-
2010-05-25
11/747,409
2007-05-11
US 7,723,510 B1
2010-05-25
-
-
Amy Bowman
2027-05-17
Smart Summary: MicroRNA molecules are small RNA sequences that play an important role in controlling how organisms develop. In a tiny worm called Caenorhabditis elegans, two specific microRNAs, lin-4 and let-7, help regulate the timing of development. Researchers have discovered that many similar microRNAs exist in both invertebrates and vertebrates, indicating that these small RNAs are more common than previously thought. These microRNAs are involved in regulating gene expression after the genes have been copied into RNA. The study shows that these regulatory mechanisms are likely important across many different species. 🚀 TL;DR
In Caenorhabditis elegans, lin-4 and let-7 enclode 22- and 21-nucleotide RNAs, respectively, that function as key regulators of developmental timing. Because the appearance of these short RNAs is regulated during development, they are also referred to as “small temporal RNAs” (stRNAs). We show that many more 21- and 22-nt expressed RNAs, termed microRNAs, (miRNAs), exist in invertebrates and vertebrates, and that some of these novel RNAs, similar to let-7 stRAN, are also highly conserved. This suggests that sequence-specific post-transcriptional regulatory mechanisms mediated by small RNAs are more general than previously appreciated.
Get notified when new applications in this technology area are published.
C07H21/04 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
C07H21/02 IPC
Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
C12N15/63 IPC
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
A61K48/00 IPC
Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
The present invention relates to novel small expressed (micro)RNA molecules associated with physiological regulatory mechanisms, particularly in developmental control.
In Caenorhabditis elegans, lin-4 and let-7 encode 22- and 21-nucleotide RNAs, respectively (1, 2), that function as key regulators of developmental timing (3-5). Because the appearance of these short RNAs is regulated during development, they are also referred to as “microRNAs” (miRNAs) or small temporal RNAs (stRNAs) (6). lin-4 and let-21 are the only known miRNAs to date.
Two distinct pathways exist in animals and plants in which 21- to 23-nucleotide RNAs function as post-transcriptional regulators of gene expression. Small interfering RNAs (siRNAs) act as mediators of sequence-specific mRNA degradation in RNA interference (RNAi) (7-11) whereas miRNAs regulate developmental timing by mediating sequence-specific repression of mRNA translation (3-5). siRNAs and miRNAs are excised from double-stranded RNA (dsRNA) precursors by Dicer (12, 13, 29), a multidomain RNase III protein, thus producing RNA species of similar size. However, siRNAs are believed to be double-stranded (8, 11, 12), while miRNAs are single-stranded (6).
We show that many more short, particularly 21- and 22-nt expressed RNAs, termed microRNAs (miRNAs), exist in invertebrates and vertebrates, and that some of these novel RNAs, similar to let-7 RNA (6), are also highly conserved. This suggests that sequence-specific post-transcriptional regulatory mechanisms mediated by small RNAs are more general than previously appreciated.
The present invention relates to an isolated nucleic acid molecule comprising:
In a preferred embodiment the invention relates to miRNA molecules and analogs thereof, to miRNA precursor molecules and to DNA molecules encoding miRNA or miRNA precursor molecules.
Preferably the identity of sequence (c) to a sequence of (a) or (b) is at least 90%, more preferably at least 95%. The determination of identity (percent) may be carried out as follows:
I=n:L
wherein I is the identity in percent, n is the number of identical nucleotides between a given sequence and a comparative sequence as shown in Table 1, Table 2, Table 3 or Table 4 and L is the length of the comparative sequence. It should be noted that the nucleotides A, C, G and U as depicted in Tables 1, 2, 3 and 4 may denote ribonucleotides, deoxyribonucleotides and/or other nucleotide analogs, e.g. synthetic non-naturally occurring nucleotide analogs. Further nucleobases may be substituted by corresponding nucleobases capable of forming analogous H-bonds to a complementary nucleic acid sequence, e.g. U may be substituted by T.
Further, the invention encompasses nucleotide sequences which hybridize under stringent conditions with the nucleotide sequence as shown in Table 1, Table 2, Table 3 or Table 4, a complementary sequence thereof or a highly identical sequence. Stringent hybridization conditions comprise washing for 1 h in 1×SSC and 0.1% SDS at 45° C., preferably at 48° C. and more preferably at 50° C., particularly for 1 h in 0.2×SSC and 0.1% SDS.
The isolated nucleic acid molecules of the invention preferably have a length of from 18 to 100 nucleotides, and more preferably from 18 to 80 nucleotides. It should be noted that mature miRNAs usually have a length of 19-24 nucleotides, particularly 21, 22 or 23 nucleotides. The miRNAs, however, may be also provided as a precursor which usually has a length of 50-90 nucleotides, particularly 60-80 nucleotides. It should be noted that the precursor may be produced by processing of a primary transcript which may have a length of >100 nucleotides.
The nucleic acid molecules may be present in single-stranded or double-stranded form. The miRNA as such is usually a single-stranded molecule, while the mi-precursor is usually an at least partially self-complementary molecule capable of forming double-stranded portions, e.g. stem- and loop-structures. DNA molecules encoding the miRNA and miRNA precursor molecules. The nucleic acids may be selected from RNA, DNA or nucleic acid analog molecules, such as sugar- or backbone-modified ribonucleotides or deoxyribonucleotides. It should be noted, however, that other nucleic analogs, such as peptide nucleic acids (PNA) or locked nucleic acids (LNA), are also suitable.
In an embodiment of the invention the nucleic acid molecule is an RNA- or DNA molecule, which contains at least one modified nucleotide analog, i.e. a naturally occurring ribonucleotide or deoxyribonucleotide is substituted by a non-naturally occurring nucleotide. The modified nucleotide analog may be located for example at the 5′-end and/or the 3′-end of the nucleic acid molecule.
Preferred nucleotide analogs are selected from sugar- or backbone-modified ribonucleotides. It should be noted, however, that also nucleobase-modified ribonucleotides, i.e. ribonucleotides, containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase such as uridines or cytidines modified at the 5-position, e.g. 5-(2-amino)propyl uridine, 5-bromo uridine; adenosines and guanosines modified at the 8-position, e.g. 8-bromo guanosine; deaza nucleotides, e.g. 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g. N6-methyl adenosine are suitable. In preferred sugar-modified ribonucleotides the 2′-OH-group is replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2 or CN, wherein R is C1-C6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I. In preferred backbone-modified ribonucleotides the phosphoester group connecting to adjacent ribonucleotides is replaced by a modified group, e.g. of phosphothioate group. It should be noted that the above modifications may be combined.
The nucleic acid molecules of the invention may be obtained by chemical synthesis methods or by recombinant methods, e.g. by enzymatic transcription from synthetic DNA-templates or from DNA-plasmids isolated from recombinant organisms. Typically phage RNA-polymerases are used for transcription, such as T7, T3 or SP6 RNA-polymerases.
The invention also relates to a recombinant expression vector comprising a recombinant nucleic acid operatively linked to an expression control sequence, wherein expression, i.e. transcription and optionally further processing results in a miRNA-molecule or miRNA precursor molecule as described above. The vector is preferably a DNA-vector, e.g. a viral vector or a plasmid, particularly an expression vector suitable for nucleic acid expression in eukaryotic, more particularly mammalian cells. The recombinant nucleic acid contained in said vector may be a sequence which results in the transcription of the miRNA-molecule as such, a precursor or a primary transcript thereof, which may be further processed to give the miRNA-molecule.
Further, the invention relates to diagnostic or therapeutic applications of the claimed nucleic acid molecules. For example, miRNAs may be detected in biological samples, e.g. in tissue sections, in order to determine and classify certain cell types or tissue types or miRNA-associated pathogenic disorders which are characterized by differential expression of miRNA-molecules or miRNA-molecule patterns. Further, the developmental stage of cells may be classified by determining temporarily expressed miRNA-molecules.
Further, the claimed nucleic acid molecules are suitable for therapeutic applications. For example, the nucleic acid molecules may be used as modulators or targets of developmental processes or disorders associated with developmental dysfunctions, such as cancer. For example, miR-15 and miR-16 probably function as tumor-suppressors and thus expression or delivery of these RNAs or analogs or precursors thereof to tumor cells may provide therapeutic efficacy, particularly against leukemias, such as B-cell chronic lymphocytic leukemia (B-CLL). Further, miR-10 is a possible regulator of the translation of Hox Genes, particularly Hox 3 and Hox 4 (or Scr and Dfd in Drosophila).
In general, the claimed nucleic acid molecules may be used as a modulator of the expression of genes which are at least partially complementary to said nucleic acid. Further, miRNA molecules may act as target for therapeutic screening procedures, e.g. inhibition or activation of miRNA molecules might modulate a cellular differentiation process, e.g. apoptosis.
Furthermore, existing miRNA molecules may be used as starting materials for the manufacture of sequence-modified miRNA molecules, in order to modify the target-specificity thereof, e.g. an oncogene, a multidrug-resistance gene or another therapeutic target gene. The novel engineered miRNA molecules preferably have an identity of at least 80% to the starting miRNA, e.g. as depicted in Tables 1, 2, 3 and 4. Further, miRNA molecules can be modified, in order that they are symmetrically processed and then generated as double-stranded siRNAs which are again directed against therapeutically relevant targets.
Furthermore, miRNA molecules may be used for tissue reprogramming procedures, e.g. a differentiated cell line might be transformed by expression of miRNA molecules into a different cell type or a stem cell.
For diagnostic or therapeutic applications, the claimed RNA molecules are preferably provided as a pharmaceutical composition. This pharmaceutical composition comprises as an active agent at least one nucleic acid molecule as described above and optionally a pharmaceutically acceptable carrier.
The administration of the pharmaceutical composition may be carried out by known methods, wherein a nucleic acid is introduced into a desired target cell in vitro or in vivo.
Commonly used gene transfer techniques include calcium phosphate, DEAE-dextran, electroporation and microinjection and viral methods [30, 31, 32, 33, 34]. A recent addition to this arsenal of techniques for the introduction of DNA into cells is the use of cationic liposomes [35]. Commercially available cationic lipid formulations are e.g. Tfx 50 (Promega) or Lipofectamin 2000 (Life Technologies).
The composition may be in form of a solution, e.g. an injectable solution, a cream, ointment, tablet, suspension or the like. The composition may be administered in any suitable way, e.g. by injection, by oral, topical, nasal, rectal application etc. The carrier may be any suitable pharmaceutical carrier. Preferably, a carrier is used, which is capable of increasing the efficacy of the RNA molecules to enter the target-cells. Suitable examples of such carriers are liposomes, particularly cationic liposomes.
Further, the invention relates to a method of identifying novel microRNA-molecules and precursors thereof, in eukaryotes, particularly in vertebrates and more particularly in mammals, such as humans or mice. This method comprises: ligating 5′- and 3′-adapter-molecules to the end of a size-fractionated RNA-population, reverse transcribing said adapter-ligated RNA-population, and characterizing said reverse transcribed RNA-molecules, e.g. by amplification, concatamerization, cloning and sequencing.
A method as described above already has been described in (8), however, for the identification of siRNA molecules. Surprisingly, it was found now that the method is also suitable for identifying the miRNA molecules or precursors thereof as claimed in the present application.
Further, it should be noted that as 3′-adaptor for derivatization of the 3′-OH group not only 4-hydroxymethylbenzyl but other types of derivatization groups, such as alkyl, alkyl amino, ethylene glycol or 3′-deoxy groups are suitable.
Further, the invention shall be explained in more detail by the following Figures and Examples:
FIG. 1A. Expression of D. melanogaster miRNAs. Northern blots of total RNA isolated from staged populations of D. melanogaster were probed for the indicated miRNAs. The position of 76-nt val-tRNA is also indicated on the blots. 5S rRNA serves as loading control. E, embryo; L, larval stage; P, pupae; A, adult; S2, Schneider-2 cells. It should be pointed out, that S2 cells are polyclonal, derived from an unknown subset of embryonic tissues, and may have also lost some features of their tissue: of origin while maintained in culture. miR-3 to miR-6 RNAs were not detectable in S2 cells (data not shown). miR-14 was not detected by Northern blotting and may be very weakly expressed, which is consistent with its cloning frequency. Similar miRNA sequences are difficult to distinguish by Northern blotting because of potential cross-hybridization of probes.
FIG. 1B. Expression of vertebrate miRNAs. Northern blots of total RNA isolated from HeLa cells, mouse kidneys, adult zebrafish, frog ovaries, and S2 cells were probed for the indicated miRNAs. The position of 76-nt val-tRNA is also indicated on the blots. 5S rRNA from the preparations of total RNA from the indicated species is also shown. The gels used for probing of miR-18, miR-19a, miR-30, and miR-31 were not run as far as the other gels (see tRNA marker position). miR-32 and miR-33 were not detected by Northern blotting, which is consistent with their low cloning frequency. Oligodeoxynucleotides used as Northern probes were:
let-7a, 5′ TACTATACAACCTACTACCTCAATTTGCC (SEQ ID NO:1);
let-7d, 5′ ACTATGCAACCTACTACCTCT (SEQ ID NO:2);
let-7e, 5′ ACTATACAACCTCCTACCTCA (SEQ ID NO:3);
D. melanogaster val-tRNA, 5′ TGGTGTTTCCGCCCGGGAA (SEQ ID NO:4);
miR-1, 5′ TGGAATGTAAAGAAGTATGGAG (SEQ ID NO:5);
miR-2b, 5′ GCTCCTCAAAGCTGGCTGTGATA (SEQ ID NO:6);
miR-3, 5′ TGAGACACACTTTGCCCAGTGA (SEQ ID NO:7);
miR-4, 5′ TCAATGGTTGTCTAGCTTTAT (SEQ ID NO:8);
miR-5, 5′ CATATCACAACGATCGTTCCTTT (SEQ ID NO:9);
miR-6, 5′ AAAAAGAACAGCCACTGTGATA (SEQ ID NO:10);
miR-7, 5′ TGGAAGACTAGTGATTTTGTTGT (SEQ ID NO:11);
miR-8, 5′ GACATCTTTACCTGACAGTATTA (SEQ ID NO: 12);
miR-9, 5′ TCATACAGCTAGATAACCAAAGA (SEQ ID NO:13);
miR-10, 5′ ACAAATTCGGATCTACAGGGT (SEQ ID NO:14);
miR-11, 5′ GCAAGAACTCAGACTGTGATG (SEQ ID NO: 15);
miR-12, 5′ ACCAGTACCTGATGTAATACTCA (SEQ ID NO:16);
miR-13a, 5′ ACTCGTCAAAATGGCTGTGATA (SEQ ID NO:17);
miR-14, 5′ TAGGAGAGAGAAAAAGACTGA (SEQ ID NO:18);
miR-15, 5′ TAGCAGCACATAATGGTTTGT (SEQ ID NO:19);
miR-16, 5′ GCCAATATTTACGTGCTGCTA (SEQ ID NO:20);
miR-17, 5′ TACAAGTGCCTTCACTGCAGTA (SEQ ID NO:21);
miR-18, 5′ TATCTGCACTAGATGCACCTTA (SEQ ID NO:22);
miR-19a, 5′ TCAGTTTTGCATAGATTTGCACA (SEQ ID NO:23);
miR-20, 5′ TACCTGCACTATAAGCACTTTA (SEQ ID NO:24);
miR-21, 5′ TCAACATCAGTCTGATAAGCTA (SEQ ID NO:25);
miR-22, 5′ ACAGTTCTTCAACTGGCAGCTT (SEQ ID NO:26);
miR-23, 5′ GGAAATCCCTGGCAATGTGAT (SEQ ID NO:27);
miR-24, 5′CTGTTCCTGCTGAACTGAGCCA (SEQ ID NO:28);
miR-25, 5′ TCAGACCGAGACAAGTGCAATG (SEQ ID NO:29);
miR-26a, 5′ AGCCTATCCTGGATTACTTGAA (SEQ ID NO:30);
miR-27; 5′ AGCGGAACTTAGCCACTGTGAA (SEQ ID NO:31);
miR-28, 5′CTCAATAGACTGTGAGCTCCTT (SEQ ID NO:32);
miR-29, 5′ AACCGATTTCAGATGGTGCTAG (SEQ ID NO:33);
miR-30, 5′ GCTGCAAACATCCGACTGAAAG (SEQ ID NO:34);
miR-31, 5′CAGCTATGCCAGCATCTTGCCT (SEQ ID NO:35);
miR-32, 5′ GCAACTTAGTAATGTGCAATA (SEQ ID NO:36);
miR-33, 5′ TGCAATGCAACTACAATGCACC (SEQ ID NO:37).
FIG. 2. Genomic organization of miRNA gene clusters. The precursor structure is indicated as box and the location of the miRNA within the precursor is shown in gray; the chromosomal location is also indicated to the right. (A) D. melanogaster miRNA gene clusters. (B) Human miRNA gene clusters. The cluster of let-7a-1 and let-7f-1 is separated by 26500 nt from a copy of let-7d on chromosome 9 and 17. A cluster of let-7a-3 and let-7b, separated by 938 nt on chromosome 22, is not illustrated.
FIG. 3. Predicted precursor structures of D. melanogaster miRNAs. RNA secondary structure prediction was performed using mfold version 3.1 [28] and manually refined to accommodate G/U wobble base pairs in the helical segments. The miRNA sequence is underlined. The actual size of the stem-loop structure is not known experimentally and may be slightly shorter or longer than represented. Multicopy miRNAs and their corresponding precursor structures are also shown.
FIG. 4. Predicted precursor structures of human miRNAs. For legend, see FIG. 3.
FIG. 5. Expression of novel mouse miRNAs. Northern blot analysis of novel mouse miRNAs. Total RNA from different mouse tissues was blotted and probed with a 5′-radiolabeled oligodeoxynucleotide complementary to the indicated miRNA. Equal loading of total RNA on the gel was verified by ethidium bromide staining prior to transfer; the band representing tRNAs is shown. The fold-back precursors are indicated with capital L. Mouse brains were dissected into midbrain, mb, cortex, cx, cerebellum, cb. The rest of the brain, rb, was also used. Other tissues were heart, ht, lung, Ig, liver, Iv, colon, co, small intestine, si, pancreas, pc, spleen, sp, kidney, kd, skeletal muscle, sm, stomach, st, H, human Hela SS3 cells. Oligodeoxynucleotides used as Northern probes were:
miR-1a, CTCCATACTTCTTTACATTCCA (SEQ ID NO:38);
miR-30b, GCTGAGTGTAGGATGTTTACA (SEQ ID NO:39);
miR-30a-s, GCTTCCAGTCGAGGATGTTTACA (SEQ ID NO:40);
miR-99b, CGCAAGGTCGGTTCTACGGGTG (SEQ ID NO:41);
miR-101, TCAGTTATCACAGTACTGTA (SEQ ID NO:42);
miR-122a, ACAAACACCATTGTCACACTCCA (SEQ ID NO:43);
miR-124a, TGGCATTCACCGCGTGCCTTA (SEQ ID NO:44);
miR-125a, CACAGGTTAAAGGGTCTCAGGGA (SEQ ID NO:45);
miR-125b, TCACAAGTTAGGGTCTCAGGGA (SEQ ID NO:46);
miR-127, AGCCAAGCTCAGACGGATCCGA (SEQ ID NO:47);
miR-128, AAAAGAGACCGGTTCACTCTGA (SEQ ID NO:48);
miR-129, GCAAGCCCAGACCGAAAAAAG (SEQ ID NO:49);
miR-130, GCCCTTTTAACATTGCACTC (SEQ ID NO:50);
miR-131, ACTTTCGGTTATCTAGCTTTA (SEQ ID NO:51);
miR-132, ACGACCATGGCTGTAGACTGTTA (SEQ ID NO:52);
miR-143, TGAGCTACAGTGCTTCATCTCA (SEQ ID NO:53).
FIG. 6. Potential orthologs of lin-4 stRNA. (A) Sequence alignment of C. elegans lin-4 stRNA with mouse miR-125a and miR-125b and the D. melanogaster miR-125. Differences are highlighted by gray boxes. (B) Northern blot of total RNA isolated from staged populations of D. melanogaster, probed for miR-125. E, embryo; L, larval stage; P, pupae; A, adult; S2, Schneider-2 cells.
FIG. 7. Predicted precursor structures of miRNAs, sequence accession numbers and homology information. RNA secondary structure prediction was performed using mfold version 3.1 and manually refined to accommodate G/U wobble base pairs in the helical segments. Dashes were inserted into the secondary structure presentation when asymmetrically bulged nucleotides had to be accommodated. The excised miRNA sequence is underlined. The actual size of the stem-loop structure is not known experimentally and may be slightly shorter or longer than represented. Multicopy miRNAs and their corresponding precursor structures are also shown. In cases where no mouse precursors were yet deposited in the database, the human orthologs are indicated. miRNAs which correspond to D. melanogaster or human sequences are included. Published C. elegans miRNAs [36, 37] are also included in the table. A recent set of new HeLa cell miRNAs is also indicated [46]. If several ESTs were retrieved for one organism in the database, only those with different precursor sequences are listed. miRNA homologs-found in other species are indicated. Chromosomal location and sequence accession numbers, and clusters of miRNA genes are indicated. Sequences from cloned miRNAs were searched against mouse and human in GenBank (including trace data), and against Fugu rubripes andDanio rerio at www.jgi.doe.gov and www.sanger.ac.uk, respectively.
We previously developed a directional cloning procedure to isolate siRNAs after processing of long dsRNAs in Drosophila melanogaster embryo lysate (8). Briefly, 5′ and 3′ adapter molecules were ligated to the ends of a size-fractionated RNA population, followed by reverse transcription, PCR amplification, concatamerization, cloning and sequencing. This method, originally intended to isolate siRNAs, led to the simultaneous identification of 14 novel 20- to 23-nt short RNAs which are encoded in the D. melanogaster genome and which are expressed in 0 to 2 h embryos (Table 1). The method was adapted to clone RNAs in a similar size range from HeLa cell total RNA (14), which led to the identification of 19 novel human stRNAs (Table 2), thus providing further evidence for the existence of a large class of small RNAs with potential regulatory roles. According to their small size, we refer to these novel RNAs as microRNAs or miRNAs. The miRNAs are abbreviated as miR-1 to miR-33, and the genes encoding miRNAs are named mir-1 to mir-33. Highly homologous miRNAs are classified by adding a lowercase letter, followed by a dash and a number for designating multiple genomic copies of a mir gene.
The expression and size of the cloned, endogenous short RNAs was also examined by Northern blotting (FIG. 1, Table 1 and 2). Total RNA isolation was performed by acid guanidinium thiocyanate-phenol-chloroform extraction [45]. Northern analysis was performed as described [1], except that the total RNA was resolved on a 15% denaturing polyacrylamide-gel, transferred onto Hybond-N+membrane (Amersham Pharmacia Biotech), and the hybridization and wash steps were performed at 50° C. Oligodeoxynucleotides used as Northern probes were 5′-32P-phosphorylated, complementary to the miRNA sequence and 20 to 25 nt in length.
5S rRNA was detected by ethidium staining of polyacrylamide gels prior to transfer. Blots were stripped by boiling in 0.1% aqueous sodium dodecylsulfate/0.1×SSC (15 mM sodium chloride, 1.5 mM sodium citrate, pH 7.0) for 10 min, and were re-probed up to 4 times until the 21-nt signals became too weak for detection. Finally, blots were probed for val-tRNA as size marker.
For analysis of D. melanogaster RNAs, total RNA was prepared from different developmental stages, as well as cultured Schneider-2 (S2) cells, which originally derive from 20-24 h D. melanogaster embryos [15] (FIG. 1, Table 1). miR-3 to miR-7 are expressed only during embryogenesis and not at later developmental stages. The temporal expression of miR-1, miR-2 and miR-8 to miR-13 was less restricted. These miRNAs were observed at all developmental stages though significant variations in the expression levels were sometimes observed. Interestingly, miR-1, miR-3 to miR-6, and miR-8 to miR-11 were completely absent from cultured Schneider-2 (S2) cells, which were originally derived from 20-24 h D. melanogaster embryos [15], while miR-2, miR-7, miR-12, and miR-13 were present in S2 cells, therefore indicating cell type-specific miRNA expression. miR-1, miR-8, and miR-12 expression patterns are similar to those of lin-4 stRNA in C. elegans, as their expression is strongly upregulated in larvae and sustained to adulthood [16]. miR-9 and miR-11 are present at all stages but are strongly reduced in the adult which may reflect a maternal contribution from germ cells or expression in one sex only.
The mir-3 to mir-6 genes are clustered (FIG. 2A), and mir-6 is present as triple repeat with slight variations in the mir-6 precursor sequence but not in the miRNA sequence itself. The expression profiles of miR-3 to miR-6 are highly similar (Table 1), which suggests that a single embryo-specific precursor transcript may give rise to the different miRNAs, or that the same enhancer regulates miRNA-specific promoters. Several other fly miRNAs are also found in gene clusters (FIG. 2A).
The expression of HeLa cell miR-15 to miR-33 was examined by Northern blotting using HeLa cell total RNA, in addition to total RNA prepared from mouse kidneys, adult zebrafish, Xenopus laevis ovary, and D. melanogaster S2 cells (FIG. 1B, Table 2). miR-15 and miR-16 are encoded in a gene cluster (FIG. 2B) and are detected in mouse kidney, fish, and very weakly in frog ovary, which may result from miRNA expression in somatic ovary tissue rather than oocytes. mir-17 to mir-20 are also clustered (FIG. 2B), and are expressed in HeLa cells and fish, but undetectable in mouse kidney and frog ovary (FIG. 1, Table 2), and therefore represent a likely case of tissue-specific miRNA expression.
The majority of vertebrate and invertebrate miRNAs identified in this study are not related by sequence, but a few exceptions, similar to the highly conserved let-7 RNA [6], do exist. Sequence analysis of the D. melanogaster miRNAs revealed four such examples of sequence conservation between invertebrates and vertebrates. miR-1 homologs are encoded in the genomes of C. elegans, C. briggsae, and humans, and are found in cDNAs from zebrafish, mouse, cow and human. The expression of mir-1 was detected by Northern blotting in total RNA from adult zebrafish and C. elegans, but not in total RNA from HeLa cells or mouse kidney (Table 2 and data not shown). Interestingly, while mir-1 and let-7 are expressed both in adult flies (FIG. 1A) [6] and are both undetected in S2 cells, miR-1 is, in contrast to let-7, undetectable in HeLa cells. This represents another case of tissue-specific expression of a miRNA, and indicates that miRNAs may not only play a regulatory role in developmental timing, but also in tissue specification. miR-7 homologs were found by database searches in mouse and human genomic and expressed sequence tag sequences (ESTs). Two mammalian miR-7 variants are predicted by sequence analysis in mouse and human, and were detected by Northern blotting in HeLa cells and fish, but not in mouse kidney (Table 2). Similarly, we identified mouse and human miR-9 and miR-10 homologs by database searches but only detected mir-10 expression in mouse kidney.
The identification of evolutionary related miRNAs, which have already acquired multiple sequence mutations, was not possible by standard bioinformatic searches. Direct comparison of the D. melanogaster miRNAs with the human miRNAs identified an 11-nt segment shared between D. melanogaster miR-6 and HeLa miR-27, but no further relationships were detected. One may speculate that most miRNAs only act on a single target and therefore allow for rapid evolution by covariation, and that highly conserved miRNAs act on more than one target sequence, and, therefore have a reduced probability for evolutionary drift by covariation [6]. An alternative interpretation is that the sets of miRNAs from D. melanogaster and humans are fairly incomplete and that many more miRNAs remain to be discovered, which will provide the missing evolutionary links.
lin-4 and let-7 stRNAs were predicted to be excised from longer transcripts that contain approximately 30 base-pair stem-loop structures [1, 6]. Database searches for newly identified miRNAs revealed that all miRNAs are flanked by sequences that have the potential to form stable stem-loop structures (FIGS. 3 and 4). In many cases, we were able to detect the predicted, approximately 70-nt precursors by Northern blotting (FIG. 1). Some miRNA precursor sequences were also identified in mammalian cDNA (EST) databases [27], indicating that primary transcripts longer than 70-nt stem-loop precursors do also exist. We never cloned a 22-nt RNA complementary to any of the newly identified miRNAs, and it is as yet unknown how the cellular processing machinery distinguishes between the miRNA and its complementary strand. Comparative analysis of the precursor stem-loop structures indicates that the loops adjacent to the base-paired miRNA segment can be located on either side of the miRNA sequence (FIGS. 3 and 4), suggesting that the 5′ or 3′ location of the stem-closing loop is not the determinant of miRNA excision. It is also unlikely that the structure, length or stability of the precursor stem is the critical determinant as the base-paired structures are frequently imperfect and interspersed by less stable, non-Watson-Crick base pairs such as G/A, U/U, C/U, A/A, and G/U wobbles. Therefore, a sequence-specific recognition process is a likely determinant for miRNA excision, perhaps mediated by members of the Argonaute (rde-1/ago1/piwi) protein family. Two members of this family, alg-1 and alg-2, have recently been shown to be critical for stRNA processing in C. elegans [13]. Members of the Argonaute protein family are also involved in RNAi and PTGS. In D. melanogaster, these include argonaute2, a component of the siRNA-endonuclease complex (RISC) [17], and its relative aubergine, which is important for silencing of repeat genes [18]. In other species, these include rde-1, argonaute1, and qde-2, in C. elegans [19], Arabidopsis thaliana [20], and Neurospora crassa [21], respectively. The Argonaute protein family therefore represents, besides the RNase III Dicer [12, 13], another evolutionary link between RNAi and miRNA maturation.
Despite advanced genome projects, computer-assisted detection of genes encoding functional RNAs remains problematic [22]. Cloning of expressed, short functional RNAs, similar to EST approaches (RNomics), is a powerful alternative and probably the most efficient method for identification of such novel gene products [23-26]. The number of functional RNAs has been widely underestimated and is expected to grow rapidly because of the development of new functional RNA cloning methodologies.
The challenge for the future is to define the function and the potential targets of these novel miRNAs by using bioinformatics as well as genetics, and to establish a complete catalogue of time- and tissue-specific distribution of the already identified and yet to be uncovered miRNAs. lin-4 and let-7 stRNAs negatively regulate the expression of proteins encoded by mRNAs whose 3′ untranslated regions contain sites of complementarity to the stRNA [3-5].
Thus, a series of 33 novel genes, coding for 19- to 23-nucleotide microRNAs (miRNAs), has been cloned from fly embryos and human cells. Some of these miRNAs are highly conserved between vertebrates and invertebrates and are developmentally or tissue-specifically expressed. Two of the characterized human miRNAs may function as tumor suppressors in B-cell chronic lymphocytic leukemia. miRNAs are related to a small class of previously described 21- and 22-nt RNAs (lin-4 and let-7 RNAs), so-called small temporal RNAs (stRNAs), and regulate developmental timing in C. elegans and other species. Similar to stRNAs, miRNAs are presumed to regulate translation of specific target mRNAs by binding to partially complementary sites, which are present in their 3′-untranslated regions.
Deregulation of miRNA expression may be a cause of human disease, and detection of expression of miRNAs may become useful as a diagnostic. Regulated expression of miRNAs in cells or tissue devoid of particular miRNAs may be useful for tissue engineering, and delivery or transgenic expression of miRNAs may be useful for therapeutic intervention. miRNAs may also represent valuable drug targets itself. Finally, miRNAs and their precursor sequences may be engineered to recognize therapeutic valuable targets.
To gain more detailed insights into the distribution and function of miRNAs in mammals, we investigated the tissue-specific distribution of miRNAs in adult mouse. Cloning of miRNAs from specific tissues was preferred over whole organism-based cloning because low-abundance miRNAs that normally go undetected by Northern blot analysis are identified clonally. Also, in situ hybridization techniques for detecting 21-nt RNAs have not yet been developed. Therefore, 19- to 25-nucleotide RNAs were cloned and sequenced from total RNA, which was isolated from 18.5-weeks old BL6 mice. Cloning of miRNAs was performed as follows: 0.2 to 1 mg, of total RNA was separated on a 15% denaturing polyacrylamide gel and RNA of 19- to 25-nt size was recovered. A 5′-phosphorylated 3′-adapter oligonucleotide (5′-pUUUaaccgcgaattccagx: uppercase, RNA; lowercase, DNA; p, phosphate; x, 3′-Amino-Modifier C-7, ChemGenes, Ashland, Ma., USA, Cat. No. NSS-1004; SEQ ID NO:54) and a 5′-adapter oligonucleotide (5′-acggaattcctcactAAA: uppercase, RNA; lowercase, DNA; SEQ ID NO:55) were ligated to the short RNAs. RT/PCR was performed with 3′-primer (5′-GACTAGCTGGAATTCGCGGTTAAA; SEQ ID NO:56) and 5′-primer (5′-CAGCCAACGGAATTCCTCACTAAA; SEQ ID NO:57). In order to introduce Ban I restriction sites, a second PCR was performed using the primer pair 5′-CAGCCAACAGGCACCGAATTCCTCACTAAA (SEQ ID NO:57) and 5′-GACTAGCTTGGTGCCGAATTCGCGGTTAAA (SEQ ID NO:56), followed by concatamerization after Ban I digestion and T4 DNA ligation. Concatamers of 400 to 600 basepairs were cut out from 1.5% agarose gels and recovered by Biotrap (Schleicher & Schuell) electroelution (1×TAE buffer) and by ethanol precipitation. Subsequently, the 3′ ends of the concatamers were filled in by incubating for 15 min at 72° C. with Taq polymerase in standard PCR reaction mixture. This solution was diluted 3-fold with water and directly used for ligation into pCR2.1 TOPO vectors. Clones were screened for inserts by PCR and 30 to 50 samples were subjected to sequencing. Because RNA was prepared from combining tissues of several mice, minor sequence variations that were detected multiple times in multiple clones may reflect polymorphisms rather than RT/PCR mutations. Public database searching was used to identify the genomic sequences encoding the approx. 21-nt RNAs. The occurrence of a 20 to 30 basepair fold-back structure involving the immediate upstream or downstream flanking sequences was used to assign miRNAs [36-38].
We examined 9 different mouse tissues and identified 34 novel miRNAs, some of which are highly tissue-specifically expressed (Table 3 and FIG. 5). Furthermore, we identified 33 new miRNAs from different mouse tissues and also from human Soas-2 osteosarcoma cells (Table 4). miR-1 was previously shown by Northern analysis to be strongly expressed in adult heart, but not in brain, liver, kidney, lung or colon [37]. Here we show that miR-1 accounts for 45% of all mouse miRNAs found in heart, yet miR-1 was still expressed at a low level in liver and midbrain even though it remained undetectable by Northern analysis. Three copies or polymorphic alleles of miR-1 were found in mice. The conservation of tissue-specific miR-1 expression between mouse and human provides additional evidence for a conserved regulatory role of this miRNA. In liver, variants of miR-122 account for 72% of all cloned miRNAs and miR-122 was undetected in all other tissues analyzed. In spleen, miR-143 appeared to be most abundant, at a frequency of approx. 30%. In colon, miR-142-as, was cloned several times and also appeared at a frequency of 30%. In small intestine, too few miRNA sequences were obtained to permit statistical analysis. This was due to strong RNase activity in this tissue, which caused significant breakdown of abundant non-coding RNAs, e.g. rRNA, so that the fraction of miRNA in the cloned sequences was very low. For the same reason, no miRNA sequences were obtained from pancreas.
To gain insights in neural tissue miRNA distribution, we analyzed cortex, cerebellum and midbrain. Similar to heart, liver and small intestine, variants of a particular miRNA, miR-124, dominated and accounted for 25 to 48% of all brain miRNAs. miR-101, -127, -128, -131, and -132, also cloned from brain tissues, were further analyzed by Northern blotting and shown to be predominantly brain-specific. Northern blot analysis was performed as described in Example 1. tRNAs and 5S rRNA were detected by ethidium staining of polyacrylamide gels prior to transfer to verify equal loading. Blots were stripped by boiling in deionized water for 5 min, and reprobed up to 4 times until the 21-nt signals became too weak for detection.
miR-125a and miR-125b are very similar to the sequence of C. elegans lin-4 stRNA and may represent its orthologs (FIG. 6A). This is of great interest because, unlike let-7 that was readily detected in other species, lin-4 has acquired a few mutations in the central region and thus escaped bioinformatic database searches. Using the mouse sequence miR-125b, we could readily identify its ortholog in the D. melanogaster genome. miR-125a and miR-125b differ only by a central diuridine insertion and a U to C change. miR-125b is very similar to lin-4 stRNA with the differences located only in the central region, which is presumed to be bulged out during target mRNA recognition [41]. miR-125a and miR-125b were cloned from brain tissue, but expression was also detected by Northern analysis in other tissues, consistent with the role for lin-4 in regulating neuronal remodeling by controlling lin-14 expression [43]. Unfortunately, orthologs to C. elegans lin-14 have not been described and miR-125 targets remain to be identified in D. melanogaster or mammals. Finally, miR-125b expression is also developmentally regulated and only detectable in pupae and adult but not in embryo or larvae of D. melanogaster (FIG. 6B).
Sequence comparison of mouse miRNAs with previously described miRNA reveals that miR-99b and miR-99a are similar to D. melanogaster, mouse and human miR-10 as well as C. elegans miR-51 [36], miR-141 is similar to D. melanogaster miR-8, miR-29b is similar to C. elegans miR-83, and miR-131 and miR-142-s are similar to D. melanogaster miR-4 and C. elegans miR-79 [36]. miR-124a is conserved between invertebrates and vertebrates. In this respect it should be noted that for almost every miRNA cloned from mouse was also encoded in the human genome, and frequently detected in other vertebrates, such as the pufferfish, Fugu rubripes, and the zebrafish, Danio rerio. Sequence conservation may point to conservation in function of these miRNAs. Comprehensive information about orthologous sequences is listed in FIG. 7.
In two cases both strands of miRNA precursors were cloned (Table 3), which was previously observed once for a C. elegans miRNA [36]. It is thought that the most frequently cloned strand of a miRNA precursor represents the functional miRNA, which is miR-30c-s and miR-142-as, s and as indicating the 5′ or 3′ side of the fold-back structure, respectively.
The mir-142 gene is located on chromosome 17, but was also found at the breakpoint junction of a t(8; 17) translocation, which causes an aggressive B-cell leukemia due to strong up-regulation of a translocated MYC gene [44]. The translocated MYC gene, which was also truncated at the first exon, was located only 4-nt downstream of the 3′-end of the miR-142 precursor. This suggests that translocated MYC was under the control of the upstream miR-142 promoter. Alignment of mouse and human miR-142 containing EST sequences indicate an approximately 20 nt conserved sequence element downstream of the mir-142 hairpin. This element was lost in the translocation. It is conceivable that the absence of the conserved downstream sequence element in the putative miR-142/mRNA fusion prevented the recognition of the transcript as a miRNA precursor and therefore may have caused accumulation of fusion transcripts and overexpression of MYC.
miR-155, which was cloned from colon, is excised from the known noncoding BIC RNA [47]. BIC was originally identified as a gene transcriptionally activated by promoter insertion at a common retroviral integration site in B cell lymphomas induced by avian leukosis virus. Comparison of BIC cDNAs from human, mouse and chicken revealed 78% identity over 138 nucleotides [47]. The identity region covers the miR-155 fold-back precursor and a few conserved boxes downstream of the fold-back sequence. The relatively high level of expression of BIC in lymphoid organs and cells in human, mouse and chicken implies an evolutionary conserved function, but BIC RNA has also been detected at low levels in non-hematopoietic tissues [47].
Another interesting observation was that segments of perfect complementarity to miRNAs are not observed in mRNA sequences or in genomic sequences outside the miRNA inverted repeat. Although this could be fortuitous, based on the link between RNAi and miRNA processing [11, 13, 43] it may be speculated that miRNAs retain the potential to cleave perfectly complementary target RNAs. Because translational control without target degradation could provide more flexibility it may be preferred over mRNA degradation.
In summary, 63 novel miRNAs were identified from mouse and 4 novel miRNAs were identified from human Soas-2 osteosarcoma cells (Table 3 and Table 4), which are conserved in human and often also in other non-mammalian vertebrates. A few of these miRNAs appear to be extremely tissue-specific, suggesting a critical role for some miRNAs in tissue-specification and cell lineage decisions. We may have also identified the fruitfly and mammalian ortholog of C. elegans lin-4 stRNA. The establishment of a comprehensive list of miRNA sequences will be instrumental for bioinformatic approaches that make use of completed genomes and the power of phylogenetic comparison in order to identify miRNA-regulated target mRNAs.
| TABLE 1 |
| D. melanogaster miRNAs. The sequences given represent the most abundant, and typically longest miRNA |
| sequence identified by cloning; miRNAs frequently vary in length by one or two nucleotides at their 3′ |
| termini. From 222 short RNAs sequenced, 69 (31%) corresponded to miRNAs, 103 (46%) to already character- |
| ized functional RNAs (rRNA, 7SL RNA, tRNAs), 30 (14%) to transposon RNA fragments, and 20 (10%) |
| sequences with no database entry. The frequency (freq.) for cloning a particular miRNA relative to all identified |
| miRNAs is indicated in percent. Results of Northern blotting of total RNA isolated from staged populations |
| of D. melanogaster are summarized. E, embryo; L, larval stage; P, pupae; A, adult; S2, Schneider-2 cells. |
| The strength of the signal within each blot is represented from strongest (+++) to undetected (−). |
| let-7 stRNA was probed as control. Genbank accession numbers and homologs of miRNAs identified by database |
| searching in other species are provided as supplementary material. |
| freq. | E | E | L1 + | ||||||
| miRNA | sequence (5′ to 3′) | (%) | 0-3 h | 0-6 h | L2 | L3 | P | A | S2 |
| miR-1 | UGGAAUGUAAAGAAGUAUGGAG | 32 | + | + | +++ | +++ | ++ | +++ | − |
| (SEQ ID NO: 58) | |||||||||
| miR-2a* | UAUCACAGCCAGCUUUGAUGAGC | 3 | |||||||
| (SEQ ID NO: 59) | |||||||||
| miR-2b* | UAUCACAGCCAGCUUUGAGGAGC | 3 | ++ | ++ | ++ | +++ | ++ | + | +++ |
| (SEQ ID NO: 60) | |||||||||
| miR-3 | UCACUGGGCAAAGUGUGUCUCA# | 9 | +++ | +++ | − | − | − | − | − |
| miR-4 | AUAAAGCUAGACAACCAUUGA | 6 | +++ | +++ | − | − | − | − | − |
| (SEQ ID NO: 62) | |||||||||
| miR-5 | AAAGGAACGAUCGUUGUGAUAUG | 1 | +++ | +++ | +/− | +/− | − | − | − |
| (SEQ ID NO: 63) | |||||||||
| miR-6 | UAUCACAGUGGCUGUUCUUUUU | 13 | +++ | +++ | +/− | +/− | − | − | − |
| (SEQ ID NO: 64) | |||||||||
| miR-7 | UGGAAGACUAGUGAUUUUGUUGU | 4 | +++ | ++ | +/− | +/− | +/− | +/− | +/− |
| (SEQ ID NO: 65) | |||||||||
| miR-8 | UAAUACUGUCAGGUAAAGAUGUC | 3 | +/− | +/− | +++ | +++ | + | +++ | − |
| (SEQ ID NO: 66) | + | ||||||||
| miR-9 | UCUUUGGUUAUCUAGCUGUAUGA | 7 | +++ | ++ | +++ | +++ | +++ | +/− | − |
| (SEQ ID NO: 67) | |||||||||
| miR-10 | ACCCUGUAGAUCCGAAUUUGU | 1 | + | + | ++ | +++ | +/− | + | − |
| (SEQ ID NO: 68) | |||||||||
| miR-11 | CAUCACAGUCUGAGUUCUUGC | 7 | +++ | +++ | +++ | +++ | +++ | + | − |
| (SEQ ID NO: 69) | |||||||||
| miR-12 | UGAGUAUUACAUCAGGUACUGGU | 7 | + | + | ++ | ++ | + | +++ | +/− |
| (SEQ ID NO: 70) | |||||||||
| miR-13a* | UAUCACAGCCAUUUUGACGAGU | 1 | +++ | +++ | +++ | +++ | + | +++ | +++ |
| (SEQ ID NO: 71) | |||||||||
| miR-13b* | UAUCACAGCCAUUUUGAUGAGU | 0 | |||||||
| (SEQ ID NO: 72) | |||||||||
| miR-14 | UCAGUCUUUUUCUCUCUCCUA | 1 | − | − | − | − | − | − | − |
| (SEQ ID NO: 73) | |||||||||
| let-7 | UGAGGUAGUAGGUUGUAUAGUU | 0 | − | − | − | − | +++ | +++ | − |
| (SEQ ID NO: 74) | |||||||||
| # = (SEQ ID NO: 61) | |||||||||
| *Similar miRNA sequences are difficult to distinguish by Northern blotting because of potential cross-hybridization of probes. |
| TABLE 2 |
| Human miRNAs. From 220 short RNAs sequenced, 100 (45%) corresponded to miRNAs, 53 (24%) to |
| already characterized functional RNAs (rRNA, snRNAs, tRNAs), and 67 (30%) sequences with no database |
| entry. Results of Northern blotting of total RNA isolated from different vertebrate species and S2 cells |
| are indicated. For legend, see Table 1. |
| freq. | HeLa | mouse | adult | frog | |||
| miRNA | sequence (5′ to 3′) | (%) | cells | kidney | fish | ovary | S2 |
| let-7a* | UGAGGUAGUAGGUUGUAUAGUU# | 10 | +++ | +++ | +++ | 8− | − |
| let-7b* | UGAGGUAGUAGGUUGUGUGGUU | 13 | |||||
| (SEQ ID NO: 76) | |||||||
| let-7c* | UGAGGUAGUAGGUUGUAUGGUU | 3 | |||||
| (SEQ ID NO: 77) | |||||||
| let-7d* | AGAGGUAGUAGGUUGCAUAGU | 2 | +++ | +++ | +++ | − | − |
| (SEQ ID NO: 78) | |||||||
| let-7e* | UGAGGUAGGAGGUUGUAUAGU | 2 | +++ | +++ | +++ | − | − |
| (SEQ ID NO: 79) | |||||||
| let-7f* | UGAGGUAGUAGAUUGUAUAGUU | 1 | |||||
| (SEQ ID NO: 80) | |||||||
| miR-15 | UAGCAGCACAUAAUGGUUUGUG | 3 | +++ | ++ | + | +/− | − |
| (SEQ ID NO: 81) | |||||||
| miR-16 | UAGCAGCACGUAUAUAUUGGCG | 10 | +++ | + | +/− | +/− | − |
| (SEQ ID NO: 82) | |||||||
| miR-17 | ACUGCAGUGAAGGCACUUGU | 1 | +++ | − | − | − | − |
| (SEQ ID NO: 83) | |||||||
| miR-18 | UAAGGUGCAUCUAGUGCAGAUA | 2 | +++ | − | − | − | − |
| (SEQ ID NO: 84) | |||||||
| miR-19a* | UGUGCAAAUCUAUGCAAAACUGA | 1 | +++ | − | +/− | − | − |
| (SEQ ID NO: 85) | |||||||
| miR-19b* | UGUGCAAAUCCAUGCAAAACUGA | 3 | |||||
| (SEQ ID NO: 86) | |||||||
| miR-20 | UAAAGUGCUUAUAGUGCAGGUA | 4 | +++ | − | + | − | − |
| (SEQ ID NO: 87) | |||||||
| miR-21 | UAGCUUAUCAGACUGAUGUUGA | 10 | +++ | + | ++ | − | − |
| (SEQ ID NO: 88) | |||||||
| miR-22 | AAGCUGOCAGUUGAAGAACUGU | 10 | +++ | +++ | + | +/− | − |
| (SEQ ID NO: 89) | |||||||
| miR-23 | AUCACAUUGCCAGGGAUUUCC | 2 | +++ | +++ | +++ | + | − |
| (SEQ ID NO: 90) | |||||||
| miR-24 | UGGCUCAGUUCAGCAGGAACAG | 4 | ++ | +++ | ++ | − | − |
| (SEQ ID NO: 91) | |||||||
| miR-25 | CAUUGCACUUGUCUCGGUCUGA | 3 | +++ | + | ++ | − | − |
| (SEQ ID NO: 92) | |||||||
| miR-26a* | UUCAAGUAAUCCAGGAUAGGCU | 2 | + | ++ | +++ | − | − |
| (SEQ ID NO: 93) | |||||||
| miR-26b* | UUCAAGUAAUUCAGGAUAGGUU | 1 | |||||
| (SEQ ID NO: 94) | |||||||
| miR-27 | UUCACAGUGGCUAAGUUCCGCU | 2 | +++ | +++ | ++ | − | − |
| (SEQ ID NO: 95) | |||||||
| miR-28 | AAGGAGCUCACAGUCUAUUGAG | 2 | +++ | +++ | − | − | − |
| (SEQ ID NO: 96) | |||||||
| miR-29 | CUAGCACCAUCUGAAAUCGGUU | 2 | + | +++ | +/− | − | − |
| (SEQ ID NO: 97) | |||||||
| miR-30 | CUUUCAGUCGGAUGUUUGCAGC | 2 | +++ | +++ | +++ | − | − |
| (SEQ ID NO: 98) | |||||||
| miR-31 | GGCAAGAUGCUGGCAUAGCUG | 2 | +++ | − | − | − | − |
| (SEQ ID NO: 99) | |||||||
| miR-32 | UAUUGCACAUUACUAAGUUGC | 1 | − | − | − | − | − |
| (SEQ ID NO: 100) | |||||||
| miR-33 | GUGCAUUGUAGUUGCAUUG | 1 | − | − | − | − | − |
| (SEQ ID NO: 101) | |||||||
| miR-1 | UGGAAUGUAAAGAAGUAUGGAG | 0 | − | − | + | − | − |
| (SEQ ID NO:102) | |||||||
| miR-7 | UGGAAGACUAGUGAUUUUGUUGU | 0 | + | − | +/− | − | +/− |
| (SEQ ID NO: 103) | |||||||
| miR-9 | UCUUUGGUUAUCUAGCUGUAUGA | 0 | − | − | − | − | − |
| (SEQ ID NO: 104) | |||||||
| miR-10 | ACCCUGUAGAUCCGAAUUUGU | 0 | − | + | − | − | − |
| (SEQ ID NO: 105) | |||||||
| # = (SEQ ID NO: 75) | |||||||
| *Similar miRNA sequences are difficult to distinguish by Northern blotting because of potential cross-hybridization of probes. |
| TABLE 3 |
| Mouse miRNAs. The sequences indicated represent the longest miRNA sequences identified |
| by cloning. The 3′-terminus of miRNAs is often truncated by one or two nucleotides. miRNAs |
| that are more than 85% identical in sequence (i.e. share 18 out of 21 nucleotides) or contain |
| 1- or 2-nucleotide internal deletions are referred to by the same gene number followed |
| by a lowercase letter. Minor sequence variations between related miRNAs are generally |
| found near the ends of the miRNA sequence and are thought to not compromise target RNA |
| recognition. Minor sequence variations may also represent A to G and C to U changes, |
| which are accommodated as G-U wobble base pairs during target recognition. miRNAs |
| with the suffix -s or -as indicate RNAs derived from either the 5′-half or the 3′-half of |
| a miRNA precursor. Mouse brains were dissected into midbrain, mb, cortex, cx, cerebellum, |
| cb. The tissues analyzed were heart, ht; liver, lv; small intestine, si; colon, co; cortex, |
| ct; cerebellum, cb; midbrain, mb. |
| Number of clones |
| miRNA | sequence (5′ to 3′) | ht | lv | sp | si | co | cx | cb | mb |
| let-7a | UGAGGUAGUAGGUUGUAUAGUU | 3 | 1 | 1 | 7 | ||||
| (SEQ ID NO: 106) | |||||||||
| let-7b | UGAGGUAGUAGGUUGUGUCGUU | 1 | 1 | 2 | 5 | ||||
| (SEQ ID NO: 107) | |||||||||
| let-7c | UGAGGUAGUAGGUUGUAUGGUU | 2 | 2 | 5 | 19 | ||||
| (SEQ ID NO: 108) | |||||||||
| Iet-7d | AGAGGUAGUAGGUUGCAUAGU | 2 | 2 | 2 | 2 | ||||
| (SEQ ID NO: 109) | |||||||||
| let-7e | UGAGGUAGGAGGUUGUAUAGU | 1 | 2 | ||||||
| (SEQ ID NO: 110) | |||||||||
| let-7f | UGAGGUAGUAGAUUGUAUAGUU | 2 | 3 | 3 | |||||
| (SEQ ID NO: 111) | |||||||||
| let-7g | UOAGGUAGUAGUUUGUACAGUA | 1 | 1 | 2 | |||||
| (SEQ ID NO: 112) | |||||||||
| let-7h | UGAGGUAGUAGUGUGUACAGUU | 1 | 1 | ||||||
| (SEQ ID NO: 113) | |||||||||
| let-7i | UGAGGUAGUAGUUUGUGCU | 1 | 1 | ||||||
| (SEQ ID NO: 114) | |||||||||
| miR-1b | UGGAAUGUAAAGAAGUAUGUAA | 4 | 2 | 1 | |||||
| (SEQ ID NO: 115) | |||||||||
| miR-1c | UGGAAUGUAAAGAAGUAUGUAC | 7 | |||||||
| (SEQ ID NO: 116) | |||||||||
| miR-1d | UGGAAUGUAAAGAAGUAUGUAUU | 16 | 1 | ||||||
| (SEQ ID NO: 117) | |||||||||
| miR-9 | UCUUUGGUUAUCUAGCUGUAUGA | 3 | 4 | 4 | |||||
| (SEQ ID NO: 118) | |||||||||
| miR-15a | UAGCAGCACAUAAUGGUUUGUG | 1 | 2 | ||||||
| (SEQ ID NO: 119) | |||||||||
| miR-15b | UAGCAGCACAUCAUGGUUUACA | 1 | |||||||
| (SEQ ID NO: 120) | |||||||||
| miR-16 | UAGCAGCACGUAAAUAUUGGCG | 1 | 1 | 2 | 1 | 2 | 3 | ||
| (SEQ ID NO: 121) | |||||||||
| miR-18 | UAAGGUGCAUCUAGUGCAGAUA | 1 | |||||||
| (SEQ ID NO: 122) | |||||||||
| miR-19b | UGUGCAAAUCCAUGCAAAACUGA | 1 | |||||||
| (SEQ ID NO: 123) | |||||||||
| miR-20 | UAAAGUGCUUAUAGUGCAGGUAG | 1 | |||||||
| (SEQ ID NO: 124) | |||||||||
| miR-21 | UAGCUUAUCAGACUGAUGUUGA | 1 | 1 | 2 | 1 | ||||
| (SEQ ID NO: 125) | |||||||||
| miR-22 | AAGCUGCCAGDUGAAGAACUGU | 2 | 1 | 1 | 1 | 2 | |||
| (SEQ ID NO: 126) | |||||||||
| miR-23a | AUCACAUUGCCAGGGAUUUCC | 1 | |||||||
| (SEQ ID NO: 127) | |||||||||
| miR-23b | AUCACAUUGCCAGGGAUUACCAC | 1 | |||||||
| (SEQ ID 140: 128) | |||||||||
| miR-24 | UGGCUCAGUUCAGCAGGAACAG | 1 | 1 | 1 | 1 | ||||
| (SEQ ID 140: 129) | |||||||||
| miR-26a | UUCAAGUAAUCCAGGAUAGGCU | 3 | 2 | ||||||
| (SEQ ID 140: 130) | |||||||||
| miR-26b | UUCAAGUAAUUCAGGAUAGGUU | 2 | 4 | 1 | |||||
| (SEQ ID NO: 131) | |||||||||
| miR-27a | UUCACAGUGGCUAAGUUCCGCU | 1 | 2 | 1 | 1 | 2 | 1 | ||
| (SEQ ID NO: 132) | |||||||||
| miR-27b | UUCACAGUGGCUAAGUUCUG | 1 | |||||||
| (SEQ ID NO: 133) | |||||||||
| miR-29a | CUAGCACCAUCUGAAAUCGGUU | 1 | 1 | 1 | |||||
| (SEQ ID NO: 134) | |||||||||
| miR-29b/ | UAGCACCAUUUGAAAUCAGUGUU | 1 | 1 | 5 | 3 | ||||
| miR-102 | (SEQ ID NO: 135) | ||||||||
| miR-29c/ | UAGCACCAUUGAAAUCGGUUA | 1 | 3 | 1 | |||||
| (SEQ ID NO: 136) | |||||||||
| miR-30a-s/ | UGUAAACAUCCUCGACUGGAAGC | 1 | 1 | 1 | |||||
| miR-97 | (SEQ ID NO: 137) | ||||||||
| miR-30a-as* | CUUUCAGUCGGAUGUUUGCAGC | 1 | |||||||
| (SEQ ID NO: 138) | |||||||||
| miR-30b | UGUAAACAUCCUACACUCAGC | 1 | 2 | ||||||
| (SEQ ID NO: 139) | |||||||||
| miR-30c | UGUAAACAUCCUACACUCUCAGC | 2 | 1 | 1 | |||||
| (SEQ ID NO: 140) | |||||||||
| miR-30d | UGUAAACAUCCCCGACUGGAAG | 1 | |||||||
| (SEQ ID NO: 141) | |||||||||
| miR-99a/ | ACCCGUAGAUCCGAUCUUGU | 1 | |||||||
| miR-99 | (SEQ ID NO: 142) | ||||||||
| miR-99b | CACCCGUAGAACCGACCUUGCG | 1 | |||||||
| (SEQ ID NO: 143) | |||||||||
| miR-101 | UACAGUACUGUGAUAACUGA | 2 | 1 | 1 | |||||
| (SEQ ID NO: 144) | |||||||||
| miR-122a | UGGAGUGUUACAAUGGUGUUUGU | 3 | |||||||
| (SEQ ID NO: 145) | |||||||||
| miR-122b | UGGAGUGUGACAAUGGUGUUUGA | 11 | |||||||
| (SEQ ID NO: 146) | |||||||||
| miR-122a,b | UGGAGUGUGACAAUGGUGUUUG | 23 | |||||||
| (SEQ ID NO: 147) | |||||||||
| miR-123 | CAUUAUUACUUUUGGUACGCG | 1 | 2 | ||||||
| (SEQ ID NO: 149) | |||||||||
| miR-124ab | UUAAGGCACGCGG-UGAAUGCCA | 1 | 37 | 41 | 24 | ||||
| (SEQ ID NO: 149) | |||||||||
| miR-124b | UUAAGGCACGCGGGUGAAUGC | 1 | 3 | ||||||
| (SEQ ID NO: 150) | |||||||||
| miR-125a | UCCCUGAGACCCUUUAACCUGUG | 1 | 1 | ||||||
| (SEQ ID NO: 151) | |||||||||
| miR-125b | UCCCUGAGACCCU--AACUUGUGA | 1 | |||||||
| (SEQ ID NO: 152) | |||||||||
| miR-126 | UCGUACCGUGAGUAAUAAUGC | 4 | 1 | ||||||
| (SEQ ID NO: 153) | |||||||||
| miR-127 | UCGGAUCCGUCUGAGCUUGGCU | 1 | |||||||
| (SEQ ID NO: 154) | |||||||||
| miR-128 | UCACAGUGAACCGGUCUCUUUU | 2 | 2 | 2 | |||||
| (SEQ ID NO: 155) | |||||||||
| miR-129 | CUUUUUUCGGUCUGGGCUUGC | 1 | |||||||
| (SEQ ID NO: 156) | |||||||||
| miR-130 | CAGUGCAAUGUUAAAAGGGC | 1 | |||||||
| (SEQ ID NO: 157) | |||||||||
| miR-131 | UAAAGCUAGAUAACCGAAAGU | 1 | 1 | 1 | |||||
| (SEQ ID NO: 158) | |||||||||
| miR-132 | UAACAGUCUACAGCCAUGGUCGU | 1 | |||||||
| (SEQ ID NO: 159) | |||||||||
| miR-133 | UUGGUCCCCUUCAACCAGCUGU | 4 | 1 | ||||||
| (SEQ ID NO: 160) | |||||||||
| miR-134 | UGUGACUGGUUGACCAGAGGGA | 1 | |||||||
| (SEQ ID NO: 161) | |||||||||
| miR-135 | UAUGGCUUUUUAUUCCUAUGUGAA | 1 | |||||||
| (SEQ ID NO: 162) | |||||||||
| miR-136 | ACUCCAUUUGUUUUGAUGAUGGA | 1 | |||||||
| (SEQ ID NO: 162) | |||||||||
| miR-137 | UAUUGCUUAAGAAUACGCGUAG | 1 | 1 | ||||||
| (SEQ ID NO: 164) | |||||||||
| miR-138 | AGCUGGUGUUGUGAAUC | 1 | |||||||
| (SEQ ID NO: 165) | |||||||||
| miR-139 | UCUACAGUGCACGUGUCU | 1 | 1 | ||||||
| (SEQ ID NO: 166) | |||||||||
| miR-140 | AGUGGUUUUACCCUAUGGUAG | 1 | |||||||
| (SEQ ID NO: 167) | |||||||||
| miR-141 | AACACUGUCUGGUAAAGAUGG | 1 | 1 | 1 | |||||
| (SEQ ID NO: 168) | |||||||||
| miR-142-s | CAUAAAGUAGAAAGCACUAC | 1 | 1 | ||||||
| (SEQ ID NO: 169) | |||||||||
| miR-142-asb | UGUAGUGUUUCCUACUUUAUGG | 1 | 1 | 6 | |||||
| (SEQ ID NO: 170) | |||||||||
| miR-143 | UGAGAUGAAGCACUGUAGCUCA | 3 | 7 | 2 | 1 | ||||
| (SEQ ID NO: 171) | |||||||||
| miR-144 | UACAGUAUAGAUGAUGUACUAG | 2 | 1 | ||||||
| (SEQ ID NO: 172) | |||||||||
| miR-145 | GUCCAGUUUUCCCAGGAAUCCCUU | 1 | |||||||
| (SEQ ID NO: 173) | |||||||||
| miR-146 | UGAGAACUGAAUUCCAUGGGUUU | 1 | |||||||
| (SEQ ID NO: 174) | |||||||||
| miR-147 | GUGUGUGGAAAUGCUUCUGCC | 1 | |||||||
| (SEQ ID NO: 175) | |||||||||
| miR-148 | UCAGUGCACUACAGAACUUUGU | 1 | |||||||
| (SEQ ID NO: 176) | |||||||||
| miR-149 | UCUGGCUCCGUGUCUUCACUCC | 1 | |||||||
| (SEQ ID NO: 177) | |||||||||
| miR-150 | UCUCCCAACCCUUGUACCAGUGU | 1 | |||||||
| (SEQ ID NO: 178) | |||||||||
| miR-151 | CUAGACUGAGGCUCCUUGAGGU | 1 | |||||||
| (SEQ ID NO: 179) | |||||||||
| miR-152 | UCAGUGCAUGACAGAACUUGG | 1 | |||||||
| (SEQ ID NO: 180) | |||||||||
| miR-153 | UUGCAUAGUCACAAAAGUGA | 1 | |||||||
| (SEQ ID NO: 181) | |||||||||
| miR-154 | UAGGUUAUCCGUGUUGCCUUCG | 1 | |||||||
| (SEQ ID NO: 182) | |||||||||
| miR-155 | UUAAUGCUAAUUGUGAUAGGGG | 1 | |||||||
| (SEQ ID NO: 183) | |||||||||
| aThe originally described miR-30 was renamed to miR-30a-as in order to distinguish it from the miRNA derived from the opposite strand of the precursor encoded by the mir-30a gene. miR-30a-s is equivalent to miR-97 [46]. | |||||||||
| bA 1-nt length heterogeneity is found on both 5′ and 3′ end. The 22-nt miR sequence is shown, but only 21-nt miRNAs were cloned. |
| TABLE 4 |
| Mouse and human miRNAs. The sequences indicated represent the longest miRNA sequences identified by cloning. The |
| 3′ terminus of miRNAs is often truncated by one or two nucleotides. miRNAs that are more than 85% identical in |
| sequence (i.e. share 18 out of 21 nucleotides) or contain 1- or 2-nucleotide internal deletions are referred to by the same |
| gene number followed by a lowercase letter. Minor sequence variations between related miRNAs are generally found near the |
| ends of the miRNA sequence and are thought to not compromise target RNA recognition. Minor sequence variations may also |
| represent A to G and C to U changes; which are accommodated as G-U wobble base pairs during target recognition. Mouse brains |
| were dissected into midbrain, mb, cortex, cx, cerebellum, cb. The tissues analyzed were lung, ln; liver, lv; spleen, sp; kidney, kd; |
| skin, sk; testis, ts; ovary, ov; thymus, thy; eye, ey; cortex, ct; cerebellum, cb; midbrain, mb. The human osteosarcoma cells |
| SAOS-2 cells contained an inducible p53 gene (p53-, uninduced p53; p53+, induced p53); the differences in miRNAs identified from |
| induced and uninduced SAOS cells were not statistically significant. |
| number of clones |
| human SAOS- | |||
| mouse tissues | 2 cells |
| miRNA | Sequences (5′ to 3′) | ln | lv | sp | kd | sk | ts | ov | thy | ey | p53− | p53+ |
| miR-C1 | AACAUUCAACGCUGUCGGUGAGU | 1 | 1 | 2 | (SEQ ID NO. 184) | ||||||||
| miR-C2 | UUUGGCAAUGGUAGAACUCACA | 1 | (SEQ ID NO. 185) | ||||||||||
| miR-C3 | UAUGGCACUGGUAGAAUUCACUG | 1 | (SEQ ID NO. 186) | ||||||||||
| miR-C4 | CUUUUUGCGGUCUGGCCUUCUU | 1 | 1 | 1 | (SEQ ID NO. 187) | ||||||||
| miR-C5 | UGGACGGAGAACUGAUAAGGGU | 2 | (SEQ ID NO. 188) | ||||||||||
| miR-C6 | UGCAGAGAAAGGCAGUUC | 1 | (SEQ ID NO. 189) | ||||||||||
| miR-C7 | CAAAGAAUUCUCCUUUUGGGCUU | 1 | 1 | (SEQ ID NO. 190) | |||||||||
| miR-C8 | UCGUGUCUUGUGUUGCAGCCGG | 1 | (SEQ ID NO. 191) | ||||||||||
| miR-C9 | UAACACUGUCUGGUAACGAUG | 1 | (SEQ ID NO. 192) | ||||||||||
| miR-C10 | CAUCCCUUGCAUGGUGGAGGGU | 1 | (SEQ ID NO. 193) | ||||||||||
| miR-C11 | GUGCCUACUGAGCUGACAUCAGU | 1 | (SEQ ID NO. 194) | ||||||||||
| miR-C12 | UGAUAUGUUUGAUAUAUUAGGU | 2 | (SEQ ID NO. 195) | ||||||||||
| miR-C13 | CAACCGAAUCCCAAAAGCAGCU | 2 | 1 | (SEQ ID NO. 196) | |||||||||
| miR-C14 | CUGACCUAUGAAUUGACA | 2 | 1 | (SEQ ID NO. 197) | |||||||||
| miR-C15 | UACCACAGGGUAGAACCACGGA | 1 | (SEQ ID NO. 198) | ||||||||||
| miR-C16 | AACUGGCCUACAAAGUCCCAG | 1 | (SEQ ID NO. 199) | ||||||||||
| miR-C17 | UGUAACAGCAACUCCAUGUGGA | 1 | (SEQ ID NO. 200) | ||||||||||
| miR-C18 | UAGCAGCACAGAAAUAUUGGC | 2 | 1 | 1 | (SEQ ID NO. 201) | ||||||||
| miR-C19 | UAGGUAGUUUCAUGUUGUUGG | 1 | (SEQ ID NO. 202) | ||||||||||
| mtR-C20 | UUCACCACCUUCUCCACCCAGC | 1 | 1 | (SEQ ID NO. 203) | |||||||||
| miR-C21 | GGUCCAGAGGGGAGAUAGG | 1 | (SEQ ID NO. 204) | ||||||||||
| miR-C22 | CCCAGUGUUCAGACUACCUGUU | 1 | (SEQ ID NO. 205) | ||||||||||
| miR-C23 | UAAUACUGCCUGGUAAUGAUGAC | 2 | 1 | (SEQ ID NO. 206) | |||||||||
| miR-C24 | UACUCAGUAAGGCAUUGUUCU | 1 | (SEQ ID NO. 207) | ||||||||||
| miR-C25 | AGAGGUAUAGCCCAUCCGAACA | 1 | (SEQ ID NO. 208) | ||||||||||
| miR-C26 | UAAUGUUUAGGACCACUAG | 1 | (SEQ ID NO. 209) | ||||||||||
| miR-C27 | UUCCCUUUGUCAUCCUAUGCCUG | 1 | (SEQ ID NO. 210) | ||||||||||
| miR-C28 | UCCUUCAUUCCACCGGAGUCUG | 1 | (SEQ ID NO. 211) | ||||||||||
| miR-C29 | GUGAAAUGUUUAGGACCACUAGA | 2 | (SEQ ID NO. 212) | ||||||||||
| miR-C30 | UGGAAUGUAAGGAAGUGUGUGG | 2 | (SEQ ID NO. 213) | ||||||||||
| miR-C31 | UACACUAGUCUGCACAUUGGUU | 1 | (SEQ ID NO. 214) | ||||||||||
| miR-C32 | CCCUGUAGAACCCAAUUUGUCU | 1 | 1 | (SEQ ID NO. 215) | |||||||||
| miR-C33 | AACCCGUAGAUCCGAACUUGUGAA | 1 | (SEQ ID NO. 216) | ||||||||||
| miR-C34 | GCUUCUCCUGGCUCUCCUCCCUC | 1 | (SEQ ID NO. 217) | ||||||||||
| TABLE 5 |
| D. meLanogaster miRNA sequences and genomic location. The sequences given represent the most |
| abundant, and typically longest miRNA sequences identified by cloning. It was frequently observed |
| that miRNAs vary in length by one or two nucleotides at their 3′-terminus. From 222 short RNAs |
| sequenced; 69 (31%) corresponded to miRNAs, 103 (46%) to already characterized functional |
| RNAs (rRNA, 7SL RNA, tRNAs), 30 (14%) to transposon RNA fragments, and 20 (10%) |
| sequences with no database entry. RNA sequences with a 5′-guanosine are likely to be |
| underrepresented due to the cloning procedure (8). miRNA homologs found in other species |
| are indicated. Chromosomal location (chr.) and GenBank accession numbers (acc. nb.) are |
| indicated. No ESTs matching miR-1 to miR-14 were detectable by database searching. |
| miRNA | sequence (5′ to 3′) | chr., acc. nb. | remarks |
| miR-1 | UGGAAUGUAAAGAAGUAUGGAG | 2L, AE003667 | homologs: C. briggsae, G20U, |
| (SEQ ID NO: 58) | AC87074; C. elegans G20u, | ||
| U97405; mouse, G20U, G22U, | |||
| AC020867; human, chr. 20, | |||
| G20U, G22U, AL449263; ESTs: | |||
| zebrafish, G20u, G22u, BF157- | |||
| 601; cow, G20U, G22U, BE722- | |||
| 224; human, G20U, G22U, | |||
| A1220268 | |||
| miR-2a | UAUCACAGCCAGCUUUGAUGAGC | 2L, AE003663 | 2 precursor variants clustered |
| (SEQ ID NO: 59) | with a copy of mir-2b | ||
| miR-2b | UAUCACAQCCAGCUDUGAGGAGC | 2L, AE003620 | 2 precursor variants |
| (SEQ ID NO: 60) | 2L, AE003663 | ||
| miR-3 | UCACUGGGCAAAGUGUGUCUCA | 2R, AE003795 | in cluster mir-3 to mir-6 |
| (SEQ ID NO: 61) | |||
| miR-4 | AUAAAGCUAGACAACCAUUGA | 2R, AE003795 | in cluster mir-3 to mir-6 |
| (SEQ ID NO: 62) | |||
| miR-5 | AAAGGAACGAUCGUUGUGAUAUG | 2R, AE003795 | in cluster mir-3 to mir-6 |
| (SEQ ID NO: 63) | |||
| miR-6 | UAUCACAGUGGCUGUUCUUUUU | 2R, AE003795 | in cluster mir-3 to mir-6 with 3 |
| (SEQ ID NO: 64) | variants | ||
| miR-7 | UGGAAGACUAGUGAUUUUGUUGU | 2R, AE003791 | homologs: human, chr. 19 |
| (SEQ ID NO:65) | AC006537, EST BF373391; | ||
| mouse chr. 17 AC026385, EST | |||
| AA881786 | |||
| miR-8 | UAAUACUGUCAGGUAAAGAUGUC | 2R, AE003805 | |
| (SEQ ID NO: 66) | |||
| miR-9 | UCUUUGGUUAUCUAGCUGUAUGA | 3L, AE003516 | homologs: mouse, chr. 19, |
| (SEQ ID NO: 67) | AF155142; human, chr. 5, | ||
| AC026701, chr. 15, AC005316 | |||
| miR-10 | ACCCUGUAGAUCCGAAUUUGU | AE001574 | homologs: mouse, chr 11, |
| (SEQ ID NO: 68) | AC011194; human, chr. 17, | ||
| AF287967 | |||
| miR-11 | CAUCACAGUCUGAGUUCUUGC | 3R, AE003735 | intronic location |
| (SEQ ID NO: 69) | |||
| miR-12 | UGAGUAUUACAUCAGGUACUGGU | X, AE003499 | intronic location |
| (SEQ ID NO: 70) | |||
| miR-13a | UAUCACAGCCAUUUUGACGAGU | 3R, AE003708 | mir-13a clustered with mir-13b |
| (SEQ ID NO: 71) | X;AE003446 | on chr. 3R | |
| miR-13b | UAUCACAGCCAUUUUGAUGAGU | 3R, AE003708 | mir-13a clustered with mir-13b |
| (SEQ ID NO: 72) | on chr. 3R | ||
| miR-14 | UCAGUCUUUUUCUCUCUCCUA | 2R, AE003833 | no signal by Northern analysis |
| (SEQ ID NO: 73) | |||
| TABLE 6 |
| Human miRNA sequences and genomic location. From 220 short RNAs sequenced, 100 (45%) corres- |
| ponded to miRNAs, 53 (24%) to already characterized functional RNAs (rRNA, snRNAs, tRNAs), and |
| 67 (30%) sequences with no database entry. For legend, see Table 1. |
| chr. or EST, | |||
| miRNA | sequence (5′ to 3′) | acc. nb. | remarks* |
| let-7a | UGAGGUAGUAGGUUGUAUAGUU | 9, AC007924, | sequences of chr 9 and 17 |
| (SEQ ID NO: 75) | 11, AP001359, | identical and clustered with let-7f, | |
| 17, AC087784, | homologs: C. elegans, AF274345; | ||
| 22, AL049853 | C. briggsae, AF210771, D. | ||
| melanogaster, AE003659 | |||
| let-7b | UGAGGUAGUAGGUUGUGUGGUU | 22, AL049853†, | homologs: mouse, EST AI481799; |
| (SEQ ID NO: 76) | ESTs, AI382133, | rat, EST, BE120662 | |
| AW028822 | |||
| let-7c | UGAGGUAGUAGGUUGUAUGGUU | 21, AP001667 | Homologs: mouse, EST, |
| (SEQ ID NO: 77) | AA575575 | ||
| let-7d | AGAGGUAGUAGGUUGCAUAGU | 17, AC087784, | identical precursor sequences |
| (SEQ ID NO: 78) | 9, AC007924 | ||
| let-7e | UGACGUAGGAGGUUGUAUAGU | 19, AC018755 | |
| (SEQ ID NO: 79) | |||
| let.7f | UGAGGUAGUAGAUUGUAUAGUU | 9, AC007924, | sequences of chr 9 and 17 |
| (SEQ ID NO: 80) | 17, AC087784, | identical and clustered with let-7a | |
| X, AL592046 | |||
| miR-15 | UAGCAGCACAUAAUGGUUUGUG | 13, AC069475 | in cluster with mir-16 homolog |
| (SEQ ID NO: 81) | |||
| miR-16 | UAGCAGCACGUAAAUAUUGGCG | 13, AC069475 | in cluster with mir-15 homolog |
| (SEQ ID NO: 82) | |||
| miR-17 | ACUGCAGUGAAGGCACUUGU | 13, AL138714 | in cluster with mir-17 to mir-20 |
| (SEQ ID NO: 83) | |||
| miR-18 | UAAGGUGCA.UCUAGUGCAGAUA | 13, AL138714 | in cluster with mir-17 to mir-20 |
| (SEQ ID NO: 84) | |||
| miR-19a | UGUGCAAAUCUAUGCAAAACUG | 13, AL138714 | in cluster with mir-17 to mir-20 |
| A (SEQ ID NO: 85) | |||
| miR-19b | UGUGCAAAUCCAUGCAAACUG | 13, AL138714, | in cluster.with mir-17 to mir-20 |
| A (SEQ ID NO: 86) | X, AC002407 | ||
| miR-20 | UAAAGUGCUUAUAGUGCAGGUA | 13, AL138714 | in cluster with mir-17 to mir-20 |
| (SEQ ID NO: 87) | |||
| miR-21 | UAGCUUAUCAGACUGAUGUUGA | 17, AC004686, | homologs: mouse, EST, |
| (SEQ ID NO: 88) | EST,BF326048 | AA209594 | |
| miR-22 | AAGCUGCCAGUUGAAGAACUGU | ESTs, | human ESTs highly similar; |
| (SEQ ID NO: 89) | AW961681†, | homologs: mouse, ESTs, e.g. | |
| AA456477, | AA823029; rat, ESTs, e.g. | ||
| AI752503, | BF543690 | ||
| BF030303, | |||
| HS1242049 | |||
| miR-23 | AUCACAUUGCCAGGGAUUUCC | 19, AC020916 | homologs: mouse, EST, |
| (SEQ ID NO: 90) | AW124037;rat, EST, BF402515 | ||
| miR-24 | UGGCUCAGUUCAGCAGGAACAG | 9, AF043896, | homologs: mouse, ESTs, |
| (SEQ ID NO: 91) | 19, AC020916 | AA111466, AI286629; pig, EST, | |
| BE030976 | |||
| miR-25 | CAUUGCACUUGUCUCGGUCUGA | 7, AC073842, | human chr 7 and EST identical; |
| (SEQ ID NO: 92) | EST, BE077684 | highly similar precursors in | |
| mouse ESTs (e.g. AI595464); fish | |||
| precursor different STS: G46757 | |||
| miR-26a | UUCAAGUAAUCCAGGAUAGGCU | 3, AP000497 | |
| (SEQ ID NO: 93) | |||
| miR-26b | UUCAAGUAAUUCAGGAUAGGUU | 2, AC021016 | |
| (SEQ ID NO:94) | |||
| miR-27 | UUCACAGUGGCUAAGUUCCGCU | 19, AC20916 | U22C mutation in human genomic |
| (SEQ ID NO: 95) | sequence | ||
| miR-28 | AAGGAGCUCACAGUCUAUUGAG | 3, AC063932 | |
| (SEQ ID NO: 96) | |||
| miR-29 | CUAGCACCAUCUGAAAUCGGUU | 7, AF017104 | |
| (SEQ ID NO: 97) | |||
| miR-30 | CUUUCAGUCGGAUGUUUGCAGC | 6, AL035467 | |
| (SEQ ID NO: 98) | |||
| miR-31 | GGCAAQAUGCUGGCAUAGCUG | 9, AL353732 | |
| (SEQ ID NO: 99) | |||
| miR-32 | UAUUGCACAUUACUAAGUUGC | 9, AL354797 | not detected by Northern blotting |
| (SEQ ID NO: 100) | |||
| miR-33 | GUQCAUUGUAGUUGCAUUG | 22, Z99716 | not detected by Northern blotting |
| (SEQ ID NO: 101) | |||
| *If several ESTs were retrieved for one organism in the database, only those with different precursor sequences are listed. | |||
| †precursor structure shown in FIG. 4. |
1. An isolated nucleic acid molecule selected from the group consisting of:
(a) a nucleotide sequence as shown in SEQ ID NO: 88,
(b) a nucleotide sequence which is the complement of (a); and
(c) a nucleotide sequence consisting of 18-25 nucleotides which has a sequence identity of at least 80% to the sequence of (a) or (b).
2. The nucleic acid molecule of claim 1, wherein the identity of sequence (c) is at least 90%.
3. The nucleic acid molecule of claim 1, wherein the identity of sequence (c) is at least 95%.
4. The nucleic acid molecule of claim 1, which is a miRNA molecule or an analog thereof having a length of from 18-25 nucleotides.
5. The nucleic acid molecule of claim 1, which is single-stranded.
6. The nucleic acid molecule of claim 1, which is at least partially double-stranded.
7. The nucleic acid molecule of claim 1, which is selected from RNA, DNA or nucleic acid analog molecules.
8. The nucleic acid molecule of claim 1, which is a molecule containing at least one modified nucleotide analog.
9. A recombinant expression vector comprising at least one nucleic acid molecule of claim 1.
10. A composition comprising at least one nucleic acid molecule of claim 1 in combination with a pharmaceutically acceptable carrier.
11. The composition of claim 10 wherein said pharmaceutically acceptable carrier is suitable for diagnostic applications.
12. The composition of claim 10 wherein said pharmaceutically acceptable carrier is suitable for therapeutic applications.
13. The composition of claim 10 as a marker or a modulator for developmental or pathogenic processes.
14. The composition of claim 10 as a marker or modulator of developmental disorders.
15. The composition of claim 10 as a marker or modulator of gene expression.
16. The nucleic acid molecule of claim 1, wherein the identity of sequence (c) is 100%.
17. The nucleic acid molecule of claim 8, wherein said modified nucleotide analog is a 2′ modified nucleotide.
18. The nucleic acid molecule of claim 8, wherein said modified nucleotide analog is a backbone-modified nucleotide.
19. The nucleic acid molecule of claim 1, wherein said molecule has at least one locked nucleic acid.
20. The nucleic acid molecule of claim 1, having a length of 21, 22 or 23 nucleotides.
21. The composition of claim 14, wherein said developmental disorder is cancer.
22. The composition of claim 21, wherein said cancer is a B-cell chronic leukemia.