Methods of promoting angiogenesis using cerium oxide nanoparticles

Description

CROSS-REFERENCE TO RELATED APPLICATION

Priority is claimed to provisional patent application Ser. No. 61/493,994 titled “Pro-angiogenic properties of cerium oxide nanoparticles: Role of surface Ce³⁺/Ce⁴⁺ ratio on induction of tube formation,” which was filed Jun. 7, 2011 and is incorporated herein by reference in its entirety.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

This invention was made with government support under grant 1R01AG031529-01 awarded by the National Institutes of Health and under grants 0708172 CBET and 080473355 CBET awarded by the National Science Foundation. The government has certain rights in the invention.

SEQUENCE LISTING

This application contains a Sequence Listing electronically submitted via EFS-web to the United States Patent and Trademark Office as a text file named “Sequence Listing.txt.” The electronically filed Sequence Listing serves as both the paper copy required by 37 C.F.R. §1.821(c) and the computer readable file required by 37 C.F.R. §1.821(c). The information contained in the Sequence Listing is incorporated herein by reference in its entirety.

FIELD OF THE INVENTION

The invention relates to promoting angiogenesis and, more particularly, to using cerium oxide nanoparticles to promote angiogenesis.

BACKGROUND

Angiogenesis is an important physiological process in which new blood vessels form from pre-existing blood vessels. Compounds that target angiogenesis offer a route to treating diseases characterized by poor or abnormal vascularization of biological tissue. Abnormal angiogenesis can trigger pathological conditions such as cancer, chronic inflammation, diabetic retinopathy and arthritis. Insufficient angiogenesis is a major pathological component of chronic wounds or ischemic heart diseases.

Compounds aimed at treating diseases related to angiogenesis typically either inhibit or induce the creation of new blood vessels. Angiogenesis inhibitors are used to prevent new blood vessels from forming in areas where blood vessels should not form. In contrast, angiogenesis promoters are used in areas where the tissue requires new blood vessels to perform essential functions such as repairing wounds. Neo-vascularization should be promoted in such areas in order to transport nutrients to the site.

Angiogenesis can be promoted chemically by various endogenous angiogenic growth factors such as vascular endothelial growth factor (“VEGF”) and fibroblast growth factor (“FGF”). VEGF-A and bFGF have been proposed to increase the blood flow to the damaged area. Cells called “endothelial cells” line mature blood vessels and typically do not proliferate. However, if endothelial cells are activated by an angiogenic growth factor, they will proliferate and migrate into un-vascularized tissue to form new blood vessels.

Blood vessels are surrounded by biological tissue in an extracellular matrix. The formation of new blood vessels is a function of the interactions between endothelial cells and the interaction of the endothelial cells with the extracellular matrix. These interactions are regulated by receptors on the surface of endothelial cells, which are sensitive to particular molecules such as angiogenic growth factors.

Angiogenesis can also be promoted chemically by applying non-endogenous compounds. For example, Eu(III) hydroxide nanorods are reported to have pro-angiogenic properties.

Cerium oxide nanoparticles exhibit interesting physical behavior, which has been exploited for various biological applications. Cerium oxide nanoparticles are typically considered to be antioxidants since they have been shown to scavenge reactive oxygen species or reactive oxygen intermediates. The antioxidant properties of cerium oxide nanoparticles are believed to be a function of the fact that, at the surface of the nanoparticles, cerium can be reversibly oxidized from a +3 state to a naturally stable +4 oxidation state.

Antioxidants typically inhibit, rather than promote, angiogenesis. Accordingly, the conventional wisdom on cerium oxide nanoparticles would suggest that they inhibit angiogenesis. Remarkably, the present inventors have unexpectedly found that cerium oxide nanoparticles also promote angiogenesis and are useful for treating physiological conditions that require the growth of new blood vessels in order to remediate the condition.

SUMMARY

In view of the foregoing, it is an object of the invention is to provide methods of promoting angiogenesis using cerium oxide nanoparticles.

In certain methods of the invention cerium oxide nanoparticles are used to promote angiogenesis in animal tissue. In such methods, angiogenesis is promoted in the tissue by contacting the tissue with a composition comprising cerium oxide nanoparticles effective for stimulating proliferation of endothelial cells associated with the tissue.

In certain methods of the invention cerium oxide nanoparticles are used to promote angiogenesis in a patient having a physiological condition that can be remediated by increasing endothelial cell proliferation by administering the cerium oxide nanoparticles to the patient.

In certain methods of the invention cerium oxide nanoparticles are used to promote angiogenesis in a patient having a condition that can be remediated by increasing endothelial cell proliferation by contacting the a tissue of the patient with cerium oxide nanoparticles in an amount sufficient to transiently lower the intracellular oxygen concentration of the tissue, wherein the transient lowering of the intracellular oxygen concentration stimulates expression of HIF1α, promotes proliferation of endothelial cells, and promotes angiogenesis in the tissue.

BRIEF DESCRIPTION OF THE DRAWINGS

The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

FIGS. 1A-D show the characterization of cerium oxide nanoparticles (CNPs). A shows HRTEM image of the differently synthesized CNPs (CNP-I & CNP-II), having similar shape and size (3-5 nm). The selected area electron diffraction (SAED) pattern in the inset of A confirms the fluorite structure where A (100), B (200), C (220), D (311) are the crystal plane of the lattice. B shows the XPS spectrum of CNP-I and CNP-II. C and D show deconvoluted XPS spectra of CNP-I and CNP-II. E shows the zeta potential of CNP-I and CNP-II.

FIG. 2 shows representative HRTEM images of the different shaped and sized CNPs discussed in the examples section.

FIGS. 3A-D show the assessment of cell viability in HUVECs exposed to CNPs. HUVEC cells were cultured in endothelial cell media (ScienceCell, San Diego, Calif., USA) supplemented with 5% FBS and 100 IU ml−1 penicillin, and MTT dye reduction was assessed after 24 h (A) and 48 (B) treatment with varying concentrations of CNP-I and CNP-II. C and D are graphs that show the cell viability of cells treated with different size (10-15 nm), 15-20 nm, >25 nm and 30-50 nm) and shaped (star-shaped and rod-shaped) CNPs at 1000 nM concentration after 24 hr and 48 hr of incubation, respectively. The data are reported as the mean of multiple independent cultures and the error represents standard deviation.

FIGS. 4A-G show that CNPs promote angiogenesis in HUVEC cell culture models. HUVEC cells were cultured with vehicle (control), 10 μM β-estradiol (negative control), 30 ng rVEGF (positive control) and varying concentrations of cerium oxide nanoparticles (100 nM to 1 μM CNP-I or CNP-II) and tube formation counted as the number of branches at 10× magnification after 8 hr of treatment. The data represent the mean of at least six different experiments and the plotted error represents the standard deviation. A and B show the number of tubes formed when cells were exposed to different concentrations of CNP-I and CNP-II respectively. Images of tubes formed in beta-estradiol (C), control (D), VEGF treated (E), 1 μM CNP-I treated (F) and 1000 nM CNP-II treated (G) after 8 hr of incubation are shown.

FIGS. 5A-D shows the effect of the Ce³⁺/Ce⁴⁺ ratio, zeta potential, size and shape of CNPs on tube formation. Tube formation in (A) CNP-I (Ce³⁺/Ce⁴⁺→1.33), CNP-II (Ce³⁺/Ce⁴⁺→0.37) and SiO₂; (B) CNP with different zeta potentials: CNP-I (+17.78±0.5 mV), CNP-I′ (−20±1.4 mV), CNP-II (−14.05±0.83 mV) and CNP-II′ (+34.05±0.52 mV); (C) CNPs with varying size; (D) CNPs with varying shape. All the experiments were carried out with cells exposed to nanoparticles at a concentration of 1 μM. The data represent a mean of at least six experiments and the error plotted represents the standard deviation.

FIGS. 6A-D show CNP induced angiogenesis measured by Chick CAM assay. The extent of angiogenesis on CAM's treated with either (A) methylcellulose, (B) 50 ng of VEGF-A, (C) 1 μg of CNP1 or (D) 1 μg of CNP2. (E) The extent of CAM angiogenesis measured by counting the number of vascular sprouts from tertiary vessels in a minimum of 8 separate experiments. Hpf means high power field.

FIGS. 7A-C show that CNPs induced VEGF expression. (A) The amount of VEGF released from HUVEC cells to culture supernatant (exposed to varying concentrations of CNP-I) were measured by using ELISA. (B) The intracellular VEGF levels from HUVEC cells after CNP-I treatment (for different time points) was analyzed using the western blot technique. Semi-quantitative data obtained by densitometric analysis of western blot images are presented as mean±standard deviation from multiple experiments. (C) Changes in HUVEC cell m-RNA level after CNPI treatment were determined by RT-PCR.

FIGS. 8A-D show that reactive oxygen species are not generated in HUVECs during CNP-I exposure. DCFH₂-DA (green, used for estimate ROS)/DAPI (blue, used for nuclear staining) staining were used. A, B, C and D are control, positive control, 30 ng VEGF and CNP-I respectively. Time dependent expression levels of two markers of cellular oxidative stress, hemeoxygenase 1 (E) and thioredoxin reductase (F) with or without CNP-I are shown.

FIGS. 9A-D show that CNPs regulate of HIF1α by altering the intracellular oxygen concentration. Analysis of HIF1α in cytoplasmic (A) and nuclear (B) fractions at different time points (0 min, 30 min and 2 hr) in cells treated with 1 μM CNP-I or CoCl₂ used as a positive control (2 hr). Semi-quantitative data obtained by densitometric analysis are presented as mean±standard deviations from two independent experiments. The bar diagram is the fold of HIF1α amount as normalized to the β-actin expression. C shows the immunofluorescence image (left to right: Blue-DCF, Green-pimonidazole staining and merge image) of control and CNP treated HUVEC cells for different time durations (0 min, 30 min, 2 hr). The semi-quantitative data (D) calculated by measuring the fluorescence intensity of cells and presented as mean±standard deviations.

FIG. 10 shows immunoblot detection of HDAC-1 in nuclear and cytoplasmic extracts from HUVEC cells. HUVEC cells were treated with CoCl₂ (2 h) or 1000 nM CNPs for two different time durations (30 min and 2 hr). Nuclear and cytoplasmic lysates were prepared from treated and untreated cells and analyzed for enrichment of the nuclear marker protein HDAC-1. In all cases, nuclear extracts show an enhancement of nuclear proteins. Here, N=nuclear lysate and C=cytoplasmic lysate.

DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS

In the Summary above and in the Detailed Description of Preferred Embodiments, reference is made to particular features (including method steps) of the invention. It is to be understood that the disclosure of the invention in this specification includes all possible combinations of such particular features. For example, where a particular feature is disclosed in the context of a particular aspect or embodiment of the invention, that feature can also be used, to the extent possible, in combination with and/or in the context of other particular aspects and embodiments of the invention, and in the invention generally.

The term “comprises” is used herein to mean that other features, ingredients, steps, etc. are optionally present. When reference is made herein to a method comprising two or more defined steps, the steps can be carried in any order or simultaneously (except where the context excludes that possibility), and the method can include one or more steps which are carried out before any of the defined steps, between two of the defined steps, or after all of the defined steps (except where the context excludes that possibility).

This invention may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will convey the scope of the invention to those skilled in the art.

Embodiments of the invention involve the use of cerium oxide nanoparticles for promoting angiogenesis. A particular embodiment is a method of promoting angiogenesis in animal tissue. The method comprises contacting the tissue with a composition comprising cerium oxide nanoparticles effective for stimulating proliferation of endothelial cells associated with the tissue. Animal tissue includes but is not limited to living or artificial mammalian or non-mammalian tissue that is capable of being vascularized. The animal tissue is preferably a tissue for which neovascularization would provide a benefit, such as damaged tissue that needs neovascularization to heal, as opposed to a tissue in which neovascularization is to be avoided, such as certain cancerous tissues.

Contacting the tissue with the composition may be achieved by bringing or putting the composition into a state or condition of touching the tissue or being in immediate or local proximity to the tissue. Examples of techniques for contacting the tissue include conventional techniques for administering pharmaceutical substances such as, for example, intravenous, pericardial, oral, via implant, transmucosal, transdermal, intramuscular, subcutaneous, intraperitoneal, intrathecal, intralymphatical, intralesional, epidural, or topical administration techniques.

“Stimulating proliferation of endothelial cells” means that the cerium oxide nanoparticles are, at least in part, responsible for increasing the number of endothelial cells in the tissue. The increased number of endothelial cells allows for neovascularization of the tissue. Remarkably, the data discussed in the examples section show that cerium oxide nanoparticles can stimulate a 400% increase in angiogenesis when compared to a control sample.

Another particular embodiment of a method for promoting angiogenesis comprises administering cerium oxide nanoparticles to a patient having a physiological condition that can be remediated by increasing endothelial cell proliferation. The term “administering” means the giving or applying of a substance, including in vivo and/or ex vivo administration. Compositions may be administered systemically either orally, buccally, parenterally, topically, by inhalation or insufflations (i.e., through the mouth or through the nose), or rectally in dosage unit formulations containing conventional pharmaceutically acceptable carriers, adjuvants, and vehicles as desired, or may be locally administered by means such as, but not limited to, injection, implantation, grafting, topical application, or parenterally. Administering can be performed, for example, once, a plurality of times, and/or over one or more extended periods.

The term “physiological condition” means any abnormal physical or physiological condition characterized, at least in part, by a need for neovascularization in order to remediate the condition. Examples of such conditions include, but are not limited to: wounds and ischemic conditions where insufficient angiogenesis is the main cause of the pathology.

A “patient” is a human or other animal subject that has the physiological condition. Examples of patients include, but are not limited to mammalian subjects such as humans, mice, rats, dogs, pigs, rabbits, monkeys, or apes. Examples of patients also include, but are not limited to non-mammalian subjects such as chickens, for example.

Another particular embodiment of a method of promoting angiogenesis involves promoting angiogenesis in a patient having a condition that can be remediated by increasing proliferation of endothelial cells. In this embodiment, the method comprises contacting a tissue of the patient with cerium oxide nanoparticles in an amount sufficient to transiently lower an intracellular oxygen concentration of the tissue, wherein the transient lowering of the intracellular oxygen concentration stimulates expression of HIF1α and promotes proliferation of endothelial cells in the tissue.

In effect, contacting the tissue with the cerium oxide nanoparticles leads to a transient or short term decrease in the intracellular oxygen environment of the tissue. This, in turn, stimulates the expression of the angiogenic growth factor HIF1α, which promotes proliferation of endothelial cells and promotes angiogenesis.

Details about the cerium oxide nanoparticles and cerium oxide nanoparticles compositions useful in the methods of the invention are now described.

The cerium oxide nanoparticles may be mixed with other substances to provide a pharmaceutically acceptable dosage form. Examples of these substances include one or more excipients, diluents, disintegrants, emulsifiers, solvents, processing aids, buffering agents, colorants, flavorings, solvents, coating agents, binders, carriers, glidants, lubricants, granulating agents, gelling agents, polishing agents, suspending agent, sweetening agent, anti-adherents, preservatives, emulsifiers, antioxidants, plasticizers, surfactants, viscosity agents, enteric agents, wetting agents, thickening agents, stabilizing agents, solubilizing agents, bioadhesives, film forming agents, essential oils, emollients, dissolution enhancers, dispersing agents, or combinations thereof.

The cerium oxide nanoparticles may be spherical, rod-shaped, star-shaped, or polygonal. As discussed in the examples section, the shape of the cerium oxide nanoparticles apparently has little effect on their ability to promote angiogenesis with the exception being that the rod-shaped cerium oxide nanoparticles resulted in a slightly decreased endothelial cell proliferation.

In a preferred embodiment, the cerium oxide nanoparticles are spherically-shaped, meaning that they more or less approximate the shape of a sphere. Preferably, the average diameter of the spherically-shaped cerium oxide nanoparticles is about 15 nm or less, about 1 nm to about 15 nm, about 2 nm to about 6 nm, or about 3 nm to about 5 nm. In a particularly preferred embodiment, the spherically-shaped cerium oxide nanoparticles have an average diameter of 3 nm to 5 nm as measured by transmission electron microscopy. In embodiments in which the cerium oxide nanoparticles are not spherically shaped, it is preferred that the average dimension between two opposing sides of the nanoparticles is 15 nm or less.

The cerium oxide nanoparticles have a cerium oxide core with an external surface. The surface is characterized according to the percentage of Ce(3+) relative to Ce(4+) ions thereon. Although the amount is not intended to be limiting, when used in methods of the invention, some preferred ranges of Ce(3+):Ce(4+) percentages are: about 80%:20% to about 20%:80%, about 75%:25% to about 25%:75%, about 60%:40% to about 25%:75%, or about 57%:43% to about 27%:73%. In certain preferred embodiments, the percentage of Ce(3+) relative to Ce(4+) is >50% Ce(3+).

The concentration of cerium oxide in the composition that is administered to the patient or used to contact the tissue can be varied according to the type of administration or tissue being contacted. In preferred embodiments, the cerium oxide concentration in the composition is between about 0.5 μM to about 1.5 μM. In other preferred embodiments, the cerium oxide concentration in the composition is about 1 μM.

EXAMPLES

The following examples are provided for the purpose of illustration and do not limit the scope of the invention in any way.

Example 1

Preparation and Characterization of Cerium Oxide Nanoparticles

This example discusses the preparation and characterization of cerium oxide nanoparticles used in the subsequent examples.

Cerium oxide nanoparticles were prepared according to two different synthetic protocols. In either protocol 99.999% pure cerium nitrate hexahydrate purchased from Sigma Aldrich was used as a precursor reagent.

In the first synthetic protocol, the cerium oxide nanoparticles referred to herein as (CNP-I) were prepared using the wet chemical method described in an article titled “Anti-inflammatory Properties of Cerium Oxide Nanoparticles,” published in Small 2009 5(24) at pages 2848-2856. The portion of this article that describes the synthesis of cerium oxide nanoparticles is incorporated herein by reference.

In the second synthetic protocol, the cerium oxide nanoparticles referred to herein as (CNP-II) were prepared using a conventional NH₄OH precipitation method. Briefly, cerium nitrate hexahydrate was dissolved in deionized sterile water. A stoichiometric amount NH₄OH was added to the cerium nitrate solution and was stirred for about 4 hr at room temperature. The cerium oxide nanoparticles that formed were subsequently separated from the solution by centrifugation at about 8000 g for about 10 minutes.

The size and morphology of the nanoparticles were analyzed using high resolution transmission electron microscopy (HRTEM), with a FEI Tecnai F30 having an energy dispersive X-ray (EDX) analyzer. The oxidation states of the cerium on the surface of the nanoparticle were calculated using a 5400 PHI ESCA (XPS) spectrometer and Mg—Kα X-radiation (1253.6 eV) at a power of 350 W.

As shown in FIG. 1A, the size of the CNP-I and CNP-II nanoparticles were typically about 3 to about 5 nm. For some experiments different sized nanoparticles were used, however. Cerium oxide nanoparticles having a size of about 10 nm to about 15 nm were purchased from from Alfa Aesar, Inc. Cerium oxide nanoparticles having a size of about 15 nm to about 20 nm were purchased from Nanostructure and Amorphous Inc. Cerium oxide nanoparticles having a size of about >25 nm were purchased from Sigma Aldrich, Inc. Cerium oxide nanoparticles having a size of about 50 nm to about 60 nm were purchased from Johnson Matthey, Plc.

One difference between CNP-I and CNP-II is that CNP-I and CNP-II include different ratios of Ce³⁺/Ce⁴⁺ on their surfaces. FIGS. 1B and C show the Ce (3d) XPS spectrum of CNP-I and CNP-II. CNP-I has a high Ce³⁺ concentration (57%) as compared to CNP-II (27%). The Ce³⁺ concentration was calculated as described in an article titled “Symmetry-Driven Spontaneous Self-Assembly of Nanoscale Ceria Building Blocks to Fractal Superoctahedra” published in Crystal Growth & Design 2009 9(3) at pages 1614-1620. The portion of that article describing how to calculate the concentration of cerium ions is incorporated by reference herein.

Another difference between CNP-I and CNP-II is that the surface charge of the nanoparticles has a different polarity. The surface charge is quantified using a parameter called a Zeta potential. The Zetapotentials of CNP-I and CNP-II are +17.78±O.5 and −14.05±O.83 mV, respectively, as shown in FIG. 1D.

Cerium oxide nanoparticles with different shapes including stars, polygons, and nanorods have also been synthesized and confirmed by HRTEM (FIG. 2).

In the following examples, the cerium oxide nanoparticles samples were diluted in either phosphate buffer, saline solution, or cell culture media to the concentration indicated.

Example 2

CNP-I and CNP-II Induce the Formation of Endothelial Tubes

This example shows that cerium oxide nanoparticles promote proliferation of endothelial cells.

Proliferation of endothelial cells is the first step involved in angiogenesis. Proliferation of the human umbilical vein endothelial cells (HUVECs) was estimated using the tetrazolium dye reduction (MTT) assay. No cytotoxicity was observed in cells exposed to either of the CNPs (FIGS. 3A and B). Cell proliferation was also analyzed in the presence of different size and shaped cerium oxide nanoparticles at a concentration of 1 μM (FIGS. 3C and D). With the exception of cerium oxide nanorods, other size and shaped nanoparticles did not reveal any overt toxicity towards HUVEC cells. Exposure to cerium oxide nanorods led to a slight reduction in cell proliferation (P>0.05).

The endothelial tube formation assay is an in vitro model system where anti and pro-angiogenic molecules can be tested. FIG. 4 (A) shows the representative tube formation of the control, positive control (30 ng VEGF), negative control (10 pM 2-methoxyestradiol) and different concentrations of CNP-I exposure. Interestingly, we observed that the addition of CNP-I to cells resulted in a significant, concentration dependent, (P: −S; O.OOI; induction 40% of tube increase) formation. Further, up to 1 pM concentration increases of CNP-I up to 10 pM did not increase tube formation significantly (data not shown). A weaker induction of tube formation was seen (P: −S; O. 05; increase) with the addition of CNP-II (FIG. 4B.).

To confirm that tube formation induction is a unique property of CNPs, a similar sized SiO₂ nanoparticle (5-10 nm; FIG. 2) was tested and no tubes were observed (FIG. 5A). We also determined Lipopolysaccharide (LPS) contamination, because low levels of LPS may influence the tube formation assay. LPS was not detected using either of the CNPs (<0.005 EU/ml), showing that induction of tube formation is an intrinsic property of CNPs.

To determine whether the promotion of endothelial tube formation is a function of surface charge, we tested the effect of tube formation using CNP-I and CNP-II with inverted surface charge by treating the CNP-I and CNP-II with acid (1 mM HCL) or base (1 mM NaOH) while stirring for about 4 to about 6 hrs. After thorough washing with dH₂O, the inverted zeta potential of CNP-I* and CNP-II* was altered to −20±1.4 mV and +44.08±1.1 mV, respectively. We did not notice a difference between the promotion of tube formation when cells were treated with the original CNPs or the CNPs with inverted zeta potentials (FIG. 5B).

We also determined whether the endothelial cell culture medium (ECM) influenced the surface charge of CNP-I and CNP-II. CNP-I and CNP-II were analyzed after 1 hr incubation in ECM in the absence of cells. Both types of nanoparticles showed a net negative surface charge of about −9.23±0.56 mV. This suggests that CNPs interact with components of ECM, thereby shifting the surface charge towards the negative. Our combined results indicate that surface charge does not influence tube induction.

To determine possible size and shape effects, CNPs spanning: 3-5, 10-15, 15-20, >25 and 50-60 nm were exposed to HUVECS at a concentration of 1 μM. As shown in FIG. 5C, the 3-5 nm and 10-15 nm sized CNPs showed induced tube formation while exposing HUVECS to CNPs >15 nm in size did not result in tube formation. The micron size particles inhibited tube formation, though the inhibition was not statistically significant.

The size modulation may be linked to a change in the mechanism by which the cells interact with the CNPs. To eliminate this possibility, HUVECs were exposed to different shaped CNPs all having a size >15 nm. No discernible difference in tube formation was observed as a function of shape (FIG. 5D).

Example 3

CNP-I and CNP-II Promote Mature Vascular Sprouting in Chick Chorioallantoic Membrane (CAM) Sprouting Assay

This examples shows that cerium oxide nanoparticles promote vascular sprouting.

To support our observations using tube assays, we performed chick CAM sprouting assays. FIG. 6A-D represent the CAM after treatment with vehicle (A), VEGF (positive control) (B), 1 μM CNP-I (C) or 1 μM CNP-II (D). No vascular sprouting was observed when CAMs were treated with water only (control). Vascular sprouting was observed with CAMs, treated with VEGF (50 ng), as expected. The CAMs treated with CNP-I and CNP-II remarkably showed significant vascular sprouting. CNP-I promoted angiogenesis (P≦0.001) with matured vascular sprouting. CNP-II (P≦0.001) also presented similar angiogenesis but was slightly less robust compared to CNP-I. Quantitative data from the CAM assay is shown in FIG. 6E and reveals that CNP-I induces a 400% increase in angiogenesis compared to the un-stimulated control. Our results clearly demonstrate that CNPs induce endothelial cell proliferation as well as vascular sprouting.

Example 4

Cerium Oxide Nanoparticles Promote Angiogenesis Through a VEGF Regulated Pathway, by Regulating the Intracellular Oxygen Environment, and by Promoting Expression of HIF1α

This example shows that cerium oxide nanoparticles promote angiogenesis through a VEGF regulated pathway, by regulating the intracellular oxygen environment, and by stimulating the expression of HIF1α.

Next, we analyzed VEGF expression in a culture medium of HUVEC cells by ELISA (FIG. 7A). Specifically, we focused on HUVECs exposed to CNP-I to further understand the molecular mechanism underpinning the angiogenic properties of the CNPs. A significant increase in VEGF levels in the culture medium for CNP-I treated cells was observed. The amount of VEGF reached a maximum when the cells were exposed to a concentration of 1 μM CNP-I. In comparison, the amount of excreted VEGF was less when a 2 μM CNP concentration was used. This suggests that a CNP concentration of about 1 μM the optimum or, at least, close to the optimum concentration of CNPs for stimulating angiogenesis induction.

The intracellular VEGF expression in CNP treated cells was estimated using western blotting as well as the RT-PCR technique. VEGF expression was estimated in the whole cell lysate, as a function of time, at a concentration of 1 μM (FIG. 7B). Densitometric analysis of western blot images, normalized to β-actin, showed almost three fold increase after a 2 hr treatment. Similar observations were observed in mRNA expression of VEGF, assayed by quantitative RT-PCR (FIG. 7C). From the ELISA, Western blotting and RT-PCR data it was clear that exposure of cells to CNPs induces pro-angiogenesis via a VEGF-dependent pathway.

Angiogenesis can be induced either by inducing low levels of intracellular reactive oxygen species (ROS) or by controlling the intracellular oxygen concentration to the cells. To identify the pathways by which CNPs induce the angiogenesis, we have analyzed intracellular ROS levels using 2′,7′-dichlorodihydrofluorescein diacetate (DCF) (FIG. 8). No increase in ROS generation was observed in CNP-I treated cells (green-DCF positive) after 2 hr of CNP-I treatment. To further confirm, we analyzed the mRNA expression of hemeoxygenase-1 (HO1) and thioredoxin reductase (TrxR1), which is upregulated during oxidative stress. No increase in HO-1 or TrxR1 expression was observed up to 4 hr after addition of CNPs (FIG. 8C). These results indicate that exposure to CNPs most likely does not induce the angiogenesis by triggering higher levels of ROS, unlike Eu(OH)₃ nanorods which have been shown to induce angiogenesis through ROS generation.

Angiogenesis can be regulated by the local oxygen concentration of the tissue. This pathway is indirectly governed by HIF1α regulation and transcriptional activation of angiogenic factors, which regulates gene expression involved in angiogenesis. We estimated the amount of HIF1α in the cytoplasm and the amount translocated into the nucleus of HUVECs following CNPI treatment. FIGS. 9A and B present the amount of HIF1α in cytoplasmic and nuclear fraction in control, CNP-I and CoCl₂ (Positive control) treated cells (30). A higher amount of HIF1α in cytoplasmic fraction was observed in cells treated with CNP-I (both 30 min and 2 hr treatment) (FIG. 9A). As expected, HIF1α nuclear translocation was also found to be increased in CNP-I treated cells (FIG. 9B). FIG. 10 shows the immunoblotting of nuclear marker histone deacetylase (HDAC-1), which confirmed successful separation of nuclear and cytoplasmic fraction of CNPI treated cells. HIF1α stabilization and translocation to the nucleus indicates that CNPs induced angiogenesis by regulating HIF1α.

Conventional immunostaining with pimonidazole was used to determine the intracellular O₂ level. Immunostaining images representing the intracellular O₂ level at different times (30 min, 1 hr and 2 hr) after CNP-I treatment are shown in FIG. 9C. FIG. 9D shows quantitative immunofluorescence data, which is proportional to the amount of O₂. Interestingly, low O₂ levels were observed immediately after CNP-I treatment up to 1 hr, however O₂ levels returned to normal after 2 hr of CNP-I treatment. This supports our hypothesis that CNPs activate HIF1α by modulation intracellular O₂ level.

Experimental Techniques

Cell Cultures.

HUVEC cells were obtained from Lonza Walkersville, Inc (Walkersville, Md., USA). HUVEC calls were grown in Endothelial Basal Media-2 (Lonza Walkersville) containing 2% FBS. Cultures were maintained at 37° C. and 5% CO₂ in humidified incubator and only passages 3-6 were used for experiments.

Cell Viability Assay.

The proliferation of HUVEC were assayed by colorimetric assay using MTT (3-(4,5 dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) dye. Cells were cultured in 96-well plate at a density of 3×10³ cells/well. Then cells were treated with different concentration of CNPs incubated for 24 hr and hr. MTT were added to the cell at a final concentration of 1.2 mM and incubated for 4 hr. Cells were lysed and insoluble formazan product was dissolved using buffer (10% SDS, 0.1 M HCl) and the absorbance 570 nm of each well were measured using SpectraMax 190 spectrophometer (Molecular Devices, Sunnyvale, Calif., USA). Cell proliferation was calculated by absorbing the CNPs treated samples/untreated control in percentage.

Endothelial Tube Formation Assay.

Growth factor reduced BD matrigel (BD Bioscience) was coated on a 96 well plate. 8.0-10.0×10³ endothelial (HUVEC) cells (passage 4-5) were plated per well. Cells were then treated with different concentrations of CNPs (10 nm to 10 μM). A positive control containing 30 ng/ml of rVEGF was used and a negative control was included the inhibitor 2-Methoxyestradiol. The number of tubes formed were calculated after 5 hr hours using brightfield microscopy and experiments were included triplicate cultures and carried out three times to determine reproducibility.

CAM Assay.

The CAM assay was performed as described by Vlahakis et al in Journal of Biological Chemistry, 282(20, pgs. 15187-15196 (2007) and by Fang et al in Proceedings of the National Academy of Sciences, 97(8), pgs. 3884-3889 (2000). The portions of these two articles that describe how a CAM assay is performed are incorporated herein by reference. Chicken eggs were purchased from Charles River Laboratories, Franklin, Conn. and maintained in a humidified 39° C. incubator (Lyon Electric, Chula Vista, Calif.). Pellets containing 0.5% methylcellulose plus recombinant human VEGF-A (50 ng), CNP1 (1 μg) or CNP2 (1 μg) were placed onto the CAM of 10-day-old chick embryo. Eggs were subsequently incubated at 39° C. and on Day 13 the CAM's were fixed and excised and then imaged using a digital camera (Canon PowerShot 6) attached to a stereomicroscope (Zeiss, Germany). Angiogenesis was quantified by counting the branch points arising from tertiary vessels from a minimum of 8 specimens from the three separate experiments.

DCFDHA Staining.

2500 cells/cover slip were seeded on a glass cover slip in a 6-well cell culture plate and allowed cells to adhere for 24 hrs. The next day, old media was replaced with fresh media containing CNPs, positive and negative control. Cells were then treated with 20 μM DCFDA and incubated for 30 min and washed with PBS. After washing cells were fixed under chilled methanol (−20° C.) for 8 min. Cells were again washed twice with PBS followed by incubation with DAPI for 8 min. Finally cells were washed and mounted in anti-fade mounting media (Calbiochem) and slides were prepared. These slides were stored at 4° C. until imaging under Leica TCS SP5 laser scanning confocal microscope with a 40× objective lens.

Pimonidazole Immunostaining.

Pimonidazole staining was carried out as described by Varia et al in Gynecologic Oncology, 71(2), pgs. 270-277 (1998). The portion of this article that describes how pimonidazole staining was performed is incorporated herein by reference. HUVEC cells were grown on a cover slip overnight and then treated with 1 μM CNP-I for 0 min (control), 30 min, 1 hr, and 2 hr. Then pimonidazole (final concentration 200 μM) was added to the cells and incubated for 45 min and cells were permeabilized/fixed with ice cold methanol for 10 min at room temperature and washed thoroughly with saline. Fixed cells were then blocked using 3% BSA in saline. Then cells were stained with FITC-conjugated monoclonal Hypoxyprobe-1 monoclonal antibody 1 (mAb1) (1:100 in 3% BSA) for one hr at room temperature and DAPI were used to stained the nucleus. Finally, cells were washed and mounted in anti-fade mounting media (Calbiochem) and examined under Fluorescence microscope. Using Image J 1.44p software (Wayne Rasband, National Institute of Health, USA) fluorescence intensity of 20 individual cells/field and different fields were estimated for each group and plotted as mean and standard deviation.

Western Blotting.

HUVEC cells were seeded on 60 mm petri plates coated with growth factor reduced BD matrigel (BD biosciences). Following CNPs treatment at 0.5 hr, 2 hr and 4 hr or CoCl₂ (positive control) cells were recovered by BD cell recovery kit. NE_PER Nuclear and Cytoplasmic Extraction Kit (Thermo) were used to isolate nuclear and cytoplasmic extract. Proteins were measured using Bradford assay. An equal amount of protein (25 ug) was fractionated by 4-20% SDS-PAGE gradient gels and transferred to PVDF membrane. 1:2000 diluted monoclonal anti-human VEGF and HIF1α antibody were used as primary antibody, incubated for overnight at 4° C. Anti-mouse IgG conjugated with HRP (1:15,000) used as 2ndary antibody, incubated for 1 hr at room temperature. A chemiluminescence method was adopted for developing the blot. Equal loading was ensured by re-probing of the blot using anti-β-actin antibody (1:1000). Densitometry analysis (ImageJ Software) was also carried out from the image to have semi quantitative data of HIF1α nuclear translocation.

ELISA Assay for VEGF.

Growth factor reduced BD matrigel (BD Bioscience) was coated on a 96 well plate. 8.0-10.0×10³ endothelial (HUVEC) cells (passage 4-5) were plated per well as describe in endothelial tube formation assay. Then cells were treated with different concentration of CNPs and culture media were collected after 8 hr of incubation with nanoparticles. Amount of VEGF in culture media were assayed using an ELISA kit from Bio Scientific Corporation following the manufacturer's instructions.

RT-PCR.

Up-regulation or down-regulation of gene expressions flowing CNP treatment, if any, related to the angiogenesis were analyzed using RTPCR as a function of treatment time like 0 hr, 1 hr, 2 hr and 4 hr. Briefly, the total RNA were extracted similar as described in the previous section of PCR array. Equal quantity of mRNA (0.5 μg) were used for cDNA synthesis using Iscript cDNA synthesis kit (Bio-Rad). Oligonucleotides were designed using Primer3 Software available at www.simgene.com. RTPCR was carried out using Bio-Rad ICycler (Biomolecular Science Center) using SYBER green dye and the fold up-regulation or down-regulation of each gene were calculated from C_T values using GAPDH as an internal standard. The oligonucleotides used are listed in Table 1.

TABLE 1
Human Real-Time PCR Primers, listed 5′ to 3′

		SEQ ID NO:	Sequence
	HO-1 forward	SEQ ID NO: 1	ctgagttcatgaggaactttcagaag
	HO-1 reverse	SEQ ID NO: 2	tggtacagggaggccatcac
	Trx forward	SEQ ID NO: 3	gcagatcgagagcaagactg
	Trx reverse	SEQ ID NO: 4	ctccagaaaattcacccacc
	VEGF forward	SEQ ID NO: 5	acacattgttggaagaagcagccc
	VEGF reverse	SEQ ID NO: 6	aggaaggtcaaccactcacacaca
	GAPGH forward	SEQ ID NO: 7	agtagaggcagggatgatgtt
	GAPDH reverse	SEQ ID NO: 8	ctttggtatcgtggaaggactc

The invention has been described above with reference to the accompanying drawings, in which preferred embodiments of the invention are shown. Unless otherwise defined, all technical and scientific terms used herein are intended to have the same meaning as commonly understood in the art to which this invention pertains and at the time of its filing. Although various methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described. The skilled should understand that the methods and materials used and described are examples and may not be the only ones suitable for use in the invention.

In the specification set forth above there have been disclosed typical preferred embodiments of the invention, and although specific terms are employed, the terms are used in a descriptive sense only and not for purposes of limitation. The invention has been described in some detail, but it will be apparent that various modifications and changes can be made within the spirit and scope of the invention as described in the foregoing specification and as defined in the appended claims.