Patent application title:

Yeast strains and method for lignocellulose to ethanol production

Publication number:

-

Publication date:
Application number:

13/563,868

Filed date:

2012-08-01

✅ Patent granted

Patent number:

US 9,102,931 B1

Grant date:

2015-08-11

PCT filing:

-

PCT publication:

-

Examiner:

Yong Pak

Agent:

John Fado | Albert Y. Tsui | Lesley Shaw

Adjusted expiration:

2033-11-18

Smart Summary: A new method has been developed to help yeast produce ethanol from plant materials, specifically by adding genes that help transport xylose, a type of sugar found in these materials. The yeast strains involved are a special type called Saccharomyces cerevisiae, with some newly created strains identified by specific codes. These strains have been modified to better handle the challenges of producing ethanol, such as dealing with harmful substances that can inhibit yeast growth. Previous attempts to improve yeast's ability to use xylose have not been fully successful, so this new approach aims to enhance its efficiency. Overall, the goal is to create yeast that can thrive in tough conditions and effectively convert plant biomass into ethanol. 🚀 TL;DR

Abstract:

Disclosed is a method to incorporate xylose transport related genes into a yeast strain for lignocelluloses to ethanol production. More specifically, the invention relates to novel Saccharomyces cerevisiae strains NRRL Y-50463 and yeast strains having novel xylose transporter genes, the genes deposited as GenBank JF343555, GenBank JF343556, GenBank JF343557, GenBank JF343558, and GenBank JF343559. The yeast strains having said genes are deposited as Y-50465, Y-50466, Y-50746, Y-50747, Y-50748, and Y-50749.

Inventors:

Assignee:

Applicant:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N9/90 »  CPC main

Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Isomerases (5.)

C12N15/79 »  CPC further

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression Vectors or expression systems specially adapted for eukaryotic hosts

C12N1/14 IPC

Microorganisms, e.g. protozoa; Compositions thereof ; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor Fungi ; Culture media therefor

C12N15/00 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor

C12N1/20 IPC

Microorganisms, e.g. protozoa; Compositions thereof ; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor Bacteria; Culture media therefor

C12P7/06 IPC

Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic Ethanol, i.e. non-beverage

C07H21/04 IPC

Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical

Description

FIELD OF THE INVENTION

This invention relates to a method to incorporate xylose transport related genes into a yeast strain for lignocelluloses to ethanol production. Additionally, the invention relates to novel Saccharomyces cerevisiae strains NRRL Y-50463 and yeast strains having xylose transporter genes, the genes deposited as GenBank JF343555, GenBank JF343556, GenBank JF343557, GenBank JF343558, and GenBank JF343559. Novel yeast strains having said genes are deposited as Y-50465, Y-50466, Y-50746, Y-50747, Y-50748, and Y-50749.

BACKGROUND OF INVENTION

There exist two major bottlenecks of technical challenges for economical ethanol production using lignocellulosic biomass as feedstocks. First, inhibitory compounds associated with lignocellulo sic biomass pretreatment, especially by dilute acid hydrolysis, inhibit microbial growth and subsequent fermentation. Major inhibitor include 2-furaldehyde (furfural) and 5-(hydroxymethyl)-2-furaldehyde (HMF) are derived from lignocellulosic hydrolysates. Bacteria and yeast are susceptible and in general unable to grow in the presence of multiple inhibitors even at low concentrations. Another significant technical challenge is to enable and enhance yeast capability in utilization of pentose such as xylose and arabinose harbored in biomass.

Genetic engineering efforts have been made to improve xylose utilization by overexpressing genes encoding pentose phosphate pathway (PPP) enzymes to enhance xylose flux into central carbon metabolism. For native S. cerevisiae, there is no xylose-specific transporters available and the xylose uptake is via certain hexose transporters such as Hxt4, Hxt5, Hxt7. Recently, several heterologous sugar transporter genes possessing xylose transport functions have been expressed in S. cerevisiae such as SUT1, XUT1 or XUT3 from S. stipitis, At5g59250 and At5g17010 from A. thaliana, An25 from N. crassa, DEHA0D02167 and XylHP from D. hansenii, and symporters GXS1 and GXF1 genes from C. intermedia. Improvement of xylose utilization by such efforts was observed but a satisfactory level has not been reached. As such, there is a need to further develop ethanologenic yeast that are tolerance to major inhibitors such as aldehydes and to establish xylose transportation systems to facilitate xylose uptake for efficient lignocellulose-to-ethanol conversion.

BRIEF SUMMARY OF THE INVENTION

Disclosed herein are yeast strains expressing both glucose and xylose utilization pathways the ferment both glucose and xylose to ethanol, wherein the genes for the xylose pathway comprise a xylose isomerase gene, a xylulokinase gene, a xylitol dehydrogenase, and at least two xylose transporter genes. In one embodiment of the invention, the yeast strain express xylose transporter genes are XUT4 and XUT6. In another embodiment of the invention, the yeast strain ferments xylose to ethanol at a higher rate than the rate of its parent strain. In yet another embodiment of the invention, the yeast strain is a Saccharomyces cerevisiae strain. In one particular embodiment of the invention, the yeast strain is deposited as NRRL Y-50463.

Also disclosed herein is a method of producing ethanol from the fermentation of xylose comprising of culturing the yeast strains Y-50463, Y-50465, Y-50466, Y-50746, Y-50747, Y-50748, or Y-50749 of in xylose-containing material under suitable conditions for a period of time sufficient to allow fermentation of at least a portion of the xylose to ethanol. In one embodiment of the invention the yeast strain ferments both xylose and glucose.

Also disclosed herein are yeast strains expressing both glucose and xylose utilization pathways that ferment both glucose and xylose to ethanol, wherein the genes for the xylose pathway comprise a xylose isomerase gene and a xylose transporter gene. In one embodiment of the invention, the yeast strain expresses the xylose transporter gene of identified in SEQ. ID. Nos. 64, 65, 66, 67, 68, or 69. In another embodiment of the invention, a yeast strain having a yeast strain Y-50049 as a parent strain, expresses both glucose and xylose utilization pathways that ferment both glucose and xylose to ethanol, wherein the genes for the xylose pathway comprise a xylose isomerase gene and a xylose transporter gene, wherein the isomerase gene is integrated into said yeast strain chromosome. In another particular embodiment of the invention, the yeast strains are deposited as NRRL Y-50465, Y-50466, Y-50746, Y-50747, Y-50748, or Y-50749.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a metabolic pathways for mixed sugar fermentation for ethanol production. Xylose transport related genes (XUT4 and XUT6) from S. stipitis are incorporated into an inhibitor-tolerant ethanologenic yeast for improved xylose uptake and utilization; a synthesized xylose isomerase gene (YXI) based on codon preference of S. cerevisiae is integrated into a defined chromosomal locus as a main xylose utilization route; xylulokinase gene (XKS1) and xylitol dehydrogenase gene (XYL2) from S. stipitis are introduced into the yeast strain for enhanced downstream metabolism and xylitol conversion. Non-specific xylose reduction activities by aldose reductase are marked by nsXR in distinguishing from specific xylose reductase (XR) from S. stipitis.

FIG. 2 is a graph depicting the growth performance of engineered S. cerevisiae strain NRRL Y-50463 (filled circle) and parental strain Y-50049 (open circle). Comparisons of aerobic growth on YP medium containing 50 g l−1 D-xylose as sole carbon source (a), and mixed sugars of 50 g l−1 D-glucose and 50 g l−1 D-xylose in the absence (b) or the presence (c) of 10 mM each of furfural and HMF.

FIGS. 3A-C depict graphs of transcription analysis of heterologous genes. Graphs of quantitative transcription analysis using gene copy numbers over time of heterologous codon-optimized xylose isomerase gene YXI (FIG. 3A), xylulokinase gene XKS1 (FIG. 3B) and xylitol dehydrogenase gene XYL2 (FIG. 3C) are depicted.

FIGS. 3D-F are photos of electrophoresis gels of qRT-PCR products for YXI (d), xylose transport related gene XUT4 (e) and XUT6 (f) individually and in combination of XUT4-XUT6 (e and f). Lanes of the gel photo are labeled as 1 and 2, YXI; 3 and 4, YXI−XUT4; 5 and 6, YXI−XUT6; and 7 and 8, YXI−XUT4−XUT6.

FIG. 4 depict a graph of anaerobic fermentation of xylose by S. cerevisiae strain NRRL Y-50463 on YP medium containing 50 g l−1 D-xylose as sole carbon source. Filled square represents xylose, an open square for ethanol, and an open triangle for xylitol.

FIGS. 5A-D depict graphs of anaerobic batch co-fermentation of mixed sugars of either S. cerevisiae strain NRRL Y-50463 in the absence (a) or the presence (b) of inhibitors compared with its wild type parent strain Y-50049 (c) on a YP medium containing 50 g l−1 D-glucose, 50 g l−1 D-xylose, 15 mM furfural, and 15 mM HMF. Figure legends are labeled as glucose (filled circle), xylose (filled square), ethanol (open diamond), and xylitol (open triangle). Inhibitor conversions during the fermentation (d) for strain Y-50463 (solid line) and Y-50049 (dotted line) showing rapid reduction of furfural (filled triangle) and HMF (filled square), and corresponding conversion products of furanmethanol (open triangle) and furandimethanol (open square).

FIG. 6 depicts a vector carrying codon-optimized xylose isomerase gene YXI based on codon preference of S. cerevisiae under ADH1 promoter control for chromosomal integration at ADH2 gene site (A) and a self-replication vector (18.2 kb) containing xylose transport related genes (XUT4_ps and XUT6_ps), Xylulokinase gene (XKS1_ps) and xylitol dehydrogenase gene (XYL2_ps) for plasmid transformation (B). Relevant restriction enzyme sites and promoters are marked.

FIGS. 7A and 7B depict growth of yeast strains on xylose as sole carbon source. FIG. 7A depicts a graph comparing of cell growth of S. cerevisiae Y-50049−YXI (filled circle) and its enriched genotypes with varied xylose transporter genes using xylose as sole carbon source under aerobic conditions over time (hours). The yeast strain are labeled as Y-50049−YXI−XUT4 (filled triangle), Y-50049−YXI−XUT5 (filled diamond), Y-50049−YXI−XUT6 (filled square), Y-50049−YXI−XUT7 (open circle), Y-50049−YXIRGT2 (open triangle), and Y-50049−YXI−SUT4 (open square). Performance of strain Y-50049 without YXI background (star), was evaluated compared with its transformant derivatives Y-50049−XUT4 (cross) and Y-50049−XUT6 (plus). Symbol values are means of two replications while error bars represent the range. The growth plots of Y-50049 (star), Y-50049+XUT4 (cross), and Y-50049+XUT6 (plus) are overlapping since none of the three grew. As a result only the cross symbol can be distinguished since it is on top of the other two. FIG. 7B depicts a graph of the same strains under the same conditions as FIG. 7A and xylose consumption by said strains over time (hours).

FIGS. 8A and 8B depict fermentation performance on mixed sugars of glucose and xylose of various yeast strains. FIG. 8A depicts a graph cell growth density of various yeast strains over time (hours) on YP medium supplemented with 24.3 g/L D-glucose and 32.5 g/L D-xylose under oxygen-limited conditions. S. cerevisiae Y-50049−YXI is labeled with a filled circle, Y-50049−YXI−XUT4 with a filled triangle, Y-50049−YXI−XUT5 with a filled diamond, Y-50049−YXI−XUT6 with a filled square, Y-50049−YXI−XUT7 with an open circle, Y-50049−YXI−RGT2 with an open triangle, and Y-50049−YXI−SUT4 with an open square. FIG. 8B depicts a graph of the same strains under the same conditions as FIG. 8A and consumption of xylose as depicted by solid lines or glucose by dotted lines for each strain. FIG. 8C depicts a graph of the same strains under the same conditions as FIG. 8A and production of ethanol as depicted by solid lines or xylitol by dotted lines for each strain.

FIG. 9 depicts a graph of the pH over time for various yeast strains S. cerevisiae Y-50049−YXI, Y-50049−YXI+SUT4, and Y-50049−YXI+XUT7. A native pentose fermenting yeast, S. stipitis strain Y-7124 is also depicted.

FIG. 10 is a graph depicting the expression of YXI affected by xylose transporters. Comparison of gene expression of YXI in varied genotypes enriched with varied xylose transporter genes on xylose as sole carbon source under oxygen-limited fermentation conditions 48 h after incubation. Values are means of three replications.

BRIEF DESCRIPTION OF THE SEQUENCES

Below is a list of primers used with endonuclease restriction sites underlined and italicized as necessary.

SEQ. ID. NO. 1:
GCCCGCGGATGAAAAATTACTTTCCAAATG is primer Xy1A_F.
SEQ. ID. NO. 2:
GCCCGCGGTTATCTAAATAAAATATTATTTACG is primer Xy1A_R.
SEQ. ID. NO. 3:
GCGCGCATGCATATGAAGAACTACTTCCCAAACGTTCCAGAAG is primer YXI_L.
SEQ. ID. NO. 4:
GCGCGCCCGCGGTTATCTGAACAAAATGTTGTTAACAATGGTTTCCAA is primer YXI_R.
SEQ. ID. NO. 5:
TTTTAGACAATGATTTCAGCTGGAGGAGCC is primer XUT4_L.
SEQ. ID. NO. 6:
GCGCGCAAGCTTTTATTCCATCTCATTCAACTTGTACTTAAA is primer XUT4_R.
SEQ. ID. NO. 7:
GCGCGCACTAGTATGTCCAGTGTTGAAAAAAGTGCT is primer XUT6_L.
SEQ. ID. NO. 8:
GCGCGCCCCGGGTTAGCTGATGTTTTCGACATGCTC is primer XUT6_R.
SEQ. ID. NO. 9:
GCAAGCTTATGACCACTACCCCATTTGATGCTCCA is primer XKS1_L.
SEQ. ID. NO. 10:
GCTTAATTAAATTTTAGTGTTTCAATTCACTTTCCATCTT is primer XKS1_R.
SEQ. ID. NO. 11:
GCGAATTCATGACTGCTAACCCTTCCTTGGTGTTGAA is primer XYL2_L.
SEQ. ID. NO. 12:
CCGCGGCCGCTTACTCAGGGCCGTCAATGAGACACTT is primer XYL2_R.
SEQ. ID. NO. 13:
GTTGCGTCACTAGTTGCATTATGGACTTCCTC is primer ADH1_pL.
SEQ. ID. NO. 14:
CTTCAACCGCGGATAGGCCATCAGGATAGACATATGCATTGAGATAGTT is primer ADH1_pR.
SEQ. ID. NO. 15:
GATGGCCTTTCCGCGGTTGAAGAA is primer CYC1_tL.
SEQ. ID. NO. 16:
GGAAGCGATGTTAACAGCGACGAT is primer CYC1_tR.
SEQ. ID. NO. 17:
GCGCGCGGTACCCGACGGCTCACAGGTTTTGTAACAAG is primer PGK_pL.
SEQ. ID. NO. 18:
GCGCGCCTCGAGTGTTTTATATTTGTTGTAAAAAGTAGATAATTACTTCCTTGATG is primer PGK_pR.
SEQ. ID. NO. 19:
GCGCGCCCGCGGATTGAATTGAATTGAAATCGATAGATCAATTTT is primer PGK_tL.
SEQ. ID. NO. 20:
GCGCGCGAGCTCTTCAAGCTTACACAACACGGTTTATTT is primer PGK_tR.
SEQ. ID. NO. 21:
GCCAGCTGAACACACCCCGCGTTTATTTACCTA is primer PDC1_pL.
SEQ. ID. NO. 22:
GCAAGCTTGAGCTCTGATTTGACTGTGTTATTTTGCGTGA is primer PDC1_pR.
SEQ. ID. NO. 23:
GCAAGCTTCATTAATTAAATTGAAATCATGTTGCCAGTCTT is primer PDC1_tL.
SEQ. ID. NO. 24:
GCGGTACCAACCATTATTTGTATCGAGGTGTCTA is primer PDC1_tR.
SEQ. ID. NO. 25:
GCGGTACCTGAGCCGATCTAAATACTTCTGTGTT is primer TDH2_pL.
SEQ. ID. NO. 26:
GCGAATTCTTTGTTTTGTTTGTTTGTGTGATGA is primer TDH2_pR.
SEQ. ID. NO. 27:
CCGCGGCCGCACTCCTTAAGTTACTTTAATGATTTAGTTTTT is primer TDH2_tL.
SEQ. ID. NO. 28:
GCCTCGAGGCGAAAAGCCAATTAGTGTGAT is primer TDH2_tR.
SEQ. ID. NO. 29:
GCCTGCAGAGGTGCCGGTGTCGTTGTCG is primer ADH2-1a_F.
SEQ. ID. NO. 30:
GCGTCGACCAGCGTCAGCGGTAGCGTATTCTT is primer ADH2-1a_R.
SEQ. ID. NO. 31:
GCGTTAACGCGCGGTGCCCACGGTATCATC is primer ADH2-2_F.
SEQ. ID. NO. 32:
GGAAGCGGAAGAGCGTTCCCCACGTAAGAGCCGACAAT is primer ADH2-2a_R.
SEQ. ID. NO. 33:
AACATTACCGACCCAATGGA is primer qYXIp_L.
SEQ. ID. NO. 34:
CACCTTCTGGAGCAATGTCA is primer qYXIp_R.
SEQ. ID. NO. 35:
CGAAGGTGACATTGCCTCTT is primer qXKS1_L.
SEQ. ID. NO. 36:
AGCCAAAGGCAACGAGATAA is primer qXKS1_R.
SEQ. ID. NO. 37:
GATCAAGGCTTTCGGTGGTA is primer qXYL2_L.
SEQ. ID. NO. 38:
ACCGACTTGAACGAAACGAC is primer qXYL2_R.
SEQ. ID. NO. 39:
TAGGTGACATCGTTGGCAGA is primer qXUT4_L.
SEQ. ID. NO. 40:
GCAATACCGGCAATCAATCT is primer qXUT4_R.
SEQ. ID. NO. 41:
GCTCTTGTCATGGCTGGTTT is primer qXUT6_L.
SEQ. ID. NO. 42:
AGACGCCGAAGAATGAGTTG is primer qXUT6_R.
SEQ. ID. NO. 43:
GCGCGCCTGCAGATGTCTTCGTTATTGACTAACGAATACTTC is primer XUT4_P_L.
SEQ. ID. NO. 44:
GCGCGCAAGCTTTTATTCCATCTCATTCAACTTGTACTTAAA is primer XUT4_H_R.
SEQ. ID. NO. 45:
GCGCGCCTGCAGATGTCCAGTGTTGAAAAAAGTGCT is primer XUT6_P_L.
SEQ. ID. NO. 46:
GCGCGCCCCGGGTTAGCTGATGTTTTCGACATGCTC is primer XUT6_Sm_R.
SEQ. ID. NO. 47:
GCGCGCCTCGAGATGTCTTCGTTATTGACTAACGAATACTTC is primer XUT4_X_L.
SEQ. ID. NO. 48:
GCGCGCCCGCGGTTATTCCATCTCATTCAACTTGTACTTAAA is primer XUT4_S_R.
SEQ. ID. NO. 49:
GCGCGCGTCGACATGACGGAAAGAAGCATTGG is primer XUT5_S_L.
SEQ. ID. NO. 50:
GCGCGCGATATCTTACTTCTTTGTATTAACAACAAAACCTTG is primer XUT5_EV_R.
SEQ. ID. NO. 51:
GCGCGCCCCGGGATGTCCAGTGTTGAAAAAAGTGCT is primer XUT6_Sm_L.
SEQ. ID. NO. 52:
GCGCGCACTAGTTTAGCTGATGTTTTCGACATGCTC is primer XUT6_S_R.
SEQ. ID. NO. 53:
GCGCGCGTCGACATGACTTTTGCAGTTAACTTGTATGTG is primer XUT7_S_L.
SEQ. ID. NO. 54:
GCGCGCGGATCCTTAGTCCAAATCGTCCAAATCGTC is primer XUT7_B_R.
SEQ. ID. NO. 55:
GCGCGCGTCGACATGGGTTTAGAAGACAGTGCTCTC is primer RGT2_S_L.
SEQ. ID. NO. 56:
GCGCGCGATATCCTATACAGAAGCTTCTTCAACTTCAGA is primer RGT2_EV_R.
SEQ. ID. NO. 57:
GCGCGCGTCGACATGTCCTCACAAGATTTACCCTCG is primer SUT4_S_L.
SEQ. ID. NO. 58:
GCGCGCGGATCCCTAAACTTGCTCTTGCTCTTTTGTTTC is primer SUT4_B_R.
SEQ. ID. NO. 59:
GCGCGCGGTACCCGACGGCTCACAGGTTTTGTAACAAG is primer PGK_PL.
SEQ. ID. NO. 60:
GCGCGCCTCGAGTGTTTTATATTTGTTGTAAAAAGTAGATAATTATTCCTTGATG is primer PGK_PR.
SEQ. ID. NO. 61:
GCGCGCCCGCGGATTGAATTGAATTGAAATCGATAGATCAATTTT is primer PGK_TL.
SEQ. ID. NO. 62:
GCGCGCGAGCTCTTCAAGCTTACACAACACGGTTTATTT is primer PGK_TR.
SEQ. ID. NO. 63:
atgaagaactacttcccaaacgttccagaagttaagtacgaaggtccaaactctaccaacccattcgctttcaagtactacgacgctaacaag
gttgttgctggtaagaccatgaaggaacactgtagattcgctttgtcttggtggcacaccttgtgtgctggtggtgctgacccattcggtgttac
caccatggacagaacctacggtaacattaccgacccaatggaattggctaaggctaaggttgacgctggtttcgaattgatgaccaagttgg
gtattgaattcttctgtttccacgacgctgacattgctccagaaggtgacaccttcgaagaatctaagaagaacttgttcgaaattgttgactaca
ttaaggaaaagatggaccaaaccggtattaagttgttgtggggtaccgctaacaacttctctcacccaagattcatgcacggtgcttctacctct
tgtaacgctgacgttttcgcttacgctgctgctaagattaagaacgctttggacgctaccattaagttgggtggtaagggttacgttttctggggt
ggtagagaaggttacgaaaccttgttgaacaccgacttgggtttggaattggacaacatggctagattgatgaagatggctgttgaatacggt
agagctaacggtttcgacggtgacttctacattgaaccaaagccaaaggaaccaaccaagcaccaatacgacttcgacaccgctaccgtttt
ggctttcttgagaaagtacggtttggaaaaggacttcaagatgaacattgaagctaaccacgctaccttggctggtcacaccttcgaacacga
attggctatggctagagttaacggtgctttcggttctgttgacgctaaccaaggtgacccaaacttgggttgggacaccgaccaattcccaac
cgacgttcactctgctaccttggctatgttggaagttttgaaggctggtggtttcaccaacggtggtttgaacttcgacgctaaggttagaagag
gttctttcgaattcgacgacattgcttacggttacattgctggtatggacaccttcgctttgggtttgattaaggctgctgaaattattgacgacgg
tagaattgctaagttcgttgacgacagatacgcttcttacaagaccggtattggtaaggctattgttgacggtaccacctctttggaagaattgg
aacaatacgttttgacccactctgaaccagttatgcaatctggtagacaagaagttttggaaaccattgttaacaacattttgttcagataa is
the cDNA of the gene YXI.
SEQ. ID. NO. 64:
attatctactttttacacaaatataaaacactcgaggtcgacatgggtttagaagacagtgctctcttgcaaaagtacatcaacttcggtgaaaa
gaaggctggttccaccaccatgggtatctgtgttggtttgttcgcagccttcggtggtatccttttcggttatgacactggtaccatctccggtat
catggccatggactacgtcactgccagattcccatccaaccaccaatctttcagttcttctgaatcttcccttattgtttccattttgtctgttggtac
cttctttggttctctttctgcatctttcatctccgacagattgggtcgtagattgactttaatgatctccaccttgatcatcttcaatgtcggtattatctt
gcaaactgcctctactagcattccacttttgtgtgttggtagagtttttgctggtcttggtgttggtctcatttccgctgttattccattgtaccaagct
gaaacagttccaaagtggatcagaggtgctgttgtctcctgttaccaatgggccattacccttggtttgttgttggctgctgttgttaaccaaggt
acccacaacagaaatgactctggttcctacagaatcccaattgctatccaattcttgtgggctttgattttgggaggtggtatgtgtttgttgcca
gaaaccccaagattctgggtttctaaaggtgacaacgacagagccaaggactccttgagaagattgagaaagttgcccctcgaccatcccg
acttgattgaagaatacgaagaaatcaaggctaactacgaatacgaagctcaatacggttcaggttcttggagtcaagtttttgctaacaagaa
ccaccaaagaaagagattggccatgggtgttggtatccaagccttgcaacaattgaccggtattaactttatcttctactatggtactaacttctt
caagggttctggtatcaaaaacgaattccttatccaaatggccactaacattgtcaacttcggttctactgtcccaggtattcttttggttgaaatta
ttggtagaagaaagttgttgttgggtggttctgcagttatgtccatttctcaattgattgttgctattgtcggtgttgccgctggtgaaggttcaactt
ctgccaacaagtgtttggttgccttcgtttgtatcttcattgctgctttcgcagccacttggggtcctctttgttgggctgtcattgccgaatgttacc
cacttacagttagacaaaagtccatctccttgtgtacagcttccaactggttgtggaactggggtattgcctacgctactccttacatggtcaact
ccggtccaggtaacgccaacttgggttccaaggttttcttcatctggggtggttgtaatatcattggtggtcttttcgtgtggtaccttgtctacga
aactaagggcttgaccttagaacaaatcgatgaaatgtacgaaaaggttccaaaggcttggcaatctaccagattcattccatccgaacatgc
attcactcaaccatccgcagctgcctctgtctcttctggtaaggctgaaggtgtttctgaagttgaagaagcttctgtataggatatcgaattcct
gcagcccgggggatccactagttctagagcggccgccaccgcggatg is the cDNA of the xylose transporter gene
RGT2.
SEQ. ID. NO. 65:
tatctactttttcaacaaatataaaacactcgaggtcgacatgacttttgcagttaacttgtatgtgtttgcagttggtagagtgctttctggggtgg
gtgtaggagttctatcgactatggtgccgtcctatcaatgcgaaattagtcccagcgaagaaagaggcaagttggtgtgtggagagttcacg
ggaaatatcactggttatgctctcagtgtatgggccgattacttctgctactttattcaagatataggtgatgcaagggagaagcctcatagcttc
tttgcccacttgtcctggcgattgcctctattcatccaggtggtgatagcggctgttctctttgttgggggattttttattgtcgagtcacctcgttgg
ttattagatgtagaccaggaccaacaaggattccatgtattagcgttgctctatgattcacatctagatgataacaaaccacgtgaagagttcttt
atgatcaagaactccatcttgttagaaagagaaactacacctaagagcgaacgaacttggaaacatatgttcaagaactacatgacccgagt
gcttatagcttgttcagcacttggctttgcacagttcaacggcataaatatcatttcgtactatgcccccatggtatttgaagaagcaggcttcaa
caactccaaggctttacttatgacaggcatcaactctatagtatattggttcagtacgattcctccgtggtttctcgtggatcattggggtagaaa
gccaattttgatatccgggggtttatctatgggaatatgtattggtttgattgcggtggtaattctactagacaagtcgttcacaccgtctatggttg
cggtgttggtgataatctacaatgcatcttttggctacagttggggtcctatcggattcttgatcccgccggaggtgatgccattggcagttaga
tcgaaaggtgtttctatttctacggctacaaactggtttgccaattttgttgtgggtcagatgacgccaattctacagcagagattgggctgggg
aacttatctattcccggctggtagttgtatcatctcggtgatagtggtgattttcttctatccagagacaaagggtgtagagctagaggatatgga
ctctgtgttcgagagcttttacaactacaagtctccgttcaagatttcacgaaagagacaccagaatgatggccaggcgtaccaaagggtag
agaacgatatccgccacaacgatgtagaaatggacgatttggacgatttggactaaggatccactagttctagagcggccgccaccgcgga
tgaattgaatgaaa is the cDNA of the xylose transporter gene XUT7.
SEQ. ID. NO. 66:
actttttcacaaatataaaacactcgaggtcgacatgacggaaagaagcattggacctttaatccccagaaataagcacttattctatggatcc
gtattatagatgagtattgttcacccaactatcatgggatacgattccatgatggttggtagtattcttaatctagatgcatatgtaaattatttccac
ttaacggctgctaccactggactcaatactgctgcagtatggcttgggcaagtaattgccacattgacagttattctgtatttcaatgacaaattt
ggtagaagaagctcagtttgtataagtattgcaatcagtttggttggggttgcattgcaatcagcagcccagaacattgagatgtttattatcgg
aagaatagttattggttttggaatatctattggttttgtctcatctaccattttggtaagtgaactagcccctccagacaaaagaggatttattcttgg
attgagttttacaagctttctagtaggaagtttaattgcagcaggtgtcacatatggaacaagaaatgctcctggagactggtgttggagaatcc
catcaattattcaaggggctccagatattgttgctattattaacatactctttatttcagaatcaccaaggtggttgattgcaaaggaaagattcag
cgaagctcgtgaaattatttctatcattagtgatgttcctattgaagatgcacatgaagaatgtgaaaagatacatgcccatattcaaactgagaa
gactgctttccctggcaataagtggaaacaaatggtgagctccaagagcaatacaagaagagttattatcttgttcacacaggccatagttact
gaaatggccggttcttcagttggatcgtactatttttcaattatattaactcaagctggggtcaaagattcgaatgatagactaagagtaaatattg
tgatgagttcgtggtcattggtaattgctctttccggatgtctaatgtttgacagaattggaagaaagatgcaatcgctcatttcgttatcaggtat
gatcatatgctttatagttttaggtgttttggttaaagaatatggcgatggtcatagcaagagcggaagttacgcagctgtcgccatgatgttttta
ttcacaggattttactcattcactttcactccattgaactctttgtaccctccagaattgttcccctacgtgttgagaagtacaggagttacactcttt
aatattttcaacggctgctggggacttttcgcaagtttcattttacccattgcaatgaatggaattggctggaaattttacatcattaatgcttgctat
gacgtcatattccttccaataataatgttctgttggattgagacaaagggaattaatttggatacaattagtgaagtattgcacggaagaggacc
tgaagatgaagaaagcattgaagaaagtcacagcctaatcagacaaggttttgttgttaatacaaagaagtaagatatcgaattcctgcagcc
cgggggatccactagttctagagcggccgccaccgcggatgaatgaatgaaat is the cDNA of the xylose transporter
gene XUT5.
SEQ. ID. NO. 67:
tctggaatggcgggaaagggtttagtaccacatgctatgatgcccactgtgatctccagagcaaagttcgttcgatcgtactgttactctctctc
tttcaaacagaattgtccgaatcgtgtgacaacaacagcctgttctcacacactcttttcttctaaccaagggggtggtttagtttagtagaacct
cgtgaaacttacatttacatatatataaacttgcataaattggtcaatgcaagaaatacatatttggtcttttctaattcttagtttttcaagttcttagat
gctttctttttctcttttttacagatcatcaaggaagtaattatctactttttacacaaatataaaacactcgagatgtccagtgttgaaaaaagtgct
gaaactgcttcctatacgtcgcaggtcagcgcaagcggctctgcaaagaccaacagctaccttggcctcagaggcaacaaacttaattttgc
tgtctcttgttttgctggtgttggtttcttacttttgggttacgatcaaggtgtcatgggttcattgttgaccttgccatccttcgaaaacactttcccg
gccatgaaggctagcaacaacgctaccttacaaggcgccgttattgcactttatgaaatcggttgtatgtcttcttctttagcaaccatttaccttg
gtgacagattgggtagattgaagatcatgtttattggctgtgtaattgtctgtattggtgctgctttgcaagcttctgctttcactattgctcacttga
ctgttgctagaattatcactggtttaggtacaggtttcatcacttctactgttccagtttaccaatcggagtgctctccagccaagaaaagaggac
agttgatcatgatggaaggttctcttatcgcccttggcattgccatctcatactggattgactttggattttactttttgagaaacgatggtttgcact
cctcggcttcttggagagcacctatcgcgcttcaatgtgtcttcgctgtcttgttgatttccacagtcttcttcttcccagaatctccaagatggttg
ctcaacaaaggtaggaccgaagaagctagagaagttttttctgctctttacgacttgccagccgactctgaaaagatttctattcaaattgaaga
aattcaagctgctatagatttagaaagacaagccggagaaggtttcgtacttaaggaattgttcactcagggcccagccagaaacttgcagc
gtgtggccttgtcatgttggtctcaaataatgcaacaaatcactggtattaacattattacgtactatgctggtactatttttgaatcatacattggta
tgagtccatttatgtcaagaatcttggctgccttgaacggtactgaatatttccttgtctctcttattgctttctacaccgtcgaaagattaggtaga
agattccttttgttctggggtgccatcgccatggctcttgtcatggctggtttaactgttaccgttaaacttgccggtgaaggcaacacccatgct
ggtgtcggtgctgctgttcttttgtttgcattcaactcattcttcggcgtctcctggttaggtggatcctggttgttaccacctgaattgttgtctttga
aattgagagctcctggtgctgctttgtcgaccgcttctaactgggcttttaacttcatggttgtcatgatcactcctgtcggtttccaaagtattggt
tcctacacctaccttatctttgctgccatcaatttgttgatggctccggtcatctacttcttgtatcccgaaaccaagggtagatcgttggaagaaa
tggatatcattttcaaccaatgtcctgtttgggagccatggaaggttgtccaaattgccagagacctccctattatgcactcagaagttcttgacc
acgaaaaggatgtcattattgaaaaatctagaatagagcatgtcgaaaacatcagctaaactagttctagagcggccgccaccgcggatga
atgaatgaaatc is the cDNA of the xylose transporter gene XUT6.
SEQ. ID. NO. 68:
cacaaatataaaacactcgagatgtcttcgttattgactaacgaatacttcaaagactactaccacaacccgactcctgttgaagtgggtactat
gattgctatcttagagatcggcgcacttttttcctccttcatagctggaagagtaggtgacatcgttggcagaagaagaaccattagatacggg
tctttcatttttgtagtaggcggtcttgtacaagctacttcggtcaatattgtcaatctctcactaggaagattgattgccggtattgccattggctttt
tgacaaccatcatcccatgctaccagtctgaaatcagccccccagacgatagaggtttctatgcctgtttggagttcaccggaaatatcattgg
atatgctagtagtatttgggtagactacgggttttcatttttagacaatgatttcagctggaggagcccattgtatgttcaggttgttattggctcca
tgttatttattggttcattccttattgtagaaacccctagatggctcttggatcacaaccatgatatcgaaggcatgattgtcatttctgacttgtatg
cagatggtgatgtggaagacgatgatgctattgctgagtacagaaacataaaggaaagtgtcttgatagccagagttgaaggcggagagag
atcgtaccagtatttgttcaccaaatataccaagagactttctgtggcatgcttttcgcaaatgtttgcccagatgaatggtataaacatggtatct
tactatgctcctatgatcttcgaatctgctggctgggttggtagacaagctatcttgatgactggtatcaactccattatctacatctttagtaccatt
cctccatggtacttagttgattcttggggcagaaaacctttgcttttatctggatctgtgctcatgggtgttccgctcttaaccattgcttgttcgttat
tcttaaacaacacatacacacccggggttgtggttggcagtgtaatcgtattcaatgctgcttttggatacagttggggtccaattccttggctca
tgagcgaagtgttccctaactcagttagatcaaaaggtgctgccatgtctactgcaaccaactggctctttaactttattgttggagagatgaca
cctattttgttggatacaattacctggagaacttacttgatcccggcaacttcgtgtgtattatcgttttttgctgttggatttttatttccagagacca
agggtttagcattggaggatatgggctccgtattcgatgataattcgtcaatattttcatatcactcaactccttccactgggtatggtgcgaccg
agtctaacagtaatgccaggagagcaagtgtcatctcttcagaaaactaccaggatagtttgcatcagacagcggcttcattggctaggaatc
cttcaagcatgaggcctgattacgatggcataatcacaggagctgctaccctttcgccagtaccaccattaaaaccaataaagtctgatgcgt
cagtccattcagtcgatgccataattccaagcatttccagcaatattccgcaggaaattgaaccaccaacctttgatgaagtctttaagtacaag
ttgaatgagatggaataaccgcggatgaatgaatgaaat is the cDNA of the xylose transporter gene XUT4.
SEQ. ID. NO. 69:
tatctactttttacacaaatataaaacactcgaggtcgacatgtcctcacaagatttaccctcgggtgctcaaaccccaatcgatggttcttccat
cctcgaagataaagttgagcaaagttcgtcaaatagccaacgtgatttagcttctattccagcaacagatatcaaagcctatctcttggtttgttt
cttctgcatgttggttgccttcggtggcttcgtattcggtttcgataccggtactatttccggtttccttaatatgtctgatttcctttccagatttggtc
aagatggttctgaaggaaaatatttgtccgatatcagggttggtttgattgtttccatttttaacattggttgtgcaattggtggtattttcctttctaa
gataggagatgtttacggtagaagaattggtatcatttcagctatggttgtctatgtcgtcggtataatcatccagatctcgtcccaagacaagtg
gtatcaacttacaattggacgtggagttacaggattagctgttggtactgtttcggttttgtctccaatgttcattagtgaaagtgctccaaagcatt
tgagaggtactttggtatactgttaccaattatgcatcaccttaggtattttcattggttactgtgtcacttatggaaccaaagatttaaatgattcaa
gacaatggagagttcctttgggtttatgtttcctctgggctattttcttagttgtcggtatgttggctatgcctgaatccccaagattcttaattgaaa
agaagagaatcgaagaagccaagaagtcccttgcaagatccaacaagttatctccagaagatccaggtgtctacactgaagttcaattgatt
caggctggtattgacagagaagctgctgcaggttctgcttcatggatggaattgatcactggtaagccagctattttcagaagagttatcatgg
gaattatcttacagtctttgcaacaattaactggtgtcaactatttcttctattacggaactacaatcttccaagctgttggtttgcaagattccttcc
agacttccatcatcttaggtacagtcaactttctttctacatttgttggtatttgggccattgaaagatttggaagaagacaatgtttgttagtcggtt
ctgctggtatgttcgtttgtttcatcatttactctgtcattggtacaactcatttgttcattgatggagtagtagataacgacaacacccgtcaactgt
ctggtaatgctatgatctttatcacttgtttgttcatcttcttctttgcctgtacttgggctggaggtgtttttacaatcatttccgaatcatatccattga
gaatcagatccaaggctatgtctattgccactgccgctaactggatgtggggtttcttgatttcattctgcactccattcattgttaacgccatcaa
cttcaagttcggctttgtgtttactggttgtttgctcttttcgttcttctatgtctacttctttgtcagcgaaacaaaaggtttgtcgttggaagaagttg
atgagttgtacgctgagggaattgcaccatggaaatccggtgcatgggttcctccttctgcacaacaacaaatgcaaaactctacttatggtgc
cgaaacaaaagagcaagagcaagtttagggatccactagttctagagcggccgccaccgcggatgaatgaatgaaatcg is the
cDNA of the xylose transporter gene SUT4.

Deposit of Biological Material

Strain NRRL Y-50463 was deposited on Jan. 24, 2011, under the provisions of the Budapest Treaty in the Agricultural Research Culture Collection (NRRL) in Peoria, Ill., and has been assigned Accession No. NRRL Y-50463.

Strain NRRL Y-50465 was deposited on Feb. 6, 2011, under the provisions of the Budapest Treaty in the Agricultural Research Culture Collection (NRRL) in Peoria, Ill., and has been assigned Accession No. NRRL Y-50465 and is also referred to as Y-50049−YXI−RGT2.

Strain NRRL Y-50466 was deposited on Feb. 6, 2011, under the provisions of the Budapest Treaty in the Agricultural Research Culture Collection (NRRL) in Peoria, Ill., and has been assigned Accession No. NRRL Y-50466 and is also referred to as Y-50049−YXI−XUT7.

Strain NRRL Y-50746 was deposited on May 4, 2012, under the provisions of the Budapest Treaty in the Agricultural Research Culture Collection (NRRL) in Peoria, Ill., and has been assigned Accession No. NRRL Y-50746 and is also referred to as Y-50049−YXI−XUT5.

Strain NRRL Y-50747 was deposited on May 4, 2012, under the provisions of the Budapest Treaty in the Agricultural Research Culture Collection (NRRL) in Peoria, Ill., and has been assigned Accession No. NRRL Y-50747 and is also referred to as Y-50049−YXI−XUT4.

Strain NRRL Y-50748 was deposited on May 4, 2012, under the provisions of the Budapest Treaty in the Agricultural Research Culture Collection (NRRL) in Peoria, Ill., and has been assigned Accession No. NRRL Y-50748 and is also referred to as Y-50049−YXI−SUT4.

Strain NRRL Y-50749 was deposited on May 4, 2012, under the provisions of the Budapest Treaty in the Agricultural Research Culture Collection (NRRL) in Peoria, Ill., and has been assigned Accession No. NRRL Y-50749 and is also referred to as Y-50049−YXI−XUT6.

The subject cultures have been deposited under conditions that assure that access to the cultures will be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 CFR §1.14 and 35 USC §122. The deposits are available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny, are filed. However, it should be understood that the availability of the deposits does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.

Further, the subject culture deposits will be stored and made available to the public in accord with the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e., the culture will be stored with all the care necessary to keep it viable and uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposit, and in any case, for a period of at least 30 (thirty) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the culture. The depositor acknowledges the duty to replace the deposit should the depository be unable to furnish a sample when requested, due to the condition of the deposit. All restrictions on the availability to the public of the subject culture deposits will be irrevocably removed upon the granting of a patent disclosing them.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

As used in the specification and claims, the singular form “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes a plurality of cells, including mixtures thereof.

The term “gene” refers to a DNA sequence involved in producing a polypeptide or precursor thereof. The polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence, such as exon sequences.

Methods which are well known to those skilled in the art may be used to construct expression vectors containing sequences encoding xylose isomerase gene YXI, Xylulokinase gene (XKS1_ps), xylitol dehydrogenase gene (XYL2_ps), xylose transport related genes (XUT4_ps, XUT6_ps, XUT5_ps, XUT6_ps, XUT7_ps, RGT2, SUT4) and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described in Sambrook, J. et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y. and Ausubel, F. M. et al. (1989) Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y., and incorporated herein by reference.

Preferably in the present invention, YXI (xylose isomerase), XKS (xylulokinase), XYL (xylitol dehydrogenase) and at least one XUT (xylose transporter gene) are constitutively expressed. For example, after introduction of the YXI gene into a chromosomal integration-type vector or the like, the vector is integrated into a yeast chromosome, and then single or several copies of the genes are preferably expressed. These genes may be integrated by homologous recombination into a single allele of a chromosomal DNA. Alternatively, the gene may be separately integrated by homologous recombination into different alleles of a chromosomal DNA. Preferably, the five types of enzyme gene are simultaneously integrated into a single allele of a host DNA. Techniques for chromosomal integration of plasmid DNA by homologous recombination are well known in the art, as reported in Casey, et al., (1991), American Society of Microbiology, Vol. 57, No. 9, 2677-2682, and incorporated herein by reference. Following chromosomal integration of a synthesized YXI, genes for XKS, XYL and at least one XUT were plasmid carrier. As detailed below, in a preferable embodiment, a yeast strain would comprise a chromosomal integration of YXI along with a xylose transporter gene XUT4, XUT5, XUT6, XUT7, RGT2 or SUT4.

In addition to S. cerevisiae, it is envisioned that other yeast species could be used to obtain yeast strains according to the invention for use in the methods of the invention. Other suitable yeast species include, without limitation, Candida boidinii, Enteroramus dimorphus, Candida jeffriesii, Debaryomyces hansenii, Candida Guillermondii, Candida shehatae, Brettanomyces naardensis, Candida guillermondii, Candida lyxosophilia, Candida intermedia, Candida tenuis, Hansenula polymorpha, Kluyveromyces marxianus, Kluyveromyces lactis, Kluyveromyces fragilis, Kluyveromyces thermotolerans, Pachysolen tannophilus, Pichia Segobiensis, and Spathaspora passalidarum.

In another aspect, the present invention provides a method of fermenting xylose in a xylose-containing material to produce ethanol using the yeast of the invention as a biocatalyst. Another aspect of the present invention provides a method of fermenting xylose in a xylose-containing material to produce xylitol as a byproducts. Ideally the invention aims to minimize producing the byproduct of xylitol. In this embodiment, the yeast preferably has reduced xylitol dehydrogenase activity such that xylitol is accumulated. Preferably, the yeast is recovered after the xylose in the medium is fermented to ethanol and used in subsequent fermentations.

By “xylose-containing material” it is meant any medium comprising xylose, whether liquid or solid. Suitable xylose-containing materials include, but are not limited to, hydrolysates of polysaccharide or lignocellulosic biomass such as corn hulls, wood, paper, agricultural by-products, and the like.

By a “hydrolysate” as used herein, it is meant a polysaccharide that has been depolymerized through the addition of water to form mono and oligosaccharides. Hydrolysates may be produced by enzymatic or acid hydrolysis of the polysaccharide-containing material, by a combination of enzymatic and acid hydrolysis, or by another suitable means.

Preferably, the yeast strain is able to grow under conditions similar to those found in industrial sources of xylose. The method of the present invention would be most economical when the xylose-containing material can be inoculated with the mutant yeast without excessive manipulation. By way of example, the pulping industry generates large amounts of cellulosic waste. Saccharification of the cellulose by acid hydrolysis yields hexoses and pentoses that can be used in fermentation reactions. However, the hydrolysate or sulfite liquor contains high concentrations of sulfite and phenolic inhibitors naturally present in the wood which inhibit or prevent the growth of most organisms. Serially subculturing yeast selects for strains that are better able to grow in the presence of sulfite or phenolic inhibitors.

It is expected that yeast strains of the present invention may be further manipulated to achieve other desirable characteristics, or even higher specific ethanol yields. For example, selection of mutant yeast strains by serially cultivating the mutant yeast strains of the present invention on medium containing hydrolysate may result in improved yeast with enhanced fermentation rates.

Strains and Media

Strains of S. cerevisiae, S. stipitis, and Escherichia coli used are listed in Table 1. Yeast strains were maintained and aerobic growth was measured on YP medium (1% yeast extract, 2% peptone) supplemented with 20 g l−1 D-glucose or 20 g l−1 D-xylose as carbon source. G418 or hygromycin B was added into medium for selection and maintaining positive transformants as previously described in Taxis C, Knop M (2006), Biotechniques 40:73-78 and hereby incorporated by reference. A YP medium amended with 50 g l−1 D-xylose was used for evolutionary adaptation, growth assay and ethanol fermentation; and with 50 g l−1 D-xylose and D-glucose each was used for growth test and co-fermentation assay. Inhibitors of furfural and HMF were added into a medium for evaluation of cell growth under the inhibitor challenge. Competent cells of E. coli were grown on LB medium (1% tryptone, 0.5% yeast extract, 1% NaCl, pH 7.0; 20 g l−1 agar was added for solid medium) amended with 100 mg l−1 ampicillin for plasmid selection.

TABLE 1
Plasmids and strains used
ID Description Reference
Plasmids
pUG6 loxP-KanMX-loxP cassette Güldener et al. (1996)
pYES2 Yeast protein expression vector Invitrogen Carlsbad, CA
pRS42H System integrative vector Taxis and Knop (2006)
pUG-ADH1_p-CYC1_t pUG6 with ADH1 promoter and CYC1 This study
terminator
pUG-ADH1_p-ADH2 pUG6 with ADH1 promoter, CYC1 terminator This study
and ADH2 integration fragments
pUG-ADH1_p-XylA pUG6 with XylA inserted between ADH1 This study
promoter and CYC1 terminator
pUG-ADH1_p-YXI pUG6 with YXIsyn gene inserted between ADH1 This study
promoter and CYC1 terminator
pYES2 + XKS1 pYES2 with XKS1 gene This study
pYES2 + XKS1 + XYL2 pYES2 with XKS1 and XYL2 genes This study
pRS42H + XUT4 pRS42H with XUT4 gene This study
pRS42H + XUT6 pRS42H with XUT6 gene This study
pRS42H + XUT4 + XUT6 pRS42H with XUT4 and XUT6 genes This study
pRS42H + XUT4 + XUT6 + pRS42H with XUT4, XUT6, XKS1 and XYL2 This study
XKS1 + XYL2 genes
Strains
S. cerevisiae NRRL Y-50049 Inhibitor-tolerant derivative of strain NRRL Y- ARS Culture Collection,
12632 through evolutionary engineering Peoria, IL, USA
S. stipitis NRRL Y-7124 Wild type of xylose utilizing yeast ARS Culture Collection,
Peoria, IL, USA
Y-50049-XylA Y-50049 with XylA gene from C. This study
phytofermentans
NRRL Y-50463 Genetically engineered Y-50049-YXI_F10 with This study
XUT4, XUT6, XKS1, and XYL2 genes
E. coli Top 10 Competent cells Invitrogen Carlsbad, CA
E. coli DH10B Competent cells Invitrogen Carlsbad, CA

Preparation of Genomic DNA

Yeast genomic DNA was prepared using DNeasy Blood & Tissue Kit (QIAGEN, Alameda, Calif., USA) following manufacturer's instructions. Bacterial DNA was prepared as previously described in Sambrook J, Russell DW (2001) Molecular cloning: A laboratory manual, third ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Crude genomic DNA was used as template for PCR amplification. Genomic DNA of Clostridium phytofermentans strain ISDg (ATCC 700394) was supplied by American Type Culture Collection (Manassas, Va.) and used for amplification of xylose isomerase gene XylA as control.

Synthesis of Codon-Optimized Xylose Isomerase Gene

Using amino acid sequence of xylose isomerase from C. phytofermentans, a codon-optimized xylose isomerase gene (YXI) was designed on principle of highly expressed gene codons of S. cerevisiae. A total of 1317 bp nucleotides encoding 438 amino acids were composed. The full length of YXI gene was synthesized by Epoch Biolabs, Inc. (Sugar Land, Tex.) based on individual custom requirements and its sequence was deposited at NCBI nucleotide database under Accession No. JF261697.

HPLC Analysis

Samples of culture supernatant were taken periodically from 0 to 120 h, and glucose, xylose, ethanol, xylitol, furfural, HMF, furanmethanol (FM) and furan dimethanol (FDM) were measured using a high performance liquid chromatography (HPLC) system of Water (Milford, Mass.) and Shimadzu (Columbia, Md.). The HPLC was equipped with an autosampler controlled at 10° C., a programmable pump, an Aminex HPX-87 H column (Bio-Rad Laboratories, Hercules, Calif.) proceeded by a Microguard cartridge, a Spectra-Physics Spectra 100 variable wavelength UV detector (215 nm), and a refractive index detector. The column was maintained at 65° C., and samples were eluted with 1.6 mM H2SO4 at 0.6 ml min−1 isocratic flow. A standard curve was constructed for each detected chemical and metabolic conversion product for HPLC assays.

EXAMPLE 1

Plasmid Construction

All DNA manipulations were performed using standard molecular biology techniques as described by Sambrook and Russell. E. coli Top10 and DH10B (Invitrogen, Carlsbad, Calif., USA) were used for gene cloning. Primers used for plasmid construction are listed in the Description of Sequences above. Plasmids were extracted using QIApre Spin Miniprep Kit (QIAGEN, Alameda, Calif., USA). PCR products were purified using QIAquick PCR Purification Kit (QIAGEN, Alameda, Calif., USA) and QIAquick Gel Extraction Kit (QIAGEN, Alameda, Calif., USA) was used to recover interested DNA fragments from agarose gel. Bacterial transformations were performed using Gene Pulser Xcell Electroporation system (BioRad, Hercules, Calif.), and selection made on LB plate containing 100 mg l−1 ampicillin. All constructed plasmids were confirmed by PCR, restriction endonuclease digestion, or DNA sequencing if necessary.

Based on robust performance evaluation of transcriptional response under aldehyde inhibitor and ethanol stress challenges, ADH1 promoter was selected for constitutive overexpression of heterologous xylose isomerase in S. cerevisiae. The ADH1 promoter and terminator were amplified from S. cerevisiae and inserted into plasmid pUG6. To realize chromosomal integration at ADH2 locus, homologous sequences of ADH2 were amplified and inserted into the new constructed plasmid. An in vitro synthesized 1317 bp YXI gene was cloned into the plasmid under ADH1 promoter control, resulting in plasmid pUG-ADH1_p-YXI (FIG. 6). A native xylose isomerase gene XylA from C. phytofermentans was cloned into the plasmid, resulting in plasmid pUG-ADH1_P-XylA in a similar structure as comparison studies. All necessary insertion restriction sites and primers used are provided supra.

XUT4 and XUT6 genes were amplified from S. stipitis NRRL Y-7124 and cloned into pRS42H under PGK1 promoter control resulting in plasmid pRS42H+XUT4 and pRS42H+XUT6, respectively. A self-replication 18.2 kb plasmid was constructed carrying two xylose transport related genes XUT4 and XUT6, xylulokinase gene XKS1, and xylitol dehydrogenase gene XYL2 from S. stipitis flanked by PGK1, TDH2, and PDC1 promoters and terminators respectively, resulting in plasmid pRS42H+XUT4+XUT6+XKS1+XYL2 (FIG. 6).

Yeast Transformation

Standard molecular biology techniques were performed for yeast transformation as previously described in Sambrook (supra). Plasmids of pUG-ADH1_P-XylA and pUG-ADH1_P-YXI were digested separately with PstI and SapI prior to transformation. The 4.4 kb cassette containing varied versions of xylose isomerase gene was recovered and transformed into S. cerevisiae strain Y-50049 using Gene Pulser Xcell Electroporation system (BioRad, Hercules, Calif.). Positive transformants were selected on YPD plate containing 200 mg l−1 G418 followed by a PCR confirmation, resulting in strain Y-50049−XylA and Y-50049−YXI, respectively. The strain Y-50049−YXI was delivered to evolutionary adaptation on YP medium amended with 50 g l−1 D-xylose for at least ten consecutive transfers over a period of 40 days, and the strain Y-50049−YXI_F10 was used for further plasmid transformation of pRS42H+XUT4, pRS42H+XUT6 and pRS42H+XUT4+XUT6+XKS1+XYL2, respectively. Positive transformants were selected out on a YPD plate containing 300 mg l−1 hygromycin B and confirmed by PCR, resulting in strain Y-50049−YXI−XUT4, Y-50049−YXI−XUT6, and NRRL Y-50463.

EXAMPLE 2

Growth of Y-50463 on Xylose and Mixed Sugars in the Presence of Inhibitors

Cell growth of strain NRRL Y-50463 was evaluated on medium using xylose as sole carbon source at 20 g l−1 or 50 g l−1 D-xylose. Precultures were grown on a YPD medium in a 50-ml shake flask with 250 rpm agitation at 30° C. for 16 h. Cells were collected and resuspended in YP medium with D-xylose to OD600 reading at 1.0. Two percent of resuspended cells was inoculated onto YP medium containing D-xylose in a 50-ml flask and incubated at 30° C. with agitation at 250 rpm. The parental strain Y-50049 was served as control. Cell growth performance of strain NRRL Y-50463 on mixed glucose and xylose medium was evaluated using a similar procedure with 50 g l−1 D-glucose and 50 g l−1 D-xylose in the presence or the absence of 10 mM each of furfural and HMF. Each assay was carried out with three replications.

Xylose metabolism in S. cerevisiae involves multiple steps of xylose transport, xylose-to-xylulose conversion, xylulose phosphorylation, and subsequent flux into and through the pentose phosphate pathway to central carbon metabolism pathways. Using a set of genes involving xylose utilization pathways, a genetically engineered S. cerevisiae strain designated as NRRL Y-50463 was obtained in this study carrying heterologous genes of YXI, XUT4, XUT6, XKS1 and XYL2. Strain Y-50463 was able to grow on xylose as sole carbon source (FIG. 2A). When examined on a medium with mixed sugars of 50 g l−1 D-glucose and D-xylose, it grew continuously with a significantly higher density of cells at 96 h (FIG. 2B). In contrast, the control strain Y-50049 stopped growth after glucose was consumed after 24 h. In the presence of 10 mM furfural and HMF each, a similar cell density was reached at 120 h for Y-50463 (FIG. 2C). However, a slightly delayed in growth was observed. The growth performance of the control strain Y-50049 appeared to be similar in the presence and absence of the inhibitors but unable to utilize xylose. Introduction of a set of genes in this study extended xylose utilization capability of the tolerant yeast. On the other hand, it seemed the yeast resistance to the inhibitors was compromised slightly (FIG. 2C).

EXAMPLE 3

Gene Expression Analysis

Genetically engineered target genes were evaluated for their expression grown on xylose as sole carbon source using real time qRT-PCR. Yeast cells were harvested periodically and immediately frozen on dry ice and stored at −80° C. until use. Total RNA was isolated and RNA integrity. Primers identified in supra were designed using Primer 3, and qRT-PCR profiles and assays were performed using standard mRNA reference. Assays were performed for each condition with two biological replications and two technical replications. Electrophoresis of qRT-PCR products was also performed to examine expression of YXI, and xylose transport related gene XUT4 and XUT6 individually and in combination using mRNA harvested from two day cultures.

Previously reported bacterial XylA genes were often expressed using promoter of GAPDH, TPI1 or HXT7 in S. cerevisiae. In fact, transcription levels by these promoters are not constitutive and vary in different cell growth stages. Promoters used in plasmid construction included ADH1 promoter used for expression of YXI gene, PGK1 promoter for XUT4 and XUT6, PDC1 promoter for XKS1, and TDH2 promoter for XYL2. When transcription analysis of these heterologous genes was examined, a nearly constitutive expression over time was observed grown on xylose as sole carbon source as anticipated (FIG. 3A-C). The YXI gene under ADH1 promoter control had the highest transcription levels among the heterologous genes (FIGS. 3A and 3D). Xylose transporter genes XUT4 and XUT6 each under PGK1 promoter control was also successfully expressed (FIGS. 3E and 3F). Using ethanol- and inhibitor-tolerant promoters, constitutive and higher transcription levels of engineered heterologous genes of YXI, XKS1, XYL2, XUT4 and XUT6 in S. cerevisiae over time. Multi-copy integration of xylose isomerase gene was achieved by δ integration method for a higher level of XI expression. Apparently, more copy numbers of the desirable gene are also beneficial to improve xylose utilization.

EXAMPLE 4

Xylose Fermentation and Co-Fermentation of Mixed Sugars

Anaerobic Xylose Fermentation

Fermentation performance of strain NRRL Y-50463 using mixed sugars of glucose and xylose in the absence or the presence of furfural and HMF was evaluated using a 2-liter BioStat Fermentor at 30° C. Culture inoculum was prepared as described above and YP medium was amended with 50 g l−1 each of D-glucose and D-xylose, and 15 mM each of furfural and HMF. The parental strain Y-50049 was served as a control. Fermentation was performed by duplicated experiments.

Anaerobic fermentation of strain NRRL Y-50463 using 50 g l−1 D-xylose as sole carbon source was assayed at 30° C. with agitation at 250 rpm. The parental strain NRRL Y-50049 served as control. Cells were prepared using a procedure similar as described above and inoculated at ˜5.0 g l−1 dry weight cells. Duplicated experiments were carried out.

Using 50 g l−1 xylose as sole carbon source, the engineered strain Y-50463 was able to produce 14.3 g l−1 ethanol with 37.5 g l−1 xylose consumed at 120 h in an anaerobic fermentation (FIG. 4). Its ethanol production and production rate was 0.38 g l−1 and 0.119 g l−1 h−1, respectively. When mixed sugars of 50 g l−1 D-glucose and 50 g l−1 D-xylose were used for co-fermentation, strain Y-50463 displayed a linear consumption of xylose in 72 h. It appeared that the xylose consumption was simultaneously occurred with a rapid glucose conversion (FIG. 5A). The highest ethanol concentration of 38.6 g l−1 was detected at 72 h with a production rate of 0.54 g l−1 h−1 for total consumed sugars in the absence of furfural and HMF. In the presence of inhibitors, the trend of xylose consumption was similar but the highest ethanol concentration was obtained at 96 h, a delay of less than 24 comparing with that in the absence of the inhibitors (FIG. 5B). It produced 38.6 g l−1 ethanol with a production rate of 0.40 g l−1 h−1 at 96 h. As a control, the parental strain Y-50049 was unable to utilize xylose (FIG. 5C). Both Y-50463 and Y-50049 were able to convert furfural and HMF into FM and FDM under the defined fermentation conditions (FIG. 5D). In the absence of inhibitors, ethanol production kept increasing after 24 h. In the presence of the inhibitors, ethanol production rate was higher prior to 24 h but lower after 24 h comparing with that in the absence of the inhibitors. It also took more than 96 h to complete the fermentation; however, the final ethanol productions are similar. The presence of the inhibitors apparently affected the patterns of the ethanol conversion pathways.

Similarly with previous observations, xylitol was also observed as a by-product produced by this genetically engineered S. cerevisiae strain utilizing xylose. Xylitol is mainly produced from xylose by xylose reductase (XR) enzymes such as XYL1. Since heterologous XR was introduced into this yeast, the xylitol production observed is likely to be catalysed by nonspecific aldose reductase such as GRE3. Deletion of GRE3 in previous report reduced xylitol production. However, since GRE3 involves yeast tolerance and detoxification of pretreatment inhibitors, we intend to keep it intact.

EXAMPLE 5

Cloning of Xylose-Transporter Genes XUT4, XUT5, XUT6, XUT7, RGT2, SUT4 and Vector Construction

A portion of promoter and terminator for PGK1 was amplified from S. cerevisiae NRRL Y-50049 genomic DNA using primers PGK_PL/PGK_PR and PGK_TL/PGK_TR, as detailed in the Description of Sequences above. Amplified PGK1 fragments were cloned into vector pRS42H resulting in pRS42H -PGK1 promoter-terminator. Six putative xylose transporter genes XUT4, XUT5, XUT6, XUT7, RGT2, and SUT4 were amplified using various primers from the genomic DNA of S. stipitis. Each xylose transporter gene was cloned into the S. cerevisiae expression vector pRS42H-PGK1 promoter-terminator with proper restriction endonuclease sites designed. All DNA oligos were synthesized by IDT (Coralville, Iowa).

Each xylose transporter gene was confirmed by DNA sequencing using BigDye® Terminator v3.1 Cycle Sequencing Kit and sequencing run on an ABI 3730 DNA sequencer (Applied Biosystems, Carlsbad, Calif.). Sequences were analyzed using Sequencher v4.6 software (Gene Codes Corp. Ann Arbor, Mich.). Verified DNA sequences were deposited at NCBI GenBank under Accession numbers JF343554, JF343555, JF343556, JF343557, JF343558, and JF343559.

Six xylose transporter genes XUT4, XUT5, XUT6, XUT7, RGT2 and SUT4 were cloned and transformed into S. cerevisiae Y-50049−YXI, resulting in Y-50049−YXI−XUT4 (Y-50747), Y-50049−YXI−XUT5 (Y-50746), Y-50049−YXI−XUT6 (Y-50749), Y-50049−YXI−XUT7 (Y-50466), Y-50049−YXI−RGT2 (Y-50465) and Y-50049−YXI−SUT4 (Y-50748), respectively. As a control measurement, two genotypes of Y-50049−XUT4 and Y-50049−XUT6 without a functional YXI gene were also generated.

EXAMPLE 6

Xylose Utilization for Strains Y-50746, Y-50747, Y-50748, Y-50749, Y-50465, and Y-50466

The relative performance of yeast strains Y-50746, Y-50747, Y-50748, Y-50749, Y-50465, and Y-50466 containing a xylose isomerase gene and a xylose xylose transporter gene was further assessed in cell populations that were first grown aerobically on xylose and then transferred into fresh culture medium at high cell density. Under these conditions a high metabolic carbon demand creates the potential for transport to be a limiting factor and amplifies volumetric xylose consumption from the medium. Aerobic xylose uptake rate was assessed for the host strain Y-50049−YXI and each of its six xylose transporter-expressing derivatives. Duplicate pre-cultures consisting of 250 ml of YP+50 g/L xylose each in aluminum foil-closed 1 L flasks were grown under aerobic conditions for 72 h at 30° C. and 200 rpm. The 72-h precultures were centrifuged (7000 rpm, 5 minutes) to pellet cells which were then resuspended in YP medium (without sugar) to an optical density of ˜16.7 (at 600 nm). The cell suspensions were then distributed 9 ml per flask to each of 10 flasks per each strain (five xylose concentrations in duplicate). Reactions were brought to 10 ml and initiated by adding the appropriate 1-mL mix of YP (without sugar) and YP+500 g/L xylose, giving a reaction cell optical density of ˜15 and the following targeted initial xylose concentrations: 5, 10, 15, 30, 50 mM. The cultures were incubated at 30° C., 250 rpm in 50-mL baffled flasks with stainless steel closures. Once xylose was added to cultures, the reaction timing began, and the first sample was immediately taken, diluted for optical density reading, and centrifuged (10,000 rpm, 6 min). The supernatant was transferred to vials and frozen at −20° C. until HPLC assay. Subsequent samples were collected at 2 h, 4 h, 6 h, and the specific xylose consumption rate (V) was calculated as the rate of decline in xylose concentration (X)/per dry cell concentration (b), assuming the linear correlation of dry yeast biomass concentration with absorbance, b=(0.167 g/L). For each yeast strain, a Lineweaver-Burk plot of 1/V versus 1/X was prepared in order to assess Vmax and Km. The relative statistical differences between strain performances due to the specific transporter gene expressed were determined by running a two-way analysis of variance of V as a function of the transporter gene and the initial xylose concentration.

Using xylose as sole carbon source, strain Y-50049 without YXI gene and its transformant derivatives with xylose transporter genes Y-50049−XUT4 (Y-50747) and Y-50049−XUT6 (Y-50749) were unable to grow under aerobic conditions (FIG. 7A). The host strain Y-50049−YXI was able to grow on xylose at a relatively slow rate. In contrast, strains Y-50746, Y-50747, Y-50748, Y-50749, Y-50465, and Y-50466 with individual xylose transporter genes in the yeast xylose isomerase gene background showed significantly higher rates of cell growth on xylose as sole source of carbon and energy (FIG. 7A). The specific growth rate for all six strains improved up to 50% higher (Table 2). Xylose consumption over time was significantly faster and more complete for each new genotype compared with their parent Y-50049−YXI (FIG. 7B). The volumetric xylose consumption rate was significantly improved up to 7.5-fold as shown by genotype Y-50049−YXI−XUT7 (Y-50466) (Table 2).

TABLE 2
Volumetric xylose Specific growth
Strain consumption rate (g l−1 h−1) Rate (h−1)
Y50049-YXI 0.071 ± 0.041 0.061 ± 0.010
Y50049-YXI-XUT4 0.442 ± 0.026 0.091 ± 0.004
Y50049-YXI-XUT5 0.332 ± 0.083 0.082 ± 0.005
Y50049-YXI-XUT6 0.399 ± 0.036 0.089 ± 0.008
Y50049-YXI-XUT7 0.535 ± 0.056 0.095 ± 0.003
Y50049-YXI-RGT2 0.482 ± 0.039 0.095 ± 0.007
Y50049-YXI-SUT4 0.250 ± 0.009  0.68 ± 0.025

When relative kinetic advantage was assessed among the transporter-enriched genotypes compared to the parent strain Y-50049−YXI, a significant 2.5- to 4-fold improvement of the apparent specific xylose uptake rate (V) depended on the transporter gene incorporated and the initial xylose concentration supplied (Xo) (Table 3). The apparent xylose uptake for all strains fit a Michaelis-Menten saturation kinetics model V=VmaxX/(Km+X), and Lineweaver-Burk plots were applied to obtain average values for the saturation constant Km and the maximum specific uptake rate Vmax as summarized in (Table 4). All of the xylose transporter-enriched strains Y-50746, Y-50747, Y-50748, Y-50749, Y-50465, and Y-50466 tested allowed a higher affinity for xylose compared to the control, except for strain Y-50746 which had the highest Vmax but the lowest xylose affinity. Among the improved genotypes, incorporation of XUT7 in strain Y-50766 most significantly enhanced the affinity to xylose.

TABLE 3
V (g/g/h)
Overall Xo = 5 Xo = 10 Xo = 15 Xo = 30 Xo = 50
Strain V (h−1) g/L g/L g/L g/L g/L
Y-50049-YXI 0.082 d* 0.041 c 0.054 c 0.070 d 0.096 e 0.150 e
(control)
Y-50049-YXI- 0.211 c 0.112 b 0.147 b 0.167 c 0.166 d 0.461 b
RGT2
Y-50049-YXI- 0.240 b 0.144 ab 0.172 ab 0.236 b 0.330 b 0.318 c
SUT4
Y-50049-YXI- 0.227 bc 0.131 ab 0.190 ab 0.187 bc 0.292 bc 0.336 c
XUT4
Y-50049-YXI- 0.336 a 0.128 ab 0.189 ab 0.298 a 0.469 a 0.593 a
XUT5
Y-50049-YXI- 0.236 bc 0.154 ab 0.212 a 0.235 b 0.267 c 0.312 c
XUT6
Y-50049-YXI- 0.224 bc 0.185 a 0.189 ab 0.230 b 0.254 c 0.261 d
XUT7
*Within columns, means having no letters in common are significantly different using Student-Newman-Keuls pairwise comparison (p < 0.05).

TABLE 4
Vmax
Genotype (g/g/h) Km (g/L) R2
Y-50049-YXI (control) 0.14 13.26 0.82
Y-50049-YXI-RGT2 0.28 8.10 0.71
Y-50049-YXI-SUT4 0.36 7.83 0.97
Y-50049-YXI-XUT4 0.35 8.74 0.91
Y-50049-YXI-XUT5 0.88 30.58 0.96
Y-50049-YXI-XUT6 0.33 5.82 0.97
Y-50049-YXI-XUT7 0.26 2.47 0.80

EXAMPLE 7

Fermentation of Glucose-Xylose Mixtures by Strains Y-50746, Y-50747, Y-50748, Y-50749, Y-50465, and Y-50466

Fermentations of YP medium with 24.3 g L−1 of D-glucose and 32.5 g/L D-xylose were assessed with each of the S. cerevisiae transformed strains in 30 ml cultures inoculated to a starting optical density of 0.05 at 600 nm (OD600). The cultures were incubated at 30° C., 250 rpm in 50 ml flasks fitted with 22 gage needle-vented septa. This condition allows severely oxygen-limited growth of the yeast population which naturally transitions into anaerobic fermentation as cell density increases to scavenge available oxygen and carbon dioxide fills the system. Samples were taken periodically and all experiments were performed with three replications. Pre-culture growth conditions for inoculum production were as described in Example 4.

Under initial oxygen-limited conditions all genotypes tested grew similarly at relatively low cell densities of ˜2 optical density units (FIG. 8A) as compared to the more abundant, but varied growth among strains observed under aerobic conditions (FIGS. 7A and 7B). As expected, glucose was quickly consumed and undetectable within 24 to 48 h (FIG. 8B). Xylose was consumed at a near linear model for all strains till 150 h but at a slower rate than glucose. However, there was no obvious glucose repression observed as commonly exhibited by recombinant S. cerevisiae strains.

All genotypes enriched with xylose transporter genes showed a faster xylose utilization rate than the parental control strain even when glucose was present during the first 24 h of growth (Table 5). They also showed higher levels of ethanol production and lower xylitol production than their parental strain Y-50049−YXI (FIG. 8C). Among which, genotypes containing RGT2 (Y-50465), XUT7 (Y-50466), and SUT4 (Y-50748) displayed significantly higher levels of ethanol production (FIG. 8C) than other strains. Volumetric ethanol production rate on xylose or mixtures of glucose and xylose was improved by all genotypes compared with the host strain Y-50049−YXI (Table 5).

TABLE 5
Glucose and Xylose Uptake Xylose Uptake Overall
(0-24 h) (48-144 h) (0-144 h)
Genotype Oz (g/L/h) Ox (g/L/h) P (g/L/h) Y (g/g) P (g/L/h) Y (g/g) P (g/L/h) Y (g/g)
Y-50049-YXI 0.991 ± 0.004 0.017 ± 0.047 0.33 ± 0.04 0.33 ± 0.03 0.015 ± 0.011 0.11 ± 0.09 0.067 ± 0.007 0.24 ± 0.03
Y-50049-YXI-XUT4 0.752 ± 0.015 0.118 ± 0.033 0.21 ± 0.03 0.24 ± 0.04 0.027 ± 0.004 0.14 ± 0.02 0.075 ± 0.003  0.22 ± 0.004
Y-50049-YXI-XUT5 0.646 ± 0.024 0.114 ± 0.028 0.17 ± 0.01 0.22 ± 0.02 0.038 ± 0.004 0.22 ± 0.01 0.077 ± 0.003 0.22 ± 0.01
Y-50049-YXI-XUT6 0.828 ± 0.022 0.159 ± 0.009 0.21 ± 0.02 0.22 ± 0.01 0.033 ± 0.004 0.18 ± 0.02 0.079 ± 0.004 0.22 ± 0.01
Y-50049-YXI-XUT7 0.602 ± 0.021 0.082 ± 0.015 0.24 ± 0.02 0.35 ± 0.01 0.061 ± 0.003 0.31 ± 0.03 0.122 ± 0.003 0.34 ± 0.01
Y-50049-YXI-RGT2 0.231 ± 0.030 0.040 ± 0.057 0.12 ± 0.01 0.45 ± 0.11 0.064 ± 0.005 0.29 ± 0.01 0.128 ± 0.005 0.35 ± 0.01
Y-50049-YXI-SUT4 0.558 ± 0.032 0.126 ± 0.010 0.22 ± 0.02 0.32 ± 0.02 0.036 ± 0.007 0.22 ± 0.04 0.119 ± 0.006 0.35 ± 0.02

EXAMPLE 8

Xylose Proton Symport Assay for Strains Y-50746, Y-50747, Y-50748, Y-50749, Y-50465, and Y-50466

Cultures of the host strain Y-50049−YXI and strains Y-50746, Y-50747, Y-50748, Y-50749, Y-50465, and Y-50466 were assayed for proton symport. A modification of the method of Lucas and Van Uden was used to determine if a symport-indicative alkaline pH shift occurred upon addition of xylose to high cell density sugar-starved cultures. All S. cerevisiae strains were precultured aerobically on YP plus 50 g/L xylose as described in Example 6. As a positive control, the native pentose-fermenting yeast S. stipitis Y-7124 was transferred from YPD plates to 50 ml YP plus 50 g/L xylose preculture (25° C., 250 rpm, 24 h) to final precultures at 0.1 optical density to be cultivated 72 h similarly to the S. cerevisiae strains. The Y-7124 served as a positive control since it is known to possess both low and high-affinity xylose proton symporters. The aerobic condition used to grow cells was expected to build ATP reserves to support symport if present. The 72-h yeast cultures were centrifuged at 15° C., washed once with sugarless YP medium, then concentrated and resuspended in ˜25-50 ml of the sugarless medium. The cells were allowed to starve for 2 hours at 250 rpm and 25° C. Sugar-starved cultures were resuspended to an absorbance of 140-200 in isotonic saline (9 g/L NaCl) and kept on ice until assay. Assays were conducted in a 25 ml Bellco jacketed spinner flask maintained at 350 rpm and 25° C. For recording pH readings at 0.05 sec intervals, a Broadley James FermProbe Micro, 175 mm pH probe was connected to a pH meter with analog output to an ExTech Instruments Multi-Log 720 Multimeter Datalogger. Twelve ml of isotonic saline was added to the reaction vessel, and ˜4 ml of cell concentrate was added to obtain an optical density of 40. The temperature was allowed to equilibrate to 25° C. and pH was adjusted to just below 4.5 with 2-20 μl of 0.025 N HCl. After a short baseline, the symport assay was initiated by pipetting a few micro-liters of a 500 g/L xylose stock solution to achieve 7.5 g/L xylose, which was confirmed in other experiments on Y-7124 to be in excess of the Km of ˜0.01-0.3 g/L xylose associated with S. stipitis symport. One-ml samples were drawn before and after the pH shift and iced immediately for subsequent absorbance determination of cell biomass and HPLC confirmation of xylose concentration.

None of the S. cerevisiae genotype tested exhibited an alkaline pH shift in response to a defined xylose spike. The typical negative pH responses observed are presented for selected genotypes in comparison with a S. stipitis positive control exhibiting the blatant alkaline shift (FIG. 9) consistent with xylose proton symport. These results indicated that none of the six xylose transporter-enriched strains were capable of xylose proton symport.

EXAMPLE 9

Expression of YXI with XUT4, XUT5, SUT4, XUT6, RGT2, and XUT7

Expression of YXI with a background of different xylose transporter genes under fermentation conditions was assayed using qRT-PCR. A culture of each xylose transporter transformed yeast strain was incubated on YPX medium at 30° C. with agitation at 250 rpm. Cell samples were collected 24 h after incubation. Total RNA extraction and qRT-PCR assays were carried out using standard mRNA quantification.

The genetically engineered host strain Y-50049−YXI with a synthesized YXI is able to grow on xylose as sole carbon source, and the YXI is constitutively expressed. The new genotypes enriched with individual xylose transporter genes showed further enhanced expressions of the YXI gene. The most enhanced mRNA abundance was observed for genotype Y-50049−YXI−RGT2, followed by −SUT4, −XUT6 and −XUT7 (FIG. 10). Genotypes enriched with −XUT5, −XUT4 showed modest enhancement 24 h after incubation under oxygen-limited conditions.

While the invention has been described with reference to details of the illustrated embodiment, these details are not intended to limit the scope of the invention as defined in the appended claims. The embodiment of the invention in which exclusive property or privilege is claimed is defined as follows:

Claims

The invention claimed is:

1. A recombinant yeast strain comprising a nucleotide sequence encoding a xylose isomerase gene and a nucleotide sequence encoding xylose transporter gene, wherein the xylose isomerase gene is SEQ ID NO 63 and the xylose transporter gene is selected from the group consisting of SEQ. ID. Nos. 64, 65, 66, 67, 68, or 69.

2. A recombinant yeast strain having yeast strain Y-50049 as a parent strain comprising a nucleotide sequence encoding a xylose isomerase gene and a nucleotide sequence encoding xylose transporter gene, wherein the xylose isomerase gene is SEQ ID NO 63 and the xylose transporter gene is selected from the group consisting of SEQ. ID. Nos. 64, 65, 66, 67, 68, or 69.

3. A yeast strain deposited as NRRL Y-50465, NRRL Y-50466, NRRL Y-50746, NRRL Y-50747, NRRL Y-50748 or NRRL Y-50749.

4. A method of producing ethanol from the fermentation of xylose comprising: culturing the yeast strain of claim 1 in xylose-containing material under suitable conditions for a period of time sufficient to allow fermentation of at least a portion of the xylose to ethanol.

5. The method of claim 4, wherein the xylose-containing material further comprises glucose.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: