-
2019-10-15
13/372,180
2012-02-13
US 10,446,261 B1
2019-10-15
-
-
John S Brusca
Saliwanchik, Lloyd & Eisenschenk
2033-05-24
Smart Summary: A new system helps scientists analyze specific parts of genes called introns and exons. It works by finding unique markers in the DNA or RNA sequences that show where these parts are located. Once the sequences are identified, researchers can use various laboratory methods to confirm and study them further. If a sequence is verified, it can be translated into a protein, and its functions can be understood using existing knowledge. This information can also be compared to databases that link these genetic parts to diseases or mutations, allowing for deeper insights into genetic conditions. 🚀 TL;DR
A system and method for analyzing splicing codes of spliceosomal introns is disclosed. One embodiment comprises methods of identifying introns and exons in genomic DNA or pre-mRNA sequences by locating characteristic markers in splicing junctions by computation and/or manually. Exon sequences predicted by computation can be verified and characterized by employing standard amplification methods, such as comparative genomic, RNA-seq, next-generation sequencing, RT-PCR. DNA/RNA/oligo, electrophoretic or protein chip technologies. If a given sample is verified, its polypeptide can be translated based on genetic codons. Its functions can be deduced based on its characteristics, computation predictions and related knowledge databases. These data can be used to compare databases which correlate the characterized intron or exon or gene to characterized diseases or genetic mutations. Isoforms can be detected and analyzed at mRNA and protein levels alone and with other isoforms predicted by computation, characterized by experiments and stored in existing databases.
Get notified when new applications in this technology area are published.
G16B30/00 » CPC main
ICT specially adapted for sequence analysis involving nucleotides or amino acids
C12Q1/6806 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
C12Q1/6813 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Hybridisation assays
C12Q1/6869 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Methods for sequencing
C12Q1/6876 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
G16B25/20 » CPC further
ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression Polymerase chain reaction [PCR]; Primer or probe design; Probe optimisation
C12Q2600/156 » CPC further
Oligonucleotides characterized by their use Polymorphic or mutational markers
This application is a continuation-in-part of U.S. patent application Ser. No. 12/006,898, filed on Jan. 6, 2008 and titled METHOD OF IDENTIFYING EXONS AND INTRONS AND DIAGNOSTIC USES THEREOF, the contents of which are herein incorporated by reference in its entirety.
The content of the electronically submitted sequence listing, file name Patent2_seq_patent_in35_v2_ST25.txt, size 427,239 bytes; and date of creation Nov. 7, 2015, filed herewith, is incorporated herein by reference in its entirety.
This application relates generally to a system and method for analyzing splicing codes of spliceosomal introns. One embodiment of the invention comprises methods of identifying introns and exons in genomic DNA or pre-mRNA sequences by locating characteristic markers in splicing junctions by computation. Exon sequences predicted by computation can be verified and characterized by employing standard amplification methods, such as comparative genomic, RNA-seq, next-generation sequencing, RT-PCR, DNA/RNA/oligo, electrophoretic or protein chip technologies. If a given sample is found to contain a characterized splicing junction, the sample is analyzed for the presence of introns or exons. When a putative intron or exon is found, it will be verified and characterized by the methods described above. The isoform associated with this splice site can be deduced and can be translated into protein sequence. It is compared to a database which correlates the known intron or exon to known diseases or genetic mutations. If a given sample is found to contain a characterized splicing junction, but not characterized introns or exons, the presence of novel introns or exons is likely and can be determined.
Our computational and experimental data have shown that a mammalian gene can generate hundreds or thousands of alternatively-spliced isoforms, and these alternatively-spliced isoforms may have different or even opposed functions. For example, under normal conditions, an insulin receptor (insr) gene encodes isoforms that promote normal metabolism and growth. However, other truncated isoforms of the insulin receptor (insr) gene can have opposite functions to suppress the normal functions which cause insulin insistence and leading to metabolic syndromes or even cancer. By detecting varieties of isoforms of genes at RNA levels including RNA (characterized or uncharacterized) and/or protein levels in conjunction with individual genetic backgrounds, devices can be developed to detect the balances of these isoforms to predict health conditions. A variety of methods (traditional or nontraditional; chemical or physical) can be developed to restore these balances to achieve the diagnosis and/or treatments of aging and complex diseases, such as diabetes, cardiovascular disease, Parkinson's disease, Alzheimer's disease and/or cancer. Thus, the methods herein are applicable for predicting disease or genetic mutations, or for searching for novel introns and exons.
Prokaryotic genes differ from eukaryotic genes in that every base pair in a prokaryotic gene is reflected in the mRNA base sequence. In eukaryotic genes there are often intervening sequences which do not appear in the mRNA base sequence for the gene product. The DNA sequences which are expressed and retained in the final product of mRNAs are “exons”. The intervening sequences which are not expressed are called “introns”.
Genomic DNA sequence, including exons and introns, are transcribed to produce a precursor of the mature mRNA or pre-mRNA. Genes from eukaryotic organisms contain a variable number of introns of varying sizes, which range from more than 20 bp to 800 kp. For example, the gene for mouse Tbc1d2 gene encoding TBC1 domain family, member 2 contains 12 introns, the mouse Col1a1 gene coding for procollagen, type I, alpha 1, contains 50 introns.
During the processing of pre-mRNA, the introns are excised out and the exons are spliced and joined together to generate a mature mRNA, which is exported into cytoplasm for translation into protein. Aberrations in pre-mRNA splicing have played an essential role in almost every known disease with genetic aetiology, disease susceptibility and severity and maybe in all aspects of life including development, differentiation, aging and cancer. See Baralle, D., Lucassen, A., Buratti, E., Missed threads. The impact of pre-mRNA splicing defects on clinical practice. EMBO Rep. 2009:10(8):810-6 (“Baralle”); Cooper T A, Wan L, Dreyfuss G., RNA and disease. Cell 2009:136(4):777-93 (“Cooper”); Belfiore, A., Frasca, F., Pandini, G., et al., Insulin receptor isoforms and insulin receptor/insulin-like growth factor receptor hybrids in physiology and disease. Endocr. Rev. 2009:30(6):586-623 (“Belfiore”).
Introns are removed from pre-mRNAs via two consecutive trans-esterification reactions before mature mRNAs are exported from the nucleus into cytoplasm for translation into proteins. See Black, D. L., Mechanisms of alternative pre-messenger RNA splicing. Annu. Rev. Biochem. 2003:72:291-336 (“Black”). Intron removal from pre-mRNAs is mediated by spliceosomes, which are known to be comprised of several hundred proteins and five small snRNAs packaged as ribonucleoprotein particles (RNPs). See Black; Sanford J. R., Gray N. K., Beckmann K., et al., A novel role for shuttling SR proteins in mRNA translation. Genes Dev. 2004:18(7):755-68 (“Sanford”); Moore, M. J., From birth to death: the complex lives of eukaryotic mRNAs. Science 2005:309(5740):1514-8 (“Moore”). In brief, the 5′ intronic conserved sequence, GURAGU, of pre-mRNAs is base-paired with the 5′ end of U1 snRNP and the conserved branch-point and 3′ splice site of pre-mRNAs are recognized by U2 snRNP1. See Black. The pre-assembled U4/U6, U5 tri-snRNPs associates with pre-mRNA and snRNPs already bound to pre-mRNA. This dynamic rearrangement leads to 2′-hydroxyl of adenosine of the branch-point to attack the last nucleotide of 5′ exon, producing the “free” 5′ exon and lariat intron-3′ intron intermediates. In the second step the 3′ hydroxyl of the 5′ exon attacks 3′ splice site to generate a spliced mRNA and lariat intronic product.
Many approaches have been developed to predict pre-mRNA splicing and alternative splicing with only a limited success. Introns were first identified by highly conserved sequences, which begin with highly conserved sequence among different eukaryotic organism, GTRAGT, and end with (C/T)AG (“Black”). Traditionally, alternative spliceovariants were identified by aligning different cDNAs/ESTs to the different regions of the same genomic sequences. See Zhuo, D., Zhao, W. D., Wright, F A, Yang, H. Y., and Wang, J. P. et al., Assembly, annotation, and integration of UNIGENE clusters into the human genome draft. Genome Res. 11(5): 904-918 (2001) (“Zhuo I”); Brent, M. R., Steady progress and recent breakthroughs in the accuracy of automated genome annotation. Nat Rev Genet 9(1): 62-73(2008) (“Brent”); Kim, N. and Lee, C., Bioinformatics detection of alternative splicing. Methods Mol Biol 452: 179-197 (2008) (“Kim”); Bonizzoni, P., Mauri, G., Pesole, G., Picardi, E., Pirola, Y. et al. Detecting alternative gene structures from spliced ESTs: a computational approach. J Comput Biol 16(1): 43-66 (2009) (“Bonizzoni”).
Comparative analyses exploit homology searches to identify highly conserved exon-intron boundaries. See Lee, C., Wang, Q., Bioinformatics analysis of alternative splicing. Brief Bioinform 6(1): 23-33 (2005) (“Lee and Wang”). Two approaches have been used: inter-genomic or cross species comparisons. See Clark, A. G., Eisen, M. B., Smith, D. R., Bergman, C. M., Oliver, B. et al. Evolution of genes and genomes on the Drosophila phylogeny. Nature 450(7167): 203-218 (2007) (“Clark”). Effectiveness of both approaches is limited by constraints of phylogenetic distance and homologies within databases. Neural networks, Fourier transforms and Markov models have been developed to predict the gene structures. See Lu, D. V., Brown, R. H., Arumugam, M., Brent, M. R., Pairagon: a highly accurate, HMM-based cDNA-to-genome aligner. Bioinformatics 25(13): 1587-1593 (2009) (“Lu”). The statistics programs require a set of parameters, which are often estimated, based on training datasets of well-characterized sequences. See Brent.
Deep sequencing of the human transcriptome makes it possible to identify novel splice sites. See Hartmann, L., Theiss, S., Niederacher, D., et al, Diagnostics of pathogenic splicing mutations: does bioinformatics cover all bases? Front. Biosci. 2008:13:3252-72 (“Hartmann”); Sultan, M., Schulz, M. H., Richard, H., et al., A global view of gene activity and alternative splicing by deep sequencing of the human transcriptome. Science 2008:321(5891):956-60 (“Sultan”). Using polyA capture, RNA-seq. and other methods, Mangone et al. identified large numbers of cis- and trans-alternative splicing isoforms originated from C. elegans 3′ UTR. See Mangone, M., Manoharan, A. P., Thierry-Mieg, D., et al., The landscape of C. elegans 3′ UTRs. Science:329 (5990):432-5 (“Mangone”). Using paired-end RNA sequencing and RNA-seq, surprisingly >23,000 introns have been identified in D. melanogaster. See Soller, M., Pre-messenger RNA processing and its regulation: a genomic perspective. Cell. Mol. Life Sci. 2006:63(7-8):796-819 (“Soller”); Chen, M., Manley, J. L., Mechanisms of alternative splicing regulation: insights from molecular and genomics approaches. Nat. Rev. Mol. Cell. Biol. 2009:10(11):741-54 (“Chen”).
To solve diversity and specificity of pre-mRNA splicing and alternative splicing, exonic and intronic splicing enhancers and silencers have been suggested to be potential candidates of splicing codes. See Fu, X. D., Towards a splicing code. Cell 2004:119(6):736-8 (“Fu”); Matlin, A. J., Clark, F., Smith, C. W., Understanding alternative splicing: towards a cellular code. Nat. Rev. Mol. Cell. Biol. 2005:6(5):386-98 (“Matlin”); Wang, G. S., Cooper, T. A., Splicing in disease: disruption of the splicing code and the decoding machinery. Nat. Rev. Genet. 2007:8(10):749-61 (“Wang”). More recently, Barash et al. used computation methods to assemble several hundreds of RNA features (the “splicing code”) to predict tissue-dependent changes in alternative splicing for thousands of exons. See Barash, Y., Calarco, J. A., Gao, W., et al., Deciphering the splicing code. Nature: 465(7294):53-9 (“Barash”). Although this splicing code model may explain some tissue-dependent alternative splicing, unlike genetic codes, it fails to explain the conundrums of university, diversity, specificity and fidelity of pre-mRNA splicing as does the nature of splice site choice in alternative splicing. See Soller; Chen.
Ever since their discovery about 30 years ago, introns have intrigued the scientific community and stimulated debate about the nature and timing of their origin. See Black; Roy, S. W., Gilbert, W., The evolution of spliceosomal introns: patterns, puzzles and progress. Nat. Rev. Genet. 2006:7(3):211-21 (“Roy I”); Rodriguez-Trelles, F., Tarrio, R., Ayala, F. J., Origins and evolution of spliceosomal introns. Annu. Rev. Genet. 2006:40:47-76 (“Rodriguez-Trelles”). There has also been curiosity about the apparent recent explosion in intron number in mammals and its contribution to expanded protein diversity and regulation through alternative splicing pathways. See Pan, Q., Shai, O., Lee, L. J., et al., Deep surveying of alternative splicing complexity in the human transcriptome by high-throughput sequencing. Nat. Genet. 2008:40(12):1413-5 (“Pan”); Nilsen, T. W., Graveley, B. R., Expansion of the eukaryotic proteome by alternative splicing. Nature:463(7280):457-63 (“Nilsen”). Correct removal of introns from genes has become a central issue in the medical research and biological sciences. However there currently are no known methods to accurately identify the introns, that is, to accurately define exon/intron boundaries.
Many newly-acquired introns in the human genome have been found to share a signature of similar 5′ and 3′ splicing junctions consistent with an origin via DNA duplication or gene duplication. See See Zhuo, D., Madden, R., Elela, S. A., et al., Modern origin of numerous alternatively spliced human introns from tandem arrays. Proc. Nat'l. Acad. Sci. U.S.A. 2007:104(3):882-6 (“Zhuo II”). According to one aspect of the invention, previously-identified introns from a eukaryotic species, which are supported by cDNA/EST data and/or comparative genomics, can be used to identify novel control trans- or cis-elements and to predict novel alternatively spliced mRNA isoforms. Markers are located 150 bp upstream (E5) and 150 bp downstream (I5) nucleotides of 5′ splicing sites, and 150 bp upstream (I3) and 150 bp downstream (E3) nucleotides of 3′ splicing sites. The invention provides for computational and/or experimental and/or diagnostic methods employing the characteristic markers of associated introns and exons.
Specifically, the invention comprises a method for indirectly detecting introns and exons by detecting whether a DNA pre-mRNA sequence contains characteristic markers or splicing codes. Splicing junction databases from a eukaryotic organism are constructed by introns determined by EST/cDNAs and/or comparative genomics from a species. DNA or pre-mRNA samples are compared and searched to have identical or similar sequences in these pre-determined splicing junction databases. If putative splicing junctions are found to be present in these splicing junction databases by pre-determined factors, the presence of these splicing junctions can be verified and characterized by RT-PCR amplifications, RNA-seq, next-generation sequencing, comparative genomics, gel electrophoresis or protein chip technologies. When a putative intron or exon is determined, it is compared to a database which correlates the characterized intron or exon to characterized diseases or genetic mutations. If a given sample is found to comprise introns or exons that are associated with diseases, the novel isoforms of the associated gene can be determined. The polypeptides of the novel isoforms can be deduced based on existing databases and common knowledge. The functions of these polypeptides can be roughly determined by database and computation methods. The isoforms can be further tested to determine the detailed functions. Thus, the methods herein are applicable for predicting disease or genetic mutations, or for searching for novel introns and exons.
In one embodiment, the invention comprises a computerized method of predicting alternative splice sites, comprising:
In another embodiment, the invention comprises a computerized method of constructing an expression vector to enable insertion of mRNA sequences for use in gene therapy to treat a complex disease, comprising:
In another embodiment, the invention comprises a computerized method of identifying splice sites to enable removal of mRNA sequences for use in gene therapy to treat a complex disease, comprising:
In another embodiment, the invention comprises a computerized method of constructing expression vector mRNA constructs without splice sites, comprising:
In another embodiment, the invention comprises a computerized method of treating diabetes by reducing soluble insulin receptors and/or truncated insulin receptors on the cell membrane, comprising:
In another embodiment, the invention comprises a computerized method of detecting cancer by detecting isoforms, comprising:
In another embodiment, the invention comprises a computerized method of predicting novel putative alternative splice sites in a RNA sample from a host, comprising:
In another embodiment, the invention comprises a computerized method of generating primers based on exon sequences, comprising:
In another embodiment, the invention comprises a computerized method of detecting Alzheimer's disease (AD) by detecting isoforms, comprising:
In another embodiment, the invention comprises a computerized method of detecting Parkinson's disease (PD) by detecting isoforms, comprising:
In another embodiment, the invention comprises a computerized method of cloning full-length cDNA, comprising:
In another embodiment, the invention comprises a computerized method of diagnosing and treating Cardiovascular Disease (CD) by detecting and balancing full-length/soluble/truncated receptors, ion channels, transporters and other proteins on the cell membrane, in blood and in cellular and extracellular tissues, comprising:
In another embodiment, the invention comprises a computerized method of diagnosing and treating aging by detecting and balancing full-length/soluble/truncated receptors, ion channels, transporters and other proteins on the cell membrane, in blood and in cellular and extracellular tissues, comprising:
The invention will be described with reference to the accompanying drawings, in which like elements are referenced with like numerals.
FIGS. 1a and 1b depict a schematic model of a nuclear pre-mRNA splicing pathway involving a splicer RNA and proteins.
FIG. 2a provides signatures of typical splice site consensus sequences and human spliceosomal introns (top panel), for intron with E5-I3 LIN≥6 (middle panel) and introns with I5-E3 LIN≥6 (bottom panel).
FIG. 2b provides a schematic drawing of alignment of sequences flanking intron 8 of the human ciz1 gene, specifically human genomic CIZl premessenger nucleotide sequences (SEQ ID NO.: 3); genomic region: 24968-25675 of NM 001131015.1.
FIG. 2c summarizes data of comparison analysis results of human, mouse, chicken, zebrafish and D. melangaster.
FIG. 3a provides a comparison analysis of LIN (length of identical nucleotides) distributions for E5-I3 and I5-E3 alignments analysis of the total human intron dataset. Random sequences are used as a control represented by dashed line.
FIG. 3b provides a comparison analysis of LIN (length of identical nucleotides) distributions for E5-I3 and I5-E3 alignments of the total mouse intron dataset. Random sequences are used as a control represented by dashed line.
FIG. 3c provides a comparison analysis of LIN (length of identical nucleotides) distributions for E5-I3 and I5-E3 alignments of the total zebrafish intron dataset. Random sequences are used as a control represented by dashed line.
FIG. 3d provides a comparison analysis of LIN (length of identical nucleotides) distributions for E5-I3 and I5-E3 alignments of the total chicken intron dataset. Random sequences are used as a control represented by dashed line.
FIG. 3e provides a comparison analysis of LIN (length of identical nucleotides) distributions for E5-I3 and I5-E3 alignments of the total C. elegans intron dataset. Random sequences are used as a control represented by dashed line.
FIG. 3f provides a comparison analysis of LIN (length of identical nucleotides) distributions for E5-I3 and I5-E3 alignments of the total D. melanogaster intron dataset. Random sequences are used as a control represented by dashed line.
FIG. 4a provides a plot of the distributions of the E5 hexamers (from positions −1 to −6) for the total human intron.
FIG. 4b provides a plot of the distributions of the I5 hexamers (from positions −1 to −6) for the total human intron.
FIG. 4c provides a plot of the distributions of the I3 hexamers (from positions −1 to −6) for the total human intron.
FIG. 4d provides a plot of the distributions of the E3 hexamers (from positions −1 to −6) for the total human intron.
FIG. 4e provides plots of the distributions of hexamers overlayed for E5 and I3 which are adjacent to the 5′ and 3′ splice sites for the LIN≥6 datasets. FIG. 4f provides plots of the distributions of hexamers overlayed for I5 and E3 which are adjacent to the 5′ and 3′ splice sites for the LIN≥6 datasets.
FIG. 4g provides plots of the distributions of hexamers overlayed for E5 and I3 which are adjacent to the 5′ and 3′ splice sites for the LIN≥6 dataset. FIG. 4h provides plots of the distributions of hexamers overlayed for I5 and E3 which are adjacent to the 5′ and 3′ splice sites for the LIN≥6 dataset.
FIG. 5a provides the distribution of total E5 hexamers ending with CAG in FIG. 4a.
FIG. 5b provides a plot of the distribution of E5 hexamers of E5-I3 LIN≥6 ending with CAG in FIG. 4a.
FIG. 5c provides a plot of the distribution of E5 hexamers of LIN≥6 for I5-E3 ending with CAG in FIG. 4f.
FIGS. 6a-6l provide plots of the distribution of the hexamers from the human introns after removing the last and first three nucleotides adjacent the 5′ and 3′ splice sites (namely, from positions −1 to −3 of E5 and I3, and from +1 to +3 of I5 and E3). Hexamers for the total intron dataset are shown for E5 in FIG. 6a; for E3 in FIG. 6b; for I3 in FIG. 6c; and for I5 in FIG. 6d. Hexamers for the E5-I3 LIN≥3 dataset are shown for E5 in FIG. 6e; for E3 in FIG. 6f; for I3 in FIG. 6g; and for I5 in FIG. 6h. Hexamers for the I5-E3 LIN≥3 dataset are shown for E5 in FIG. 6i; for E3 in FIG. 6j; for I3 in FIG. 6k; and for I5 in FIG. 6l.
FIG. 7a depicts a schema of predicating potential alternative splicing sites.
FIG. 7b depicts the relationship between predicted putative alternative splice sites and lengths of E5 and I3 sequences. The number of PPASSs predicted when the numbers of I3 sequences are fixed at 9 bp are shown, along with the number of PPASSs using a fixed 9 bp of E5 sequences plus the first intronic dinucleotide-the last 9 bp intronic sequences. The insert of FIG. 7b depicts ratios between the number of PPASSs at n+1 and those at n of E5 and I3 sequences, respectively.
FIG. 7c depicts RT-PCR verification of PPASSs identified using a fixed 9 bp of E5 sequences plus the first intronic dinucleotide-the last 9 bp intronic sequences in FIG. 7b. M is DNA markers. CK is negative control.
FIG. 8 depicts schematic diagrams of experimentally verified alternatively expressed isoforms shown in FIG. 7c. Protein-coding and none-coding exon sequences are represented. The lines depict intronic sequences.
FIGS. 9a-9c depicts Western blot analysis of various mouse tissues.
FIG. 9a is a schematic diagram of the mouse insulin receptor (insr) gene. The arrows represent epitopes of the antibodies 4B8 and sc-711, respectively.
FIG. 9b depicts a Western blot analysis of protein lysates from brain, heart, liver, lung, gastrocnemius muscle, seleus muscle and white fat using antibody 4b8. The minor bands are consistent with proteins predicted by the mouse splicing code table.
FIG. 9c depicts a Western blot analysis of protein lysates from brain, heart, liver, lung, gastrocnemius muscle, seleus muscle and white fat using antibody sc-711. The differences between two Western blot (FIG. 9b vs. FIG. 9c) analysis show reflection of shorter isoforms predicted by the mouse splicing code table.
FIG. 10A and B depict the sequence results of the cloned PCR products in FIG. 7c, which are amplified on pooled cDNAs from various mouse tissues using primers described in Tables 12a & 12b. specifically. seven sequences: (1) 8-175, 176-285, 286-448, 449-458 of sf1 F1R3 that correspond to 115778-115945, 117391-117500, 117683-117845 and 119118-119207 of NM_010568 genomic sequences; (2) 1-15 and 16-953 of isf2F1R12 that correspond to 119320-119335 and 119342-118399 of NM_010568 genomic sequences; (3) 565-699. 698-908, 909-919 and 920-930 of isf3FR2 that correspond to 1 17709-117843, 117843, 119598-119808, 125748-125758 and 119790-119800 of NM_010568 genomic sequences: L4)367-501 and 500-710 of isf4F3 that correspond to 117709-117843 and 119598-119808 of NM_010568 genomic sequences: (5) 8-110, 109-242, 240-316, 311-332 and 333-343 of ist9FR2 that correspond to 117741-117843, 1195898-119731, 120351-120351-120427, 125274-125295 and 125577-125588 of NM_010568 genomic sequences: (6) 21-149 and 186-294 of isfl0FR3 that correspond to 124467-124595 and 124642-124750 of NM_010568 genomic sequences; and (7) 1-7 and 8-1-8 of isf1 1FR1 that correspond to 12054-120551 and 125214-126201 of NM_010568 genomic sequences.
FIG. 11 depicts results of “splice site walking” on total RNAs isolated from brain, intestine, kidney, uterus, heart, spleen, white fat, soleus muscle, gastrocnemius muscle, liver, hepatoma, hepatocyte, pancreas islet, c2c12 and lung, and specifically shows the presence of minor PCR products in some mouse tissues in addition to the major isoforms.
FIG. 12 depicts how different insulin receptor isoforms outside cell membranes and on the plasma membranes regulate insulin concentrations.
The inventor previously found many newly-acquired introns in the human genome have been found to share a signature of identical 5′ and 3′ splicing junctions consistent with an origin via DNA duplication. See Zhuo II. Therein, he proposed that 5′ exonic sequence and 3′ intronic sequence constitute spliceosomal splicing codes, which are deciphered by yet uncharacterized splicer-RNAs or splicer proteins as described in FIGS. 1a and 1b.
FIG. 1a depicts 5′ and 3′ exon sequences and a core spliceosome, including the intron and putative splicer RNA sequences. The circled A represents the branchpoint adenosine, and gu and ag represent the nucleotides typically present at the 5′ and 3′ ends of introns, respectively. The vertical lines represent base-pairing between the putative splicer RNA and pre-mRNA (although these two cis-elements in a splicer RNA are not expected to be identical). The last nucleotide of the 5′ exon and the last two nucleotides of the intron may lack perfect complementarity. See Wu, S., Romfo, C. M., Nilsen, T. W., et al., Functional recognition of the 3′ splice site AG by the splicing factor U2AF35. Nature 1999:402(6763):832-5 (“Wu”). For simplicity, a single splicer RNA has been shown, although the model is compatible with two RNAs (recognizing the 5′ exon and 3′ intron, respectively) in conjunction with other spliceosomal components. This model is conceptually similar to that first proposed by Holliday and Murray. See Holliday, R., Murray, V., Specificity in splicing. Bioessays 1994:16(10):771-4 (“Holliday”); Murray, V., Holliday, R., Mechanism for RNA splicing of gene transcripts. FEBS Lett. 1979:106(1):5-7 (“Murray”).
FIG. 1b depicts a schematic model of E5 and I3 sequences recognized by as yet uncharacterized proteins, including 5′ and 3′ exon sequences and a core spliceosome. The black line represents the intron. The circled A is the branchpoint adenosine, and gu and ag represent the nucleotides typically present at the 5′ and 3′ ends of introns, respectively. The E5 interacts in a sequence-specific manner with an as yet uncharacterized protein and I3 is recognized by a different unknown protein. These two proteins interact with each other to assist in bringing together the 5′ and 3′ splice sites.
Based on this concept, a method of identifying putative alternative splice sites has been developed. According to one aspect of the invention, mammalian genes to identify novel control trans- or cis-elements and to predict novel alternatively spliced mRNA isoforms are accurately predicted and annotated. Markers are located 150 bp upstream (E5) and 150 bp downstream (I5) nucleotides of 5′ splicing sites, and 150 bp upstream (I3) and 150 bp downstream (E3) nucleotides of 3′ splicing sites. The invention provides for diagnostic methods employing the characteristic markers of associated introns and exons.
The invention comprises a method for indirectly detecting introns and exons through analysis of correlating splice junctions. Samples are analyzed for the presence of characterized splicing junctions via bioinformatics, genomics, comparative genomics, RT-PCR, gel electrophoresis, DNA/RNA chips, RNA-seq next generation sequencing or protein chip technologies. If a given sample is found to contain a known splicing junction, the sample is analyzed for the presence of known introns or exons. Novel isoforms mRNAs can be generated and can be translated into proteins. When a characterized intron or exon is verified and characterized, it is compared to a database which correlates the characterized intron or exon to characterized diseases or genetic mutations. If these proteins are over-expressed or expressed at extremely low levels relatively to dominant forms, they will disrupt the balances of these isoforms which results in disease. For example, over-expressed soluble insulin receptor proteins, which are secreted into the blood or tissues or outside the cell membranes, can directly bind to incoming insulin and therefore result in reduced level of insulin entering into cells. This is the best way to explain the insulin resistance or insulin insensitivity. Therefore, the cells cannot metabolize the intake of sugar and cause the human body to display insulin resistance. On other hand, if the soluble isoforms proteins are expressed at very low level and proteins with dominate tyrosine kinase are expressed at higher level, the cells will eventually overgrow and cause cancers. If a given sample is found to contain a known splicing junction, but not known introns or exons, the presence of novel introns or exons is likely and can be determined. Thus, the methods herein are applicable for predicting disease or genetic mutations, or for searching for novel introns and exons.
FIGS. 2a-2c provide signatures of typical splice site consensus sequences and human spliceosomal introns (top panel), for intron with E5-I3 LIN≥6 (middle panel) and introns with I5-E3 LIN≥6 (bottom panel). The graphics were generated by Pictogram (genes.mit.edu/pictogram.html). The splice junctions are located between the nucleotide positions −1 and +1.
Recently-acquired human spliceosomal introns have been shown to have signatures of similar 5′ and 3′ splice sites. See Zhuo II. FIG. 2a provides a plot of consensus sequences of 5′ and 3′ splice sites from the total human intron dataset (top panel), for E5-I3 with LIN≥6 (middle panel) and I5-E3 with LIN≥6 (bottom panel). The sequence below E5-I5 shows the 5′ splice site recognition motif of U1 snRNA. The signatures of such introns are 5′ and 3′ intron boundaries that are very similar to each other (FIG. 2a, middle and bottom panels) and that do not conform well to the typical splice site consensus sequences (FIG. 2a, top panel). Each splice junction is divided into its exonic and intronic portions (designated as E5 and I5 for the 5′ splice site and I3 and E3 for the 3′ splice site, respectively). The lengths of identical nucleotides (LIN) have been scored in an uninterrupted stretch independently for the E5-I3 and I5-E3 alignments, respectively.
FIG. 2b provides an example of E5-I3 and I5-E3 alignments for intron 8 (168 bp) of the human ciz1 gene. The italic uppercase letters represent the 5′ and 3′ exonic sequences at splice sites, respectively, and the italic lowercase letters indicate the 5′ and 3′ intronic sequences. The vertical lines indicate uninterrupted identical nucleotides extending from the splice junctions for the E5-I3 and I5-E3 alignments, and are designated as LIN (length of identical nucleotides). Asterisks represent identical nucleotides outside of this region.
FIG. 2b provides a specific example showing the sequences flanking intron 8 of the human ciz1 gene, which encodes Cip1-interacting zinc finger protein 1. This was done for human introns as well as those for other vertebrates (mouse, zebrafish and chicken) (FIG. 2c) and the invertebrates C. elegans and D. melanogaster (FIG. 3e). As seen in FIG. 2c, the percentage of E5-I3 alignments with LIN≥6 is significantly higher (p<0.001) than for I5-E3 in humans (by 3-fold), in other vertebrates (by 2.4 to 5.3 fold) and in the invertebrate D. melanogaster (by 4.5 fold). In C. elegans, whose genome is believed to contain relatively few recently-gained introns, there is a 14-fold excess of E5-I3, driven in part by a low frequency of I5-E3 with LIN≥6 (compared to vertebrates). See Coghlan, A., Wolfe, K. H., Origins of recently gained introns in Caenorhabditis. Proc. Nat'l. Acad. Sci. U.S.A. 2004:101(31):11362-7 (“Coghlan II”).
FIG. 2c provides sizes of animal intron datasets, and proportion with LIN≥6, also expressed as the ratio between E5-I3 and I5-E3. All observed differences between E5-I3 and I5-E3 were statistically significant (p<0.001).
FIGS. 3a-3f provide plots of the frequencies of distributions of E5-I3 and I5-E3 alignments for the full range of LIN from 0 to ≥20 for human, mouse, zebrafish, chicken, C. elegans and D. melanogaster. The data are set forth below in Tables 1-6. Table 1 presents comparative analysis of human E5-I3 and I5-E3 alignments. Probabilities reflect the random chance of differences between E5-I3 and I5-E3 proportions as judged by U-tests. One and two asterisks represent statistical significances at 0.05 and 0.001 levels, respectively.
| TABLE 1 |
| Human |
| LIN | E5-I3 | I5-E3 | E5-I3/I5-E3 | Probabilities (p) | |
| 0 | 44654 | 121410 | 0.37 | <0.001** | |
| 1 | 59395 | 72673 | 0.82 | <0.001** | |
| 2 | 87690 | 29250 | 3.00 | <0.001** | |
| 3 | 31020 | 8102 | 3.83 | <0.001** | |
| 4 | 8170 | 2290 | 3.57 | <0.001** | |
| 5 | 2438 | 504 | 4.84 | <0.001** | |
| 6 | 780 | 150 | 5.20 | <0.001** | |
| 7 | 243 | 64 | 3.80 | <0.001** | |
| 8 | 75 | 30 | 2.50 | <0.001** | |
| 9 | 33 | 18 | 1.83 | <0.05 & >0.02 | |
| 10 | 15 | 14 | 1.07 | >0.5 | |
| 11 | 7 | 12 | 0.58 | <0.5 & >0.2 | |
| 12 | 9 | 10 | 0.90 | >0.5 | |
| 13 | 11 | 9 | 1.22 | >0.5 | |
| 14 | 15 | 5 | 3.00 | <0.05 & >0.02 | |
| 15 | 6 | 5 | 1.20 | >0.5 | |
| 16 | 1 | 6 | 0.17 | <0.1 & >0.05 | |
| 17 | 2 | 4 | 0.50 | <0.5 & >0.2 | |
| 18 | 8 | 2 | 4.00 | <0.1 & >0.05 | |
| 19 | 4 | 2 | 2.00 | <0.5 & >0.2 | |
| ≥20 | 67 | 83 | 0.81 | <0.2 & >0.1 | |
Table 2 presents comparative analysis of mouse E5-I3 and I5-E3 alignments. Probabilities reflect the chances of differences between E5-I3 and I5-E3 proportions by U-tests. One and two asterisks represent statistical significances at 0.05 and 0.001 levels, respectively.
| TABLE 2 |
| Mouse |
| E5-I3/ | ||||
| LIN | E5-I3 | I5-E3 | I5-E3 | Probabilities (p) |
| 0 | 50374 | 130138 | 0.4 | <0.001** |
| 1 | 62590 | 76584 | 0.8 | <0.001** |
| 2 | 92948 | 31844 | 2.9 | <0.001** |
| 3 | 32172 | 8164 | 3.9 | <0.001** |
| 4 | 8214 | 2259 | 3.6 | <0.001** |
| 5 | 2478 | 555 | 4.5 | <0.001** |
| 6 | 726 | 189 | 3.8 | <0.001** |
| 7 | 231 | 79 | 2.9 | <0.001** |
| 8 | 92 | 45 | 2.0 | <0.001** |
| 9 | 43 | 29 | 1.5 | <0.1 & >0.05 |
| 10 | 28 | 24 | 1.2 | >0.5 |
| 11 | 19 | 14 | 1.4 | <0.5 & >0.2 |
| 12 | 24 | 10 | 2.4 | <0.02 & 0.01* |
| 13 | 16 | 9 | 1.8 | <0.2 & >0.1 |
| 14 | 6 | 12 | 0.5 | <0.2 & >0.1 |
| 15 | 10 | 9 | 1.1 | >0.5 |
| 16 | 11 | 6 | 1.8 | <0.5 & >0.2 |
| 17 | 9 | 7 | 1.3 | >0.5 |
| 18 | 4 | 8 | 0.5 | <0.5 & >0.2 |
| 19 | 6 | 11 | 0.5 | <0.5 & >0.2 |
| ≥20 | 94 | 99 | 0.9 | >0.5 |
Table 3 presents comparative analysis of zebrafish E5-I3 and I5-E3 alignments. Probabilities reflect the chances of differences between E5-I3 and I5-E3 proportions by U-tests. One and two asterisks represent statistical significances at 0.05 and 0.001 levels, respectively.
| TABLE 3 |
| Zebrafish |
| E5-I3/ | ||||
| LIN | E5-I3 | I5-E3 | I5-E3 | Propabilties (p) |
| 0 | 56829 | 120429 | 0.5 | <0.001** |
| 1 | 53399 | 60571 | 0.9 | <0.001** |
| 2 | 74414 | 28975 | 2.6 | <0.001** |
| 3 | 25713 | 6933 | 3.7 | <0.001** |
| 4 | 6296 | 2028 | 3.1 | <0.001** |
| 5 | 2120 | 498 | 4.3 | <0.001** |
| 6 | 646 | 152 | 4.3 | <0.001** |
| 7 | 175 | 28 | 6.3 | <0.001** |
| 8 | 44 | 15 | 2.9 | <0.001** |
| 9 | 20 | 5 | 4.0 | <0.005 & |
| >0.002** | ||||
| 10 | 7 | 6 | 1.2 | >0.5 |
| 11 | 7 | 0.0 | <0.5 & >0.2 | |
| 12 | 1 | 21 | 0.0 | <0.001** |
| 13 | 6 | 7 | 0.9 | >0.5 |
| 14 | 4 | 2 | 2.0 | <0.5 & >0.2 |
| 15 | 1 | 1 | 1.0 | >0.5 |
| 16 | 5 | 1 | 5.0 | <0.1 & >0.05 |
| 17 | 1 | 3 | 0.3 | <0.5 & >0.2 |
| 18 | 6 | 5 | 1.2 | >0.5 |
| 19 | 1 | 1 | 1.0 | >0.5 |
| ≥20 | 32 | 32 | 1.0 | >0.5 |
Table 4 presents comparative analysis of chicken E5-I3 and I5-E3 alignments. Probabilities reflect the chances of differences between E5-I3 and I5-E3 proportions by U-tests. One and two asterisks represent statistical significances at 0.05 and 0.001 levels, respectively.
| TABLE 4 |
| Chicken |
| E5-I3/ | |||||
| LIN | E5-I3 | I5-E3 | I5-E3 | Probabilities (p) | |
| 0 | 42496 | 90642 | 0.5 | <0.001** | |
| 1 | 41048 | 47333 | 0.9 | <0.001** | |
| 2 | 56186 | 20243 | 2.8 | <0.001** | |
| 3 | 18761 | 5287 | 3.5 | <0.001** | |
| 4 | 4814 | 1430 | 3.4 | <0.001** | |
| 5 | 1471 | 305 | 4.8 | <0.001** | |
| 6 | 421 | 65 | 6.5 | <0.001** | |
| 7 | 102 | 20 | 5.1 | <0.001** | |
| 8 | 30 | 9 | 3.3 | <0.001** | |
| 9 | 6 | 3 | 2.0 | <0.5 & >0.2 | |
| 10 | 3 | 3 | 1.0 | >0.5 | |
| 11 | 2 | <0.2 & >0.1 | |||
| 12 | |||||
| 13 | 1 | <0.5 & >0.2 | |||
| 14 | |||||
| 15 | |||||
| 16 | |||||
| 17 | |||||
| 18 | 1 | 0.0 | <0.5 & >0.2 | ||
| 19 | |||||
| ≥20 | 6 | 6 | 1.0 | >0.5 | |
Table 5 presents comparative analysis of C. elegans E5-I3 and I5-E3 alignments. Probabilities reflect the chances of differences between E5-I3 and I5-E3 proportions by U-tests. One and two asterisks represent statistical significances at 0.05 and 0.001 levels, respectively.
| TABLE 5 |
| C. elegans |
| E5-I3/ | |||||
| LIN | E5-I3 | I5-E3 | I5-E3 | Probabilties (p) | |
| 0 | 38200 | 64331 | 0.6 | <0.001** | |
| 1 | 22059 | 15756 | 1.4 | <0.001** | |
| 2 | 20604 | 6486 | 3.2 | <0.001** | |
| 3 | 5609 | 1696 | 3.3 | <0.001** | |
| 4 | 1303 | 450 | 2.9 | <0.001** | |
| 5 | 701 | 87 | 8.1 | <0.001** | |
| 6 | 241 | 17 | 14.2 | <0.001** | |
| 7 | 80 | 4 | 20.0 | <0.001** | |
| 8 | 20 | 2 | 10.0 | <0.001** | |
| 9 | 10 | <0.002 & | |||
| >0.001** | |||||
| 10 | 4 | 2 | 2.0 | <0.5 & >0.2 | |
| 11 | 1 | <0.5 & >0.2 | |||
| 12 | |||||
| 13 | |||||
| 14 | |||||
| 15 | |||||
| 16 | |||||
| 17 | |||||
| 18 | |||||
| 19 | |||||
| ≥20 | 1 | 0.0 | <0.5 & >0.2 | ||
Table 6 presents comparative analysis of D. melanogaster E5-I3 and I5-E3 alignments. Probabilities reflect the chances of differences between E5-I3 and I5-E3 proportions by U-tests. One and two asterisks represent statistical significances at 0.05 and 0.001 levels, respectively.
| TABLE 6 |
| D. melanogaster |
| E5-I3/ | |||||
| LIN | E5-I3 | I5-E3 | I5-E3 | Probabilties (p) | |
| 0 | 17183 | 32954 | 0.5 | <0.001** | |
| 1 | 14137 | 9204 | 1.5 | <0.001** | |
| 2 | 11321 | 3781 | 3.0 | <0.001** | |
| 3 | 3347 | 890 | 3.8 | <0.001** | |
| 4 | 807 | 265 | 3.0 | <0.001** | |
| 5 | 270 | 55 | 4.9 | <0.001** | |
| 6 | 80 | 15 | 5.3 | <0.001** | |
| 7 | 23 | 5 | 4.6 | <0.001** | |
| 8 | 4 | 2 | 2.0 | <0.5 & >0.2 | |
| 9 | 2 | 1 | 2.0 | >0.5 | |
| 10 | 1 | 0.0 | <0.5 & >0.2 | ||
| 11 | |||||
| 12 | |||||
| 13 | |||||
| 14 | |||||
| 15 | |||||
| 16 | |||||
| 17 | |||||
| 18 | |||||
| 19 | |||||
| ≥20 | 1 | 0.0 | <0.5 & >0.2 | ||
The arrows of FIGS. 3a-3f delimit the windows for which there are a significantly higher value observed for E5-I3 than for I5-E3, as judged by U-test with p<0.001. The values for all vertebrates were significantly higher than for random sequences (FIGS. 3a-d). For large LIN (≥10 for human and C. elegans, ≥8 for D. melanogaster and ≥9 for the others), no significant difference was seen between E5-I3 and I5-E3 at distances that are more than 10 nt away from the splice junctions. For LIN between 2 and 9 in C. elegans, there is a very marked excess of E5-I3 relative to I5-E3 (FIG. 3e), whereas D. melanogaster shows a more vertebrate-like profile (FIG. 3e). For the invertebrates, the virtually complete absence of introns with long LINs is consistent with few recent intron gains. See Coghlan; Banyai, L., Patthy, L., Evidence that human genes of modular proteins have retained significantly more ancestral introns than their fly or worm orthologues. FEBS Lett. 2004:565(1-3):127-32 (“Coghlan I”).
The E5-I3 and I5-E3 alignments were also compared to scramble (mix-and-match) data produced by randomly aligning E5 with I3, and I5 with E3, from a non-redundant intron dataset. A statistically significant difference was seen in all cases as set forth below in Tables 7 and 8 for human and C. elegans.
Tables 7a and 7b present comparative analysis of human E5-I3 and their scrambles (SC5) with I3 and E5 randomly selected from non-redundant human introns and I5-E3 and their scrambles (SC3) with randomly selected E3 and I5. One and two asterisks represent statistical significances at 0.05 and 0.001 levels, respectively.
| TABLE 7a |
| Human |
| E5-I3/ | ||||
| LINs | E5-I3 | SC5 | SC5 | Probabilities (p) |
| 0 | 44655 | 68328 | −34.65 | <0.001** |
| 1 | 59396 | 69024 | −13.95 | <0.001** |
| 2 | 87690 | 69549 | 26.08 | <0.001** |
| 3 | 31022 | 20672 | 50.07 | <0.001** |
| 4 | 8170 | 5196 | 57.24 | <0.001** |
| 5 | 2438 | 1384 | 76.16 | <0.001** |
| 6 | 780 | 356 | 119 | <0.001** |
| 7 | 243 | 95 | 156 | <0.001** |
| 8 | 75 | 27 | 178 | <0.001** |
| 9 | 33 | 10 | 230 | <0.001** |
| 10 | 15 | 6 | 150 | >0.05 & <0.02* |
| 11 | 7 | <0.01 & >0.005** | ||
| 12 | 9 | <0.005 & | ||
| >0.002** | ||||
| 13 | 11 | <0.001** | ||
| 14 | 15 | <0.001** | ||
| 15 | 6 | <0.02 & >0.01* | ||
| 16 | 1 | <0.5 & >0.2 | ||
| 17 | 2 | <0.2 & >0.1 | ||
| 18 | 8 | <0.005 & | ||
| >0.001** | ||||
| 19 | 4 | >0.05 & <0.2 | ||
| ≥20 | 67 | <0.001** | ||
| TABLE 7b |
| Human |
| E5-I3/ | |||||
| LINs | I5-E3 | SC3 | SC3 | Probabilties (p) | |
| 0 | 121411 | 120692 | 0.6 | >0.05 & <0.02* | |
| 1 | 72674 | 73436 | −1.04 | >0.01 & <0.02* | |
| 2 | 29251 | 30344 | −3.6 | <0.001** | |
| 3 | 8103 | 7645 | 5.99 | <0.001** | |
| 4 | 2290 | 1990 | 15.08 | <0.001** | |
| 5 | 504 | 415 | 21.45 | >0.005 & | |
| <0.002** | |||||
| 6 | 150 | 88 | 70.45 | <0.001** | |
| 7 | 64 | 26 | 146.15 | <0.001** | |
| 8 | 30 | 6 | 400 | <0.001** | |
| 9 | 18 | 5 | 260 | <0.01 & >0.005** | |
| 10 | 14 | <0.001** | |||
| 11 | 12 | <0.001** | |||
| 12 | 10 | <0.002 & | |||
| >0.001** | |||||
| 13 | 9 | <0.002 & | |||
| >0.001** | |||||
| 14 | 5 | <0.05 & >0.02* | |||
| 15 | 5 | <0.05 & >0.02* | |||
| 16 | 6 | <0.02 & >0.01* | |||
| 17 | 4 | <0.05 & >0.02* | |||
| 18 | 2 | <0.2 & >0.1 | |||
| 19 | 2 | <0.2 & >0.1 | |||
| ≥20 | 83 | <0.001** | |||
Tables 8a and 8b present comparative analyses of C. elegans E5-I3 and their scrambles (SC5) with I3 and E5 randomly selected from non-redundant C. elegans introns and I5-E3 and their scrambles (SC3) with randomly selected E3 and I5. One and two asterisks represent statistical significances at 0.05 and 0.001 levels, respectively.
| TABLE 8a |
| C. elegans |
| E5-I3/ | |||||
| LINs | E5-I3 | SC5 | SC5 | Probabilities (p) | |
| 0 | 38200 | 44445 | −14.1 | <0.001** | |
| 1 | 22059 | 22461 | −1.8 | <0.05 & >0.02* | |
| 2 | 20604 | 16231 | 27 | <0.001** | |
| 3 | 5609 | 4128 | 36 | <0.001** | |
| 4 | 1303 | 959 | 36 | <0.001** | |
| 5 | 701 | 402 | 74 | <0.001** | |
| 6 | 241 | 128 | 88 | <0.001** | |
| 7 | 80 | 56 | 43 | <0.05 & >0.02* | |
| 8 | 20 | 14 | 43 | <0.2 & >0.1 | |
| 9 | 10 | 6 | 67 | <0.2 & >0.1 | |
| 10 | 4 | 2 | 100 | <0.2 & >0.1 | |
| 11 | 1 | <0.2 & >0.1 | |||
| 12 | |||||
| 13 | |||||
| 14 | |||||
| 15 | |||||
| 16 | |||||
| 17 | |||||
| 18 | |||||
| 19 | |||||
| ≥20 | |||||
| TABLE 8b |
| C. elegans |
| E5-I3/ | |||||
| LINs | I5-E3 | SC3 | SC3 | Probabilities (p) | |
| 0 | 64331 | 62969 | 2.2 | <0.001** | |
| 1 | 15756 | 16332 | −3.5 | <0.001** | |
| 2 | 6486 | 7155 | −9.4 | <0.001** | |
| 3 | 1696 | 1759 | −3.6 | <0.2 & >0.1 | |
| 4 | 450 | 526 | −14 | <0.02 & >0.01* | |
| 5 | 87 | 64 | 36 | <0.1 & >0.05 | |
| 6 | 17 | 21 | −19 | >0.5 | |
| 7 | 4 | 5 | −20 | >0.5 | |
| 8 | 2 | 1 | 100 | >0.5 | |
| 9 | |||||
| 10 | 2 | <0.2 & >0.1 | |||
| 11 | |||||
| 12 | |||||
| 13 | |||||
| 14 | |||||
| 15 | |||||
| 16 | |||||
| 17 | |||||
| 18 | |||||
| 19 | |||||
| ≥20 | 1 | >0.5 | |||
Because it is known that U1 snRNA, in addition to base-pairing with sequences at the 5′ end of the intron, also imposes a strong constraint on the terminal AG of the upstream exon (within E5), as does the binding of U2AF35 to the cAG region at the 3′ end of the intron (within I3), this analysis was repeated omitting the sequences located at positions −3 to +3 of both the 5′ and 3′ splice sites. See Carmel, I., Tal, S., Vig, I., et al., Comparative analysis detects dependencies among the 5′ splice-site positions. RNA 2004:10(5):828-40 (“Carmel”); Wu. As shown in Table 9 below, the frequencies of LINs with values ≥1 and ≥5 for human E5-I3 and I5-E3 were significantly higher (p<0.05) than those of the corresponding scrambles.
Tables 9a and 9b present comparative analyses of human E5-I3 and their scrambles (SC5) with I3 and E5 randomly selected from non-redundant human introns and I5-E3 and their scrambles (SC3) with randomly selected E3 and I5 after removing the last and first three nucleotides adjacent the 5′ and 3′ splice sites (namely, from positions −1 to −6 and from +1 to +6) of E5, E3, I3 and I5. One and two asterisks represent statistical significances at 0.05 and 0.001 levels, respectively.
| TABLE 9a |
| Human |
| E5-I3 |
| LINs | E5-I3 | SC5 | E5-13/SC5 | Probabilities (p) | |
| 0 | 172558 | 175984 | −0.02 | <0.001** | |
| 1 | 44258 | 42841 | 0.03 | <0.001** | |
| 2 | 12700 | 11672 | 0.09 | <0.001** | |
| 3 | 3586 | 3040 | 0.18 | <0.001** | |
| 4 | 999 | 790 | 0.26 | <0.001** | |
| 5 | 282 | 238 | 0.18 | >0.05 & <0.02* | |
| 6 | 84 | 66 | 0.27 | <0.2 & <0.1 | |
| 7 | 35 | 11 | 2.18 | <0.001** | |
| 8 | 13 | 4 | 2.25 | <0.05 & >0.02* | |
| 9 | 11 | 3 | 2.67 | <0.05 & >0.02* | |
| 10 | 15 | 1 | 14.00 | <0.001** | |
| 11 | 16 | <0.001** | |||
| 12 | 6 | <0.02 & >0.01* | |||
| 13 | 1 | <0.5 & >0.2 | |||
| 14 | 3 | >0.1 & >0.05 | |||
| ≥15 | 83 | <0.001** | |||
| TABLE 9b |
| Human |
| I5-E3 |
| LINs | I5-E3 | SC3 | E5-I3/SC3 | Probabilities (p) |
| 0 | 175253 | 176744 | −0.84 | <0.001** |
| 1 | 44840 | 44150 | 1.56 | <0.02 & >0.01* |
| 2 | 10675 | 10508 | 1.59 | >0.2 & <0.5 |
| 3 | 2648 | 2381 | 11.21 | <0.001** |
| 4 | 761 | 649 | 17.26 | <0.005 & >0.002** |
| 5 | 215 | 156 | 37.82 | <0.005 & >0.001** |
| 6 | 67 | 46 | 45.65 | <0.02 & >0.01* |
| 7 | 30 | 12 | 150.00 | <0.01 & >0.005** |
| 8 | 23 | 3 | 666.67 | <0.001** |
| 9 | 14 | 1 | 1300.00 | <0.001** |
| 10 | 11 | <0.001** | ||
| 11 | 5 | <0.02 & >0.01* | ||
| 12 | 6 | <0.02 & >0.01* | ||
| 13 | 6 | <0.02 & >0.01* | ||
| 14 | 4 | <0.02 & >0.01* | ||
| ≥15 | 93 | <0.001** | ||
No statistical differences were observed for I5-E3 as seen in Table 10, consistent with the profiles shown in FIG. 3e.
Tables 10a and 10b present comparative analyses of C. elegans E5-I3 and their scrambles (SC5) with I3 and E5 randomly selected from non-redundant C. elegans introns and I5-E3 and their scrambles (SC3) with randomly selected E3 and I5 after removing the last and first three nucleotides adjacent the 5′ and 3′ splice sites (namely, from positions −1 to −6 and from +1 to +6) of E5, E3, I3 and I5. One and two asterisks represent statistical significances at 0.05 and 0.001 levels, respectively.
| TABLE 10a |
| C. elegans |
| I5-E3 |
| LINs | I5-E3 | SC3 | E5-I3/SC3 | Probabilities (p) |
| 0 | 64795 | 65057 | −0.40 | >0.05 & <0.1 |
| 1 | 19528 | 19489 | 0.20 | >0.5 |
| 2 | 3321 | 3211 | 3.43 | >0.05 & <0.1 |
| 3 | 849 | 800 | 6.13 | >0.5 & >0.2 |
| 4 | 248 | 212 | 16.98 | >0.05 & <0.1 |
| 5 | 61 | 43 | 41.86 | >0.05 & <0.1 |
| 6 | 19 | 17 | 11.76 | >0.5 |
| 7 | 8 | 2 | 300.00 | >0.05 & <0.1 |
| 8 | 2 | 1 | 100.00 | >0.5 |
| 9 | ||||
| 10 | ||||
| 11 | ||||
| 12 | ||||
| 13 | ||||
| 14 | ||||
| ≥15 | 1 | >0.2 & <0.5 | ||
| TABLE 10b |
| C. elegans |
| I5-E3 |
| LINs | I5-E3 | SC3 | E5-I3/SC3 | Probabilities (p) |
| 0 | 64795 | 65057 | −0.40 | >0.05 & <0.1 |
| 1 | 19528 | 19489 | 0.20 | >0.5 |
| 2 | 3321 | 3211 | 3.43 | >0.05 & <0.1 |
| 3 | 849 | 800 | 6.13 | >0.5 & >0.2 |
| 4 | 248 | 212 | 16.98 | >0.05 & <0.1 |
| 5 | 61 | 43 | 41.86 | >0.05 & <0.1 |
| 6 | 19 | 17 | 11.76 | >0.5 |
| 7 | 8 | 2 | 300.00 | >0.05 & <0.1 |
| 8 | 2 | 1 | 100.00 | >0.5 |
| 9 | ||||
| 10 | ||||
| 11 | ||||
| 12 | ||||
| 13 | ||||
| 14 | ||||
| ≥15 | 1 | >0.2 & <0.5 | ||
The E5-I3 values for the LIN≥3 (and therefore comparable to LIN≥6 in FIG. 1c) are still significantly higher (p<0.001) than those for I5-E3 by about 0.3-fold for human introns and about 2.7-fold higher in the case of C. elegans.
The distributions of hexamers which are adjacent to the 5′ and 3′ splice sites (from positions −1 to −6 and from +1 to +6) for each of E5, I5, I3 and E3 for the total human intron set are plotted in FIGS. 4a-4d. The distributions for the LIN≥6 subset for E5 are plotted in FIGS. 4e-4f and for E3 in FIGS. 4g-4h. For the total set (FIGS. 3a-d), the distribution of exon hexamers (E3) located immediately downstream of introns is much broader than for those upstream (E5) (FIG. 4b vs. FIG. 4a). This uneven distribution of E5 for the I5-E3 with LIN≥6 dataset is supported by an E5 variance (σ2) which is 50% larger than E3 variance for the E5-I3 LIN≥6 set (F-test, p<0.00001) (FIG. 4g vs. FIG. 4f).
These non-random distributions are also seen for the subset of E5 hexamers which end with CAG as seen in FIGS. 5a-5c. In the case of the I5 hexamer plots, the two sharp peaks (FIG. 4d), namely GTGAGT and GTAAGT, are consistent with a role in U1 snRNA base-pairing (FIG. 2a), as are those seen LIN≥6 dataset, namely GTAAGA and GTAAGT (FIG. 4h). For the profiles in FIGS. 4e and 4h (which overlay substantially perfectly in keeping with their LIN≥6 values), the highest peaks in FIGS. 4a, 4e and 4g represent the hexamer CTGCAG, which incidentally is present in Alu repeats. Furthermore, the E5 hexamers from positions −4 and −9 are as divergent as the E3 hexamers from positions+4 and +9 as seen in FIG. 2a and FIGS. 6a-6b and 6f vs. 6i, while the corresponding I3 pyrimidine-rich hexamers are more restricted as seen in FIG. 6k].
5′ exonic (E5) and intronic (I3) sequences constitute splicing codes of spliceosomal introns, which determine splicing sites in conjunction with the conserved intronic GTRAGT (R: purine) recognized by U1 snRNA. Like the genetic codes whose genetic codons specify amino acids, the splicing codes also form splicing code tables to determine which sequences are potential splicing sites. Since up to 9 bp between E5 and I3 sequences are conserved as seen in FIGS. 3 and 4, after removing the last intronic dinucleotide, AG, such a splicing code table will contain 4.29×109 unique splicing codes. Nature selection, genetic drifts and evolution result in much different and much smaller numbers of splicing codes, which are supported by FIGS. 2c, 3 and 4. Accordingly, each species has its own splicing code table, which confers specificity and fidelity of splicing and alternative splicing as suggested by FIGS. 3 and 4. Splicing code tables can be constructed using databases known to those skilled in the art, including but not limited to single nucleotide polymorphism (SNP) databases, and nucleotide sequence and protein databases.
The conservation between E5 and I3 sequences and independent evolution between E5 and I5 sequences, as seen in FIGS. 3 and 4, suggest that E5 sequences are dynamically conserved (without a conserved nucleotide sequence pattern like the first six nucleotides) and that E5 and I5 evolved differently. These data suggested that the conserved E5 sequences are similar to those of their ancestor, self-spliced group II introns. Since the 5′ exonic sequences provide specificity of the group II introns, E5 and I3 sequences are potential splice codes. Based on characteristics of self-splicing group II introns, we can bold speculate that these splicing codes of the spliceosomal introns are believed to be deciphered by splicer RNAs or equivalent splicer-RNA protein (or proteins) as seen in FIGS. 1a and 1b This model is a derivative of the proposal of Holliday and Murray, who suggested that splicer RNAs hybridize to sequences near the splice junctions to guide intron removal. This splicing code model is similar to the genetic codons, which are deciphered by tRNAs and ribosome. In addition, the splicing code model is further supported by its similarities with the splicing of ribozymic group II introns in which 5′ intronic-binding sites sequences (IBSs) are complementary to specific exonic-binding sites (EBSs) within domain 1D3 in addition to long-range single base-pair interaction at the 3′ splice-site.
Characterized introns from a species must be deciphered by their splicer RNAs (or proteins), so characterized E5-I3 sequences from a species can be used to predict alternative splicing from this species. If the splicing codes of spliceosomal introns are deciphered by splicer RNA (RNAs) or equivalent splicer-RNA proteins (FIGS. 1 and 1b), they are believed to be alternatively-spliced if they exist in the splicing code table. To consider contribution of the conserved intronic GTRAGT, the splicing code table, which contains the E5-I3 sequences plus the first dinucleotide from the spliceosomal introns from a species, can therefore be used accurately to predict novel alternative splice sites of pre-mRNAs.
Verification of the Splicing Code Model to Predict Alternative Splice Sites of the Mouse Insulin Receptor (Insr) Gene.
To verify splicing code model, a mouse gene of insulin receptor (insr) encoding insulin receptor (IR), which is 128,255 bp in length and interrupted by 20 introns, was chosen as a model. In addition, this gene has been well studied in vivo and in vitro, and has only two isoforms that have been identified in human so far since 1985. A mouse splicing code table was constructed from the mouse introns supported by cDNA and EST sequences and containing 290000 sequences, which consists of 9 bp E5 sequence plus the first dinucleotide of I5 (GT/GC/AT) and 9 bp of I3 sequence for total of 20 bp in length. A probability to find one 20 bp identical sequences in the mouse genome is 1.1×10−12 or 0.28% if the mouse genome is randomly distributed. A possibility to find one of the random sequences in this splicing code table is 5.8×10−5 after excluding the first and last invariable dinucleotides. When 128,255 bp of the mouse insulin receptor (insr) gene scan the mouse splicing code table using intron sizes of 500 bp to 50,000 bp, the mouse insulin receptor (insr) gene is predicted to encode surprisingly large numbers of 4,631 putative novel splice sites (PPASSs), which is three time larger than the expected number of 1358 (p<0.001). It suggests that the mouse insulin receptor (insr) gene encodes 36 PPASSs per kb and is 1.2×105 times larger than the expected numbers of PPASSs.
Various lengths of E5 plus the first dinucleotide of I5 sequences and fixed 9 bp of I3 sequences were used to predict putative alternative splice sites. FIG. 7b shows that the numbers of predicted putative alternative splice sites (PPASSs) displays two different phases as the total numbers of nucleotides used to predict PPASSs are increased. From 20 to 24 bp (9 bp to 13 bp of E5), the numbers of PPASSs are dramatically decreased and range from 4.3 to 1.5 folds per decreasing nucleotide (see Insert in FIG. 7b). From 25 bp on, the numbers of PPASS are slowly declined and almost flat. At 40 bp (or 29 bp of E5), the mouse insulin receptor (insr) gene is still predicted to encode 17 PPASSs, among which 7 are alternative splice sites of the existing exons (1, 9, 13, 14, 15, 16, and 17) and the remaining 10 of them are novel putative splice sites. Only three of 17 PPASSs have ≥6 bp of identical sequences between 5′ and 3′ splice sites. Based on intron-types, 12 of them are GT-AG and five are GC-AG introns without AT-AC introns.
Fixed numbers of nine bp E5 sequences plus the first dinucleotides of I5 and various lengths of I3 sequences can be used to characterize the use of I3 nucleotide sequences affect the prediction of alternative splice sites. The mouse insulin receptor (insr) I3 sequences have shown a trend similar to that of E5 sequences (FIG. 7B). The difference is that the numbers of PPASSs are decreased much faster from 20 bp to 26 bp (9 bp to 15 bp of I3) and range from 2.4 to 3.7 folds. From 26 bp on, the numbers of PPASSs are extremely stable and in fact from 30 bp to 36 bp (19 bp to 25 bp of I3), the numbers of PPASSs is decreased only by one as seen in FIG. 7a. From 25 bp to 36 bp, the numbers of PPASSs predicted by increasing I3 sequences are 2.4 to 4.8 folds smaller than those observed by corresponding E5. A total of 36 bp (or 25 bp of I3), the mouse insulin receptor (insr) gene were predicted to encode the nine PPASSs. Only one out of nine is alternative splicing of a known exon, which is expected to result in deletion of one amino acid from the normal insulin receptor. None of nine PPASSs are simple sequences with long stretch of polypyrimidine tracts. Only two out of nine are GT-AG intron types and seven out of nine are GC-AG intron types, which are much higher than those predicted by E5. Two of nine PPASSs have more than ≥6 bp of identical sequences between 5′ and 3′ splices. Low proportions of introns with ≥6 bp of identical sequences between 5′ and 3′ splice sites predicted by long E5 and I3 sequences have ruled out that long-stretch of DNA conservation between 5′ and 3′ splice sites is caused by template switching or misplicing. See Roy, S. W., Irimia, M., Intron mis-splicing: no alternative? Genome Biol. 2008:9(2):208 (“Roy II”).
Experimental Verification of PPASSs.
4,631 putative splicing sites predicted by the splicing code model using total 20 bp are expressed in the normal mouse cells and tissues. 12 out of 4,631 PPASSs are exclusively selected from the IR β region, which regulates IR signal transduction including tyrosine kinase, regulation and other functional domains. See Belfiored. 58.3% of the pseudo-randomly selected predicted splice sites (7 out of 12) were verified by RT-PCR and sequencing of cloned RT-PCR products as seen in FIG. 7b. FIG. 8 shows that these alternatively-spliced isoforms result in much shorter β subunits that lack tyrosine kinase domains and/or their regulation domains, which have functions different from full-length wild-type IR proteins. Out of seven IR isoforms, three of these alternatively-spliced spliceovariants will produce almost identical truncated IR proteins and therefore have similar functions.
Since the splicing code table generated by all known mouse introns cannot predict all novel splicing sites, novel methods, such as “splice-site walking,” has been used to identify more than 20 novel alternatively-spliced IR isoforms, including previously-uncharacterized mice IR-A isoforms. These data are consistent with notion that the mammalian insulin receptor (insr) genes encode large numbers of extremely complex alternatively-spliced isoforms which are tissue-specific and are regulated developmentally.
Performance of “Splice-Site Walking” PCR
To overcome non-specific PCR amplifications and artifacts, “splice-site walking” technology was developed to amplify different cDNAs from the different tissues under the identical conditions. Using the “splice-site walking” method, novel soforms including isoforms expressed at very low levels can be amplified disproportionately. “Splice-site” walking includes changing PCR amplification conditions including temperatures, extension time, ion conditions and primers to preferably amplify novel isoforms expressed at very low levels. RNAs were isolated from various mouse tissues as described above. Mouse cDNAs were made by TaqMan Reverse Transcription Reagents (Applied Biosystems Inc., Foster City, Calif., USA) as the manufacturer suggests except that equal amounts of pooled reverse-transcription reaction mixes were added to 3 μg RNA. To perform PCR on different cDNAs, all reagents were pooled together except cDNAs and then were equally divided into different samples. PCR reactions were carried out by HiFi Taq polymerase (Invitrogen, Carlsbad, Calif., USA). The extension time was about 20% shorter than 1 kb/min which the manufacturer suggests. For example, 2.0-2.4 minutes were used for 3 kb fragments. Under this condition, the minor products, which are expressed at very low levels, were preferred to be amplified. The PCR products were separated on 2.0% agarose gels in 1×TBE buffer (Tris-HCl (pH8.0) 89 mM, boric acid, 89 mM and 2 mM EDTA).
Differential Western Blot Analysis.
Western blot analysis was performed against mouse tissue lysates by a monoclonal rabbit antibody, insulin receptor 4b8 (Cell Signaling, MA), whose epitope is residues surrounding Tyr960 of human insulin receptor β and rabbit polyclonal antibody, sc-711 (Santa Cruz Biotech, CA), whose epitopes are mapped to the last 20 residues of the C-terminus of the β chain of the human insulin receptor to determine that these minor alternatively-spliced isoforms were translated. The polypeptides detected by antibody 4b8, but not by sc-711, should be insulin receptor which have epitope surrounding Tyr960 and without the last 20 residues of the C-terminus.
FIGS. 9a-9c depicts Western blot analysis of various mouse tissues. FIG. 9a is a schematic diagram of the mouse insulin receptor (insr) gene. The arrows represent epitopes of the antibodies 4B8 and sc-711, respectively. FIG. 9b depicts Western blot analysis of protein lysates from brain, heart, liver, lung, g. muscle, seleus muscle and white fat by antibody 4b8. The minor bands are consistent with proteins predicted by the mouse splicing code table. FIG. 9c depicts Western blot analysis of protein lysates from brain, heart, liver, lung, g. muscle, seleus muscle and white fat by antibody sc-711. The differences between these two Western blot analyses show reflection of shorter isoforms predicted by the mouse splicing code table. FIG. 9a showed that Western blot analysis against the 4b8 antibody detected not only the main isoforms, but also complex minor bands, many of which are different in sizes, in abundances and in numbers among different tissues and approximated to the IR β subunit isoforms predicted by the mRNA isoforms above. On the other hand, the Western blot analysis against the sc-711 antibody showed the main informs and much less minor bands as seen in FIG. 8. The differences of minor bands detected by the two Western blots against the antibodies, 4b8 and sc-711, reflect the differences of the IR proteins translated from alternatively-spliced isoforms predicted by the splicing code model discussed above. The differences of the minor bands among the different tissues reflect that alternatively-spliced spliceoforms encoded by the different tissues are different in numbers of polypeptides, their sizes and their abundances, which are believed to contribute the tissue functional specificities, diversities and plasticity. These extra minor polypeptides support that predicted alternatively-spliced isoforms are translated into proteins, which attenuate insulin signaling pathway among tissues. These differences may only reflect one individual at the time when it was harvested.
In vertebrates there are 2.5-5 fold more cases of ≥6 nt identical length between 5′ exonic (E5) and 3′ intronic (I3) sequences than between 5′ intronic (I5) and 3′ exonic (E3) ones. It is believed that 5′ exonic and 3′ intronic sequences of the splice junctions constitute splicing codes of the spliceosomal introns, which are sequence-specifically decoded by as yet uncharacterized RNAs or proteins as suggested in FIGS. 1a and 1b. The mechanisms of deciphering splicing codes by splicer RNAs (or proteins) are similar to that of genetic codons decoded by tRNAs except that splicer RNAs/proteins hybridize to both E5 and I3 sequences, bring two exons together and guide spliceosome's removal of intronic sequences.
Evidence supports that conservation between E5 and I3 sequences and E5 and I5 independent evolution can be explained by the splicer RNA model rather than protein models of pre-mRNA splicing. For example, S. pombe and S. cerevisiae have similar genome sizes (13.8 Mb vs 12.2 Mb) and encode similar protein-coding genes (4730 vs 5796). See Wood, V., Gwilliam, R., Rajandream, M. A., et al., The genome sequence of Schizosaccharomyces pombe. Nature 2002:415(6874):871-80 (“Wood”). Nonetheless, S. pombe encodes more than 4,730 spliceosomal introns while S. cerevisiae codes for less than 260 introns. See Wood; Davis, C. A., Grate, L., Spingola, M., et al., Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res. 2000:28(8):1700-6 (“Davis”). Unlike those found in mammalian systems, no complex alternative splicing has been identified so far in both S. pombe and S. cerevisiae. See Wood; Davis. If each gene encoding RNA-binding protein can be alternatively expressed to generate 100 isoforms, each of whom recognize one specific intron, the expectation would be that the S. pombe genome would encode 47 members of such gene family and the S. cerevisiae genome would encode 3 ones, such that S. pombe would encode 44 more genes coding for such RNA-recognizing protein superfamilies than would S. cerevisiae. The fact that no large RNA-binding protein superfamilies have been identified in S. pombe strongly suggests that the splicing codes are decoded by splicer RNAs instead of splicer proteins.
Secondly, since domains of self-splicing group II introns and small spliceosomal U snRNAs are structurally conserved, these domains were thought to be ancestors of the spliceosomal snRNAs. See Pyle, A. M., The tertiary structure of group II introns: implications for biological function and evolution. Crit. Rev. Biochem. Mol. Biol.; 45(3):215-32 (“Pyle”). Like small U snRNAs, exonic-binding sites (EBSs) within domain I of self-splicing group II introns might have been expected to be more ready to co-evolve into splicer RNAs, rather than development by their ancestors of a revolutionary splicer protein system de novo. This model of splicing codes deciphered by splicer RNAs also shares similarities with the splicing of ribozymic group II introns in which 5′ intronic-binding sites (IBSs) are complementary to specific exonic-binding sites (EBSs) within domain 1D3 in addition to long-range single base-pair interaction at the 3′ splice-site, and these interactions are important for the accuracy of pre-mRNA splicing. Moreover, the eukaryotic genomes easily have these capacities and the number of identified non-coding RNAs keeps increasing, as does an appreciation for the extent of transcriptionally-active regions which lie outside of known coding regions in eukaryotes. See Mattick, J. S., Makunin IV. Non-coding RNA. Hum. Mol. Genet. 2006:15 Spec. No. 1:R17-29 (“Mattick”); Kapranov, P., Cheng, J., Dike, S., et al., RNA maps reveal new RNA classes and a possible function for pervasive transcription. Science 2007:316(5830):1484-8 (“Kapranov”); Birney, E., Stamatoyannopoulos, J. A., Dutta, A., et al., Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature 2007:447(7146):799-816 (“Birney”).
Splicing codes of spliceosomal introns require yet-to-be characterized splicer RNAs to be decoded via a manner similar to genetic codons decoded by tRNAs within ribosome. The splicer RNA has sequences complementary to 5′ exonic and 3′ intronic sequences and maybe to U RNAs. Any diseases can be treated by injecting the splicer RNA into target cells or tissues, which could form the basis of future medicines.
Similar to tRNAs, which are required to translate the genetic codons into amino acids, splicer RNAs are required to hybridize E5 and I3 sequences of splicing codes and guide spliceosomes to remove intron sequences from pre-mRNAs, whose mechanisms are little understood. The up to 9 bp of conserved regions between E5 and I3 sequences and no significant differences beyond that as seen in FIG. 3 suggest that at least 9 bp of the conserved E5-I3 regions under functional constraints are coevolved. Like I5 sequences as seen in FIG. 4 that are constrained by U1 snRNA, I3 sequences have become more clustered together as seen in FIG. 4 and I3 sequences between branch and the last conserved intronic dinucleotide, AG, have become the polypyrimidine tracts during evolution, as seen in FIG. 2a from the bottom panel to the top panel, whose locations are quite variable among different introns. This may reflect that two distinct essential functions—university and individuality (diversity)—are driving forces of evolution of I3 sequences. The most reasonable explanation is that a domain of a splicer RNA that interacts with a common components of spliceosomes (the most likely candidate is U5 snRNA, whose conserved loop functions as a carrier, and/or those interacting with branch points) are adjacent to a domain of a splicer RNA that recognizes I3 sequence. Because of these structures of I3 sequences, E5 sequences may play more important role in determining specificity and fidelity of removing spliceosomal introns by splicer RNAs like those of self-splicing group II introns. See Toor, N., Robart, A. R., Christianson, J., et al., Self-splicing of a group IIC intron: 5′ exon recognition and alternative 5′ splicing events implicate the stem-loop motif of a transcriptional terminator. Nucleic Acids Res. 2006:34(22):6461-71 (“Toor”). Both E5 and I3 sequences may form stem-loop structures with splicer RNAs to avoid accidental havocs of RNA-induced silencing complex (RISC).
Using a mouse splicing code table, constructed from the characterized sequences of 9 bp of E5 plus the first dinucleotide of I5 and the last 9 bp of I3 sequences, the mouse insulin receptor (insr) gene are predicted to have surprisingly large numbers of 4,631 predicted putative splice sites (PPASSs), which is 3.3 times larger than the expected number, 1358, of PPASS. To verify this prediction, 12 out of the PPASSs of 4631 PPASSs that resulted in alternative splicing in the IR β region were pseudo-randomly selected, which regulated IR signal transduction including tyrosine kinase regulation and other functional domains. See Belfiore. To perform isoform-specific PCR, a primer was designed to cross the 5′ and 3′ exonic sequences of a PPASS while the other primer was located upstream or downstream of the mouse insulin receptor (insr) exonic sequences (12 pairs of forward and reverse primers are shown below in Tables 12a and 12b). The 12 pairs of forward primers are identified as follows: (1) primer regions 1-25 of mIRs2F sequence GCAAGAAATGATTCAGATGACAGCA (SEQ ID NO.:4) correspond to 117712-117737 of NM_010568 genomic sequences; (2) primer regions 1-25 of mIRs2F sequence CCTTGCAAGAAATGATTCAGATGAC (SEQ ID NO.: 5) correspond to 117709-117733 of NM_010568 genomic sequences; (3) primer regions 1-25 of mIRs1F sequence GCAAGAAATGATTCAGATGACAGCA (SEQ ID NO.:4) correspond to 117713-117737 of NM_010568 genomic sequences; (4) primer regions 1-25 of mIRs1F sequence GCAAGAAATGATTCAGATGACAGCA (SEQ ID NO.:4) correspond to 117713-117737 of NM_010568 genomic sequences; (5) primer regions 1-25 of mIRs1F sequence GCAAGAAATGATTCAGATGACAGCA (SEQ ID NO.:4) correspond to 117713-117737 of NM_010568 genomic sequences; (6) primer regions 1-21 of mIRs3F sequence TTGGTATGGTGTATGAAGGCA (SEQ ID NO.:7) correspond to 115788-115808 of NM_010568 genomic sequences; (7) primer regions 1-21 of mIRs4F sequence TCCCCCTACCTTGCAAGAAAT (SEQ ID NO.:8) correspond to 117701-117721 of NM_010568 genomic sequences; (8) primer regions 1-21 of mIRs4F sequence TCCCCCTACCTTGCAAGAAAT (SEQ ID NO.:8) correspond to 117701-117721 of NM_010568 genomic sequences; (9) primer regions 1-22 of mIRs5F sequence ATTGCTGATGGCATGGCATACT (SEQ ID NO.:9) correspond to 117741-117762 of NM_010568 genomic sequences; (10) primer regions 1-15 and 15-27 of mIRs6F sequence GTCTGTATATTTTAGTCACATCAGAAG (SEQ ID NO.:10) correspond to 120543-120557 and 124468-124480 of NM_010568 genomic sequences; (11) primer regions 1-7 and 8-20 of mIRs7F sequence ATTTTAGCTGCTCTTGGCGT (SEQ ID NO.:11) correspond to 120544-120551 and 125214-125227 of NM_010568 genomic sequences; and (12) primer regions 1-11 and 12-20 of mIRs8F sequence TTTGCTTCCTTCTGCTCTTG (SEQ ID NO.: 12) correspond to 122469-122479 and 125208-125217 of NM_010568 genomic sequences. The 12 pairs of forward and reverse primers are identified as follows: primer regions 1-11 and 12-24 of mIRs2F/mIRs1R sequence TCCTCCAACCTCCAATTTTGACAG (SEQ ID NO.:13) correspond to 119214-119204 and 117848-117829 of NM_010568 genomic sequences; primer regions 1-8 and 9-23 of mIRs2F/mIRs2R sequence AAGAGCAGCTTGCTTCTTGCTGA (SEQ ID NO.:14) correspond to 125223-125215 and 119342-119328 of NM_010568 genomic sequences; primer regions 1-8 and 9-25 of mIRs1F/mIRs3R sequence CAAATTTACTCCTGATGAGCACATT (SEQ ID NO.:15) correspond to 128272-128264 and 119808-119792 of NM_010568 genomic sequences; primer regions 1-8 and 9-25 of mIRs1F/mIRs4R sequence ACACACATCTCCTGATGAGCACATT (SEQ ID NO.:16) correspond to 119800-119792 and 119808-119792 of NM_010568 genomic sequences; primer regions 1-14 and 15-30 of mIRs1F/mIRs5R sequence GGACGACCCAGTTCTTCATTTCTA (SEQ ID NO.:17) correspond to 122565-122548 and 119848-119838 of NM_010568 genomic sequences; primer regions 1-13 and 14-20 of mIRs3F/mIRs6R sequence ACGACCCAGTTCTCCTGATGA (SEQ ID NO.:18) correspond to 119812-119799 and 122551-122557 of NM_010568 genomic sequences; primer regions 1-8 and 9-22 of mIRs4F/mIRs7R sequence TGATGTGAAGTCTCTCTGGACA (SEQ ID NO.: 19) correspond to 124478-124470 and 120486-120473 of NM_010568 genomic sequences; primer regions 1-14 and 15-30 of mIRs4F/mIRs8R sequence TGAGGTAGACTGTACTAAAATATACAGACA (SEQ ID NO.:20) correspond to 125984-125967 and 120557-120542 of NM_010568 genomic sequences; primer regions 1-22 of mIRs5F/mIRs9R sequence GAGACTCAAACATAAGCACCTGTTC (SEQ ID NO.:21) correspond to 125925-125274 of NM_010568 genomic sequences; primer regions 1-20 of mIRs6F/mIRs10R sequence CACCACTGCTCCCAAAGAAA (SEQ ID NO.:22) correspond to 124750-124731 of NM_010568 genomic sequences; primer regions 1-21 of mIRs7F/mIRs11R sequence CAGGGAAACATTTAGAAAGGC (SEQ ID NO.:23) correspond to 127110-127090 of NM_010568 genomic sequences; and primer regions 1-21 of mIRs8F/mIFs12R sequence TGAGCAGCTGTGGTTTTATGC (SEQ ID NO.:24) correspond to 125406-125386 of NM_010568 genomic sequences.
| TABLE 12a |
| Forward and Reverse Primers for PPASS |
| Forward Primers |
| Names | Sequences | |
| mIRs2F | GCAAGAAATGATTCAGATGACAGCA | |
| mIRs2F | CCTTGCAAGAAATGATTCAGATGAC | |
| mIRs1F | GCAAGAAATGATTCAGATGACAGCA | |
| mIRs1F | GCAAGAAATGATTCAGATGACAGCA | |
| mIRs1F | GCAAGAAATGATTCAGATGACAGCA | |
| mIRs3F | TTGGTATGGTGTATGAAGGCA | |
| mIRs4F | TCCCCCTACCTTGCAAGAAAT | |
| mIRs4F | TCCCCCTACCTTGCAAGAAAT | |
| mIRs5F | ATTGCTGATGGCATGGCATACT | |
| mIRs6F | GTCTGTATATTTTAGTCACATCAGAAG | |
| mIRs7F | ATTTTAGCTGCTCTTGGCGT | |
| mIRs8F | TTTGCTTCCTTCTGCTCTTG | |
| TABLE 12b |
| Reverse Primers for PPASS |
| Reverse Primers |
| Names | Names | Sequences |
| mIRs2F | mIRs1R | TCCTCCAACCTCCAATTTTGACAG |
| mIRs2F | mIRs2R | AAGAGCAGCTTGCTTCTTGCTGA |
| mIRs1F | mIRs3R | CAAATTTACTCCTGATGAGCACATT |
| mIRs1F | mIRs4R | ACACACATCTCCTGATGAGCACATT |
| mIRs1F | mIRs5R | GGACGACCCAGTTCTTCATTTCTA |
| mIRs3F | mIRs6R | ACGACCCAGTTCTCCTGATGA |
| mIRs4F | mIRs7R | TGATGTGAAGTCTCTCTGGACA |
| mIRs4F | mIRs8R | TGAGGTAGACTGTACTAAAATATACAGACA |
| mIRs5F | mIRs9R | GAGACTCAAACATAAGCACCTGTTC |
| mIRs6F | mIRs10R | CACCACTGCTCCCAAAGAAA |
| mIRs7F | mIRs11R | CAGGGAAACATTTAGAAAGGC |
| mIRs8F | mIRs12R | TGAGCAGCTGTGGTTTTATGC |
PCR was performed on the pooled cDNAs from various mouse tissues as indicated in FIGS. 10A and 10B and PCR products were separated on a 2.0% agarose gel. Nine out of 12 PCR reactions had products and were cloned into pCR2.1 TA vectors. Eight of them were shown to have inserts by agarose gel separation of EcoRI-digested plasmids. As shown in FIG. 8, seven of the clones (7 out of 12) had been verified by RT-PCR and sequencing of cloned RT-PCR products in FIG. 7c). FIGS. 10A and 10B showed the seven sequence data (58.3%) of these alternatively-spliced isoforms, which would result in much shorter β subunits that lacked tyrosine kinase domains and/or their regulation domains and which had functions different from full-length wild-type IR proteins. Out of seven IR isoforms, three of these alternatively-spliced spliceovariants would produce almost identical truncated IR proteins and therefore had similar functions. These data indicated that the mouse insulin receptor gene encoded a far more complex system of alternatively-spliced isoforms than what had been discovered so far.
To show that the mouse insulin receptor (insr) gene encoded large numbers of alternatively spliced isoforms, “splice-site walking” PCR was developed to detect alternatively-spliced isoforms. A pair of primers (5′-GAGATGGTCCACCTGAAGGA-3′, SEQ ID NO.: 25, and 5′-TGTGCTCCTCCTGACTTGTG-3′, SEQ ID NO.: 26) were designed, which were located at the exon 2 and exon 12, to perform PCR with cDNAs constructed from various tissues of 8-week C57BL/6 male mice under the identical conditions. Primer regions 1-20 sequence GAGATGGTCCACCTGAAGGA (SEQ ID NO.: 25) correspond to 20518-20537 of NM_010568 genomic sequences. Primer regions 1-20 sequence TGTGCTCCTCCTGACTTGTG (SEQ ID NO.: 26) correspond to 104412-104393 of NM_010568 genomic sequences. FIG. 11 had shown that there were numbers of clear minor PCR products in some tissues in addition to the major isoforms. Some PCR products were much weaker and were observed only under careful scrutiny. Most of these minor isoforms encoded ectodomains of insulin receptors, which were predicted to be soluble and to secret into blood and/or extracellular matrixes and which previously had been thought to be generated by an undefined “protein shedding” process. Different tissues have almost completely different profiles of minor PCR products, which indicated these isoforms were tissues-specific and the same insulin receptor (insr) pre-mRNA from different mouse tissues had different secondary structures that resulted in template switching and/or missplicing. That different tissues had different PCR products ruled out that these products were not artifacts generated by template switching or misplicing. Using this and other methods, more than 20 low-level and tissue-specific alternatively-spliced IR isoforms were identified and verified, including previously-uncharacterized mouse IR-A isoform (data not shown). These data were consistent with the notion that the mammalian insulin receptor (insr) gene encoded large numbers of extremely complex alternatively-spliced isoform system, which enable mice to support their diverse functions. However, that some of these large numbers of alternative spliceovariants are caused by partial loss of specificity of splicer-RNAs as observed in self-splicing group II introns cannot be ruled out. See Toor. FIG. 12 shows relationships between different insulin receptor isoforms. Isoforms of normal functional insulin receptors are marked by 1. The truncated insulin receptor isoforms on cell membrane are indicated by 2 in FIG. 12 and can bind the insulin competitively. These isoforms may have some functions which are different from the normal functions. The soluble insulin receptor receptors were released into the outsides of cell including extracellular matrix and blood. The soluble and truncated plasma membrane insulin receptors had been shown that they can bind to insulin in vitro.
When the soluble insulin receptors can bind to insulin in blood and extracellular matrix, the numbers of insulin molecules reached to target cells will be reduced. When the reduced numbers of insulin reaches the plasma membranes of the target cells, they can be bound to both normal and truncated insulin receptors. The normal insulin receptors and activate the normal tyrosine kinase function, which result in reducing the glucose concentration in blood. The truncated insulin receptors will have opposite effects and can bind to insulin without activating the normal tyrosine kinase. That is, when concentrations of normal insulin receptors marked by 1 are reduced or the concentrations of truncated plasma membrane insulin receptors and soluble insulin receptors indicated by 2 and 3 are increased, it will result in insulin resistances.
When concentrations of normal insulin receptors marked by 1 are increased or the concentrations of truncated plasma membrane insulin receptors and soluble insulin receptors indicated by 2 and 3 are decreased, it will result in increased sensitiveness to insulin and cancer.
These results suggest that disrupting equilibrium of environmentally and developmentally regulated isoform system may be directly responsible for majority of complex diseases. The natural and/or medically-assistant restoration of these equilibriums may be the best method to cure complex diseases from diabetes to cancer.
These equilibriums are true for other receptors, ion-channels and neurotransmitters. They may be used to diagnose and treat the complex disease. These are listed in the receptor list seen in Table 13.
| TABLE 13 | ||||
| G protein-coupled | 5- | Acetylcholine | Adenosine | Adrenoceptors |
| receptors | Hydroxytryptamine | receptors | receptors | |
| receptors | (muscarinic) | |||
| Anaphylatoxin | Angiotensin | Apelin receptor | Bile acid receptor | Bombesin |
| receptors | receptors | receptors | ||
| Bradykinin | Calcitonin | Calcium- | Cannabinoid | Chemokine |
| receptors | receptors | sensing | receptors | receptors |
| receptors | ||||
| Cholecystokinin | Corticotropin- | Dopamine | Endothelin | Estrogen (G |
| receptors | releasing factor | receptors | receptors | protein |
| receptors | coupled) | |||
| receptor | ||||
| Formylpeptide | Free fatty acid | Frizzled | GABAB | Galanin |
| receptors | receptors | receptors | receptors | receptors |
| Ghrelin receptor | Glucagon receptor | Glycoprotein | Gonadotrophin- | Histamine |
| family | hormone | releasing | receptors | |
| receptors | hormone | |||
| receptors | ||||
| Hydroxycarboxylic | Kisspeptin receptor | Leukotriene | Lysophospholipid | Melanin- |
| acid receptors | receptors | receptors | concentrating | |
| hormone | ||||
| receptors | ||||
| Melanocortin | Melatonin | Metabotropic | Motilin receptor | Neuromedin U |
| receptors | receptors | glutamate | receptors | |
| receptors | ||||
| Neuropeptide | Neuropeptide S | Neuropeptide | Neuropeptide Y | Neurotensin |
| FF/neuropeptide | receptor | W/neuropeptide | receptors | receptors |
| AF receptors | B receptors | |||
| Opioid receptors | Orexin receptors | P2Y receptors | Parathyroid | Peptide P518 |
| hormone | receptor | |||
| receptors | ||||
| Platelet-activating | Prokineticin | Prolactin- | Prostanoid | Protease- |
| factor receptor | receptors | releasing | receptors | activated |
| peptide receptor | receptors | |||
| Relaxin family | Somatostatin | Tachykinin | Thyrotropin- | Trace amine |
| peptide receptors | receptors | receptors | releasing | receptor |
| hormone receptor | ||||
| Urotensin receptor | VIP and PACAP | Vasopressin and | Class A Orphans | Class B |
| receptors | oxytocin | Orphans | ||
| receptors | ||||
| Class C Orphans | Non-signalling | BLT1 | BLT2 | CysLT1 |
| 7TM chemokine- | ||||
| binding proteins | ||||
| CysLT2 | OXE | CCRL2 | CMKLR1 | GPR1 |
| GPR3 | GPR4 | GPR6 | GPR12 | GPR15 |
| GPR17 | GPR18 | GPR19 | GPR20 | GPR21 |
| GPR22 | GPR25 | GPR26 | GPR27 | GPR31 |
| GPR32 | GPR33 | GPR34 | GPR35 | GPR37 |
| GPR37L1 | GPR39 | GPR42 | GPR45 | GPR50 |
| GPR52 | GPR55 | GPR61 | GPR62 | GPR63 |
| GPR65 | GPR68 | GPR75 | GPR78 | GPR79 |
| GPR82 | GPR83 | GPR84 | GPR85 | GPR87 |
| GPR88 | GPR101 | GPR119 | GPR120 | GPR132 |
| GPR135 | GPR139 | GPR141 | GPR142 | GPR146 |
| GPR148 | GPR149 | GPR150 | GPR151 | GPR152 |
| GPR153 | GPR160 | GPR161 | GPR162 | GPR171 |
| GPR173 | GPR174 | GPR176 | GPR182 | GPR183 |
| LGR4 | LGR5 | LGR6 | LPAR6 | MASI |
| MAS1L | MRGPRD | MRGPRE | MRGPRF | MRGPRG |
| MRGPRX1 | MRGPRX2 | MRGPRX3 | MRGPRX4 | OPN3 |
| OPN5 | OXGR1 | P2RY8 | P2RY10 | SUCNR1 |
| TAAR2 | TAAR3 | TAAR4 | TAAR5 | TAAR6 |
| TAAR8 | TAAR9 | Calcium- | CatSper and | |
| Activated | Two-Pore | |||
| Potassium | Channels | |||
| Channels | ||||
| Cyclic Nucleotide- | Inwardly | Transient | Two-P Potassium | Voltage-Gated |
| Regulated | Rectifying | Receptor | Channels | Calcium |
| Channels | Potassium | Potential | Channels | |
| Channels | Channels | |||
| Voltage-Gated | Voltage-Gated | 5-HT3 receptors | GABAA | Glycine |
| Potassium | Sodium Channels | receptors | receptors | |
| Channels | ||||
| Ionotropic | Nicotinic | P2X receptors | ZAC | Thyroid |
| glutamate | acetylcholine | Hormone | ||
| receptors | receptors | Receptors | ||
| Retinoic acid | Peroxisome | Rev-Erb | RAR-related | Liver X |
| receptors | proliferator- | receptors | orphan receptors | receptor-like |
| activated receptors | receptors | |||
| Vitamin D | Hepatocyte nuclear | Retinoid X | Testicular | Tailess-like |
| receptor-like | factor-4 receptors | receptors | receptors | receptors |
| receptors | ||||
| COUP-TF-like | Estrogen receptors | Estrogen-related | 3-Ketosteroid | Nerve growth |
| receptors | receptors | receptors | factor IB-like | |
| receptors | ||||
| Fushi taruzu F1- | Germ cell nuclear | DAX-like | Human | Human |
| like receptors | factor receptors | receptors | Epidermal growth | Epidermal |
| factor Receptor 1 | growth factor | |||
| Receptor 2 | ||||
These equilibriums are true for steroid hormone receptors. They may be used to diagnose and treat the complex disease. These are listed in the receptor list seen in Table 14.
| TABLE 14 | |||
| Steroid hormone receptor | |||
| Estrogen receptor-α (ERα; NR3A1, ESR1) | |||
| Estrogen receptor-β (ERβ; NR3A2, ESR2) | |||
| Estrogen-related receptor-α (ERRα; NR3B1, ESRRA) | |||
| Estrogen-related receptor-β (ERRβ; NR3B2, ESRRB) | |||
| Estrogen-related receptor-γ (ERRγ; NR3B3, ESRRG) | |||
| Glucocorticoid receptor (GR; NR3C1) (Cortisol) | |||
| Mineralocorticoid receptor (MR; NR3C2) (Aldosterone) | |||
| Progesterone receptor (PR; NR3C3, PGR) (Sex hormones | |||
| Progesterone) | |||
| Androgen receptor (AR; NR3C4, AR) (Sex hormones | |||
| Testosterone) | |||
These equilibriums are true for RXR heterodimer receptors. They may be used to diagnose and treat the complex disease. These include the thyroid receptor (TR), vitamin D receptor (VDR), the retinoic acid receptor (RAR), the ecdysone receptor (ECR), the bile acid receptor (BAR), the androstane receptor (CAR), the liver X receptor (LXR), the steroid and xenobiotic sensing nuclear receptor (SXR) and the peroxisome proliferator-activated receptor (PPAR).
These equilibriums are true for dimeric orphan receptors. They may be used to diagnose and treat the complex disease. These include the farnesoid X receptor (FXR), the NMDA receptor, the retinoid X receptor (RXR), COUP orphan receptors, the tumor necrosis factor receptor (TNFR), the hepatocyte nuclear factor 4 receptor α (HNF4-α), the TR2 and TR4 orphan nuclear receptors, the TLX orphan nuclear receptor, GCNF orphan nuclear receptor (GCNF) and the retinoic acid receptor (RAR).
These equilibriums are true for monomeric/tethered orphan receptors. They may be used to diagnose and treat the complex disease. These include the orphan nuclear receptor NGFI-B, the SF-1 orphan nuclear receptor (SF-1), the Rev-Erb orphan receptors, RAR-related orphan receptors (RORs) and Estrogen receptor-related receptors (err).
These equilibriums are true for any receptors and ion channels to be characterized. They may be used to diagnose and treat the complex disease.
Many predicted and observed spliceovariants are generated via 4.7 kb of the mouse insulin receptor (insr) 3′ UTR region and suggest that 3′ UTR sequences are essential to generate complex alternative spliceovariants, which are consistent with recent finding that the C. elegans 3′ UTRs are used to generate trans- and cis-alternative spliceoforms. Even though their mRNA sequences resulted from many PPASSs may be dramatically different among themselves, splice variants may have almost identical proteins as seen in FIG. 7, which render their ecological plastics and adoptability. These predicted PPASSs result in heterogeneous spliceovariants, ranging from deletion of one amino acid to very large truncation of IR proteins and may be responsible for wide-range diverse functions of the insulin receptor (insr) gene. However, long-term aberration expression of some of these spliceovariants may have very significant pathological consequences and may be directly responsible for the insulin resistance and diabetes.
Increasing lengths of E5 sequences demonstrated that the numbers of PPASSs have the two distinct phases as do the I3 sequences as seen in FIG. 7: in Phase I, the numbers of PPASSs are dramatically decreased and range from 1.5 to 4.3 folds as seen in the insert of FIG. 7b and in Phase II, there are long tails of gradual decreases as the E5 and I3 sequences are increased, respectively. In Phase II, the numbers of PPASSs predicted by increasing I3 sequences are 2.4 to 4.8 folds smaller than those by E5 sequences, are consistent with the notion that E5 and I3 sequences in these long tails may have somewhat different functions discussed above as seen in FIG. 12. Since E5 and I3 sequences used to predict PPASSs can be 29 and 25 bp long, respectively, PPASSs predicted by both E5 and I3 sequences are shown to have few simple sequences and relatively low ratio of introns with ≥6 bp of identical sequences between 5′ and 3′ splice sites.
There are several possibilities to explain this long tail of gradual decreases. First, removal of introns from pre-mRNAs requires additional cis-acting regulatory sequences. One of the cis-acting regulatory sequences can tightly regulate the expression of groups of spliceoforms from the different genes, which are consistent with the notion of splicing codes. Alternatively, splicing codes of many introns are decoded by the same conserved splicer RNAs, which may control expression of a group of spliceovariants to regulate gene expression. Further, splicing codes are much longer than what have been expected. Each of E5 and I3 sequences may have much longer than 12 to 14 base-pairing than those found in self-splicing group II introns. These data not only support that many mammalian introns have originated by DNA duplications, but also have ruled out that long-stretch of DNA conservation between 5′ and 3′ splice sites of recently-acquired introns is caused by template switching or misplicing. See Roy, S. W., Irimia, M., When good transcripts go bad: artifactual RT-PCR ‘splicing’ and genome analysis. Bioessays 2008:30(6):601-5 (“Roy III”); Roy II.
By using the mouse splicing code table, the mouse insulin receptor (insr) gene is predicted to encode more than 4,631 novel alternative splice sites and express extreme and complex heterogeneous alternative spliceovariants, which make a single gene function as multiple traits. One other hand, many of these alternative spliceovariants encode almost identical proteins, which confer redundancy. Both heterogeneity and redundancy within a gene may explain why many genome-wide studies fail to identify the insulin receptor (insr) gene as one of candidate genes for type 2 diabetes and metabolic syndrome. See McClellan, J., King, M. C., Genetic heterogeneity in human disease. Cell:141(2):210-7 (“McClellan”). Many widely-used technologies, such as microarray, siRNA, real-time PCRs and Western blot analysis as well as gene knockout and knock-in, can only detect partial events and therefore cannot use them as an entire gene function. For example, the main band in FIG. 9b has been previously thought to be the two alternatively-spliced IR isoforms (IR-A and IR-B). In fact, it may represent at least four alternatively-spliced and differentially-expressed IR isoforms. See Mosthaf, L., Grakom K., Dullm T. J., et al., Functionally distinct insulin receptors generated by tissue-specific alternative splicing. Embo. J. 1990; 9(8):2409-13 (“Mosthaf”). In the insulin receptor (insr) knockout gene for mice, the exons were knocked out which resulted in loss of IR function. See Rodriguez-Trelles. However, the identification of the mouse insulin receptor (insr) spliceovariant without the exon suggests that the insulin receptor (insr) knockout gene for mice may only reflect parts of insulin receptor functions. See id.
Increase of these soluble and truncated insulin receptors may lead to insulin resistance, a dominate phenotype of type II diabetes without any change in the main IR isoforms. Development of insulin insistence can be simply interpreted by the Michaelis-Menten equation for multiple competitive inhibitions and IR alternative splicing resulted in complexities of IR isoforms confers characteristics of complex traits. This is consistent with previous findings from the genetic and physiological studies, which have shown that Leprechaunism (OMIM 246200), the most extreme form of the insulin resistance syndromes, Rabson-Mendenhall syndrome (OMIM 262190), severe forms of insulin resistance syndrome, and type A insulin resistance (OMIM 147670), milder forms of insulin resistance, are related to mutations in the insulin receptor. The discovery that complex expression of IR spliceovariants may be responsible for diabetes II not only demonstrates more simple and effective methods to diagnose this complex disease, but also enables the development of novel and personalized methods to treat and even cure this complex disease, some of which may not involve any medication.
According to the invention, E5-I3 sequences that constitute the splicing code or a part of the splicing code can be systematically predicted by splicing code tables. One can also envision that these results not only lead to much simpler ways to diagnose complex diseases from type II diabetes to cancer, but also establish scientific foundations to personalized methods to treat and even cure these complex diseases, some of which may or may not require any “traditional” medication.
Materials and Methods.
The following describes the materials and methods used in the following description of the invention.
Materials.
Mice: (C57BL/6) were housed and treated according to the protocols approved by Institutional Animal Care and Use Committee (IACUC). Nitrocellulose immunoblotting filters were obtained from Bio-Rad (Hercules, Calif.). Monoclonal rabbit antibody, 4B8, against residues surrounding Tyr960 of human insulin receptor β was purchased from Cell Signaling Technology (Boston, Mass.). Polyclonal antibody, sc-711, against human insulin receptor epitopes was purchased from Santa Cruz biotechnology (Santa Cruz, Calif., USA) Epitopes of the antibodies sc-711 are mapped to the last 20 residues of the C-terminus of the β chain of the human insulin receptor.
Intron datasets: The AceView annotated human gene data (AceView NCBI Build35) were downloaded from www.ncbi.nlm.nih.gov/IEB/Research/Acembly/, the mouse NIA gene index (Version 5) from lgsun.grc.nia.nih.gov/geneindex5/, the C. elegans gene annotation and sequence data (WS 170) from ftp.wormbase.org/pub/wormbase/ and the D. melanogaster annotation and sequence from flybase.net/annot/. The exon-intron datasets from zebrafish (Danio rerio) (release Zv4) and chicken (Gallus gallus) (GenBank 1.1) were downloaded from The Exon-Intron Database (hsc.utoledo.edu/bioinfo/eid/).
Prior to analysis, steps were taken to remove misalignments, computation errors and dubious cDNA and genomic alignments as described previously. The human intron dataset from AceView (NCBI Build35) was selected from the transcripts supported by at least one cDNA and/or more than four ESTs with >99% identities to the genomic sequences. The mouse intron data were selected from the NIA-5 U-clusters with support of cDNA and/or at least five ESTs. The intron data from zebrafish and chicken were parsed from the Exon-Intron Databases, which have significant proportions of gene annotations by computational prediction. The C. elegans and D. melanogaster intron datasets were selected from the gene annotations with support of cDNAs and ESTs. Only GT-AG, GC-AG and AT-AC types of introns were included in the datasets.
Methods.
Splice Junction Analysis.
5′ splice sites were divided into 5′ exonic (E5) and 5′ intronic (I5) splicing sequences and 3′ splice sites into 3′ intronic (I3) and 3′ exonic (E3) splicing sequences, as shown in FIG. 2b. The E5 sequence (uppercase) was aligned with I3 sequence (lowercase) from positions −1 to −150 and the I5 sequence (italicized lowercase) was aligned with E3 sequence (italicized uppercase) from positions 1 to 150. The number of uninterrupted identical nucleotides (LIN) was scored outwards from the splice sites, independently for the E5-I3 and I5-E3 alignments. This differs from the method the inventor previously used to identify young introns in which similarity was scored on both sides of the splice junction as a single block. The largest LIN category included those ≥20. As a control, comparisons were made with randomized forms of these intron sequences.
To check whether the observed results might be due to random chances, the E5 and I3 sequences were scrambled with I3 and E5 sequences randomly selected from the non-redundant intron dataset, and similarly I5 and E3 sequences were mix-and-matched with E3 and I5 sequences.
To further assess how much of the E5-I3 sequence identity is due to constraints imposed on the last three nucleotides of 5′ exons and introns (by U1 snRNA and U2AF35, for example), those nucleotides (as well as the first three nucleotides of 3′ exons and introns) were removed and the analysis as described above was repeated. To construct a non-redundant scramble dataset, both the last six nucleotides of 5′ exons and introns (compare to FIG. 2b) were combined as an ID. This collection of unique IDs from the entire intron dataset contained up to 1,000,000 introns. The programs, as well as all the other ones used, were written in Perl and computations were done on desktop computers.
Hexamer Distribution Analysis.
The six nucleotides immediately upstream and downstream of splice junctions were sorted in the order G, A, T and C with the first nucleotides being weighted least and the last nucleotides weighted most. Subsequently, the I5 and E3 hexamer sets were re-sorted by Excel in order of A, C, G and T for presentation purposes (so that the most biologically important nucleotides were weighted most, i.e. the first nucleotides of the 5′end of an intron vs. the last nucleotides of the 3′ end of an intron).
Calculation of the Expected Numbers of Predicted Putative Alternative Splice Sites (PPASSs).
To estimate the random chance a sequence may be located when searching a database, the following formula can be used to approximate the expected numbers (E) of predicted putative alternative splicing sites (PPASSs):
E=N*(S−Imax/2)*(Imax−Imin)/4L
where N is the size of the splicing code table, S is the length of a sequence used to predict PPASSs, Imax is the maximum length of a putative intron used, Imin is the minimum length of a putative intron used and L is the length of E5-(GC/GT/AT)-I3 sequences used in the search.
Computational Prediction of Novel Putative Alternative Splice Sites Using a Mouse Splicing Code Table.
The mouse was selected as a model to predict novel putative alternative splice sites by splicing code table. To reduce potential noise in the dataset generated during data collection, the first intronic dinucleotide (GT/GC/AT) was treated as a part of E5 sequences in this study. To construct a mouse splicing code table, all mouse highly-quality E5 sequences plus the first intronic dinucleotide and I3 sequences from the mouse genome sequences (MM9) were parsed out based on the AceView annotated mouse gene data (AceView Mus musculus NCBI genome 37/mm9) downloaded from www.ncbi.nlm.nih.gov/IEB/Research/Acembly/. 290,000 numbers of unique combinations of E5 and I3 nucleotide sequences are present in the splicing code table. Mouse insulin receptor (insr) gene encoding insulin receptor protein was selected as a model, which is 128,255 bp. Intron sizes from 150 bp to 50,000 bp were used. Starting from the first nucleotide of the mouse insulin receptor (insr) gene, different putative introns were generated to search their E5-(GT/GC/AT)-I3 sequences in the mouse splicing code table. If a positive match was found, the E5-(GT/GC/AT)-I3 sequences were treated as a predicted putative alternative splice site (PPASS). Using a 20 bp of E5-(GT/GC/AT)-I3 sequence, the probability to find an identical sequence is 1.1×10-12 in a randomly-distributed genome of the mouse genome size.
Isolation of Mouse RNAs.
Mice were harvested according to the protocols approved by Institutional Animal Care and Use Committee (IACUC). Total RNAs were isolated from mouse tissues by Qiagen RNeasy Mini Kit as suggested by the manufacturer. 20 mg of mouse tissues were disrupted for 30 seconds in 350 μl of Buffer RLT by Cyclone Virtishere. The homogenates were centrifuged for 3 minutes at the maximum speed and supernatants were transferred into new tubes. One volume of 70% ethanol was added to the cleared lysate, and mix well by pipetting. 700 μl of the sample were transferred to RNeasy mini spin columns sitting in a 2-ml collection tube and the columns were centrifuged for 30 seconds at maximum speed and flow-through was discarded. 700 μl Buffer RW1 were added onto the RNeasy column, the RNeasy columns were centrifuged for 30 seconds at maximum speed and flow-through was discarded. 350 μl Buffer RWT were added into the RNeasy Mini spin column and centrifuge for 15 at 8000×g. To remove potential DNA contamination, after 10 μl DNase I stock solution was mixed with 70 μl Buffer RDD by gently inverting tubes, the DNase solution was added into the RNeasy columns and incubated at room temperature for 30 minutes. The columns were washed again by adding 350 μl Buffer RWT. After RNeasy columns were transferred to new 2-ml collection tubes, the columns were washed twice using 500 μl Buffer RPE by centrifuging for 30 seconds at maximum speed. RNAs were eluted from the columns by adding 30 μl of RNase-free water.
Verification of Alternatively-Spliced Insulin Receptor (IR) Isoforms.
To identify novel mouse IR isoforms, computation predication of putative splicing sites was performed using the mouse splicing code table. Isoform-specific primers were designed to cover the putative 5′ and 3′ splice sites. Normal primers were selected from upstream or downstream exonic sequences. The primers were designed using the software (www.yeastgenome.org). To minimize potential, no specific amplification and/or special care was taken when primers were designed, especially in the intronic sequences. 3-10 ug of total RNAs were first treated with RNase-free DNase at 37° C. for 30 min. To remove any potential genomic contamination, the first-strand cDNA synthesis was carried out using oligo(T)15 and/or random hexamers by TaqMan Reverse Transcription Reagents (Applied Biosystems Inc., Foster City, Calif., USA) as suggested by the manufacturer. 10-50 ng of the cDNAs were used to amplify for specific IR isoforms using isoform-specific primers by PCR. PCR amplifications were carried out by HiFi Taq polymerase (Invitrogen, Carlsbad, Calif., USA). To further reduce potential no specific amplification, higher annealing temperatures than optimized temperatures were used. PCR reactions were carried out by HiFi Taq polymerase (Invitrogen, Carlsbad, Calif., USA) using cycles of 94° C., 15″, 60-68° C., 15″ and 68° C., 2-5 min. The PCR products were separated on 1-2% agarose gels. The expected products were excised from gels and cloned into pCR2.1 TA vector (Invitrogen, Carlsbad, Calif., USA). The novel isoforms were then verified by sequence analysis.
Western Immunoblotting Analysis.
To perform immunoblotting analysis, a 20 μl sample was heated to 75° C. for 5 minutes, cool on ice and microcentrifuge for 5 minutes. For denaturing gels, DTT were added into samples at final concentration of 50 mM. A 20 μl sample was loaded onto SDS-PAGE gel and prestained molecular weight ladder (Bio-Rad) were used as markers to verify electrotransfer and to determine molecular weights. The samples were electrotransfered to nitrocellulose membrane for 2-3.5 hour in transfer buffer (25 mM Tris, 192 mM glycine). After transfer, wash nitrocellulose membrane was washed three time with 20 ml of TBS/T (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Tween 20) for 5 minutes at room temperature. The membranes were blocked in 10 ml of 5% no-fat milk in TBS/T for 1 hour at room temperature. After being washed three times in TBS/T, the membranes were incubated with primary antibody (at the appropriate dilution) in 3 ml of 4% BSA in TBS/T with gentle agitation overnight at 4° C. After the membranes were washed three times for 5 minutes each with 15 ml of TBS/T buffer, the membranes were incubated with appropriate HRP-conjugated secondary antibody (1:1000 to 1:2000) in 10 ml of 5% fat-free milk in TBS/T buffer with gentle agitation for 1 hour at room temperature. After being washed three times for 5 minutes each with 15 ml of TBS/T, the membranes were incubated for 5 minutes with ECF Western blotting reagent (GE HealthCare BioScience, Piscataway, N.J., USA) and were scanned using a 570 nm filter by Typhoon 9410 (GE HealthCare BioScience, Piscataway, N.J., USA).
Clone Full-Length cDNAs into Expression Plasmids.
To get full-length cDNAs of the specific novel IR isoforms, the 5′ and 3′ regions were amplified independently from mouse cDNAs using the isoform-specific primers by pfu Taq polymerase, only expectant DNA fragments were recovered from agarose gels. The two fragments were mixed and amplified again using the 5′ and 3′ by pfu Taq polymerase. After incubating at 72° C. for 10 min, the resulted DNAs were then cloned into TA vectors and the positive clones were verified first by restriction enzyme analysis and then by sequence analysis. The cDNA inserts were then cloned into pcDNA3.1 (Invitrogen, Carlsbad, Calif., USA).
Statistical Analysis.
The means and variances for binomial data were calculated using u=Np and σx2=Npq, where p is the probability that a given event has occurred, q is the probability that the event has not occurred and N is the population of the event. For the continuous data, the equations of
u
=
∑
X
i
N
,
σ
2
=
∑
x
i
2
-
(
∑
x
i
)
2
N
N
and
s
2
=
∑
x
i
2
-
(
∑
x
i
)
2
N
n
-
1
were used to estimated the means, variance and sample variance, respectively. Comparisons of two proportions were performed by
U = p 1 - p 2 p 1 q 1 n + p 2 q 2 m .
The foregoing embodiments have been presented for the purpose of illustration and description only and are not to be construed as limiting the scope of the invention in any way.
1. A method of identifying at least one potentially alternatively spliced transcript in at least one pre-mRNA sequence obtained from biochemical analysis of a biological sample from a species, the method comprising:
(a) generating a splicing code table of the species, comprising the substeps of:
determining substantially all of the 5′ splice sites and 3′ splice sites from relevant existing databases, wherein the relevant existing databases comprise genome sequences of the species, and wherein the genome sequences comprise at least an intron dataset;
dividing the 5′ splice sites into 5′ exonic (E5) and 5′ intronic (I5) splicing sequences;
dividing the 3′ splice sites into 3′ intronic (I3) and 3′ exonic (E3) splicing sequences;
constructing the splicing code table by parsing out E5 sequences, I5 sequences, I3 sequences, and E3 sequences from the intron dataset, each splicing code comprising E5 junction sequence-the first intronic dinucleotide-I3 junction sequence, wherein an E5 junction sequence comprises eight twelve nucleotides of an E5 sequence upstream of the 5′ splice site and an I3 junction sequence comprises six to ten nucleotides of an I3 sequence upstream of the 3′ splice site, and storing the splicing code table in a programmable, searchable computer database;
generating by a computer processor putative markers, wherein each of the putative markers comprises an E5-the first intronic dinucleotide-I3 sequence of all genes of interest of the species;
(b) aligning the at least one pre-mRNA sequence with each of the putative markers in the splicing code table;
(c) determining that the at least one RNA sequence is an alternatively spliced transcript candidate if the at least one pre-mRNA sequence is found to have a substantially identical match with at least one of the putative markers in the splicing code table and it is not identical to putative markers; or determining that the at least one pre-mRNA sequence is not an alternatively spliced transcript candidate if no substantially identical matches are found between the at least one pre-mRNA sequence and any of the putative markers in the splicing code table;
(d) verifying, if the at least one RNA sequence is determined to be an alternatively spliced transcript candidate in step (c), that the at least one RNA sequence is a real alternatively spliced transcript by a biochemical assay,
wherein the biochemical assay in step (d) comprises at least one of the RT-PCR, RNA sequencing, DNA sequencing, RNA-seq sequencing and array hybridization, and the biochemical assay comprises use of at least one primer and/or probe, wherein the at least one primer and/or probe is designed based on the E5 sequences and the E3 sequences of the at least one of the putative markers with which the at least one pre-mRNA sequence is found to be substantially identical and wherein the at least one primer and/or probe is designed to assay an alternatively spliced transcript.
2. The method according to claim 1, wherein the biochemical assay comprises RT-PCR, and the biochemical assay comprises use of a first primer and a second primer, wherein the first primer is designed based on the E5 sequence and the second primer is designed based on the E3 sequence.
3. The method according to claim 1, wherein the biochemical assay comprises array hybridization and the biochemical assay comprises use of a probe, and wherein the probe is designed based on a splice junction sequence connecting the E5 sequence and the E3 sequence.
4. The method according to claim 1, wherein the biochemical assay comprises RNA-seq and the biochemical assay comprises use of a probe, and wherein the probe is designed based on a junction sequence connecting the E5 sequence and the E3 sequence.
5. The method according to claim 1, wherein size of the putative markers has a range of 150 bp to 50,000 bp.
6. The method according to claim 1, wherein the species is a eukaryotic organism.
7. The method according to claim 6, wherein the species is a mammal.
8. The method according to claim 7, wherein the species is a mouse.
9. The method according to claim 7, wherein the species is a human.
10. The method according to claim 6, wherein the species is a vertebrate, selected from the group consisting of chicken and zebrafish, or an invertebrate, selected from a fungus, a protest, C. elegans and D. melanogaster, or a eukaryotic virus.
11. The method according to claim 1, wherein in step (c) the E5 sequence plus the first intronic dinucleotide and the I3 sequence of each of the putative markers in the splicing code table with which the at least one RNA sequence is aligned are mapped to a gene encoding a receptor, an ion-channel or a neurotransmitter, selected from a group consisting of insulin receptor, G protein-coupled receptors, 5-Hydroxytryptamine receptors, Acetylcholine receptors (muscarinic), Adenosine receptors, Adrenoceptors, Anaphylatoxin receptors, Angiotensin receptors, Apelin receptor, Bile acid receptor, Bombesin receptors, Bradykinin receptors, Calcitonin receptors, Calcium-sensing receptors, Cannabinoid receptors, Chemokine receptors, Cholecystokinin receptors, Corticotropin-releasing factor receptors, Dopamine receptors, Endothelin receptors, Estrogen (G protein coupled) receptor, Formylpeptide receptors, Free fatty acid receptors, Frizzled receptors, GABAB receptors, Galanin receptors, Ghrelin receptor, Glucagon receptor family, Glycoprotein hormone receptors, Gonadotrophin-releasing hormone receptors, Histamine receptors, Hydroxycarboxylic acid receptors, Kisspeptin receptor, Leukotriene receptors, Lysophospholipid receptors, Melanin-concentrating hormone receptors, Melanocortin receptors, Melatonin receptors, Metabotropic glutamate receptors, Motilin receptor, Neuromedin U receptors, Neuropeptide FF/neuropeptide AF receptors, Neuropeptide S receptor, Neuropeptide W/neuropeptide B receptors, Neuropeptide Y receptors, Neurotensin receptors, Opioid receptors, Orexin receptors, P2Y receptors, Parathyroid hormone receptors, Peptide P518 receptor, Platelet-activating factor receptor, Prokineticin receptors, Prolactin-releasing peptide receptor, Prostanoid receptor, Protease-activated receptors, Relaxin family peptide receptors, Somatostatin receptors, Tachykinin receptors, Thyrotropin-releasing hormone receptor, Trace amine receptor, Urotensin receptor, VIP and PACAP receptors, Vasopressin and oxytocin receptors, Class A Orphans, Class B Orphans, Class C Orphans Non-signaling 7TM chemokine-binding proteins, BLT1, BLT2, CysLT1, CysLT2, OXE, CCRL2, CMKLR1, GPR1, GPR3, GPR4, GPR6, GPR12, GPR15, GPR17, GPR18, GPR19, GPR20, GPR21, GPR22, GPR25, GPR26, GPR27, GPR31, GPR32, GPR33, GPR34, GPR35, GPR37, GPR37L1, GPR39, GPR42, GPR45, GPR50, GPR52, GPR55, GPR61, GPR62, GPR63, GPR65, GPR68, GPR75, GPR78, GPR79, GPR82, GPR83, GPR84, GPR85, GPR87, GPR88, GPR101, GPR119, GPR120, GPR132, GPR135, GPR139, GPR141, GPR142, GPR146, GPR148, GPR 149, GPR150, GPR151, GPR152, GPR153, GPR160, GPR161, GPR162, GPR171, GPR173, GPR174, GPR176, GPR182, GPR183, LGR4, LGR5, LGR6, LPAR6, MAS1, MAS1L, MRGPR, MRGPRE, MRGPRF, MRGPRG, MRGPRX1, MRGPRX2, MRGPRX3, MRGPRX4, OPN3, OPN5, OXGR1, P2RY8, P2RY10, SUCNR1, TAAR2, TAAR3, TAAR4, TAAR5, TAAR6, TAAR8, TAAR9, Calcium-Activated Potassium Channels, CatSper and Two-Pore Channels, Cyclic Nucleotide-Regulated Channels, Inwardly Rectifying Potassium Channels, Transient Receptor Potential Channels, Two-P Potassium Channels, Voltage-Gated Calcium Channels, Voltage-Gated Potassium Channels, Voltage-Gated Sodium Channels, 5-HT3 receptors, GABAA receptors, Glycine receptors, Ionotropic glutamate receptors, Nicotinic acetylcholine receptors, P2X receptors, ZAC, Thyroid Hormone Receptors, Retinoic acid receptors, Peroxisome proliferator-activated receptors, Rev-Erb receptors, RAR-related orphan receptors, Liver X receptor-like receptors, Vitamin D receptor-like receptors, Hepatocyte nuclear factor-4 receptors, Retinoid X receptors, Testicular receptors, Tailess-like receptors, COUP-TF-like receptors, Estrogen receptors, Estrogen-related receptors, 3-Ketosteroid receptors, Nerve growth factor IB-like receptors, Fushi taruzu F1-like receptors, Germ cell nuclear factor receptors, DAX-like receptors, Human Epidermal growth factor Receptor 1, Human Epidermal growth factor Receptor 2, Estrogen receptor-α (ERα; NR3A1, ESR1), Estrogen receptor-β (ERβ; NR3A2, ESR2), Estrogen-related receptor-α (ERRα; NR3B1, ESRRA), Estrogen-related receptor-β (ERRβ; NR3B2, ESRRB), Estrogen-related receptor-γ (ERRγ; NR3B3, ESRRG), Glucocorticoid receptor (GR; NR3C1), Mineralocorticoid receptor (MR; NR3C2), Progesterone receptor (PR; NR3C3, PGR), and Androgen receptor (AR; NR3C4).
12. The method according to claim 11, wherein the gene encodes an insulin receptor.
13. The method of claim 1, wherein each splicing code comprises an E5 junction sequence comprising nine nucleotides of an E5 sequence upstream of the 5′ splice site and an I3 junction sequence comprising nine nucleotides of an I3 sequence upstream of the 3′ splice site.
14. A method of identifying at least one potentially alternatively spliced transcript of a gene from a biological tissue from a species, the method comprising:
(a) obtaining at least one pre-mRNA sequence from the biological tissue;
(b) generating a splicing code table of the species, comprising the substeps of:
(i) determining substantially all of the 5′ splice sites and 3′ splice sites from relevant existing databases, wherein the relevant existing databases comprise genome sequences of the species, and wherein the genome sequences comprise at least an intron dataset;
(ii) dividing the 5′ splice sites into 5′ exonic (E5) and 5′ intronic (I5) splicing sequences;
(iii) dividing the 3′ splice sites into 3′ intronic (I3) and 3′ exonic (E3) splicing sequences;
(iv) constructing the splicing code table by parsing out E5 sequences, I5 sequences, I3 sequences, and E3 sequences from the intron dataset, each splicing code comprising E5 junction sequence-the first intronic dinucleotide-I3 junction sequence, wherein an E5 junction sequence comprises eight to twelve nucleotides of an E5 sequence upstream of the 5′ splice site and an I3 junction sequence comprises six to ten nucleotides of an I3 sequence upstream of the 3′ splice site, and storing the splicing code table in a programmable, searchable computer database; and
(v) based on the splicing code table, generating by a computer processor a set of putative markers, wherein each of the set of putative markers comprises an E5-the first intronic dinucleotide-I3 sequence of the gene;
(d) identifying the at least one potentially alternatively spliced transcript in the at least one pre-mRNA sequence by a biochemical assay, wherein:
the biochemical assay comprises at least one of RT-PCR, RNA sequencing, DNA sequencing, DNA-seq sequencing and array hybridization; and
the biochemical assay comprises use of at least one primer and/or probe, and wherein the at least one primer and/or probe is designed based on the E5 sequences and the E3 sequences of the at least one of the putative markers and wherein the at least one primer and/or probe is designed to assay an alternatively spliced transcript.
15. The method according to claim 14, wherein the at least one potentially alternatively spliced transcript is a truncated isoform of the gene; and step (b) further comprising, after substep (iv), a substep of removing putative markers to which the E5 sequences and the E3 sequences correspond are mapped to be a membrane-binding domain.
16. The method according to claim 15, wherein the species is a mammal.
17. The method according to claim 16, wherein the gene encodes a receptor, an ion-channel or a neurotransmitter, selected from a group consisting of insulin receptor, G protein-coupled receptors, 5-Hydroxytryptamine receptors, Acetylcholine receptors (muscarinic), Adenosine receptors, Adrenoceptors, Anaphylatoxin receptors, Angiotensin receptors, Apelin receptor, Bile acid receptor, Bombesin receptors, Bradykinin receptors, Calcitonin receptors, Calcium-sensing receptors, Cannabinoid receptors, Chemokine receptors Cholecystokinin receptors, Corticotropin-releasing factor receptors, Dopamine receptors, Endothelin receptors, Estrogen (G protein coupled) receptor, Formylpeptide receptors, Free fatty acid receptors, Frizzled receptors, GABAB receptors, Galanin receptors, Ghrelin receptor, Glucagon receptor family, Glycoprotein hormone receptors, Gonadotrophin-releasing hormone receptors, Histamine receptors, Hydroxycarboxylic acid receptors, Kisspeptin receptor, Leukotriene receptors, Lysophospholipid receptors, Melanin-concentrating hormone receptors, Melanocortin receptors, Melatonin receptors, Metabotropic glutamate receptors, Motilin receptor, Neuromedin U receptors, Neuropeptide FF/neuropeptide AF receptors, Neuropeptide S receptor, Neuropeptide W/neuropeptide B receptors, Neuropeptide Y receptors, Neurotensin receptors, Opioid receptors, Orexin receptors, P2Y receptors, Parathyroid hormone receptors, Peptide P518 receptor, Platelet-activating factor receptor, Prokineticin receptors, Prolactin-releasing peptide receptor, Prostanoid receptor, Protease-activated receptors, Relaxin family peptide receptors, Somatostatin receptors, Tachykinin receptors, Thyrotropin-releasing hormone receptor, Trace amine receptor, Urotensin receptor, VIP and PACAP receptors, Vasopressin and oxytocin receptors, Class A Orphans, Class B Orphans, Class C Orphans Non-signaling 7TM chemokine-binding proteins, BLT1, BLT2, CysLT1, CysLT2, OXE, CCRL2, CMKLR1, GPR1, GPR3, GPR4, GPR6, GPR12, GPR15, GPR17, GPR18, GPR19, GPR20, GPR21, GPR22, GPR25, GPR26, GPR27, GPR31, GPR32, GPR33, GPR34, GPR35, GPR37, GPR37L1, GPR39, GPR42, GPR45, GPR50, GPR52, GPR55, GPR61, GPR62, GPR63, GPR65, GPR68, GPR75, GPR78, GPR79, GPR82, GPR83, GPR84, GPR85, GPR87, GPR88, GPR101, GPR119, GPR120, GPR132, GPR135, GPR139, GPR141, GPR142, GPR146, GPR148, GPR149, GPR150, GPR151, GPR152, GPR153, GPR160, GPR161, GPR162, GPR171, GPR173, GPR174, GPR176, GPR182, GPR183, LGR4, LGR5, LGR6, LPAR6, MAS1, MAS1L, MRGPR, MRGPRE, MRGPRF, MRGPRG, MRGPRX1, MRGPRX2, MRGPRX3, MRGPRX4, OPN3, OPN5, OXGR1, P2RY8, P2RY10, SUCNR1, TAAR2, TAAR3, TAAR4, TAAR5, TAAR6, TAAR8, TAAR9, Calcium-Activated Potassium Channels, CatSper and Two-Pore Channels, Cyclic Nucleotide-Regulated Channels, Inwardly Rectifying Potassium Channels, Transient Receptor Potential Channels, Two-P Potassium Channels, Voltage-Gated Calcium Channels, Voltage-Gated Potassium Channels, Voltage-Gated Sodium Channels, 5-HT3 receptors, GABAA receptors, Glycine receptors, Ionotropic glutamate receptors, Nicotinic acetylcholine receptors, P2X receptors, ZAC, Thyroid Hormone Receptors, Retinoic acid receptors, Peroxisome proliferator-activated receptors, Rev-Erb receptors, RAR-related orphan receptors, Liver X receptor-like receptors, Vitamin D receptor-like receptors, Hepatocyte nuclear factor-4 receptors, Retinoid X receptors, Testicular receptors, Tailess-like receptors, COUP-TF-like receptors, Estrogen receptors, Estrogen-related receptors, 3-Ketosteroid receptors, Nerve growth factor IB-like receptors, Fushi taruzu F1-like receptors, Germ cell nuclear factor receptors, DAX-like receptors, Human Epidermal growth factor Receptor 1, Human Epidermal growth factor Receptor 2, Estrogen receptor-α (ERα; NR3A1, ESR1), Estrogen receptor-β (ERβ; NR3A2, ESR2), Estrogen-related receptor-α (ERRα; NR3B1, ESRRA), Estrogen-related receptor-β (ERRβ; NR3B2, ESRRB), Estrogen-related receptor-γ (ERRγ; NR3B3, ESRRG), Glucocorticoid receptor (GR; NR3C1), Mineralocorticoid receptor (MR; NR3C2), Progesterone receptor (PR; NR3C3, PGR), and Androgen receptor (AR; NR3C4).
18. The method according to claim 17, wherein the gene encodes an insulin receptor.
19. The method of claim 14, wherein each splicing code comprises an E5 junction sequence comprising nine nucleotides of an E5 sequence upstream of the 5′ splice site and an I3 junction sequence comprising nine nucleotides of an I3 sequence upstream of the 3′ splice site.
20. A method for identifying at least one potentially alternatively spliced transcript in at least one pre-mRNA sequence obtained from biochemical analysis of a biological sample from a species, the method comprising:
(a) generating a splicing code table of the species, comprising the substeps of:
determining substantially all of the 5′ splice sites and 3′ splice sites from relevant existing databases, wherein the relevant existing databases comprise genome sequences of the species, and wherein the genome sequences comprises at least an intron dataset;
dividing the 5′ splice sites into 5′ exonic (E5) and 5′ intronic (I5) splicing sequences;
dividing the 3′ splice sites into 3′ intronic (I3) and 3′ exonic (E3) splicing sequences;
constructing the splicing code table by parsing E5 sequences, I5 sequences, I3 sequences, and E3 sequences from the intron dataset, each splicing code comprising E5 junction sequence-the first intronic dinucleotide-I3 junction sequence, wherein an E5 junction sequence comprises eight to twelve nucleotides of an E5 sequence upstream of the 5′ splice site and an I3 junction sequence comprises six to ten nucleotides of an I3 sequence upstream of the 3′ splice site, and storing the splicing code table in a programmable, searchable computer database;
generating by a computer processor putative markers, wherein each of the putative markers comprises an E5-the first intronic dinucleotide-I3 sequence of all genes of interest of the species;
(b) aligning the at least one pre-mRNA sequence with each of the putative markers in the splicing code table;
(c) determining that the at least one RNA sequence is an alternatively spliced transcript candidate if the at least one pre-mRNA sequence is found to have a substantially identical match with at least one of the putative markers in the splicing code table and it is not identical to putative markers; or determining that the at least one pre-mRNA sequence is not an alternatively spliced transcript candidate if no substantially identical matches are found between the at least one pre-mRNA sequence and any of the putative markers in the splicing code table; and
(d) verifying, if the at least one RNA sequence is determined to be an alternatively spliced transcript candidate in step (c), that the at least one RNA sequence is a real alternatively spliced transcript by a biochemical assay,
wherein the biochemical assay in step (d) comprises contacting RNA isolated from the biological sample with at least one of primer and/or probe, wherein the at least one primer and/or probe is designed based on the E5 sequences and the E3 sequences of the at least one of the putative markers with which the at least one pre-mRNA sequence is found to be substantially identical and wherein the at least one primer and/or probe is designed to bind the alternatively spliced transcript, and detecting resultant binding between the RNA isolated from the biological sample and the at least one primer and/or probe.
21. The method of claim 20, wherein each splicing code comprises an E5 junction sequence comprising nine nucleotides of an E5 sequence upstream of the 5′ splice site and an I3 junction sequence comprising nine nucleotides of an I3 sequence upstream of the 3′ splice site.