet Dev. 1996, 6(6):743-8). Despite the lack of selection for their function and broad, often variable degrees of orthology, such sequences often display sequence conservation throughout mammalian evolution (Rogan et al. Mol Biol Evol. 1987, 4(4):327-42; Mottez et al. Nucleic Acids Res. 1986, 14(7):3119-36), principally because they have properties of semiautonomous transposable elements that promote frequent amplification during host organism evolution, originally termed molecular drive by Dover (Dover, Trends Genet. 2002, 18(11):587-9). It is desirable to remove such sequences in most clinical diagnostic applications; because of their ubiquity throughout the genome, their presence can interfere with the development of probes for unique regions of the genome that correspond to functional genes whose structures must be preserved because they are essential for normal development and health.

Repetitive sequences are often interspersed with unique or single copy genes, especially in eukaryotic genomes, and their removal from genomic probes is essential to ensure that diagnostic probes specifically recognize only a single location in the genome. These sequences can be eliminated by laboratory techniques designed to sequester them away from labeled probes containing both single copy and interspersed repetitive sequences (Lichter et al. Hum Genet. 1988, 80(3):224-34; Craig et al. Hum Genet 1997, 100:472-476), by blocking their hybridization, or by deducing the single copy sequences by comparisons of known genomic reference sequences with comprehensive databases of consensus sequences that are representative of established repetitive sequence families and subfamilies (Jurka, Curr Opin Struct Biol. 1998, 8(3):333-7).

Cot-1 DNA is often used to attempt to suppress cross-hybridization of repetitive sequences to probes. The problem with attempting to suppress repeat hybridization with Cot-1 DNA is that it can result in enhanced non-specific hybridization between probes and genomic targets. Specifically, it has been demonstrated that Cot-1 added to target DNA actually enhanced hybridization to genomic probes containing conserved repetitive elements (Newkirk, H. L. et al., Nuc. Acids Res. 2005, 33(22):e191). In addition to repetitive sequences, Cot-1 was also found to be enriched for linked single copy sequences (Newkirk, H. L. et al., Nuc. Acids Res. 2005, 33(22):e191). Adventitious association between these sequences and probes distorts quantitative measurements of the probes hybridized to desired genomic targets. This also affects the reproducibility of hybridization assays with sources of genomic DNA, in particular, and can also impact hybridization to mRNAs that contain repetitive sequences (typically found in the untranslated regions of transcripts). The increased non-specific hybridization that occurs when using Cot-1 to block repeat sequence hybridization has particularly adverse effects on microarray studies which depend on quantification of signals obtained by hybridization to the unblocked presumably single copy sequences.

The elimination of Cot-1 DNA, either by sequestering repeats or by blocking their hybridization, was accomplished by direct synthesis of probes lacking repeat sequences. Knoll et al., U.S. Pat. No. 6,828,097 (termed '097 patent), discloses a procedure for determining the locations of single copy intervals and design of probes for hybridization to their complementary locations in the human genome. It is disclosed that the procedure can be implemented for any genome in which a comprehensive catalog of repetitive sequences is available. Presumed single copy sequences containing repetitive elements will cross-hybridize to multiple locations in the genome. Where hybridization occurs in too many genomic locations, the lack of specificity adversely impacts the utility of the probes in diagnosing disease. Therefore, methods from which single copy sequences can be deduced without requiring a comparison of the genomic sequence with a comprehensive database of consensus repetitive sequence family members would represent an improvement over current in silico methods of identifying single copy intervals and the ensuing probes.

Methods have been developed which can align the sequences of different, related, or the same complete genomes from which the locations of individual repetitive sequences in the genome can be inferred. One such example is the maximal unique matching algorithm which builds suffix trees from all maximal length unique matches (MUM) between sequence strings (Delcher et al. Nuc. Acids Res. 1999, 27:2369-2376). Repeats can be detected in a genome because they are found in overlapping MUMs that are not necessarily contiguous in that genome. Once repeat sequence elements are identified through such comparisons, families of related repeat sequences can be identified through comparisons of individual family members with the genome sequence itself. Another popular method, the BLAT algorithm (Kent et al. Genome Res. 2002, 12:656-64), is a rapid alignment method that uses a hash-index algorithm to quickly find sequences similar to a particular test sequence in a genome; it is not, however, an ab initio approach for single copy sequence identification. Other comparative alignment tools useful for detecting repeat sequences include ASSIRC (Vincens et al. Bioinformatics 1998, 14:715-725), DIALIGN (Morgenstern et al Bioinformatics. 1998, 14(3):290-4.), DBA (Jareborg et al. Genome Res. 1999, 9(9):815-24), GLASS (Batzoglou et al. Genome Res. 2000, 10(7):950-8), LSH-ALL-PAIRS (Buhler, Bioinformatics. 2001, 17(5):419-28), MEGABLAST (Zhang J Comput Biol. 2000, 7(1-2):203-14), PIPMaker (Schwartz et al. Genome Res. 2000, 10(4):577-86), SSAHA (www.sangerac.uk/Software/analysis/SSAHA), and WABA (Kent and Zahler Genome Res. 2000, 10(8):1115-25).

U.S. application Ser. No. 10/229,058 discloses that sequences can be screened for the presence of known repetitive sequence families (e.g., Alu elements); however the details of these screening procedures are not disclosed. U.S. application Ser. No. 10/132,002 discloses a procedure for detecting repetitive sequences experimentally, but does not disclose the identification of single copy sequences. U.S. application Ser. No. 10/833,954 discloses that in situ hybridization of a mixture of single copy and repetitive sequences can be performed in the absence of blocking nucleic acids that prevent cross hybridization of repetitive sequences. A formulation of a hybridization reagent and washing conditions that could mitigate such cross-hybridization are disclosed, but no information is provided regarding the location of single copy and repetitive sequences within the probe segment. U.S. Ser. No. 10/132,993 discloses laboratory chromatographic methods to remove repetitive sequences from genomic DNA to make probes that are substantially complementary to single copy intervals. In this application, the locations or the specific single copy sequences are not determined prior to experimentally removing the repeat sequences. A very similar approach is described in U.S. application Ser. No. 10/798,949, in which repetitive sequences are subtracted by hybridization, and single copy sequences are subsequently amplified using so called unique sequence primers. Subtraction hybridization is not a robust technique, because low- to middle-reiteration frequency repeats are not completely eliminated under the hybridization conditions typically used in these studies. Therefore, the selection of these primers could result in the production of probes that are contaminated with repetitive sequence elements. Similarly, in U.S. application Ser. No. 10/229,058, the repetitive sequences are fractionated by hybridization methods prior to library production and sequencing. Presumably, the single copy sequences would be revealed after library enrichment; however U.S. Ser. No. 10/229,058 does not teach how to identify the precise boundaries of these sequences in the genome, and it does not teach the method of determining how to identify single copy sequences for use as probes. U.S. Ser. No. 10/330,089 is the most recent of several continuation applications which infer the single copy nature of cloned sequences by their lack of hybridization to total genomic DNA, which is highly enriched in repetitive elements. The specific single copy sequences are not revealed by this approach. Furthermore, the present applicants have demonstrated that the single copy sequences produced according to this method are contaminated with repetitive sequences, since they are particularly insensitive to the detection of low- to moderate-abundance repetitive sequence family members. See U.S. Pat. No. 6,828,097, Prosecution History.

While several of these approaches can find locally similar repetitive sequences without comparison to a library of sequences (as in Knoll et al., U.S. Pat. No. 6,828,097), their objective is to identify repetitive sequences and multiple copies of related sequences found in the genomes of different individuals or species. These approaches do not involve the use of repetitive sequences to infer the presence of single copy sequence intervals (between adjacent repetitive sequences in the genome) for the development of useful single copy probes from the intervening regions between the deduced repetitive sequences. These algorithms therefore produce libraries similar to that used in the '097 patent, and the sequences contained in these libraries will be similar to those already known. These algorithms do not describe inferred single copy intervals, or in particular, the use of probes obtained from those deduced intervals.

SUMMARY OF THE INVENTION

The present invention relates to the computational design of nucleic acid probes that exclusively contain sequences found at a single location in a reference genome sequence.

A method is described to identify single copy regions in a target genome interval of known sequence and then preparing probes from these regions, principally for the detection of chromosomal and genomic abnormalities by nucleic acid hybridization. The method divides the target genome interval into consecutive sequence subintervals and compares each of the subintervals with the reference genome sequence. Those subintervals which are found once within the reference genome sequence, typically referred to as single copy intervals, serve as sequences that serve as a starting point for subsequent analysis. To more precisely localize the single copy sequences, i.e., the single copies of sequences that appear within a single copy interval, these subsequences may either be further resected into non-overlapping sub-subintervals or they may be modified by selecting windows that overlap the original single copy subintervals, but which are displaced by one or more nucleotides from the original genomic coordinates in either the telomeric or centromeric direction. Typically, as series of overlapping sub-subintervals are derived from the original sequence by extending the subinterval at one end of the sub-subsequence and shortening the sub-subsequence by the same length at the other end. The directionality of the overlapping sub-subsequence set is dictated by the orientation of the single copy subsequence adjacent to the subsequence that contains one or more repeat elements. The overlapping sub-subsequences are selected so that their displacement moves toward the location of the single copy subsequence. The overlapping sub-subsequences are compared with the genome reference sequence and the procedure is iterated by progressively decreasing the degree of overlap until either the overlapped interval demonstrates multiple regions of similarity in the reference genome or the end of the chromosome is reached. The single copy sequences thus obtained are then used to prepare probes either by direct nucleic acid synthesis, amplification or by retrieval and purification of these sequences from recombinant clones or genomic DNA.

In the present application, the probes are labeled and then hybridized to chromosomes from patients or cell lines. However, those of skill in the art will appreciate that the probes can be fixed on a surface or matrix and hybridized with genomic DNA or cDNA from patients or control specimens that have been labeled by chemical, fluorescent, or radioactive modification. With the present invention, it is not necessary to suppress hybridization of repetitive sequences with unlabeled Cot-1 nucleic acids when annealing these probes to their unique chromosomal locations in the genomes of patient samples or cell line chromosomal DNA.

The ab initio methods described in the instant invention are capable of identifying both the same repeat families that have been previously catalogued in the art and new repeat sequence families that have not been previously recognized in the art.

Another advantage of the present invention is that such ab initio methods can be used to deduce single copy sequences in instances of biological species for which catalogs of repetitive sequences have not been previously derived.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a block diagram illustrating a user interacting with a computing environment in one embodiment of the invention.

FIG. 2 is a flow chart depicting exemplary operations for deriving the locations of single copy intervals used in probe production.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is concerned with nucleic acid (e.g., DNA or RNA) hybridization probes for detection of genetic or neoplastic disorders, such as for example Monosomy 1p36 syndrome, Wolf-Hirschorn Syndrome, Cri-du-Chat Syndrome, Williams Syndrome, Langer-Giedeon Syndrome, Chronic myelogenous leukemia, Acute lymphocytic leukemia, Aneuploidy for chromosome 13 (eg. Patau Syndrome), Prader-Willi Syndrome, Angelman Syndrome & Chromosome 15 duplication Syndrome, Acute Myelogenous leukemia Type M4, Rubenstein-Taybi Syndrome, Smith-Magenis Syndrome, Charcot-Marie-Tooth Disease Type 1A, Miller-Dieker Syndrome, Alagille Syndrome, Down Syndrome, DiGeorgeNelocardiofacial Syndrome, Schizophrenia, Kallman Syndrome, Turner and Leri-Weill Syndromes, and subtelomeric chromosome rearrangements associated with idiopathic mental retardation, sex chromosome aneuploidy, and monosomy chromosome 22. See, for example, U.S. Ser. No. 09/854,867.

The probes are in the form of nucleic acid fragments or a collection of labeled nucleic acid fragments whose hybridization to a target sequence can be detected. The invention also pertains to methods of developing, generating and labeling or chemical modification of such probes, and to uses thereof. Chemical modifications of such probes can be used to permanently attach them to solid surfaces such as polystyrene microspheres or glass slides for subsequent hybridization to nucleic acids obtained, for example, from a patient for diagnosis of a genetic disorder, such as, for example, the syndromes described in U.S. Ser. No. 09/854,867, or of various cancers, such as, for example, breast cancer associated with amplification of the HER2/NEU gene, neuroblastoma associated with amplification of the N-myc gene, melanoma associated with chromosome deletions of p16/CDKN2A gene, chromosome translocations activating oncogenes associated with Chronic myelogenous leukemia (BCR/ABL1), Acute lymphocytic leukemia, B-cell lymphoma, prostate carcinoma, chromosome inversions such as that found in Acute Myelogenous leukemia-Type M4, and losses of heterozygosity for example, monosomies for chromosome 7q, 1p, 17p, and 8p. This list of chromosome abnormalities is provided for purposes of illustrating the types of abnormalities suitable for detection with probes of the art. There are many other art-recognized abnormalities which are diagnostic for neoplasia that involve gain or loss of copies of other genes and chromosomes, but result from the same or similar common mechanisms of chromosome rearrangement presented in these examples.

Various aspects of the present invention obviate the need to compare the sequence of the genomic interval from which single copy intervals and probes are derived with a database of existing repetitive sequences. Generally, a genomic subsequence is compared with the sequence of the complete haploid genome that contains that genomic subsequence. Assuming the subsequence is sufficiently long, there is a high probability that it will contain at least one repetitive element, sometimes also referred to as a repetitive or repeat sequence. Repetitive elements are detected by counting the number of times that the subsequence occurs in the genome. Typically, the presence of more than one copy of a sequence would exclude that sequence from being defined for use as an ab initio single copy probe; however, the presence of the same sequence tandemly repeated fewer than 10 times at a single location, preferably fewer than 8 times, more preferably fewer than 5 times, and still more preferably fewer than 3 times, in the genome may still be useful for detection of chromosome abnormalities if such internal tandem repetition does not display copy number polymorphism in populations. The locations of the repetitive elements are determined by aligning the subsequence with each of the genomic copies and determining the boundaries of the common multicopy sequence intervals. Single copy intervals will only align to a single genomic location. Accordingly, repetitive sequences, and therefore, single copy sequences as well, are deduced by ab initio methods rather than being derived from a preexisting repetitive sequence database.

One aspect of the invention, therefore, is probes that hybridize with the deduced single copy sequences. The probes hereof may be used with any nucleic acid target that contains the complementary single copy sequence as well as potentially repetitive sequences. These target sequences may include, but are not limited to chromosomal or purified nuclear DNA, heteronuclear RNA, cDNA or mRNA species that contain repetitive sequences as integral components of the transcript. In the ensuing detailed explanation, the usual case of a DNA target sequence and DNA probes is discussed; however, those skilled in the art will understand that the discussion is equally applicable (with art-recognized differences owing to the nature of the target sequences and probes) to other nucleic acid species.

One characteristic of the probes of the present invention is that they are made up of “single copy” or “unique” DNA sequences which are both complementary to at least a portion of the target DNA region of interest and essentially free of sequences complementary to repeat sequences within the genome of which the target region is a part. Accordingly, a probe made up of a single copy or unique sequence is complementary to essentially only one sequence in the corresponding genome. As used herein, a “repeat sequence” or “repetitive sequence” is a sequence which appears at least about twice in the genome of which the target DNA is a part. Typically, a repeat sequence will appear in a genome at least about 5 times, preferably about 50 times, more preferably about 200 times, and even more preferably about 1000 times. Factors affecting the number of times a repeat sequence appears in a genome include, for example, the size of the genome, evolutionary age of the repeat (degree of divergence from other related sequences), the mechanism(s) of copy number increase, and the relevance of pathogens which integrate into the host genome, horizontal genetic transfer (if any), and associative mating between individuals who are heterozygous for repetitive sequence copy number. A repeat sequence will generally have a sequence identity between repeats of at least about 60%, preferably at least about 70%, more preferably at least about 80%, still more preferably at least about 90%, even more preferably at least about 95%, and most preferably about 99%, and will be of sufficient length or have other qualities which would cause it to interfere with the desired specific hybridization of the probe to the target DNA, i.e., the probe would hybridize with one or more copies of the repeat sequence. Generally, a repetitive sequence appears at least about 5 times in the genome, preferably at least about 50 times, and most preferably at least about 200 times and has a length of at least about 20 nucleotides, preferably at least about 40 nucleotides, more preferably at least about 50 nucleotides, still more preferably at least about 75 nucleotides, and even more preferably at least about 100 nucleotides. Repeat sequences can be of any variety, including, for example, tandem, interspersed, palindromic or shared repetitive sequences (with some copies in the target region and some elsewhere in the genome), and can appear near the centromeres of chromosomes, distributed over a single chromosome, or throughout some or all chromosomes. This definition of a repeat includes closely related members of the same multigene family, since the utility of the probes is related to the unique locations on chromosomes. However, typically, repeat sequences are sufficiently degenerate such that most elements do not express physiologically useful proteins. Nevertheless, repeat sequences may exhibit length polymorphism such that they may be present in some individuals and absent in others. However when this is the case, complex repeats must be distinguished by copy number polymorphisms (which may contain multiple repeat elements and single copy sequences, and indeed, complete genes, in some cases). The instant invention utilizes the current assembly of a singe or composite genome. One of skill in the art would recognize that polymorphisms that duplicate or delete repetitive sequence in different individuals will require that probes derived therefrom may not be present at a single location in the diploid genome. Therefore, as additional reference genome sequences from different individuals are publicly available, genomic probes of the art are compared with each reference genome to verify their single copy nature in each of the populations for which the probe is to be employed.

Repeat sequences occur in multiple copies in the haploid genome. The number of copies of any family of related repetitive sequences can range from ten to hundreds of thousands, depending on a number of factors, including, for example, mechanisms of slipped mispairing during DNA replication, amplification by unscheduled DNA replication, expansion or contraction through unequal or illegitimate crossover or gene conversion, transposition, transduction, or viral integration, or retrotransposition. The Alu family of repetitive DNA are exemplary of the latter numerous variety. The copies of a repeat may be clustered or interspersed throughout the genome. Repeats may be clustered in one or more locations in the genome, such as, for example, repetitive sequences occurring near the centromeres of each chromosome, and variable number tandem repeats (VNTRs; Nakamura et al, Science, 1987; 235: 1616); or the repeat sequences may be distributed over a single chromosome, such as, for example, repeats found only on the X chromosome as described by Bardoni et al., Cytogenet. Cell Genet., 46: 575 (1987); or the repeats may be distributed over all the chromosomes, such as, for example, the Alu (SINE), and L1 (LINE) families of repetitive sequences.

Simple repeats of low complexity can be found within genes but are more commonly found in non-coding genomic sequences. Such repeated elements consist of mono-, di-, tri-, tetra-, or penta-nucleotide core sequence elements arrayed in tandem units. Often the number of tandem units comprising these repeated sequences varies at the identical locations among genomes from different individuals. These repetitive elements can be found by searching for consecutive runs of the core sequence elements in genomic sequences.

As used herein, “sequence identity” refers to a relationship between two or more polynucleotide sequences, namely a reference genome sequence and a test sequence from a genomic region of interest, i.e. containing one or more potential probe sequence(s) to be compared with the reference sequence. Sequence identity is determined by comparing the test sequence to the reference sequence after the sequences have been optimally aligned to produce the highest degree of sequence similarity, as determined by the match between strings of such sequences. Upon such alignment, sequence identity is ascertained on a position-by-position basis, e.g., the sequences are “identical” at a particular position if, at that position, the nucleotides are identical. The total number of such position identities is then divided by the total number of nucleotides or residues in the reference sequence to give a percent sequence identity. Sequence identity can be readily calculated by known methods including, but not limited to, those described in Computational Molecular Biology, Lesk, A. N., ed., Oxford University Press, New York (1988), Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von Heinge, G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York (1991); and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988). Preferred methods to determine sequence identity are designed to give the largest match between the sequences tested. Methods to determine sequence identity are codified in publicly available computer programs which determine sequence identity between given sequences. Examples of such programs include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research, 12(1):387 (1984)), BLASTP, BLASTN and FASTA (Altschul, S. F. et al., J. Molec. Biol., 215:403-410 (1990). The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI, NLM, NIH, Bethesda, Md. 20894, Altschul, S. F. et al., J. Molec. Biol., 215:403410 (1990)). These programs optimally align sequences using default gap weights in order to produce the highest level of sequence identity between the test and reference sequences. As an illustration, by a polynucleotide having a nucleotide sequence having at least, for example, 95% “sequence identity” to a reference nucleotide sequence, it is intended that the nucleotide sequence of the given polynucleotide is identical to the reference sequence except that the given polynucleotide sequence may include up to 5 differences per each 100 nucleotides of the reference nucleotide sequence. In other words, in a polynucleotide having a nucleotide sequence having at least 95% identity relative to the reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted, inserted, or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. Inversions in either sequence are detected by these computer programs based on the similarity of the reference sequence to the antisense strand of the homologous test sequence. These variants of the reference sequence may occur at the 5′ or 3′ terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.

It should be understood that BLAST, BLAT, and similar heuristic algorithms do not provide the sequences of all of the matches (in the genome) above the specified expected value threshold; however, they tend to indicate the degree to which a sequence may be repetitive. Sequences which match numerous genomic locations (generally on the order of hundreds) tend to be quite abundant and well conserved. Sequences which match several genomic locations tend to be either less common or less well conserved between paralogs. Sequences which match a single location in the genome are expected to be single copy, since the stringency of recognizing pairwise matches with the WU-BLAST algorithm has been deliberately relaxed to detect weakly similar genomic copies of any input sequence.

The single copy probes of the invention preferably have a length of at least about 25 nucleotides, preferably at least about 40 nucleotides, more preferably at least about 50 nucleotides, still more preferably at least about 75 nucleotides, and even more preferably at least about 100 nucleotides. Probes of this length are sufficient for Southern blot analyses, bead suspension hybridization, and microarray hybridization. However, if other analyses such as fluorescence in situ hybridization (FISH) are employed, the probes should be somewhat longer, i.e., at least about 500 nucleotides, preferably at least about 1000 nucleotides, and even more preferably at least about 2000 nucleotides in length. Factors used in determining the length of the probes include, for example, the type of analysis or hybridization method to be used, sequence specificity (i.e. complexity of the probe), nucleotide content (which dictates the optimal annealing temperature of the probe), the amount of secondary structure that the probe may adopt (which can be predicted with available software programs), and replication timing (synchronous vs asynchronous) of the genomic target sequence. The probes can be used to detect virtually any type of chromosomal rearrangement, such as, for example, deletions, duplications, insertions, additions, markers, inversions or translocations.

In addition to FISH, computationally determined single copy genomic hybridization probes may be used in a quantitative microsphere suspension hybridization assay to determine copy number of a specific sequence relative to a reference sequence or standard curve (Newkirk et al, Human Mutation, in press (2006)). Those of skill in the art would also recognize that single copy probes used as probes for microarrays would have properties similar to microsphere hybridization, since in both platforms the probes are attached to a solid phase substrate and hybridized to either labeled genomic DNA or to cDNA. Single copy probes have been shown to be more accurate for copy number determination than probes containing repetitive sequences that utilize Cot-1 DNA for suppression of cross hybridization of repetitive elements (Newkirk et al., Nucleic Acids Research 2005, 33(22):e191). Sufficient accuracy is achieved to distinguish normal copy number which is generally two for autosomes from hemizygosity or from three or more alleles. This assay allows for the direct analysis of whole genomic DNA (or RNA) using flow cytometry and if necessary can follow routine cytogenetic analysis without requiring large patient sample quantities, additional blood draws, locus-specific amplifications, or time-consuming genomic purification methods. It is notable therefore that copy number determination at a single locus can be carried out within a complex background of sequences consisting of the complete genome. This exquisite level of discrimination achieved by computationally-defined single copy probes can also be used to determine copy number of rare transcripts against the background of the complete transcriptome, or for detection of extremely dilute or low concentrations of specific nucleic acid sequences within heterogeneous solutions of nucleic acids.

In order to develop probes in accordance with the invention, the sequence of the target DNA region must be known. The target region may be an entire chromosome or only portions thereof where rearrangements have been suspected or identified. With this sequence knowledge, the objective is to determine the boundaries of single copy or unique sequences within the target region. This is preferably accomplished by inference from the locations of repetitive sequences within the target region. An important distinction between the method of the instant invention and the other methods is that the target region sequences of the present invention are not compared with known repeat sequences from the corresponding genome, using available computer software. With the instant invention, a catalog of known repeat sequences is, therefore, not a prerequisite to computational recognition of single copy intervals with this software. Therefore, single copy sequences can be derived with the instant invention from any complete genome sequence, so long as a determination of that sequence is completed.

Initially, a genomic or mRNA sequence is identified from which one or more single copy intervals and probes are desired. This test sequence, sometimes also referred to as a target sequence, typically contains at least one repetitive element; however, it is not a requirement that the test sequence contain a repetitive sequence. In the latter instance, the method does not eliminate any sequence from consideration as a potential probe; it simply verifies that the entire test sequence is non-repetitive. This test sequence is subsequently compared with the reference sequence of the same genome from which the test sequence is derived. Using homology search algorithms common in the art, such as, for example, BLAST or BLAT (see details below), this approach will identify matches with at least 80% identity to genomic sequences. Often weaker orthologies with as little as 70% or 60% identity can also be detected, although this typically requires few or no gaps to be present in the sequence alignment. This level of sensitivity is more than adequate for detection of single copy sequences, since highly divergent repetitive elements form heterologous duplexes that are easily eliminated by hybridizing and washing the probe under high stringency conditions (e.g., 0.1×SSC, 42° C.). These comparisons identify at least one region of the genome that matches (or nearly matches, due to genomic polymorphism) that test sequence. The exact and similar matches to the test sequence are termed “hits.” When multiple hits are obtained, the test sequence contains one or more members of a repetitive sequence family or one or more low-copy segmental duplicons. In principal, such intervals are not preferred for probe design since a probe designed using such intervals could potentially hybridize to more than a single genomic locus.

There are mitigating circumstances in which multiple hits may still be suitable for probe design, such as, for example, if the two hits occur at nearly contiguous locations on the chromosome. This can be deduced from the chromosomal coordinates of the sequences in the genome that are similar to the potential probe interval. For hybridization by FISH to metaphase chromosomes, these coordinates may be up to approximately 3 million nucleotides apart (it can be more or less than this quantity depending on the level of condensation of the particular genomic region), and the probe signals obtained by FISH will be coincident even at the highest power magnification. For either array-based or microsphere suspension hybridization, however, much higher levels of granularity, i.e., genomic resolution, may be required to precisely localize a genomic target in, for example, a patient specimen.

Typically, 100,000-400,000 by intervals are tested to design single copy probes in a reasonable length of time (i.e., within 1-2 CPU hours on a modern cluster computer), however it can be appreciated by those of skill in the art that this approach could be applied genome-wide, given sufficient computational power. An advantage of genome-wide pre-computation would be that subsequent probe development would only involve looking up relevant single copy intervals to identify the most appropriate primers for amplification of single copy probes using the polymerase chain reaction (PCR) (see U.S. Pat. No. 6,828,097 for details of the PCR reaction to amplify products from deduced single copy genomic intervals).

While it is possible to conduct an exhaustive genome search of every subsequence window in the test sequence, such that the windows overlap and differ by a single nucleotide, this procedure is slow and inefficient. Certain embodiments employ a more efficient approach. The genomic frequency of sequences with test genomic sequence region can be determined to establish optimal parameters of window sizes and displacements based on estimates of the local distribution of repetitive sequences in the test sequence interval. Initially, the test genomic sequence region is prescreened by comparison with the reference genome sequence in order to determine local density of repetitive sequences within the region. This density can vary considerably within local regions across the euchromatic genome and it is not adequate to assume an average density for any particular region. This density dictates the granularity of the overlapping sequence windows needed to comprehensively find all repetitive sequences in a particular region. A higher density of repetitive sequences necessitates that windows of less than this length be used in the subsequent step of defining the precise locations of the repeats. In a preferred embodiment, for a sequence with at least one repeat per kilobase pair in the test region, windows of 0.5 kb sequences are used to determine locations of repeats.

First, end-to-end window comparisons of about 500 by to about 1000 base pairs (bp) are performed across the entire test sequence. This is akin to a pre-screening function. The length utilized in this embodiment was selected because it is consistent with studies indicating the average distances between interspersed repetitive elements in the human genome. The optimal window lengths may be different for other genomes since they would be based on overall repetitive complement in those genomes (determined from kinetic reassociation studies) and the respective genome sizes. This information is available from published sources (Lewin, Eukaryotic Gene Expression, Wiley, 1983). Other factors affecting the selection of a window length include, for example, the degree of resolution desired to determine the boundaries of a single copy sequence, the efficiency (i.e., the amount of time) desired to determine the boundaries of a single copy sequence, the density of repetitive sequences in the genome sequence of interest (i.e. containing potential probe sequences) and the accuracy of sequences in this region of the genome. Accordingly, the test sequence may be divided into test segments (i.e., window lengths) of about 20 by to about 5000 bp, preferably about 100 by to about 2500 bp, more preferably from about 250 by to about 1500 bp, still more preferably about 500 by to about 1000 bp, and most preferably about 1000 bp.

Alternative faster ab initio approaches for detection of repeats have been described based on exact word-matching algorithms based on nucleotide sequences (for example, Healy et al. Genome Res. 13:2306-15, 2003). Here, words are defined as overlapping or non-overlapping sequences of a short uniform length. However such approaches are not comprehensive. It also stated in this paper that this is not sufficient to ensure that repetitive sequences are completely eliminated from the microarray. Follow up approximate homology searching is performed so that the algorithm is carried out on a single human genome reference sequence. Of course, the human genome is highly polymorphic and the word match algorithm does not consider words containing the polymorphic variants. Therefore, a genomic microarray based on this algorithm alone may fail to detect repetitive sequences that contain polymorphic words. Of course, some of the sequences in the patient DNA hybridizing to those oligonucleotides will be repetitive. This will result in incorrect (vastly increased) copy number measurements. Since this is the signature of what they are trying to detect, i.e., abnormalities, it would result in false-positive identification of copy number changes in these oligonucleotides. However, a low-stringency approximate homology search by conventional repeat masking will pick up these sequences. This is why the exact word match procedure must be followed up with conventional repeat-masking (as was done in Healy et al Genome Res. 13:2306-15, 2003; see U.S. Pat. No. 6,828,097) to ensure that single copy sequences are synthesized on the microarray chip.

There are three possible outcomes of the prescreen for repetitive sequences: (1) the subsequence can be entirely composed of repetitive sequence, (2) one or more portions of the subsequence may be repetitive, or (3) the subsequence may contain no detectable repetitive sequences. Efficient methods for comparison of test sequences with complete or near complete reference genomes are well known in the art (BLAST and BLAT). If the genome comparison reveals the presence of sequences with high percentages of similar consecutive nucleotides to the test sequence at multiple genomic loci, this indicates the presence of one or more repetitive sequences within the test sequence.

A detailed description of how the method handles each of these outcomes follows: (1) if the paralogous (related or similar) copies span the entire length of the subsequence, then this subsequence is eliminated as a potential hybridization probe. For this class of subsequences, the objective then is to determine how far upstream and downstream of the subsequence the paralogous repeats extend. The adjacent subsequences within the test sequences are then analyzed to determine whether these sequences are similar to multiple genomic loci within the genome over their entire length. The process of analyzing contiguous adjacent subsequences is iterated until, either (a) the adjacent subsequence is found at only a single genomic location, or (b) only a portion of the subsequence shows similarity to multiple genomic locations, that portion determining the boundary of the single copy and multilocus subsequences; (2) pursuant to (b), such partially repetitive subsequences are again analyzed to determine which portion is contiguous with the relevant adjacent single copy interval. Segments of the subsequence can either be sampled to and compared with the genome reference to determine the approximate locations of repetitive domains which are then fine mapped by additional short sequence comparisons, or a relative series of consecutive, short or overlapping sequence windows are progressively tested against the genome sequence until coordinates that match a single location in the haploid genome sequence are found; (3) subsequences that match only a single location in the genome are considered single copy sequences, however exceptions, for example, including non-polymorphic tandemly repeated sequences of no more than about 10 copies, preferably no more than about 8 copies, more preferably no more than about 3 copies, and still more preferably no more than about 5 copies found at a single location in the genome may be treated as single copy intervals especially in FISH studies, because of their consistent, unequivocal patterns of hybridization to the genome.

Fine mapping of the approximate repetitive sequence/single copy interval within a subsequence is performed on overlapping sequence intervals by iteratively and unidirectionally displacing the sequence window by a fixed, constant length of, for example, 1 to 20 nucleotides. The new sequence is compared with the reference genome sequence and the number of significant matches in the genome (based on length and percent of identity to the new sequence) is determined. After each comparison, the window is again displaced by this length, compared with the reference genome and this process is iterated until the end of the subsequence is reached.

If multiple hits are detected in the genome, then the range of coordinates within the subsequence that contains the repetitive sequence is then refined. This is done by performing a low stringency comparison of the genome and subsequence, preferably with the Smith-Waterman algorithm, however other algorithms may also be used such as BLAST or BLAT. The location of the matching terminal coordinate within the query is determined and this coordinate is recorded. The window is again shifted by 1-20 nucleotides. The length of the pairwise match may increase, remain the same, or decrease. If this length increases, the matching coordinate is again recorded and the window is shifted in the same direction. If it stays the same, the window is also again shifted in the same direction. If the length decreases, then the complete repeat has been found (both boundaries). The final coordinates of the centromeric and telomeric boundaries of the repetitive sequence are then recorded (and the prior intermediate coordinates are discarded).

An optional step that would reduce future computational expense is to bootstrap a catalog of repetitive elements derived from the ab initio procedure. Rather than discarding the sequences found to be present more than once per genome, the interface between single copy and repetitive sequence elements could be defined using the aforementioned procedure, which would determine the coordinates of the repeat, and the repeat sequence then catalogued. This could be accomplished by storing the sequences of the repetitive sequences detected in a separate database for subsequent searches. Similar repeats could then be sorted into families and subfamilies by multiple alignments. Subsequent searches will first compare a new sequence with the repeat sequence database, and then to the genome reference sequence as described above. Although this step is not required, it will significantly improve performance of the algorithm to detect single copy intervals, especially as the repeat catalog grows in size.

Repetitive sequence elements defined by the above method can then be deposited in an electronic database where they can be subsequently retrieved for comparisons with other potential sequences containing single copy and repetitive intervals. Since each matched segment contains an individual repetitive element, the element in most instances will not be identical to the consensus sequence of the corresponding repetitive sequence family representative found in, for example, Knoll et al.'s '097 patent, because consensus sequences are derivative sequences that are compiled by selecting the most common nucleotide at a particular position among a set of elements. Various embodiments can be used to screen sequences contained within current repeat libraries in order to ensure that a repetitive sequence is not misassigned as a single copy sequence. Finally, this procedure may identify repetitive sequences that are not otherwise recognized with the technology described in other approaches reliant upon an established repeat library because the newly identified sequences are not necessarily represented in existing databases.

Defining the boundary of the single copy interval can occur as follows. As the window moves, the repeat sequence boundary should shift by the length of the sequence displaced through each step. When sufficient steps in one direction have been performed so that there is no longer a match to a repeat sequence, this defines the other boundary of the repeat. Definition of the repeat sequence boundaries on both ends makes the repeat sequence eligible for optional deposition into a repeat sequence database.

The resolution of the single copy window is defined by the length of the smallest sequence displacement (i.e., the nucleotide word length) between iteration cycles used in the definition of the repeat/single copy boundary. The single copy interval sequence can be shortened by at least one word at the repeat boundary to ensure that the entirety of the region selected for probe development is single copy.

Single copy sequences defined by this approach can be used to detect chromosome rearrangements including deletions, insertions, additions, translocations, inversions and any combination of these chromosomal modifications by hybridization. Often, such rearrangements are diagnostic for the detection of genetic diseases and cancer.

Accordingly, among the various aspects of the present invention is a method to identify a single copy sequence in a target reference genomic sequence. The method comprises determining a number of matches between at least one subsequence of a first screened sequence and a target reference sequence, wherein the target reference sequence comprises the first screened sequence, the first screened sequence is divided into at least two subsequences, and a subsequence of the first screened sequence with a single match to the target reference sequence or a group of contiguous subsequences of the first screened sequence each with a single match to the target reference sequence is identified as a single copy interval of the first screened sequence; determining a number of matches between at least one subsequence of a second screened sequence and the target reference sequence, wherein the second screened sequence comprises a single copy interval of the first screened sequence; the second screened sequence overlaps the single copy interval of the first screened sequence; the subsequences of the first screened sequence are either (i) consecutive non-overlapping subintervals of the second screened sequence or (ii) overlapping non-identical subintervals of the second screened sequence, each containing one nucleotide homologous to the reference sequence that is not present in the adjacent subinterval; and a subsequence of the second screened sequence with a single match to the target reference sequence or a group of contiguous subsequences of the second screened sequence each with a single match to the target reference sequence is identified as a single copy interval of the second screened sequence; and identifying a single copy interval as a single copy sequence of the target reference sequence suitable for use as a single copy hybridization probe. In one embodiment, the subsequences may be at least about 100 consecutive non-overlapping nucleotides, at least about 200 consecutive non-overlapping nucleotides, at least about 400 consecutive non-overlapping nucleotides, at least about 600 consecutive non-overlapping nucleotides, at least about 800 consecutive non-overlapping nucleotides, or even at least about 1000 consecutive non-overlapping nucleotides.

In one embodiment of the invention, the method further comprises the step of determining a number of matches between at least one subsequence of a third screened sequence and the target reference sequence, wherein the third screened sequence comprises a single copy interval of the second screened sequence; the third screened sequence overlaps the single copy interval of the second screened sequence; the subsequences of the third screened sequence are either (i) consecutive non-overlapping subintervals or (ii) overlapping non-identical subintervals, each containing one nucleotide homologous to the reference sequence that is not present in the adjacent subinterval; and a subsequence of the third screened sequence with a single match to the target reference sequence or a group of contiguous subsequences of the third screened sequence each with a single match to the target reference sequence is identified as a single copy interval of the third screened sequence. In another embodiment, the method further comprises the step of determining a number of matches between at least one subsequence of a fourth screened sequence and the target reference sequence, wherein the fourth screened sequence comprises a single copy interval of the third screened sequence; the fourth screened sequence overlaps the single copy interval of the third screened sequence; the subsequences the of fourth screened sequence are either (i) consecutive non-overlapping subintervals or (ii) overlapping non-identical subintervals, each containing one nucleotide homologous to the reference sequence that is not present in the adjacent subinterval; and a subsequence of the fourth screened sequence with a single match to the target reference sequence or a group of contiguous subsequences of the fourth screened sequence each with a single match to the target reference sequence is identified as a single copy interval of the fourth screened sequence.

In still another embodiment, the method further comprises the step of identifying a subsequence of the screened sequence with at least two matches to the target reference sequence as a subsequence containing a repetitive element wherein the single copy sequence is located adjacent to the repetitive element. In another embodiment, the method further comprises the step of identifying a second, distinct subsequence of the screened sequence with at least two matches to the target reference sequence as a subsequence containing a different repetitive element, wherein the single copy interval is located between the first and the second subsequences containing the distinct repetitive elements.

Another aspect of the present invention is a single copy hybridization probe as described herein. Such probes may comprise at least one single copy interval or single copy sequence identified according to the methods disclosed herein. In one embodiment, the probes comprise at least two contiguous subsequences of a screened sequence, each having a single match to the target reference sequence.

Referring to FIG. 1, a block diagram illustrates a user 102 interacting with a computing environment in one embodiment of the invention. In the example of FIG. 1, the user 102 interacts with a computing device 104. The computing device 104 has access to one or more computer-readable media such as computer-readable medium 106. The computer-readable medium 106 stores one or more computer-executable components. In this example, the components include a first genome comparison component 108, a second genome comparison component 110, and a subsequence component 112. The first genome comparison component 108 determines a number of matches between at least one subsequence of a first screened sequence and a target reference sequence. The target reference sequence includes the first screened sequence which is divided into at least two subsequences. A subsequence of the first screened sequence with at least two matches (and preferably more than five matches) to the target reference sequence can be identified as containing a repetitive element. A subsequence of the first screened sequence with a single match to the target reference sequence or a group of contiguous subsequences of the first screened sequence, each with a single match to the target reference sequence is identified as a single copy interval of the first screened sequence.

The second genome comparison component 110 determines a number of matches between at least one subsequence of a second screened sequence and the target reference sequence. The second screened sequence includes a single copy interval of the first screened sequence. The second screened sequence overlaps the single copy interval of the first screened sequence. The subsequences are either (i) consecutive non-overlapping subintervals of the second screened sequence or (ii) overlapping non-identical subintervals of the second screened sequence, each containing one nucleotide homologous to the reference sequence that is not present in the adjacent subinterval. A subsequence of the second screened sequence with at least two matches (and preferably more than five matches) to the target reference sequence can be identified as containing a repetitive element. A subsequence of the second screened sequence with a single match to the target reference sequence or a group of contiguous subsequences of the second screened sequence each with a single match to the target reference sequence is identified as a single copy interval of the second screened sequence.

The subsequence component 112 identifies a single copy interval as a single copy sequence of the target reference sequence suitable for use as a single copy hybridization probe.

Hardware, software, firmware, computer-executable components, and/or computer-executable instructions such as the exemplary components/instructions illustrated in the figures constitute means for determining a number of matches between at least one subsequence of the first screened sequence and the target reference sequence, means for determining a number of matches between at least one subsequence of the second screened sequence and the target reference sequence, and means for identifying a single copy interval as a single copy sequence of the target reference sequence suitable for use as a single copy hybridization probe.

An exemplary operating environment for implementing aspects of the invention (e.g., the computer programs described herein) such as shown in FIG. 1 includes a general purpose computing device such as computing device 104 executing computer-executable instructions. The computing device 104 typically has at least some form of computer readable media. Computer readable media, which include both volatile and nonvolatile media, removable and non-removable media, may be any available medium that may be accessed by the general purpose computing device 104. By way of example and not limitation, computer readable media comprise computer storage media and communication media. Computer storage media include volatile and nonvolatile, removable and non-removable media implemented in any method or technology for storage of information such as computer readable instructions, data structures, program modules or other data. Communication media typically embody computer readable instructions, data structures, program modules, or other data in a modulated data signal such as a carrier wave or other transport mechanism and include any information delivery media. Those skilled in the art are familiar with the modulated data signal, which has one or more of its characteristics set or changed in such a manner as to encode information in the signal. Wired media, such as a wired network or direct-wired connection, and wireless media, such as acoustic, RF, infrared, and other wireless media, are examples of communication media. Combinations of any of the above are also included within the scope of computer readable media. The computing device 104 includes or has access to computer storage media in the form of removable and/or non-removable, volatile and/or nonvolatile memory. The user 102 may enter commands and information into the computing device 104 through input devices or user interface selection devices such as a keyboard and a pointing device (e.g., a mouse, trackball, pen, or touch pad). Other input devices (not shown) may be connected to the computing device 104. The computing device 104 may operate in a networked environment using logical connections to one or more remote computers.

Although described in connection with an exemplary computing system environment, aspects of the invention are operational with numerous other general purpose or special purpose computing system environments or configurations. The computing system environment is not intended to suggest any limitation as to the scope of use or functionality of aspects of the invention. Moreover, the computing system environment should not be interpreted as having any dependency or requirement relating to any one or combination of components illustrated in the exemplary operating environment. Examples of well known computing systems, environments, and/or configurations that may be suitable for use in embodiments of the invention include, but are not limited to, personal computers, server computers, hand-held or laptop devices, multiprocessor systems, microprocessor-based systems, set top boxes, programmable consumer electronics, mobile telephones, network PCs, minicomputers, mainframe computers, distributed computing environments that include any of the above systems or devices, and the like.

Embodiments of the invention may be described in the general context of computer-executable instructions, such as program modules, executed by one or more computers or other devices. Generally, program modules include, but are not limited to, routines, programs, objects, components, and data structures that perform particular tasks or implement particular abstract data types. The computer-executable instructions may be embodied in any computer programming language or scripting language including, but not limited to, C, C++. C#, and Perl. The computer-executable instructions may be organized into one or more computer-executable components or modules. Aspects of the invention may be implemented with any number and organization of such components or modules. For example, aspects of the invention are not limited to the specific computer-executable instructions or the specific components or modules illustrated in the figures and described herein. Other embodiments of the invention may include different computer-executable instructions or components having more or less functionality than illustrated and described herein.

Aspects of the invention may also be practiced in distributed computing environments where tasks are performed by remote processing devices that are linked through a communications network. In a distributed computing environment, program modules may be located in both local and remote computer storage media including memory storage devices. In operation, the computing device 104 executes computer-executable instructions such as those illustrated in the figures to implement embodiments of the invention.

Referring next to FIG. 2, a flow chart depicts exemplary operations for deriving the locations of single copy intervals used in probe production. FIG. 2 illustrates one exemplary implementation of aspects of the invention using computer-executable instructions. Other implementations are within the scope of embodiments of the invention. For example, the operations illustrated in FIG. 2 may be organized into other components or application programs.

In FIG. 2, an ABINITIO.PL script creates a set of individual subsequences covering a region for genome comparisons. The script takes as input the following at 202: a genomic sequence file, a length of subsequence, a length of window offset between subsequences, a minimum length of match to genomic repeats or paralogs (e.g., for filtering results of genomic comparisons), and a minimum percentage of match to genomic repeats or paralogs. If the length of window offset is smaller than the length of subsequence, the script produces overlapping windows. If the length of window offset is larger than the length of subsequence, the script produces subsequences separated by gaps having a length equal to the length of subsequence minus the length of window offset. If the length of window offset is equal to the length of subsequence, the script produces consecutive windows.

The ABINITIO.PL script outputs at 204 a set of individual subsequences (e.g., files named by subsequence boundaries) to a WUBL script (e.g., a BLAST script) to perform genome comparisons. The WUBL script performs the genome comparisons at 206 on a cluster computer (e.g., a separate parallel job is run simultaneously on a different node). Files indicating the results of the WUBL genome comparisons are filtered by a BLASTPARSE.PL script and condensed to a hit list based on user-provided or empirically-derived criteria. The BLASTPARSE.PL script produces files of filtered output.

The user 102 may confirm that the comparisons with the genome sequence have been completed using an application program, such as qstat, which is a Sun-Grid Engine utility to monitor processor status. In another embodiment, this confirmation operation is automated and the user 102 is notified when the comparisons have been completed.

The files of filtered output from the BLASTPARSE.PL script are input into a COUNTHITS.PL script for summarizing. The COUNTHITS.PL script distills at 208 the hit list from the BLASTPARSE.PL script for each interval to a copy number and sorts by sequence coordinate. The COUNTHITS.PL script identifies intervals with multiple hits as these contain repeat elements and records single copy intervals as, for example, Set A.

One output of COUNTHITS.PL is a count which contains the quantity of hits in the genome found with each subsequence interval. If the quantity of hits exceeds one, the sequence is not single copy based on the parameter definitions that are acceptable by one of skill in the art. These definitions aim to prevent cross hybridization between a single copy probe and other genomic locations that are partially paralogous to the entire potential probe sequence or a portion thereof.

The single copy intervals in Set A are grouped at 210 into contigs {L1 . . . } which are members of the Set A. For each contig, a SUBSEQ program creates a series of subsequences with small offset up to the length of subsequence from the beginning and end of the contig.

Independent threads are spawned with the series of subsequences having an upstream boundary (U) and a downstream boundary (D). The WUBL script, BLASPARSE program, and COUNTHITS.PL script are executed at 212 until the COUNTHITS.PL script produces a hit count greater than one (e.g., defining a single copy boundary). For each contig, the coordinates of single copy interval boundaries (U, D) are recorded and combined with adjacent single copy contigs to define a complete interval (A−U, A+D) at 214.

Appendix A includes an example of the ABINITIO.PL script. Appendix B includes an example of the WUBL script. Appendix C includes an example of the BLASTPARSE.PL script. Appendix D includes an example of the COUNTHITS.PL script. Appendix E includes an example of the SUBSEQ.PL script.

In another embodiment, the operations for deducing single copy intervals use a single program set to analyze a larger sequence and produce a single table that gives the genomic copy number of each consecutive or overlapping subsequence. Via this table, the system automatically detects the transitions between repetitive and single copy intervals. The boundaries may be refined in increasingly higher resolution using a programmable iterative procedure.

The order of execution or performance of the operations illustrated and described herein is not essential, unless otherwise specified. That is, the operations may be performed in any order, unless otherwise specified, and the operations may include more or less elements than those disclosed herein. For example, it is contemplated that executing or performing a particular operation or element before, contemporaneously with, or after another operation or element is within the scope of an embodiment of the invention.

Having described the invention in detail, it will be apparent that modifications and variations are possible without departing from the scope of the invention defined in the appended claims. Furthermore, it should be appreciated that all examples in the present disclosure are provided as non-limiting examples.

EXAMPLES

The following non-limiting examples are provided to further illustrate the present invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent approaches the inventors have found function well in the practice of the invention, and thus can be considered to constitute examples of modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Example 1

The following example illustrates how the probes designed using the instant invention produce similar results to the repeat-free probes described in U.S. Pat. No. 6,828,097. Here we rederive the single copy intervals shown in Example 1 of that Patent with the present invention. First we determined the locations of the repetitive sequences in the human HIRA gene and flanking regions (SEQ ID NO: 1) and subsequently inferred the locations of the single copy intervals therefrom.

TABLE 1
Results obtained using the method described in U.S. Pat. No.
6,828,097
POSITION IN
REFERENCE POSITION IN REPEAT
SEQUENCE REPEAT CONSENSUS SEQUENCE*
Begin Coord End Coord FAMILY Begin Coord End Coord
633 653 GC_rich 1 21
695 859 (CCG)n 3 172
987 1008 GC_rich 1 22
647 1061 MLT2A1 436 1
2913 3014 MER58B 239 340
3053 3397 L1M4 2884 3209
3398 3698 AluJb 303 2
3699 3935 L1M4 3209 3451
4002 4465 L1M4c 1469 1003
4466 4766 AluY 300 1
4767 4861 L1M4c 1004 910
4865 5081 AluJo 5 220
5082 5137 AluSq/x 86 141
5138 5211 AluS 76 2
5214 5713 L1MEc 2392 1876
5740 6031 AluSx 295 6
6077 6206 L1 5015 4879
6291 6557 L1 4686 4399
6560 6600 L1M4c 1457 1497
6602 6663 MLT1E1 231 293
6677 6743 MLT1E1 417 481
6774 6897 L1PB2 91 210
6878 7534 L1PB2 1113 1767
7577 7655 Alu 312 234
7656 8290 L1PB2 1771 2376
8291 8583 AluSx 293 1
8584 9844 L1PB2 2376 3758
9845 10143 AluSx 1 298
10144 11262 L1PB2 3983 5142
11263 11282 (TAAAA)n 3 22
11283 11525 L1PB2 5142 5378
11526 11659 AluJb 1 134
11661 11964 AluJb 1 306
11965 12896 L1PB2 5365 6313
12897 13179 AluSx 282 1
13180 13675 L1PB2 6313 6805
13762 14060 AluJb 1 288
14136 14364 AluJb 1 229
14387 14502 FLAM_C 117 2
14528 14584 L1 2931 2987
14586 15758 L1 3041 4281
15989 16191 MER1B 337 127
16191 16223 MER1B 33 1
16449 16582 L1M 5265 5393
16728 16858 FLAM_C 2 143
18149 18455 AluSx 1 307
18677 18964 L1MCa 895 1178
18993 19286 AluSq 293 1
19287 19575 AluSq 302 1
19586 19893 AluSx 309 2
20067 20241 HAL1 1469 1634
20261 20453 L2 2798 3023
20469 20569 AluY 310 210
20570 20852 L2 3043 3313
20994 21151 L2 2489 2646
21945 22025 A-rich 6 86
25263 25558 AluJo 297 2
28496 28708 AluSg/x 294 82
29588 29670 MIR 105 191
30298 30367 MIR 107 34
32436 33041 L1MCa 1529 2328
33042 33352 AluSq 311 1
33353 33440 L1MCa 2328 2416
33444 33753 AluSc 1 308
33768 33788 AT_rich 1 21
33821 33945 FLAM_A 4 128
33976 34107 L1MC1 5912 6056
34108 34410 AluSx 1 295
34411 34513 L1MC1 6056 6154
34523 34658 L1MC1 6197 6332
34668 34835 L1MCa 2559 2728
34843 36256 Tigger1 1 1358
36257 36551 7SLRNA 19 312
36552 36572 Tigger1 1358 1377
36573 36868 AluY 1 296
36869 37248 Tigger1 1377 1889
37253 37554 AluSx 300 1
37726 37860 MER2 1 137
37861 38163 AluSx 298 1
38164 38378 MER2 137 344
38914 38938 AT_rich 1 25
40144 40447 AluSx 1 309
40464 40735 AluSx 312 1
40738 41039 AluSx 303 1
41814 41920 L1MEd 1000 895
41961 42592 L1MB6 6172 5522
42728 43063 L1MB6 5502 5156
43064 43363 AluSq 301 1
43371 43496 AluJo 136 2
43497 43694 L1MB6 5168 4972
43817 44531 L1MEd 823 59
44543 44777 AluSq 1 234
44780 44945 AluJo 170 1
47718 47829 L2 3141 3256
48724 48880 MER104 180 1
49052 49217 MIR 28 218
49281 49513 L1MC/D 5655 5434
49514 49803 AluY 306 1
49804 49836 L1MC/D 5434 5404
49837 50139 AluSg 1 301
50140 50254 L1MC/D 5404 5256
50311 50596 AluSc 288 3
50716 50756 AT_rich 1 41
51099 51415 AluSx 306 1
51696 51914 L1 4329 4067
51952 52256 L1M4 3980 3658
53254 53280 (T)n 1 27
53417 53495 L1ME4A 5612 5692
53641 53782 L1ME4A 5968 6125
54265 54528 L1MA10 6182 5922
54529 54835 AluSc 1 300
54836 54877 L1MA10 5922 5881
55140 55445 AluSx 307 1
57716 57845 MIR 110 250
60803 61122 AluSx 1 311
61247 61490 L1ME 5680 5448
61472 61955 L1ME2 5628 6132
61964 62271 AluY 309 1
63775 63814 AT_rich 1 40
63849 64147 AluSg 299 1
66128 66369 L2 3031 3263
66726 67033 AluSq 1 308
69187 69478 AluJb 1 300
69502 69575 MIR 157 237
69646 69699 L2 3187 3240
70252 70300 AT_rich 1 49
71084 71533 L2 510 1029
71589 71784 L2 1815 2014
71790 71871 FLAM 132 48
71986 72419 L2 2275 2777
72700 72741 L2 3217 3258
73316 73622 AluJo 1 311
73820 74122 AluY 1 300
76503 76829 L1ME4A 5747 6111
79310 79501 MIR3 10 186
79772 80074 AluSx 304 1
82071 82145 L2 3185 3266
82529 82563 Tigger4 2730 2696
(Zombi)
82555 82950 MLT1G1 101 587
82960 83036 MLT1K 509 586
83328 83392 L2 3281 3216
83428 83581 L2 3081 2907
83877 83905 (TTTTA)n 2 31
84088 84406 AluY 315 1
85204 85399 AluJo 117 305
85429 85604 AluSg/x 309 134
85605 85643 Alu 40 2
85644 85998 L1MB6 4209 4547
85999 86291 AluSp 1 293
86292 86804 L1MB6 4547 5036
86805 87130 AluJb 311 1
87131 87414 L1MB6 5036 5306
87415 87719 AluSx 6 310
87720 87833 L1MB6 5306 5414
87834 88134 AluSc 1 301
88135 88725 L1MB6 5414 6154
88771 88791 AT_rich 1 21
88794 88834 L1MD1 5987 6024
88835 89139 AluY 1 301
89140 89415 L1MD1 6024 6258
89418 89444 (CA)n 2 28
89656 89751 L2 2313 2413
89911 90214 L2 2995 3302
90533 90562 (TG)n 1 30
90672 90973 AluJb 5 301
90982 91007 (CAAA)n 2 28
91112 91213 FRAM 52 154
91214 91333 L1PB3 6022 6140
91508 91808 AluSq 1 300
92080 92126 L2 2383 2429
92181 92463 AluSx 283 1
92524 92635 L1ME2 6022 6134
92657 92747 (CATATA)n 5 96
92793 93203 L2 2545 3016
93225 93631 LTRI6A 23 431
93945 94017 (CA)n 2 74
94573 94684 L2 3310 3194
95304 95379 MLT1L 549 471
95504 95590 MLT1L 267 180
96194 96524 AluSx 1 299
97576 97749 MER20 219 46
98589 98690 MIR 124 14
98733 98965 MER20 2 218
99158 99286 FLAM_A 1 127
99626 99927 AluSc 304 1
100587 100676 L2 3304 3210

The present invention is now shown to provide similar results to the above comparison of a sequence region with a predetermined library of repetitive sequences. The following results were obtained using one embodiment of the present invention.

Initially, the 103 kb HIRA sequence was divided into consecutive non-overlapping intervals of 1000 by in length to determine the density of repetitive sequences across this genomic region. The sequences of each of these intervals were compared with the May, 2004 human genome reference sequence using the WU-BLAST blastn program. The parameters for these comparisons were modified from default values to pick up the weakest similarities in the genome in order to ensure that even poorly conserved repetitive sequences would be detected. The parameters of the search were: −d human, span2, cpus=2 (number of threads), lcmask, and hspmax=100. Each comparison required approximately 5.8 seconds.

The 103 comparisons of 1 kb each required approximately 6 minutes on an 8 node dual CPU cluster computer, which is comparable or faster than the method described by Knoll et al. in the '097 patent.

After filtering the output with a Blast parsing routine (called from the Bioperl implementation of the Perl language; at www.bioperl.org), and counting the number of significant hits detected for each of the 1000 consecutive sub-intervals of SEQ ID NO: 1, the results are summarized in the Table 2. Regarding filtering, we have tested several minimum thresholds for repeat sequence detection in human genomic sequences have and each gives similar results. The preferred minimum thresholds for detection are a pairwise match between the test sequence and its genomic counterpart of at least 100 nucleotides in length and 70 percent identity. Equivalent results were obtained, for example, using criteria of at least a 50 nucleotide length match with at least 65 percent identity, since these filters eliminated all but the actual genomic location of the probe. One of skill in the art could appreciate that these criteria are of sufficiently low stringency so as to identify even the weakest members of a potential cross hybridizing repetitive sequence.

TABLE 2
Results of ab initio repeat detection for HIRA gene region from U.S.
Pat. No. 6,828,097
Begin coordinate SEQ ID No. 1 End coordinate Number hits/genome
1 1000 7535
1001 2000 20
2001 3000 1
3001 4000 51045
5001 6000 27018
6001 7000 901
7001 8000 6853
8001 9000 5504
9001 10000 8337
10001 11000 17347
11001 12000 20284
12001 13000 21380
13001 14000 14891
14001 15000 30794
18001 19000 23772
19001 20000 23741
20001 21000 19360
21001 22000 5
22001 23000 1
23001 24000 1
24001 25000 1
25001 26000 17420
26001 27000 1
27001 28000 1
28001 29000 15799
30001 31000 1
31001 32000 1
32001 33000 277
34001 35000 47220
35001 36000 5639
37001 38000 21053
38001 39000 42981
39001 40000 3
40001 41000 23551
41001 42000 7546
42001 43000 1789
43001 44000 22258
44001 45000 23320
45001 46000 1
46001 47000 1
47001 48000 1
48001 49000 1
49001 50000 21609
50001 51000 15465
51001 52000 12501
52001 53000 2
53001 54000 2
54001 55000 22837
55001 56000 23436
58001 59000 1
59001 60000 1
61001 62000 35227
62001 63000 23960
63001 64000 23119
64001 65000 22933
65001 66000 1
66001 67000 23787
67001 68000 6095
69001 70000 18850
70001 71000 1
71001 72000 611
72001 73000 2
73001 74000 20364
74001 75000 19815
75001 76000 1
76001 77000 3
77001 78000 1
78001 79000 1
79001 80000 23902
80001 81000 7712
81001 82000 1
82001 83000 5
83001 84000 1
84001 85000 23677
85001 86000 23474
86001 87000 22801
87001 88000 21328
88001 89000 21216
89001 90000 21128
90001 91000 22559
91001 92000 44018
93001 94000 270
95001 96000 1
96001 97000 22715
97001 98000 129
98001 99000 154
99001 100000 21398
100001 101000 1
101001 102000

Consider, for example, the first single copy interval identified with the present invention—from positions 2001 to 3000. The method of the '097 patent shows that the interval between positions 1062 and 2913 are free of repetitive sequences. The following demonstrates that the method of the present invention confirms this result and independently can identify a single copy intervals delimited by similar coordinates.

The present invention shows that there are sequences with multilocus representation within the flanking subsegments. Within the subsequence defined by the coordinates 1000-2000 there is a match to at least 20 other genomic segments and within the sequence defined by 3000-4000 matches at least 51,045 other genomic sequences. The latter interval contains numerous highly conserved SINE and LINE repetitive elements. The short region containing a small portion of a MER58B repeat (2914-3000) contained within the corresponding single copy interval of the present invention is a highly divergent ember (24.8% of the sequence differs from a consensus MER58B subfamily repeat) that only includes a small portion of the total repeat element (from positions 239 to 340). Hence for all practical purposes, the 86 nucleotide region that is considered to be repetitive will not cross hybridize with other MER58B repeats in the genome, if the hybridization conditions of the probe designed using the instant technology are set to be stringent (final hybridization wash should be 0.1×SSC, at least 42° C.). Similarly, positions 22001-28000 are found to occur once in the haploid reference genome sequence using the method of the present invention.

To precisely define the boundaries of the single copy domain in this region, we then rerun the analysis of the subsegment defined by coordinates 1000 to 4000 of the initial 103 kb HIRA sequence at much higher resolution. This is carried out either by comparing shorter consecutive subsegments or overlapping subsegments from this region of the HIRA gene. The following table indicates a comparison of consecutive subsegments of 200 nucleotides with the genome reference sequence. The criteria for detecting a repeat was that the minimum length match is at least 60 nucleotides and at least 65% of the nucleotides matched.

TABLE 3
Hits in consecutive subsegments in coordinates 1000-4000
Begin End Number hits/genome
1001 1200 50
1201 1400 1
1401 1600 1
1601 1800 1
1801 2000 1
2001 2200 1
2201 2400 1
2401 2600 1
2601 2800 1
2801 3000 456
3001 3200 6
3201 3400 136
3601 3800 1059

This analysis indicates that the interval from 1201 through 2800 (a length of 1599 nucleotides) was composed of a single copy sequence (because each of the subsegments in this interval were found to be present once per haploid genome). The centromeric and telomeric boundaries of the single copy interval breaks were within the 1001-1200 and 2801-3000 nucleotide intervals. These results are consistent with the initial analysis of the density of repetitive sequences indicating that positions 1000-2000 and 3000-4000 were partially repetitive.

As an example, we illustrate how the boundary of the repetitive sequence within coordinates 1001-2000 can be even more precisely defined by comparing the sequences of overlapping windows within this region with the genome reference sequence. This is a computationally efficient approach for delineating repetitive sequence boundaries (Vincens et al. Bioinformatics 2002; 18:446-451). The 1 kb subsequences analyzed in the previous step were used to produce a series of subsets, each sequence 200 nucleotides in length, and each beginning 20 nucleotides downstream of the previous sequence (adjacent members contain 160 nucleotides in common). The minimum length pairwise match was 70 nucleotides and paralogous sequences were required to be at least 65% identical. Each of these sequences was compared with that of the reference genome in Table 4. The first two intervals (positions 1001-1200 and 1021-1220) contain one or more members of one or more repetitive sequence families, because these subsegments detect significant length matches to (at least) 50 and at least 118 different genomic locations, respectively. By shifting the centromeric end of the subsequence a further 20 nucleotides in the telomeric direction, the interval defined by positions 1041-1240 of the sequence matches a single genomic location with 100% identity (Query=10411240_HIRAcg; Min length of match=70; Min percent identity=65; Number of total hits=3; Number of qualified hits=1; Hit=ref|NC000022.7|NC000022, Length=200, Percent_id=100, Start_hit=17692626, End_hit=17692825). This indicates that the single copy interval is expected to begin approximately at this position and this finding is confirmed based on the method of the '097 patent (Table 1; see below). The degree of error in specifying the precise coordinate of the single copy interval is dictated by the amount of nucleotide displacement of each window, which in this case, is 20 nucleotides. It will be evident to those of the art that the coordinates of the 3′ or telomeric boundary of this single copy interval can be refined using precisely the same procedure as was used to define the 5′ or centromeric end of this interval at 200 nucleotide resolution.

TABLE 4
Detailed refinement of 5′ centromeric boundary of a single copy
interval in the HIRA gene
Begin End Number hits in genome
1001 1200 50
1021 1220 118
1041 1240 1
1061 1260 1
1081 1280 1
1101 1300 1
1121 1320 1
1141 1340 1
1161 1360 1
1181 1380 1
1201 1400 1
1221 1420 1
1241 1440 1
1261 1460 1
1281 1480 1
1301 1500 1
1321 1520 1
1341 1540 1
1361 1560 1
1381 1580 1
1401 1600 1
1421 1620 1
1441 1640 1
1461 1660 1
1481 1680 1
1501 1700 1
1521 1720 1
1541 1740 1
1561 1760 1
1581 1780 1
1601 1800 1
1621 1820 1
1661 1860 1
1681 1880 1
1721 1920 1
1761 1960 1
1781 1980 1

TABLE 5
Analysis of Intermediate subsequence (minimum 50 nucleotides, 65%
identity)
Begin End Number_hits
2001 2100 1
2101 2200 1
2201 2300 1
2301 2400 1
2401 2500 1
2501 2600 1
2601 2700 1
2701 2800 1
2801 2900 1
2901 3000 1

This moderate resolution (i.e. 100 nts) subsequence analysis at low stringency of the interval containing positions 2001-3000 confirms that the entire region is composed of single copy sequence. We then proceed to analyze the next 1 kb subsequence at moderate (Table 6), and then finally at high (Table 7) resolution.

TABLE 6
Definition of telomeric breakpoint at moderate resolution
Begin End Number_hits
3001 3100 1
3101 3200 1
3201 3300 1
3301 3400 1
3401 3500 2081
3501 3600 529
3601 3700 1
3701 3800 1
3801 3900 163
3901 4000 1

The results shown in Table 5 suggest that the telomeric boundary of the single copy sequence interval resides between coordinates 3400 and 3500.

TABLE 7
Detailed refinement of the 3′ telomeric boundary of the single copy
interval in the HIRA gene using overlapping windows (same interval
as that analyzed in Table 4)
Begin End Number hits
3001 3100 1
3021 3120 2
3041 3140 7
3061 3160 4
3081 3180 2
3101 3200 1
3121 3220 1
3141 3240 1
3161 3260 1
3181 3280 2
3201 3300 6
3221 3320 11
3241 3340 67
3261 3360 63
3281 3380 20
3301 3400 39
3321 3420 36
3341 3440 150
3361 3460 610
3381 3480 1936
3401 3500 2081
3421 3520 2987
3441 3540 3626
3461 3560 330
3481 3580 3479
3501 3600 529
3521 3620 3473
3561 3660 819
3581 3680 1406
3601 3700 2044
3601 3700 2351
3641 3740 1281
3661 3760 1610
3701 3800 22
3721 3820 57
3741 3840 140
3761 3860 19
3781 3880 8
3801 3900 157
3801 3900 163
3821 3920 709
3881 3980 19

The results of the detailed analysis of the subsequence covered by the positions 3001-4000 subsequence indicate that the end of the first repetitive sequence can be found between positions 3100 and 3120 (positions 3021-3120 was present in 2 copies, whereas 3001-3100 is found only once per genome). Comparing with the results obtained in Table 1, we find that the telomeric boundary determined with the instant invention overlap highly divergent members of the MER58B and L1M4 subfamilies. The element contained in the HIRA derived subsequence respectively 24.5% and 22.8% (with 13.2% insertion/deletion) different from prototypic members of these families. Because of the level of divergence from the consensus elements in the genome, and the limited length of the match to these elements (101 and 47 nucleotides, respectively), probes containing these sequences should not cross hybridize with other genomic locations.

In this example, we have shown that the instant invention enables the definition of a particular single copy interval spanning coordinates 1041 through 3100 within the 103 kb HIRA complete genomic sequence. A probe prepared from this interval would be of adequate length and suitable for use as a genomic probe (for FISH, microsphere, microarray, MAPH, or Southern hybridization) using the method described in U.S. Pat. No. 6,828,097.

Although the non-homologous genomic location is still a very divergent copy, it nevertheless meets our minimum criteria for a repetitive sequence (65 nucleotides in length, and at least a 70% identity). Such a stringent criterion is necessary in order to eliminate the possibility of spurious cross hybridization with divergent repetitive sequences in the genome. This potential sequence similarly may not pose a problem of cross hybridization in actual laboratory experiments, however due to the cost and labor associated with carrying out those experiments, it is recommended that this sequence not be included in the probe. The match to the non-homologous sequence is indicated below:

>ref|NC_000017.8|NC_000017 Homo sapiens chromosome 17, complete sequence
Length = 81,860,266
Plus Strand HSPs:
Score = 189 (34.4 bits), Expect = 0.54, P = 0.42
Identities = 63/87 (72%), Positives = 63/87 (72%), Strand = Plus/Plus
Query:  12 CTAACTAAAATAATTG-AGTAAAACTCATAGGTCAAAGGGGAATTCTAATTAAGTGAAAT 70 (SEQ ID NO: 4)
|||| ||| ||| || || | |||| |||||||||||| ||| || || |||||||||
Sbjct: 19011641 CTAAATAACATACTTTTAG-ATAACCCATAGGTCAAAGAAGAAGTC-AA--AAGTGAAAT 19011696 (SEQ ID NO: 5)
Query:  71 TAAAAATGACTTGCAAGAGAATGGTAA 97 (SEQ ID NO: 6)
|||||| | || ||  |||| ||
Sbjct: 19011697 TAAAAAGTATTTAGAACCAAATGAAAA 19011723 (SEQ ID NO: 7)
Score = 171 (31.7 bits), Expect = 3.5. P = 0.97
Identities = 63/87 (72%), Positives = 63/87 (72%), Strand = Plus/Plus
Query:  13 TAACTAAAATAATTGAGTAAAACTCATAGGTCAAAGGGGAATTCTAATTAAGTGAAATTA 72 (SEQ ID NO: 8)
||| ||| |||| | | ||| | |||||||||||| |||| | |  ||| | |||||||
Sbjct: 12941025 TAAGTAATATAAGTAAATAAT-C-CATAGGTCAAAGAGGAAAT-T-TTATGGGAAATTA 12941079 (SEQ ID NO: 9)
Query:  73 AAAA-TGACTTGCAAGAGAATGGTAA 97 (SEQ ID NO: 10)
|||| || ||| || |||| ||
Sbjct: 12941080 AAAACATGTTTTG-AACTGAATGAAAA 12941105 (SEQ ID NO: 11)

Note that there are limitations to this precision of the breakpoints that can be defined by this method. In order to detect repetitive sequence elements that are highly degenerate, it is not appropriate to continue to reduce the length of the search sequence to extremely short segments because the algorithms used to detect repetitive sequences are sensitive to the lengths and composition of divergent genomic copies of such sequences. Repetitive sequences in the human genome often differ significantly both in homology and length from one another and consensus sequences derived from these repeat families, and this degree of sequence divergence challenges the sensitivity of most algorithms to detect repetitive sequence. Sequence comparisons between short test sequences and the genome using most of the common alignment methods can fail to detect shorter intervals (e.g., 50-75 nucleotides) containing members of repeat sequence families that are divergent from the majority of family members and thus the performance of the instant invention can be compromised by comparison of short subsets of sequences. The degree of similarity between a test sequence and other related sequences in the genome can vary widely across the length of the test sequence. Particular subintervals with low percentage identities can falsely indicate that a sequence is present once per genome, even though the overall subsequence (which contains this interval) is actually present multiple times in the genome.

To demonstrate this phenomenon, we attempted to divide the 1000 nucleotide subsegments from HIRA into consecutive, non-overlapping sequences as short as 50 nucleotides and search these sequences with the human genome. Most of these 50 nucleotide sequence were found by both BLAST and BLAT only one in the human genome reference, despite evidence showing that these sequences were subsets of known repetitive family methods. Thus, it might not be obvious to one of ordinary skill in the art that short contiguous sequences cannot be used to search the genome with high efficiency, since recognition of limitations on the length of the search interval are dependent on characteristics of the specific repeat sequences that are being detected. There are many eukaryotic species with genomes with families of repetitive sequences that are highly heterogeneous and contain short repetitive elements (e.g., SINE elements in the canine genome, which are often polymorphic in terms of their presence or absence in different animals). The alternative strategy of using precise word matching methods to identify repetitive sequences are themselves insensitive to weak homologies between related family members and that lack of sensitivity is only amplified when the sequence being search is particularly short.

Based on the results in Table 1, the boundaries of cataloged repetitive sequence family members flanking this interval at the centromeric and telomeric ends occur at positions 1061 and at 2913, which are completely consistent with the findings indicated in Tables 3 and 4. The minimum length of this single copy interval, i.e., 1599 nucleotides, would be quite useful for probe production for a variety of applications including fluorescence in situ hybridization, microarray hybridization, Southern analysis, and microsphere suspension array hybridization.

This same procedure was then repeated for each 1000 by subsegment that was found to be present in single copy in the initial screen that determined the overall density of repetitive sequences across the HIRA gene region. These presumed single copy subsegments and the immediately flanking subsegments which contain repeat sequences are again selected for more detailed delineation of the boundaries of the single copy intervals. These regions would include intervals defined by positions 21001-26000, 25001-29000, 28001-33000, 44001-50000, 55001-62000, 64001-67000, 69001-72000, 74001-77000, 76001-80000, 80001-83000, 82001-85000, 93001-97000, and 100001-102000 (intervals derived from Table 2).

Upon identification of the single copy intervals with the present technology, DNA products derived from these intervals are then amplified, extracted or purified from genomic DNA or from recombinant DNA clones known to contain these sequences. The derivation of such products and their hybridization to other nucleic acids (from patients with chromosome abnormalities, for example) by either Southern analysis, fluorescence in situ hybridization, attachment to microsphere suspensions, microarrays or other solid phase surfaces are entirely conventional and well known by those of skill in the art. Examples and procedures for synthesis of such probes that have been developed from computationally defined sequences of single copy intervals and hybridization applications of the instant invention have been carried out by the inventor in the '097 patent.

Example 2

HIRA Gene

The same approximate 103 kilobase pair length interval comprising the 100,836 by HIRA gene and flanking sequences (SEQ ID NO: 1) was extracted from Genbank accession NT001039. Position 1 of this interval corresponds to position 798,334 of NT001039. This approximate 103 kb interval was analyzed using the method of the instant invention. The following indicates a comparison of results obtained for design of single copy probes using the method of U.S. Pat. No. 6,828,097 versus the ab initio method of the instant invention. The coordinates provided correspond to the 103 kb interval from which probes were previously derived.

Unless otherwise noted, initially the sequence region to be tested for repetitive and single copy sequences was separated into consecutive 1000 by intervals, each of which were tested for similarity for other sequences in the genome using WU-BLAST as described in Example 1. These were divided into 100 nucleotide (nt) intervals usually overlapping one another by 10-50 nucleotides and each tested for repeats by determining the number of genomic copies of each 100 nt subsequence with matches >70 nts in length and >=70% identity.

1. Previously determined Single Copy Interval Boundaries in U.S. Pat. No. 6,828,097: Positions 55445-60803

The initial low (1 kb) resolution survey of the 103 kb region defined a single copy domain by positions 56,001-60,000 is present in single copy in the genome. The repetitive sequences adjacent to this interval were identified as follows: Centromeric boundary: 1st iteration localized to positions 55001-56000; 2nd iteration to 55393-55484 (because 55442-55541 is single copy and 55393-55492 is present in 1086 copies per haploid genome); 3rd iteration to 55,424-55,434. This single copy interval boundary is within 11 nucleotides of the boundary determined with the method of U.S. Pat. No. 6,828,097.

Telomeric boundary: Boundary iteratively defined with increasingly narrower intervals. Intermediate resolution (1st): positions 60,001-61,000; Higher resolution analysis (2nd): we find that the interval from 60,687 to 60,786 is unique in the genome (1 copy) and the interval from 60,786-60,884 is repetitive (33 copies); Highest resolution (3rd): positions 60,767-60,777. This single copy boundary is within 26 nucleotides of the boundary determined by the method of U.S. Pat. No. 6,828,097.

2. Previously Determined Single Copy Interval Boundaries in U.S. Pat. No. 6,828,097: Positions 44937-48722

Centromeric boundary: 1st: Intermediate resolution analysis shows that the 5′ most repeat ends between positions 44991 and 45000. 2nd: Fine resolution analysis shows that the boundary is between 44911 and 44921. The interval downstream of 44937 (boundary within an AluJo repeat defined by method of U.S. Pat. No. 6,828,097) is single copy. The ab initio boundary is within 16 nucleotides of the '097 boundary.

Telomeric boundary: An L2 repetitive element was shown to begin at 47718, the boundary of the single copy interval defined by the '097 patent. With the instant invention: the intermediate resolution (1st) analysis shows that a repeat begins in the interval defined by positions 47601-47700. Fine (2nd) resolution analysis shows that a repetitive sequence (with 80% identity) present four times per genome beginning in the interval defined by 47651-47661. This boundary is 58 nucleotides upstream of the boundary disclosed in U.S. Pat. No. 6,828,097.

3. Previously Determined Single Copy Interval Boundaries in U.S. Pat. No. 6,828,097: 76829-79310

Centromeric boundary: Intermediate resolution analysis (1st) delineates single copy boundary between positions 76801-76850. Fine resolution (2nd) analysis of nucleotides 76701-76900 indicates that the boundary of a repetitive sequence occurs between 76880 and 76900.

In other words, the ab initio detects a low copy divergent repeat (30% of the nucleotides are discordant) within the interval between positions 76829 and 76880 that is not found by the method of the U.S. Pat. No. 6,828,097. While this indicates that in some instances, the ab initio method may be more sensitive for detecting single copy intervals than the previous approach, one of skill in the art would recognize that divergent repetitive sequences with this level of sequence divergence do not usually produce cross-hybridization to other genomic locations under typical laboratory hybridization conditions.

Telomeric boundary: Intermediate resolution (1st) analysis (using a threshold of detecting repetitive sequences of 65% nucleotide identity) indicates boundary between positions 79400 and 79450. Fine resolution analysis (2nd) narrows this interval to between 79400 and 79410, which is 90 nucleotides from the boundary detected using the method of the '097 patent. The ab initio approach fails to detect a portion of an extremely divergent MER3 repeat element which begins at position 79310 and ends at 79501 (which is found using the method of the '097 patent). This element differs by 33% from the consensus MER3 sequence and contains insertions and deletions comprising 13% of that sequence. Because of the weak similarity to other related elements, divergent repetitive sequences of this type would not cross-hybridize to other genomic locations under typical laboratory conditions. Therefore single copy probes containing such sequences would still hybridize to a single location in the human genome under moderately stringent post-hybridization wash conditions.

4. Previously Determined Single Copy Interval Boundaries in U.S. Pat. No. 6,828,097: Positions 21423-25270

Centromeric boundary: At intermediate resolution, the ab initio method finds the boundary between a centromeric repeat and the adjacent single copy sequence within the interval defined by positions 21101 through 21149. At high resolution, the boundary is more precisely delineated between positions 21119 and 21139 using the default conditions for repeat detection. However, using a lower threshold of detecting repetitive sequences of 65% nucleotide identity, a weak, highly divergent repetitive sequence (with 67% identity to one other element in the genome) is detected within positions 21301-21399. Under typical hybridization conditions, this unlinked repetitive element would not cross-hybridize with a probe derived from this genomic interval. Application of the method used in the '097 patent indicates that the repetitive sequence at the single copy boundary is an L2 element which ends at 21151. The single copy boundary found by the ab initio method is thus 12 nucleotides from the boundary demonstrated in the '097 patent.

Telomeric boundary: At intermediate resolution (1st), the boundary found with the ab initio method between single copy and repetitive sequences falls between 25199 and 25297. The high resolution (2nd), this boundary occurs within the interval delineated between positions 25280 and 25300, which is 10 nucleotides away from the interval boundary determined in the '097 patent (position 25270).

CDC2L1 Gene

The previously determined boundaries of single copy interval based on the method of the '097 patent used to develop probes are positions 8145-17744 of GenBank accession AL03182 (SEQ ID NO: 3).

Ab initio analysis of consecutive 1 kb intervals in AL03182 (SEQ ID NO: 3) shows that positions 9001-17000 are single copy in the human genome. The sequences adjacent to this interval each contain repetitive sequences. Sequences from positions 8001-9000 are present in 117 copies per genome and sequences from 17001-18000 are present in 1672 copies.

To more precisely define the boundaries of the repetitive sequences centromeric and telomeric to the single copy interval, each of the flanking regions were further analyzed by comparing overlapping genomic intervals with increasingly shorter displacement.

Centromeric boundary: The 1st analysis localized this boundary to positions 8151-8200; the 2nd analysis to 8170-8180. The minimum distance between the boundary of the single copy interval determined with the ab initio method and the boundary determined by '097 patent is 25 nucleotides.

Telomeric boundary: The 1st analysis localized this boundary to positions 17651-17749; the 2nd analysis to positions 17662-17672. The minimum distance between the boundary of the single copy interval determined with the ab initio method and the boundary determined by '097 patent is 72 nucleotides.

This 9.5 kilobase interval was divided into two overlapping single copy intervals in order to develop probes that could be easily amplified for hybridization. As in the '097 patent, the interval sequences were used as templates for essentially conventional PCR primer selection methods, as described in the '097 patent. The resulting probes from these two intervals substantially overlapped the sequences comprising the probes of the '097 patent and when labeled by nick translation, produce an identical genomic hybridization patterns previously obtained with FISH. Differences between results produced by the current invention and the '097 patent only occur for short probes (˜100 nt) whose sequences fall at or close to the deduced boundary between the single copy and repetitive sequences (for example, for single copy probes of 100 nt typically used in microsphere hybridization assays). Probe design should avoid using probes comprised of deduced single copy sequences that are located close to the position of the single copy-repetitive sequence transition.

NDN (NECDIN) Gene

Three single copy probe intervals were derived from Genbank accession number: AC006596 (SEQ ID NO: 2) from the NECDIN gene on chromosome 15.

1. Previously Determined Single Copy Interval Boundaries in U.S. Pat. No. 6,828,097: Positions 68031-75948

For the first interval in the NECDIN gene region, the previously determined single copy interval boundaries (given in U.S. Pat. No. 6,828,097; amplified by PCR primers corresponding to SEQ ID NOS: 437 and 438 of the '097 patent) are bounded on the centromeric end by position 68031 and at the telomeric end at position 75948 of AC006596 (SEQ ID NO: 2). Sequences between these coordinates are considered single copy and are not similar to known families of repetitive sequences.

At 1 kilobase pair resolution, sequences between 69001 and 75000 were found to be present at only this location on chromosome 15 as a single copy sequence in the genome. The adjacent intervals consisting of positions 68001-69000 and 75001-76000 contained repetitive sequences based on initial copy number analysis of these sequences. Using the method of the instant invention, we first localized the centromeric boundary at intermediate resolution between positions 68051 and 68101. This interval was then refined to between positions 68051 and 68061, which is within 20 nucleotides of the previously determined centromeric single copy repetitive sequence boundary (in the '097 patent). The telomeric boundary was first determined to occur between 75949 and 75999 and subsequently refined to the interval between positions 75971 and 75981 using the ab initio method, which is within 23 nucleotides of the previously determined boundary using the method of the '097 patent.

2. Previously Determined Single Copy Interval Boundaries in U.S. Pat. No. 6,828,097: Positions 76241-78441

The second interval in the NECDIN gene region (corresponding to sequences for PCR amplification (SEQ ID NOS: 441 and 442 of the '097 patent)) has a centromeric bound at position 76249 and a telomeric bound at 79221 of the same Genbank accession number. Applying the ab initio method iteratively as shown in the previous examples, these intervals were found to occur between positions 76241-76251 at the centrometric end and between 78431-78441 at the telomeric end. Thus, the 10 nucleotide window containing the centromeric bound of the repetitive sequence defined by the ab initio method contains the boundary determined using the method of '097 patent, i.e., they are essentially coincident. The ab initio method locates a highly divergent repetitive sequence (70% sequence identity) that was not detected using the method of the '097 patent, which accounts for the 800 nucleotide difference between the respective boundary coordinates. This divergent repeat would not cause cross-hybridization under the laboratory conditions used for probe hybridization. In any case, the interval defined by the ab initio method is more conservative than the one found using the method of the '097 patent. Using typical laboratory chromosomal hybridization conditions (described in the '097 patent), one of skill in the art will understand that probes derived from this interval will produce hybridization to a single genomic location.

3. Previously Determined Single Copy Interval Boundaries in U.S. Pat. No. 6,828,097: Positions 94498-99152

The third interval in the NECDIN gene region (region (corresponding to sequences for PCR amplification (SEQ ID NOS: 439 and 440 of the '097 patent)) has a centromeric bound at position 94498 and a telomeric bound at 99152 of the Genbank AC006596. Applying the ab initio method iteratively as shown in the previous examples, these intervals were found to occur between positions 94661-94671 at the centrometric end and between 97691-97701 at the telomeric end.

The probe interval obtained using the ab initio method is more conservatively determined than the single copy interval defined by the method of the '097 patent, suggesting that the ab initio method identifies unrecognized repetitive sequences not detected with the '097 method. Indeed the instant invention detects a previously unrecognized highly divergent repetitive sequence which is present 23 times in the genome and shows an average 71% identity with the interval 97651-97750 in the Necdin gene region. This divergent repeat would not cause cross-hybridization under the laboratory conditions used for probe hybridization. Using typical laboratory chromosomal hybridization conditions (described in the '097 patent), one of skill in the art will understand that probes derived from this interval will produce hybridization to a single genomic location. At the telomeric end of this interval, the ab initio method detects several contiguous simple repetitive sequence composed of imperfect runs of polynucleotides (Gn) or polydinucleotides ([TG]n). These are detected as well by the methods of the '097 patent; however because these sequences are relatively short interrupted runs of imperfect homopolymers, they will not cause cross-hybridization under the laboratory conditions used for probe hybridization and can therefore incorporated in most probes developed using the '097 invention. Nevertheless, the ab initio method does recognize even these short, divergent sequences as repetitive sequences.

As demonstrated above, the ab initio method of probe design can recapitulate in most cases the single copy probe intervals deduced using the method of the '097 patent. In those instances where the two methods differ, in nearly all cases, the ab initio approach is more sensitive detecting even weaker similarities (of less than 70% identity) to known repetitive elements in the genome than that found with the prior method. The ab initio method may in some cases produce purer single copy sequence compositions than the methods of the '097 patent. In the laboratory however, these weak sequences similarities are not relevant, since under even moderate stringency post-hybridization wash conditions, any duplexes formed with such sequences will be disrupted and eliminated, thus preventing cross hybridization between these highly divergent repeats at other genomic locations and the designed probes.

All references cited above are hereby incorporated herein by reference.

APPENDIX A
The following script is an example of the ABINITIO.PL script.
#!/usr/bin/perl
# gets subsequences of defined length and increment from input sequence
# P Rogan 2005
#
use Bio::SeqIO;
use Bio::SeqIO::fasta;
use Bio::PrimarySeql;
use Bio::SeqFeature::Generic;
# command line arguments:
# (1) Name of genomic sequence
# (2) Length of subsequence
# (3) Length of window increment
# (4) Minimum Length of Match to repeats
# (5) Minimum Percentage Match to repeat
system(“date”);
system(“pwd”);
# get name of sequence
$ARGV = shift @ARGV;
chomp $ARGV;
if (-s $ARGV) {
 print “processing $ARGV ...\n”;
} else {
 print “Params: (1) Name of genomic seq, (2) Length of subsequence, (3)
Length of increment, \n(4) Min length of match and (5) Min percent match
to repeats\n”;
 exit; }
$seqin = Bio::SeqIO->new(‘-file’=>$ARGV,
  ‘-format’ => ‘Fasta’);
#initialization of subsequence extraction
$begin = 1;
$end = shift @ARGV;
chomp $end;
if($end<2) {die “subsequence too short”};
$incr = shift @ARGV;
chomp $incr;
if ($incr < 1) {die “beginning and ending nucleotides of subsequence are
identical”};
$minlen = shift @ARGV; chomp $minlen;
$minperc = shift @ARGV; chomp $minperc;
# $seqout = Bio::SeqIO->new(‘-format’=>‘Fasta’, ‘-file’=>‘>
# output.fa’);
# print $ARGV,“ ”, $end, “ ”, $incr;
while(( my $seqobj=$seqin->next_seq( ))) {
#length of full sequence
my $len = $seqobj->length;
#print “length”, $len;
 while( $len > $end ) {
# print “seen sequence ”,seqobj->display_id( ),“,start of seq”,
#           substr($seqobj->seq,1,10),“\n”;
 if($seqobj->alphabet eq ‘dna’){
  $subseqin = $seqobj->subseq($begin,$end);
  $id = $seqobj->display_id( );
  $idsub = $begin . “_” . $end . “_” . $id;
  $nameseg = $begin . “_” . $end;
  open (OUT, “>$nameseg”);
  print OUT “>”,$idsub, “\n”, $subseqin, “\n”;
# print “>”,$idsub, “\n”, $subseqin, “\n”;
# insert system call for qsub of wublast job here
# job runs the wubl script and then a perl program that has blast parser
  for each blast run.
Results are
# appended to a table
  $fpresults = “~/Documents/” . $nameseg . “_results”;
  system(“qsub -cwd -o $fpresults -e /dev/null ~/Documents/wubl
~/Documents/$nameseg $minlen $minperc”);
# for example: qsub -o ~/Documents/test wubl ~/Documents/101_200
  close (OUT);
  $begin = $begin + $incr;
  $end = $end + $incr;
 }
  }}
# $seqout->write_seq($subseqin)
$date=system(“date”);
print $date;

APPENDIX B
The following script is an example of the WUBL script.
if [ “$#” -ne 3 ]
then
 echo “form: wubl sequence_file min_length_match min_percent
match”
echo “sequence name (fasta format): ”$1
echo “Minimum length of match to repeat: ”$2
echo “Minimum percent match to repeat: ”$3
blastn -d “human” -span2 -i $1 -cpus 2 -lcmask -hspmax 100 -warnings
-errors -o $1_results
blaspars.pl $1_results $2 $3 >> blastparse

APPENDIX C
The following script is an example of the BLASTPARSE.PL script.
#!/usr/bin/perl
use Bio::SearchIO;
use Bio::Tools::BPlite;
# this program is called within the wubl script
#
# command line parameters : name of blast result file, min length of
match, min percent identity
$minlen = 100;
$minperc = 70;
$ARGV = shift @ARGV;
chomp $ARGV;
$minlen = shift @ARGV;
chomp $minlen;
$minperc = shift @ARGV;
chomp $minperc;
 my $in = new Bio::SearchIO(-format => ‘blast’,
        -file => $ARGV);
 print $ARGV “\n”;
 while( my $result = $in->next_result ) {
 print “\nQuery = ”, $result->query_name, “\n”;
 print “Min length of match = ”, $minlen, “ Min percent identity = ”,
$minperc;
 print “Number of hits = ”, $result->num_hits, “\n”;
  while( my $hit = $result->next_hit ) {
   while( my $hsp = $hit->next_hsp ) {
    if( $hsp->length(‘total’) > $minlen ) {
     if ( $hsp->percent_identity >= $minperc ) {
      print “Hit= ”,   $hit->name,
       “,Length=”,   $hsp->length(‘total’),
       Percent_id=”, $hsp->percent_identity,
       “Start_hit=”,  $hsp->start(‘hit’),
       “,End_hit=”,  $hsp->end(‘hit’), “\n”;
      }
     }
    }
   }
  }

APPENDIX D
The following script is an example of the COUNTHITS.PL script.
 #!/usr/bin/perl
 #counts number of qualified hits along a windowed sequence
 # 1 commandline argument: name of blastparse output file
 # parameters
 #min length of match
 $minlen = 100;
 #min percent identity
 $minperc = 70;
 $ARGV = shift @ARGV;
 chomp $ARGV;
 open (BLASTSUM, $ARGV);
 open (COUNT, “>count”);
 $num=0;
    print “Begin   End   Number hits\n”;
    print COUNT “Begin   End   Number hits\n”;
 while (<BLASTSUM>) {
  chomp;
  if (/Hit*/) {
   $num++;
    $coords[3]=$num;  }
  if (/Query*/) {
 # count the number of lines with hits
.
 #print out the number of hits for the previous query:
  if ($num>0) {
    print $coords[1],“\t”, $coords[2], “\t”, $coords[3], “\n”;
    print COUNT $coords[1],“\t”, $coords[2], “\t”, $coords[3],“\n”;
  }
   s/Query = /_/;
   @coords = split(/_/,$_);
   $coords[3]= 0;
   $num=0;
   }
 }

APPENDIX E
The following script is an example of the SUBSEQ script.
#!/usr/bin/perl
# gets subsequences of defined length and increment from input sequence
# P Rogan 2005
#
use Bio::SeqIO;
use Bio::SeqIO::fasta;
use Bio::PrimarySeql;
use Bio::SeqFeature::Generic;
# command line arguments:
# (1) Name of genomic sequence
# (2) Length of subsequence
# (3) Length of window increment
# (4) Minimum Length of Match to repeats
# (5) Minimum Percentage Match to repeat
system(“date”);
system(“pwd”);
# get name of sequence
$ARGV = shift @ARGV;
chomp $ARGV;
if (-s $ARGV) {
 print “processing $ARGV ...\n”;
} else {
 print “Params: (1) Name of genomic seq, (2) Length of subsequence, (3)
Length of increment, \n(4) Min length of match and (5) Min percent match
to repeats\n”;
 exit; }
$seqin = Bio::SeqIO->new(‘-file’=>$ARGV,
  ‘-format’ => ‘Fasta’);
#initialization of subsequence extraction
$begin = 1;
$end = shift @ARGV;
chomp $end;
if($end<2) {die “subsequence too short”};
$incr = shift @ARGV;
chomp $incr;
if ($incr < 1) {die “beginning and ending nucleotides of subsequence are
identical”};
$minlen = shift @ARGV; chomp $minlen;
$minperc = shift @ARGV; chomp $minperc;
#        $seqout = Bio::SeqIO->new(‘-format’=>‘Fasta’,
#‘-file’=>‘>output.fa’);
# print $ARGV,“ ”, $end, “ ”, $incr;
while(( my $seqobj=$seqin->next_seq( ))) {
#length of full sequence
my $len = $seqobj->length;
#print “length”, $len;
 while( $len > $end ) {
#          print “seen sequence ”,seqobj->display
#          id( ),“,start of seq”,
           substr($seqobj->seq,1,10),“\n”;
 if($seqobj->alphabet eq ‘dna’){
  $subseqin = $seqobj->subseq($begin,$end);
  $id = $seqobj->display_id( );
  $idsub = $begin . “_” . $end . “_” . $id;
  $nameseg = $begin . “_” . $end;
  open (OUT, “>$nameseg”);
  print OUT “>”,$idsub, “\n”, $subseqin, “\n”;
#             print “>”,$idsub, “\n”, $subseqin, “\n”;
# insert system call for qsub of wublast job here
# job runs the wubl script and then a perl program that has blast parser
  for each blast run.
Results are
# appended to a table
  $fpresults = “~/Documents/” . $nameseg . “_results”;
  system(“qsub -cwd -o $fpresults -e /dev/null ~/Documents/wubl
~/Documents/$nameseg $minlen $minperc”);
#           this works: qsub -o ~/Documents/test wubl
            ~/Documents/101_200
  close (OUT);
  $begin = $begin + $incr;
  $end = $end + $incr;
 }
  }}
#        $seqout->write_seq($subseqin)
$date=system(“date”);
print $date;

Claims

What is claimed is:

1. A method to identify and produce a single copy sequence in a target reference complete genome sequence by successive division of the target reference genome sequence into subintervals and comparison the subintervals to the target reference sequence, said method comprising:

determining a count of the number of times a subsequence of a first screened sequence occurs in the target reference genome sequence, said screened sequence being at least one subinterval of the target reference genome sequence obtained by division of the target reference genome sequence, wherein the target reference genome sequence comprises the first screened sequence, the first screened sequence is divided into at least two subsequences, and a subsequence of the first screened sequence with a single subsequence occurrence in the target reference genome sequence or a group of contiguous subsequences of the first screened sequence each with a single subsequence occurrence in the target reference genome sequence is identified as a single copy interval of the first screened sequence, wherein an occurrence is defined by at least about 50 consecutive nucleotides of the subsequence of the first screened sequence or the group of contiguous subsequences of the first screened sequence displaying (i) at least about 60% homology to the target reference sequence; (ii) at least about 70% homology to the target reference sequence; or (iii) at least about 80% homology to the target reference sequence;

determining a count of the number of times a subsequence of a second screened sequence occurs in the target reference genome sequence, said screened sequence being at least one subinterval of the target reference genome sequence, wherein the second screened sequence comprises a single copy interval of the first screened sequence; the second screened sequence overlaps the single copy interval of the first screened sequence; the subsequences of the second screened sequence are either (i) consecutive non-overlapping subintervals of the second screened sequence or (ii) overlapping non-identical subintervals of the second screened sequence, and a subsequence of the second screened sequence with a single subsequence occurrence in the target reference genome sequence or a group of contiguous subsequences of the second screened sequence each with a single subsequence occurrence in the target reference genome sequence is identified as a single copy interval of the second screened sequence, wherein an occurrence is defined by at least about 50 consecutive nucleotides of the subsequence of the second screened sequence or the group of contiguous subsequences of the second screened sequence displaying (i) at least about 60% homology to the target reference sequence; (ii) at least about 70% homology to the target reference sequence; or (iii) at least about 80% homology to the target reference sequence;

identifying a single copy interval as a single copy sequence of the target reference sequence suitable for use as a single copy hybridization probe; and

producing the single copy sequence as a nucleic acid molecule.

2. The method of claim 1 further comprised of the step of determining a count of the number of times a subsequence of a third screened sequence occurs in the target reference sequence, wherein the third screened sequence comprises a single copy interval of the second screened sequence; the third screened sequence overlaps the single copy interval of the second screened sequence; the subsequences of the third screened sequence are either (i) consecutive non-overlapping subintervals or (ii) overlapping non-identical subintervals, and a subsequence of the third screened sequence with a single subsequence occurrence in the target reference sequence or a group of contiguous subsequences of the third screened sequence each with a single subsequence occurrence in the target reference sequence is identified as a single copy interval of the third screened sequence, wherein an occurrence is defined by at least about 50 consecutive nucleotides of the subsequence of the third screened sequence or the group of contiguous subsequences of the third screened sequence displaying (i) at least about 60% homology to the target reference sequence; (ii) at least about 70% homology to the target reference sequence; or (iii) at least about 80% homology to the target reference sequence.

3. The method of claim 2 further comprised of the step of determining a count of the number of times a subsequence of a fourth screened sequence occurs in the target reference sequence, wherein the fourth screened sequence comprises a single copy interval of the third screened sequence; the fourth screened sequence overlaps the single copy interval of the third screened sequence; the subsequences the of fourth screened sequence are either (i) consecutive non-overlapping subintervals or (ii) overlapping non-identical subintervals, and a subsequence of the fourth screened sequence with a single subsequence occurrence in the target reference sequence or a group of contiguous subsequences of the fourth screened sequence each with a single subsequence occurrence in the target reference sequence is identified as a single copy interval of the fourth screened sequence, wherein an occurrence is defined by at least about 50 consecutive nucleotides of the subsequence of the fourth screened sequence or the group of contiguous subsequences of the fourth screened sequence displaying (i) at least about 60% homology to the target reference sequence; (ii) at least about 70% homology to the target reference sequence; or (iii) at least about 80% homology to the target reference sequence.

4. The method of claim 1 further comprised of the step of identifying a subsequence of the first or second screened sequences with at least two occurrences in the target reference sequence as a subsequence containing a repetitive element wherein the single copy sequence is located adjacent to the repetitive element.

5. The method of claim 4 further comprised of the step of identifying a second, distinct subsequence of the first or second screened sequences with at least occurrences in the target reference sequence as a subsequence containing a different repetitive element, wherein the single copy interval is located between the first and the second subsequences containing the distinct repetitive elements.

6. The method of claim 3 wherein the second, third, or fourth screened sequence comprise (i) a centromeric end that overlaps the single copy interval of the first, second, or third screened sequence, respectively; (ii) a telomeric end that overlaps the single copy interval of the first, second, or third screened sequence, respectively; or (iii) a centromeric and telomeric end that both overlap the single copy interval of the first, second, or third screened sequence, respectively.

7. The method of claim 6 further comprising the step of determining whether the extended test sequence extends in the direction toward the centromere of the chromosomal arm containing the subsequence.

8. The method of claim 3 wherein the subsequence is (i) at least about 100 consecutive non-overlapping nucleotides; (ii) at least about 200 consecutive non-overlapping nucleotides; (iii) at least about 400 consecutive non-overlapping nucleotides; (iv) at least about 600 consecutive non-overlapping nucleotides; (v) at least about 800 consecutive non-overlapping nucleotides; or (vi) at least about 1000 consecutive non-overlapping nucleotides.

9. The method of claim 1 wherein the target reference sequence is about 100,000 nucleotides to about 400,000 nucleotides.

10. The method of claim 1 wherein the target reference sequence is a sequenced genome of an organism.

11. The method of claim 9 wherein the target reference sequence is a sequenced genome of a human.

12. The method of claim 1 wherein the overlapping subintervals of the screened sequence are displaced by at least about 20 nucleotides from adjacent subintervals.

13. The method of claim 4 further comprising the step of (i) storing a sequence of a single copy sequence or (ii) storing a subsequence of a screened sequence that displays more than one match to the target reference sequence or (ii) storing a sequence of a screened subsequence containing a repetitive element.

14. One or more tangible computer-readable storage media having computer-executable components for identifying a single copy sequence in a target reference complete genome sequence, said components comprising:

a first genome comparison component for determining a count of the number of times a subsequence of a first screened sequence occurs in the target reference genome sequence, said screened sequence being at least one subinterval of the target reference genome sequence obtained by division of the target reference genome sequence, wherein the target reference genome sequence comprises the first screened sequence, the first screened sequence is divided into at least two subsequences, and a subsequence of the first screened sequence with a single subsequence occurrence in the target reference genome sequence or a group of contiguous subsequences of the first screened sequence each with a single subsequence occurrence in the target reference genome sequence is identified as a single copy interval of the first screened sequence, wherein an occurrence is defined by at least about 50 consecutive nucleotides of the subsequence of the first screened sequence or the group of contiguous subsequences of the first screened sequence displaying (i) at least about 60% homology to the target reference sequence; (ii) at least about 70% homology to the target reference sequence; or (iii) at least about 80% homology to the target reference sequence;

a second genome comparison component for determining a count of the number of times a subsequence of a second screened sequence occurs in the target reference genome sequence, said screened sequence being at least one subinterval of the target reference genome sequence, wherein the second screened sequence comprises a single copy interval of the first screened sequence; the second screened sequence overlaps the single copy interval of the first screened sequence; the subsequences of the first screened sequence are either (i) consecutive non-overlapping subintervals of the second screened sequence or (ii) overlapping non-identical subintervals of the second screened sequence, and a subsequence of the second screened sequence with a single subsequence occurrence in the target reference genome sequence or a group of contiguous subsequences of the second screened sequence each with a single subsequence occurrence in the target reference genome sequence is identified as a single copy interval of the second screened sequence, wherein an occurrence is defined by at least about 50 consecutive nucleotides of the subsequence of the second screened sequence or the group of contiguous subsequences of the second screened sequence displaying (i) at least about 60% homology to the target reference sequence; (ii) at least about 70% homology to the target reference sequence; or (iii) at least about 80% homology to the target reference sequence; and

a subsequence component for identifying a single copy interval as a single copy sequence of the target reference sequence suitable for use as a single copy hybridization probe;

and wherein the results achieved from the computer-executable components of the computer-readable storage media are outputted in a user readable format.

15. A computerized system for identifying a single copy sequence in a target reference complete genome sequence, said computerized system comprising a computer-readable storage media, said computer-readable storage media comprising:

means for determining a count of the number of times a subsequence of a first screened sequence occurs in the target reference genome sequence, said screened sequence being at least one subinterval of the target reference genome sequence obtained by division of the target reference genome sequence, wherein the target reference genome sequence comprises the first screened sequence, the first screened sequence is divided into at least two subsequences, and a subsequence of the first screened sequence with a single subsequence occurrence in the target reference genome sequence or a group of contiguous subsequences of the first screened sequence each with a single subsequence occurrence in the target reference genome sequence is identified as a single copy interval of the first screened sequence, wherein an occurrence is defined by at least about 50 consecutive nucleotides of the subsequence of the first screened sequence or the group of contiguous subsequences of the first screened sequence displaying (i) at least about 60% homology to the target reference sequence; (ii) at least about 70% homology to the target reference sequence; or (iii) at least about 80% homology to the target reference sequence;

means for determining a count of the number of times a subsequence of a second screened sequence occurs in the target reference genome sequence, said screened sequence being at least one subinterval of the target reference genome sequence, wherein the second screened sequence comprises a single copy interval of the first screened sequence; the second screened sequence overlaps the single copy interval of the first screened sequence; the subsequences of the first screened sequence are either (i) consecutive non-overlapping subintervals of the second screened sequence or (ii) overlapping non-identical subintervals of the second screened sequence, and a subsequence of the second screened sequence with a single subsequence occurrence in the target reference genome sequence or a group of contiguous subsequences of the second screened sequence each with a single subsequence occurrence in the target reference genome sequence is identified as a single copy interval of the second screened sequence, wherein an occurrence is defined by at least about 50 consecutive nucleotides of the subsequence of the second screened sequence or the group of contiguous subsequences of the second screened sequence displaying (i) at least about 60% homology to the target reference sequence; (ii) at least about 70% homology to the target reference sequence; or (iii) at least about 80% homology to the target reference sequence; and

means for identifying a single copy interval as a single copy sequence of the target reference genome sequence suitable for use as a single copy hybridization probe;

and wherein the single copy sequence is outputted in a user readable format.

16. A method to prepare a single copy hybridization probe from a target reference complete genome sequence by successive division of the target reference genome sequence into subintervals and comparison the subintervals to the target reference sequence, said method comprising:

determining a count of the number of times a subsequence of a first screened sequence occurs in the target reference genome sequence, said screened sequence being at least one subinterval of the target reference genome sequence obtained by division of the target reference genome sequence, wherein the target reference genome sequence comprises the first screened sequence, the first screened sequence is divided into at least two subsequences, and a subsequence of the first screened sequence with a single subsequence occurrence in the target reference genome sequence or a group of contiguous subsequences of the first screened sequence each with a single subsequence occurrence in the target reference genome sequence is identified as a single copy interval of the first screened sequence, wherein an occurrence is defined by at least about 50 consecutive nucleotides of the subsequence of the first screened sequence or the group of contiguous subsequences of the first screened sequence displaying (i) at least about 60% homology to the target reference sequence; (ii) at least about 70% homology to the target reference sequence; or (iii) at least about 80% homology to the target reference sequence;

determining a count of the number of times a subsequence of a second screened sequence occurs in the target reference genome sequence, said screened sequence being at least one subinterval of the target reference genome sequence, wherein the second screened sequence comprises a single copy interval of the first screened sequence; the second screened sequence overlaps the single copy interval of the first screened sequence; the subsequences of the second screened sequence are either (i) consecutive non-overlapping subintervals of the second screened sequence or (ii) overlapping non-identical subintervals of the second screened sequence, and a subsequence of the second screened sequence with a single subsequence occurrence in the target reference genome sequence or a group of contiguous subsequences of the second screened sequence each with a single subsequence occurrence in the target reference genome sequence is identified as a single copy interval of the second screened sequence, wherein an occurrence is defined by at least about 50 consecutive nucleotides of the subsequence of the second screened sequence or the group of contiguous subsequences of the second screened sequence displaying (i) at least about 60% homology to the target reference sequence; (ii) at least about 70% homology to the target reference sequence; or (iii) at least about 80% homology to the target reference sequence;

identifying a single copy interval as a single copy sequence of the target reference sequence suitable for use as a single copy hybridization probe; and

preparing a single copy hybridization probe comprising a single copy sequence.

Resources

Images & Drawings included:

Sources:

Similar patent applications:

Recent applications in this class: