Patent application title:

Identification of antigen-specific B cell receptors

Publication number:

-

Publication date:
Application number:

15/710,390

Filed date:

2017-09-20

✅ Patent granted

Patent number:

US 10,428,325 B1

Grant date:

2019-10-01

PCT filing:

-

PCT publication:

-

Examiner:

Christian C Boesen

Agent:

Cooley LLP

Adjusted expiration:

2037-09-20

Smart Summary: Researchers have developed methods to find specific B-cell receptors that attach to particular antigens. These methods help identify the unique connections between the gene segments of B-cell receptors and the antigens they recognize. B-cell receptors are proteins made of four chains, which include heavy and light chains that play a key role in identifying antigens. The diversity of these receptors comes from various genetic rearrangements and mutations that occur when B cells respond to antigens. This invention could improve our understanding of immune responses and aid in developing targeted therapies. 🚀 TL;DR

Abstract:

Compositions and methods are disclosed for identifying B-cell receptor sequences that bind to corresponding antigens. The disclosed methods and related embodiments permit the identification paired relationships between rearranged gene segments of B-cell receptors with unique antigens.

Inventors:

Assignee:

Applicant:

Interested in similar patents?

Get notified when new applications in this technology area are published.

Classification:

C12N15/1037 »  CPC main

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Processes for the isolation, preparation or purification of DNA or RNA; Isolating an individual clone by screening libraries Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display

C40B30/04 »  CPC further

Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding

C12N15/10 IPC

Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology Processes for the isolation, preparation or purification of DNA or RNA

Description

REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. Provisional Application No. 62/397,811, filed Sep. 21, 2016, the contents of which are incorporated herein by reference.

DESCRIPTION OF THE TEXT FILE SUBMITTED ELECTRONICALLY

The contents of the text file submitted electronically herewith are incorporated herein by reference in their entirety: A computer readable format copy of the Sequence Listing (file name: ADBS_033_02US_SeqList_ST25.txt; date recorded: Sep. 20, 2017; file size: 26.7 kilobytes).

BACKGROUND OF THE INVENTION

Immunoglobulins (Igs) expressed by B-cells, also referred to herein as B-cell receptors (BCR), are proteins consisting of four polypeptide chains, two heavy chains (H chains) from the IGH locus and two light chains (L chains) from either the IGK (kappa) or the IGL (lambda) locus, forming an H2L2 structure. Both H and L chains contain complementarity determining regions (CDR) involved in antigen recognition, and a constant domain. The H chains of Igs are initially expressed as membrane-bound isoforms using either the IgM or IgD constant region isoform, but after antigen recognition the H chain constant region can class switch to several additional isotypes, including IgG, IgE and IgA. The diversity of naïve Igs within an individual is mainly determined by the hypervariable complementarity determining regions (CDR). The CDR3 domain of IGH chains is created by the combinatorial joining of the VH, DH, and JH gene segments. Hypervariable domain sequence diversity is further increased by independent addition and deletion of nucleotides at the VH-DH, DH-JH, and VH-JH junctions during the process of IG gene rearrangement. Ig sequence diversity is further augmented by somatic hypermutation (SHM) throughout the rearranged IG gene after a naïve B cell initially recognizes an antigen. The process of SHM is not restricted to CDR3, and therefore can introduce changes in the germline sequence in framework regions, CDR1 and CDR2, as well as in the somatically rearranged CDR3.

As the adaptive immune system functions in part by clonal expansion of cells expressing unique BCRs, accurately measuring the changes in total abundance of each clone is important to understanding the dynamics of an adaptive immune response. Utilizing advances in high-throughput sequencing, a new field of molecular immunology has recently emerged to profile the vast BCR repertoires. Compositions and methods for the sequencing of rearranged adaptive immune receptor gene sequences and for adaptive immune receptor clonotype determination are described, for example, in Robins et al., 2009 Blood 114, 4099; Robins et al., 2010 Sci. Translat. Med. 2:47ra64; Robins et al., 2011 J. Immunol. Meth. doi:10.1016/j.jim.2011.09. 001; Sherwood et al. 2011 Sci. Translat. Med. 3:90ra61; U.S. Patent Application Nos. 61/550,311 and 61/569,118; US Patent Application Publication Nos. US 2012-0058902 and US 2010-0330571; and International PCT Publication Nos. WO 2010/151416, WO 2011/106738, and WO 2012/027503, all of which are herein incorporated by reference.

The sequence of the BCR repertoire yields complex DNA samples in which accurate determination of the multiple distinct sequences contained therein is hindered by technical limitations on the ability to quantify a plurality of molecular species simultaneously using multiplexed amplification and high throughput sequencing. In addition, it is difficult from existing methodologies to sequence quantitatively DNA or RNA encoding both chains of a BCR heterodimer in a manner that permits determination that both chains originated from the same lymphoid cell.

One or more factors can give rise to artifacts that skew sequencing data outputs, compromising the ability to obtain reliable quantitative data from sequencing strategies that are based on multiplexed amplification of a highly diverse collection of IG gene templates. These artifacts often result from unequal use of diverse primers during the multiplexed amplification step. Such biased utilization of one or more oligonucleotide primers in a multiplexed reaction that uses diverse amplification templates may arise as a function of one or more of differences in the nucleotide base composition of templates and/or oligonucleotide primers, differences in template and/or primer length, the particular polymerase that is used, the amplification reaction temperatures (e.g., annealing, elongation and/or denaturation temperatures), and/or other factors (e.g., Kanagawa, 2003 J. Biosci. Bioeng. 96:317; Day et al., 1996 Hum. Mol. Genet. 5:2039; Ogino et al., 2002 J. Mol. Diagnost. 4:185; Barnard et al., 1998 Biotechniques 25:684; Aird et al., 2011 Genome Biol. 12:R18).

The identification of paired light and heavy chains from a single B-cell is only one half of the equation regarding immuno-surveillance of antigens/epitopes that are recognized by the adaptive immune system. In the absence of the ability to identify B-cell receptors in the diverse BCR repertoire that bind to corresponding epitopes/antigens, the sequenced BCR profile does not allow for the ability to draw direct correlations between the presence of a specific BCR sequence and the presence of a corresponding epitope/antigen of a pathogen or cancer.

A BCR-specific epitope display library or a BCR-specific antigen display library is the result of introducing B-cells with an extracellular BCR into a solution comprising a genetic conveyance of random or specific antigens to which the BCRs may bind to, and which the BCR heterodimers can be linked to a specific antigen, thus allowing for the correlation of specific BCR sequences to specific antigens. Methods of utilizing phage display for serological profiling are described in Xu et al. Science. 348(6239): aaa0698.

Conventional techniques have focused on determining antigen specificity using antibodies (soluble forms of BCRs), but have not been able to directly assess BCR specificity to antigens. Current methods are not able to simultaneously determine antigen-specific BCRs on a large scale. Antigen-specificity of rare B cells is also difficult to achieve using current techniques.

Clearly there remains a need for identifying antigen-specific BCRs in a high throughput and accurate method. In particular, there exists a need for (1) improved compositions and methods that will permit accurate quantification of adaptive immune receptor-encoding DNA and RNA sequence diversity in complex samples, in a manner that avoids skewed results, for example, from amplification bias, and in a manner that permits determination of the coding sequences for both chains of a BCR heterodimer that originate from the same lymphoid cell; and (2) matching the heterodimers to a corresponding epitope/antigen binding partner to identify BCRs that bind a particular epitope or antigen of interest. The presently described embodiments address this need and provide other related advantages.

SUMMARY OF THE INVENTION

The present invention is based, in part, on methods of identifying antigen-specific B-cell receptor (BCR) sequences with the use of antigen display libraries.

In some embodiments, the present invention provides a method for identifying antigen-specific BCR sequences comprising: (A) incubating a plurality of B-cells with an antigen library displayed by an organism capable of displaying antigens; (B) distributing the B-cells bound to antigens of the antigen library into a plurality of aliquots; (C) isolating nucleic acids from B-cells bound to antigens of the antigen library and from the organism displaying said antigens; sequencing the following elements from each of the aliquots; (i) B-cell heavy chain sequence, (ii) B-cell light chain sequence, and (iii) a nucleotide sequence encoding the antigen bound to the BCR; and (E) identifying the sequenced elements of (D) that occur together in more than one aliquot thereby identifying antigen-specific BCR sequences.

In some embodiments, (A) is immediately followed by enriching for B-cells bound to species of the antigen library. In some embodiments, the enriching of B-cells bound to species of the antigen library comprises flow cytometry.

In some embodiments, (C) is immediately followed by generating a library of amplicons by performing multiplex PCR on the isolated nucleic acids.

In some embodiments, the plurality of B-cells are isolated from a human. In some embodiments, the plurality of B-cells comprises at least 104 cells. In some embodiments, the B-cells express B-cell receptors on the cell surface.

In some embodiments, the antigen library is a phage display library, a bacterial surface display library, or a yeast surface display library. In further embodiments, the antigen library comprises antigens selected from the group consisting of bacterial antigens, viral antigens, fungal antigens, protist antigens, plant antigens, vertebrate antigens, mammalian antigens, or any combination thereof. In some embodiments, the antigen library comprises a whole-genome library of an organism. In some embodiments, the organism is a mammalian pathogen. In further embodiments, the mammalian pathogen is a human pathogen.

In some embodiments, the antigen library comprises a plurality of antigens, and the nucleotide sequence encoding each antigen is flanked by a synthetic polynucleotide sequence. In further embodiments, the synthetic polynucleotide sequence comprises at least one barcode sequence. In further embodiments, the synthetic polynucleotide sequence comprises at least one universal adaptor sequence flanking the antigen. In further embodiments, the synthetic polynucleotide comprises at least one universal adaptor sequence, a sequencing platform tag sequence, and at least one barcode sequence.

In some embodiments, the nucleotide sequence encoding the antigen is a cDNA.

In some embodiments, the method further comprises: (i) for each aliquot, reverse transcribing mRNA comprising rearranged CDR3 regions of the B-cells using oligonucleotide reverse transcription primers that direct incorporation of an oligonucleotide barcode and a universal adapter resulting in cDNA from each of the light and heavy chain sequences comprising a barcode and a universal adaptor, such that amplicons in an aliquot comprises the same unique barcode; (ii) amplifying the cDNA using amplification primers to obtain amplification products; (iii) quantitatively sequencing the amplification products of (ii) to obtain a data set of sequences that includes the B-cell light and heavy chain sequences and associated barcodes for each aliquot; (iv) sorting amplification products based on the unique barcode to identify light and heavy chain sequences that were amplified from the same aliquot and determining an aliquot occupancy pattern for each unique light and heavy chain sequence; and (v) identifying light and heavy chain sequences as paired immune receptor chains based on whether the sequences occur together or do not occur together in a plurality of aliquots based on a statistical probability of observing said aliquot occupancy pattern.

In some embodiments, the oligonucleotide reverse transcription primers that are contacted with the contents of a single aliquot share a common barcode sequence. In some embodiments, the amplification primers further comprise an additional barcode, an n6 spacer, and/or a sequencing oligonucleotide. In some embodiments, the amplification primers specifically hybridize to the universal adapter added to the cDNA in step (ii). In some embodiments, the reverse transcription primers specifically hybridize to V, J, or C segments of each rearranged DNA sequence encoding a light chain and heavy chain polypeptide. In some embodiments, further comprising clustering the sorted amplification products in step (iv) based on the V, J, and/or C segments of each rearranged DNA sequence.

In some embodiments, the method for identifying antigen-specific BCR sequences comprises: (A) incubating a plurality of B-cells with a phage antigen display library; (B) distributing the B-cells bound to antigens of the antigen library into a plurality of aliquots; (C) isolating mRNA from B-cells bound to antigens of the antigen library and nucleic acids from the phage; (D) for each aliquot, reverse transcribing mRNA comprising rearranged CDR3 regions of the B-cells using oligonucleotide reverse transcription primers that direct incorporation of an oligonucleotide barcode and a universal adapter resulting in cDNA from each of the light and heavy chain sequences comprising a barcode and a universal adaptor, wherein each of the oligonucleotide reverse transcription primers that are contacted with the contents of a single aliquot share a common barcode sequence; (E) amplifying the light and heavy chain cDNA sequences using amplification primers to obtain amplification products; (F) quantitatively sequencing the amplification products of (E) to obtain a data set of sequences that includes the B-cell light and heavy chain sequences and associated barcodes for each aliquot; (G) sorting amplification products based on the unique barcode to identify light and heavy chain sequences that were amplified from the same aliquot and determining an aliquot occupancy pattern for each unique light and heavy chain sequence; (H) identifying light and heavy chain sequences as paired immune receptor chains based on whether the sequences occur together or do not occur together in a plurality of aliquots based on a statistical probability of observing said aliquot occupancy pattern; (I) generating a library of amplicons by performing PCR on the isolated nucleic acids from the phage, followed by sequencing the library of amplicons; and (J) identifying the paired immune receptor chains in (H) and the nucleic acids in (I) based on whether the sequences occur together or do not occur together in a plurality of aliquots.

In some embodiments, the amplification primers further comprise an additional barcode, an n6 spacer, and/or a sequencing oligonucleotide.

In some embodiments, the amplification primers specifically hybridize to the universal adapter added to the cDNA in (E).

In some embodiments, the the reverse transcription primers specifically hybridize to V, J, or C segments of each rearranged DNA sequence encoding a light chain and heavy chain polypeptide. In some embodiments, the method further comprises clustering the sorted amplification products in (G) based on the V, J, and/or C segments of each rearranged DNA sequence.

In some embodiments, the isolated nucleic acids from the phage comprise RNA, step (I) is immediately preceded by reverse transcribing RNA comprising antigens of the antigen display library.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 depicts a schematic depicts a schematic representation of certain herein described compositions and methods. U1 and U2 represent universal adaptor oligonucleotides. BC1 and BC2 represent barcode oligonucleotides. J represents an adaptive immune receptor joining (J) region gene and Jpr represents a region of such a gene to which a J-specific oligonucleotide primer specifically anneals. V represents an adaptive immune receptor variable (V) region gene and Vpr represents a region of such a gene to which a V-specific oligonucleotide primer specifically anneals. NDN represents the diversity (D) region found in some adaptive immune receptor encoding genes, flanked on either side by junctional nucleotides (N) which may include non-templated nucleotides. Adap1 and Adap2 represent sequencing platform-specific adapters. The segment shown as “n6” represents a spacer nucleotide segment of any nucleotide sequence, in this case, a spacer of six randomly selected nucleotides.

DETAILED DESCRIPTION OF THE INVENTION

Unless specific definitions are provided, the nomenclature utilized in connection with, and the laboratory procedures and techniques of, molecular biology, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques may be used for recombinant technology, molecular biological, microbiological, chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.

The term “isolated” means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally occurring tissue, cell, nucleic acid or polypeptide present in its original milieu in a living animal is not isolated, but the same tissue, cell, nucleic acid or polypeptide, separated from some or all of the co-existing materials in the natural system, is isolated. Such nucleic acid could be part of a vector and/or such nucleic acid or polypeptide could be part of a composition (e.g., a cell lysate), and still be isolated in that such vector or composition is not part of the natural environment for the nucleic acid or polypeptide. The term “gene” means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region “leader and trailer” as well as intervening sequences (introns) between individual coding segments (exons).

The terms “bacteriophage” and “phage” are used interchangeably herein and refer to viruses which infect bacteria. By the use of the terms “bacteriophage library” or “phage library” as used herein, is meant a population of bacterial viruses comprising heterologous DNA, i.e., DNA which is not naturally encoded by the bacterial virus.

A polynucleotide is “heterologous” to an organism or a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified from its original (native or naturally occurring) form. For example, when a polynucleotide encoding a polypeptide sequence is said to be operably linked to a heterologous promoter, it means that the polynucleotide coding sequence encoding the polypeptide is derived from one species whereas the promoter sequence is derived from another, different species; or, if both are derived from the same species, the coding sequence is not naturally associated with the promoter (e.g., is a genetically engineered coding sequence, e.g., from a different gene in the same species, or an allele from a different ecotype or variety).

Unless the context requires otherwise, throughout the present specification and claims, the word “comprise” and variations thereof, such as, “comprises” and “comprising” are to be construed in an open, inclusive sense, that is, as “including, but not limited to.” By “consisting of” is meant including, and typically limited to, whatever follows the phrase “consisting of.” By “consisting essentially of” is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase “consisting essentially of” indicates that the listed elements are required or mandatory, but that no other elements are required and may or may not be present depending upon whether or not they affect the activity or action of the listed elements.

In this specification and the appended claims, the singular forms “a,” “an” and “the” include plural references unless the content clearly dictates otherwise. As used herein, in particular embodiments, the terms “about” or “approximately” when preceding a numerical value indicates the value plus or minus a range of 5%, 6%, 7%, 8% or 9%. In other embodiments, the terms “about” or “approximately” when preceding a numerical value indicates the value plus or minus a range of 10%, 11%, 12%, 13% or 14%. In yet other embodiments, the terms “about” or “approximately” when preceding a numerical value indicates the value plus or minus a range of 15%, 16%, 17%, 18%, 19% or 20%.

Reference throughout this specification to “one embodiment” or “an embodiment” or “an aspect” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, the appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

Where a numerical range is disclosed herein, then such a range is continuous, inclusive of both the minimum and maximum values of the range, as well as every value between such minimum and maximum values. Still further, where a range refers to integers, every integer between the minimum and maximum values of such range is included. In addition, where multiple ranges are provided to describe a feature or characteristic, such ranges can be combined. That is to say that, unless otherwise indicated, all ranges disclosed herein are to be understood to encompass any and all sub ranges subsumed therein. For example, a stated range of from “1 to 10” should be considered to include any and all sub ranges between the minimum value of 1 and the maximum value of 10. Exemplary sub ranges of the range “1 to 10” include, but are not limited to, 1 to 6.1, 3.5 to 7.8, and 5.5 to 10.

Cells and Vectors

Any cell into which a construct of the disclosure may be introduced and expressed is useful according to the disclosure. That is, because of the wide variety of uses for the constructs of the disclosure, any cell in which a construct of the disclosure may be expressed, and optionally detected, is a suitable host. The construct may exist in a host cell as an extrachromosomal element or be integrated into the host genome.

A host cell may be prokaryotic, such as any of a number of bacterial strains, or may be eukaryotic, such as yeast or other fungal cells, insect, plant, amphibian, or mammalian cells including, for example, rodent, simian or human cells. A host cell may be a primary cultured cell, for example a primary human fibroblast or a keratinocyte, or may be an established cell line, such as NIH3T3, 293T or CHO among others. Further, a mammalian cell useful for expression of the constructs may be phenotypically normal or oncogenically transformed. It is assumed that one skilled in the art can readily establish and maintain a chosen host cell type in culture.

For large scale production of the protein, a unicellular organism, such as E. coli, B. subtilis, S. cerevisiae, an insect cell in combination with one or more baculovirus vectors, or a cell of a higher organism such as a vertebrate, e.g., COS 7, HEK 293, CHO, Xenopus oocyte, etc., may be used as the expression host cell. In some situations, it is desirable to express the construct in a eukaryotic cell, where the expressed protein will benefit from native folding and post-translational modifications. Small peptides may also be synthesized in the laboratory. Polypeptides that are subsets of the complete protein sequence may be used to identify and investigate parts of the protein important for function. Specific expression systems of interest include bacterial, yeast, insect cell, and mammalian cell derived expression systems such as those described in U.S. Pat. No. 6,969,597 and incorporated herein by reference.

When a host cell is used to replicate or express the polynucleotides or nucleic acids of the disclosure, the resulting replicated nucleic acid, RNA, expressed protein or polypeptide, is within the scope of the disclosure as a product of the host cell or organism. The product may be recovered by any appropriate means known in the art.

A bacterial host cell may be selected from phyla of Actinobacteria, Aquificae, Armatimonadetes, Bacteroidetes, Caldiserica, Chlamydiae, Chloroflexi, Chrysiogenetes, Cyanobacteria, Deferribacteres, Deinococcus-Thermus, Dictyoglomi, Elusimicrobia, Fibrobacteres, Firmicutes, Fusobacteria, Gemmatimonadetes, Nitrospirae, Planctomycetes, Proteobacteria, Spirochaetes, Synergistets, Tenericutes, Thermodesulfobacteria, and Thermotogae. In some embodiments the host cell is a Firmicute selected from Bacillus, Listeria, Staphylococcus. In some embodiments the host cell is from Proteobacteria selected from Acidobacillus, Aeromonas, Burkholderia, Neisseria, Shewanella, Citrobacter, Enterobacter, Erwinia, Escherichia, Klebsiella, Kluyvera, Morganella, Salmonella, Shigella, Yersinia, Coxiella, Rickettsia, Legionella, Avibacterium, Haemophilus, Pasteurella, Acinetobacter, Moraxella, Pseudomonas, Vibrio, and Xanthomonas. In some embodiments the host cell is from Tenericutes selected from Mycoplasma, Spiroplasma, and Ureaplasma.

The present disclosure provides compositions and methods for introducing constructs or vectors into host cells. Constructs provided by the disclosure, including vectors, plasmids, and expression cassettes containing polynucleotides of the disclosure, may be introduced to selected host cells by any of a number of suitable methods known to those skilled in the art. Constructs may be inserted into mammalian host cells by methods including, but not limited to, electroporation, transfection, microinjection, micro-vessel transfer, particle bombardment, biolistic particle delivery, liposome mediated transfer and other methods described in Current Protocols in Cell Biology, Unit 20, pub. John Wiley & Sons, Inc., 2004 and incorporated herein by reference.

For example, for the introduction of a construct containing vectors into yeast or other fungal cells, chemical transformation methods are generally used (as described by Rose et al., 1990, Methods in Yeast Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and incorporated herein by reference). For transformation of S. cerevisiae, for example, the cells are treated with lithium acetate. Transformed cells are then isolated on selective media appropriate to the selectable marker used.

Constructs may be introduced to appropriate bacterial cells by infection, as in the case of E. coli bacteriophage particles such as lambda or M13, or by any of a number of transformation methods for plasmid vectors or for bacteriophage DNA. For example, standard calcium-chloride-mediated bacterial transformation is still commonly used to introduce naked DNA to bacteria (Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., incorporated herein by reference), electroporation may also be used (Current Protocols in Molecular Biology, pub. John Wiley & Sons, Inc., 1993 and incorporated herein by reference).

The present disclosure provides compositions and methods for the introduction of vectors into host cells.

Methods for introducing a DNA sequence into eukaryotic cells are known in the art and typically include the use of a DNA vector or plasmid. There are many vectors known and available in the art that are useful for the polynucleotides of the disclosure. One of skill in the art will recognize that the selection of a particular vector depends upon the intended use of the polynucleotide. In one aspect, the DNA sequences are introduced by a vector or plasmid, capable of transforming and driving the expression of the components of the construct in the desired cell type, whether that cell type is prokaryotic or eukaryotic. Many vectors comprise sequences allowing both prokaryotic vector replication and eukaryotic expression of operably linked gene sequences.

Vectors useful according to the disclosure may be autonomously replicating, that is, the vector exists extrachromosomally, and its replication is not necessarily directly linked to the replication of the host genome. Alternatively, the replication of the vector may be linked to the replication of the host chromosomal DNA. For example, the vector may be integrated into a chromosome of the host cell as achieved by retroviral vectors.

A vector will comprise sequences operably linked to the coding sequence of the subject polypeptide that permit the transcription and translation of the components when appropriate. Within the expression vector, a subject polynucleotide is linked to a regulatory sequence as appropriate to obtain the desired expression properties. These regulatory sequences may include promoters (attached either at the 5′ end of the sense strand or at the 3′ end of the antisense strand), enhancers, terminators, operators, repressors, and inducers. The promoters may be regulated or constitutive. In some situations it may be desirable to use conditionally active promoters, such as environment specific promoters. In other words, the expression vector will provide a transcriptional and translational initiation region, which may be inducible or constitutive, where the coding region is operably linked under the transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region. These control regions may be native to the subject species from which the subject nucleic acid is obtained, or may be derived from exogenous sources.

Numerous phage vectors are disclosed in Kieser et al. (Practical Streptomyces Genetics. 2000. John Innes Foundation. 613p). These vectors may include previously describe vectors like KC304 or, like KC304, may be a derivative of ΦC31 which contains a repressor gene (c) to establish and maintain lysogeny, a specific site (attP) in its DNA for integration into the host chromosome, cohesive ends to its DNA, deletion of inessential regions of DNA, one or more drug-selectable markers, comprise combinations of promoters, operators, ribosome binding sites, and signal sequences, and one or more restriction sites to facilitate cloning of a polynucleotide sequence encoding a transcription factor using ligation or other cloning techniques in the art.

Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding heterologous proteins. A selectable marker operative in the expression host may be present. Expression vectors may be used for, among other things, the production of fusion proteins, as is known in the art.

A skilled artisan will recognize that the choice of vector for use with the disclosure is dependent on the host with which the disclosure will be utilized. Suitable vectors include, but are not limited to, bacteriophage-derived vectors, viral vectors, retroviral vectors, adenoviral vectors, adeno-associated viral vectors, herpes virus vectors, and insect vector systems. Such vectors are well known in the art.

Samples

The subject or biological source, from which a test biological sample may be obtained, may be a human or non-human animal, or a transgenic or cloned or tissue-engineered (including through the use of stem cells) organism. In certain preferred embodiments of the invention, the subject or biological source may be known to have, or may be suspected of having or being at risk for having, a circulating or solid tumor or other malignant condition, or an autoimmune disease, or an inflammatory condition, and in certain preferred embodiments of the invention the subject or biological source may be known to be free of a risk or presence of such disease.

Certain preferred embodiments contemplate a subject or biological source that is a human subject such as a patient that has been diagnosed as having or being at risk for developing or acquiring cancer according to art-accepted clinical diagnostic criteria, such as those of the U.S. National Cancer Institute (Bethesda, Md., USA) or as described in DeVita, Hellman, and Rosenberg's Cancer: Principles and Practice of Oncology (2008, Lippincott, Williams and Wilkins, Philadelphia/Ovid, New York); Pizzo and Poplack, Principles and Practice of Pediatric Oncology (Fourth edition, 2001, Lippincott, Williams and Wilkins, Philadelphia/Ovid, New York); and Vogelstein and Kinzler, The Genetic Basis of Human Cancer (Second edition, 2002, McGraw Hill Professional, New York); certain embodiments contemplate a human subject that is known to be free of a risk for having, developing or acquiring cancer by such criteria.

Certain other embodiments contemplate a non-human subject or biological source, for example a non-human primate such as a macaque, chimpanzee, gorilla, vervet, orangutan, baboon or other non-human primate, including such non-human subjects that may be known to the art as preclinical models, including preclinical models for solid tumors and/or other cancers. Certain other embodiments contemplate a non-human subject that is a mammal, for example, a mouse, rat, rabbit, pig, sheep, horse, bovine, goat, gerbil, hamster, guinea pig or other mammal; many such mammals may be subjects that are known to the art as preclinical models for certain diseases or disorders, including circulating or solid tumors and/or other cancers (e.g., Talmadge et al., 2007 Am. J. Pathol. 170:793; Kerbel, 2003 Canc. Biol. Therap. 2(4 Suppl 1):S134; Man et al., 2007 Canc. Met. Rev. 26:737; Cespedes et al., 2006 Clin. Transl. Oncol. 8:318). The range of embodiments is not intended to be so limited, however, such that there are also contemplated other embodiments in which the subject or biological source may be a non-mammalian vertebrate, for example, another higher vertebrate, or an avian, amphibian or reptilian species, or another subject or biological source.

Biological samples may be provided by obtaining a blood sample, biopsy specimen, tissue explant, organ culture, biological fluid or any other tissue or cell preparation from a subject or a biological source. Preferably the sample comprises DNA or mRNA from lymphoid cells of the subject or biological source, which, by way of illustration and not limitation, may contain rearranged DNA at one or more BCR loci (or mRNA transcribed from one or more BCR loci). In certain embodiments a test biological sample may be obtained from a solid tissue (e.g., a solid tumor), for example by surgical resection, needle biopsy or other means for obtaining a test biological sample that contains a mixture of cells.

According to certain embodiments it may be desirable to isolate lymphoid cells (e.g., T cells and/or B cells) according to any of a large number of established methodologies, where isolated lymphoid cells are those that have been removed or separated from the tissue, environment or milieu in which they naturally occur. B cells and T cells can thus be obtained from a biological sample, such as from a variety of tissue and biological fluid samples including bone marrow, thymus, lymph glands, lymph nodes, peripheral tissues and blood, but peripheral blood is most easily accessed. Any peripheral tissue can be sampled for the presence of B and T cells and is therefore contemplated for use in the methods described herein. Tissues and biological fluids from which adaptive immune cells, may be obtained include, but are not limited to skin, epithelial tissues, colon, spleen, a mucosal secretion, oral mucosa, intestinal mucosa, vaginal mucosa or a vaginal secretion, cervical tissue, ganglia, saliva, cerebrospinal fluid (CSF), bone marrow, cord blood, serum, serosal fluid, plasma, lymph, urine, ascites fluid, pleural fluid, pericardial fluid, peritoneal fluid, abdominal fluid, culture medium, conditioned culture medium or lavage fluid. In certain embodiments, adaptive immune cells may be isolated from an apheresis sample. Peripheral blood samples may be obtained by phlebotomy from subjects. Peripheral blood mononuclear cells (PBMC) are isolated by techniques known to those of skill in the art, e.g., by Ficoll-Hypaque® density gradient separation. In certain embodiments, whole PBMCs are used for analysis.

For nucleic acid extraction, total genomic DNA may be extracted from cells using methods known in the art and/or commercially available kits, e.g., by using the QIAamp® DNA blood Mini Kit (QIAGEN®). The approximate mass of a single haploid genome is 3 pg. Preferably, at least 100,000 to 200,000 cells are used for analysis, i.e., about 0.6 to 1.2 μg DNA from diploid B cells. Using PBMCs as a source, the number of B cells can be estimated to be about 30% of total cells. The number of B cells can also be estimated to be about 30% of total cells in a PBMC preparation.

In some embodiments, a plurality of B-cells are isolated, wherein said plurality comprises at least 102, 103, 104, 105, 106, 107, 108, or 109 B-cells. In some embodiments, said plurality of isolated B-cells comprises at least 102-103, 102-104, 102-105, 102-106, 102-107, 102-108, 102-109, 103-104, 103-105, 103-106, 103-107, 103-108, 103-109, 104-105, 104-106, 104-107, 104-108, 104-109, 105-106, 105-107, 105-108, 105-109, 106-107, 106-108, 106-109, 107-108, 107-109, or 108-109 B-cells. In some embodiments, the B-cell receptors are extracellular, and in further embodiments the B-cell receptors are intracellular.

The BCR gene loci contain many different variable (V), diversity (D), and joining (J) gene segments, which are subjected to rearrangement processes during early lymphoid differentiation. BCR V, D and J gene segment sequences are known in the art and are available in public databases such as GENBANK. The V-D-J rearrangements are mediated via a recombinase enzyme complex in which the RAG1 and RAG2 proteins play a key role by recognizing and cutting the DNA at the recombination signal sequences (RSS), which are located downstream of the V gene segments, at both sides of the D gene segments, and upstream of the J gene segments. Inappropriate RSS reduce or even completely prevent rearrangement. The recombination signal sequence (RSS) consists of two conserved sequences (heptamer, 5′-CACAGTG-3′, and nonamer, 5′-ACAAAAACC-3′), separated by a spacer of either 12+/−1 bp (“12-signal”) or 23+/−1 bp (“23-signal”).

A number of nucleotide positions have been identified as important for recombination including the CA dinucleotide at position one and two of the heptamer, and a C at heptamer position three has also been shown to be strongly preferred as well as an A nucleotide at positions 5, 6, 7 of the nonamer. (Ramsden et al., 1994 Nucl. Ac. Res. 22:1785; Akamatsu et al., 1994 J. Immunol. 153:4520; Hesse et al., 1989 Genes Dev. 3:1053). Mutations of other nucleotides have minimal or inconsistent effects. The spacer, although more variable, also has an impact on recombination, and single-nucleotide replacements have been shown to significantly impact recombination efficiency (Fanning et al., 1996 Cell. Immunol. Immunopath. 79:1, Larijani et al., 1999 Nucl. Ac. Res. 27:2304; Nadel et al., 1998 J. Immunol. 161:6068; Nadel et al., 1998 J. Exp. Med. 187:1495). Criteria have been described for identifying RSS polynucleotide sequences having significantly different recombination efficiencies (Ramsden et al., 1994 Nucl. Ac. Res. 22:1785; Akamatsu et al. 1994 J. Immunol. 153:4520; Hesse et al. 1989 Genes Dev. 3:1053, and Lee et al., 2003 PLoS 1(1):E1).

The rearrangement process generally starts with a D to J rearrangement followed by a V to D-J rearrangement in the case of IG heavy chain (IGH) genes or concerns direct V to J rearrangements in case of IG kappa (IGK), or IG lambda (IGL) genes. The sequences between rearranging gene segments are generally deleted in the form of a circular excision product, also called B cell receptor excision circle (BREC).

The many different combinations of V, D, and J gene segments represent the so-called combinatorial repertoire, which is estimated to be ˜2×106 for Ig molecules. At the junction sites of the V, D, and J gene segments, deletion and random insertion of nucleotides occurs during the rearrangement process, resulting in highly diverse junctional regions, which significantly contribute to the total repertoire of Ig molecules, estimated to be >1012.

Mature B-lymphocytes further extend their Ig repertoire upon antigen recognition in follicle centers via somatic hypermutation, a process, leading to affinity maturation of the Ig molecules. The somatic hypermutation process focuses on the V- (D-) J exon of IGH and IG light chain genes and concerns single nucleotide mutations and sometimes also insertions or deletions of nucleotides. Somatically-mutated IG genes are also found in mature B-cell malignancies of follicular or post-follicular origin.

In certain embodiments described herein, V-segment and J-segment primers may be employed in a PCR reaction to amplify rearranged BCR CDR3-encoding DNA regions in a test biological sample, wherein each functional Ig V-encoding gene segment comprises a V gene recombination signal sequence (RSS) and each functional Ig J-encoding gene segment comprises a J gene RSS. In these and related embodiments, each amplified rearranged DNA molecule may comprise (i) at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 (including all integer values therebetween) or more contiguous nucleotides of a sense strand of the Ig V-encoding gene segment, with the at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more contiguous nucleotides being situated 5′ to the V gene RSS and/or each amplified rearranged DNA molecule may comprise (ii) at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500 (including all integer values therebetween) or more contiguous nucleotides of a sense strand of the Ig J-encoding gene segment, with the at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500 or more contiguous nucleotides being situated 3′ to the J gene RSS.

In some embodiments, the present invention will employ, unless indicated specifically to the contrary, conventional methods in microbiology, molecular biology, biochemistry, molecular genetics, cell biology, virology and immunology techniques that are within the skill of the art, and reference to several of which is made below for the purpose of illustration. Such techniques are explained fully in the literature. See, e.g., Sambrook, et al., Molecular Cloning: A Laboratory Manual (3rd Edition, 2001); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Maniatis et al., Molecular Cloning: A Laboratory Manual (1982); Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008); Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Glover, DNA Cloning: A Practical Approach, vol. I & II (IRL Press, Oxford Univ. Press USA, 1985); Current Protocols in Immunology (Edited by: John E. Coligan, Ada M. Kruisbeek, David H. Margulies, Ethan M. Shevach, Warren Strober 2001 John Wiley & Sons, NY, N.Y.); Real-Time PCR: Current Technology and Applications, Edited by Julie Logan, Kirstin Edwards and Nick Saunders, 2009, Caister Academic Press, Norfolk, UK; Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992); Guthrie and Fink, Guide to Yeast Genetics and Molecular Biology (Academic Press, New York, 1991); Oligonucleotide Synthesis (N. Gait, Ed., 1984); Nucleic Acid Hybridization (B. Hames & S. Higgins, Eds., 1985); Transcription and Translation (B. Hames & S. Higgins, Eds., 1984); Animal Cell Culture (R. Freshney, Ed., 1986); Perbal, A Practical Guide to Molecular Cloning (1984); Next-Generation Genome Sequencing (Janitz, 2008 Wiley-VCH); PCR Protocols (Methods in Molecular Biology) (Park, Ed., 3rd Edition, 2010 Humana Press); Immobilized Cells And Enzymes (IRL Press, 1986); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Harlow and Lane, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1998); Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and CC Blackwell, eds., 1986); Riott, Essential Immunology, 6th Edition, (Blackwell Scientific Publications, Oxford, 1988); Embryonic Stem Cells: Methods and Protocols (Methods in Molecular Biology) (Kurstad Turksen, Ed., 2002); Embryonic Stem Cell Protocols: Volume I: Isolation and Characterization (Methods in Molecular Biology) (Kurstad Turksen, Ed., 2006); Embryonic Stem Cell Protocols: Volume II: Differentiation Models (Methods in Molecular Biology) (Kurstad Turksen, Ed., 2006); Human Embryonic Stem Cell Protocols (Methods in Molecular Biology) (Kursad Turksen Ed., 2006); Mesenchymal Stem Cells: Methods and Protocols (Methods in Molecular Biology) (Darwin J. Prockop, Donald G. Phinney, and Bruce A. Bunnell Eds., 2008); Hematopoietic Stem Cell Protocols (Methods in Molecular Medicine) (Christopher A. Klug, and Craig T. Jordan Eds., 2001); Hematopoietic Stem Cell Protocols (Methods in Molecular Biology) (Kevin D. Bunting Ed., 2008) Neural Stem Cells: Methods and Protocols (Methods in Molecular Biology) (Leslie P. Weiner Ed., 2008).

Antigen Display Library

In some embodiments, antigen display libraries are used to present potential antigenic epitopes to BCRs in a method for identifying antigen-specific BCR sequences. In some embodiments, antigenic epitopes, also known as antigenic determinants, is the portion of an antigen that is recognized by components of the immune system, e.g., antibodies, B-cells, T-cells, etc. In some embodiments, an antigen is any structural substance that serves as a target for receptors of an adaptive immune response, such as BCRs.

In some embodiments, antigen display libraries comprise whole antigens or fragments thereof. In some embodiments, the antigens or fragments thereof may be selected from bacteria, viruses, fungi, protists, plants, vertebrates, mammals, fish, or any combination thereof. In some embodiments, the antigens may be from pathogens or cancerous cells. In some embodiments, the displayed antigen is 9, 10, 11, 12 or more amino acids in length. Preferably the displayed antigen is 9-12 amino acids in length.

In some embodiments, antigen display libraries are selected from phage display libraries, yeast display libraries, bacterial display libraries, and eukaryotic virus display libraries.

Antigen display methodologies have proven invaluable for the discovery, production, and optimization of proteins and peptides in a variety of biotechnological applications. Various approaches including phage display (Smith, G. P. (1985) Science, 228, 1315-1317), mRNA (Wilson et al. (2001)Proc. Natl. Acad. Sci. USA, 98, 3750-3755) and DNAdisplay (Yonezawa et al. (2003) Nucleic Acids Res., 31, e118), ribosome display (Hanes, J. & Pluckthun, A. (1997) Proc. Natl. Acad. Sci. USA, 94, 4937-42), eukaryotic virus display (Bupp, K. & Roth, M. J. (2002) Mol. Ther., 5, 329-335; Muller et al. (2003) Nat. Biotechnol., 21:1040-1046), yeast display (Boder, E. T. & Wittrup, K. D. (1997) Nat. Biotechnol., 15, 553-557), and bacterial display (Lu et al. (1995) Biotechnology (N Y), 13, 366-372) have been developed to screen diverse molecular repertoires. In particular, bacterial display libraries have enabled antibody affinity maturation (Daugherty et al. (2000) Proc. Natl. Acad. Sci. USA, 97, 2029-2034), the discovery of protein binding peptides (Bessette et al. (2004) Protein Eng. Des. Sel., 17, 731-739), cell-specific ligands (Dane et al. (2006)J. Immunol. Methods, 309, 120-129; Nakajima et al. (2000) Gene, 260, 121-131), and the identification of optimal protease substrates (Boulware, K. T. & Daugherty, P. S. (2006) Proc. Natl. Acad. Sci. USA, 103, 7583-7588).

In one embodiment, phage display libraries are utilized. Phage display libraries may be constructed on the surface of phages, e.g. a bacteriophage such as fd (McCafferty et al, 1990, Nature, 348, 552-554) or M13 (Barbas III et al, 1991, PNAS, 8ji, 7978-7982). Phage display libraries are constructed following essentially the same principles as antibody libraries, e.g. peptide libraries on the surface of bacteriophage (Smith, 1985, Science, 228, 1315-1317).

In some embodiments of this disclosure, phage for use within the scope of this disclosure include, but are not limited to, A11, R4, A118, C31, C62, C43, AE2, Acm7, BL8, BL9, BK5, Bf42, BN1, BT11, ΦBT1, C2121, Chp1, CTXΦ, D37, DAV1, Deβ, EΦB, EΦ-y, EC1, Erh1, FP1, Min1, Plot, SV1, TG1, R4, TJE1, TPA2, PhiSAV, p1.1, B22, P105, PhiAsp2, ArV2, ArV1, GTE2, GTES. GRU1, TA17A, T7, T3, T4, DD5, PAD20, PA6, K29, P58, PM4, PYO6, RP10, Qβ, SAV1, SD1, SP1, SST, SsV, Tm10, Tull*, V40, λ, ΦXo, ΦC31, ΨM1, SV1, ΦC44, Ω8, M13, fd, f1, or variants thereof.

In one embodiment, bacterial surface display libraries are utilized. One of the key advantages of bacterial surface display is the ability to use flow cytometry for quantitative screening of the libraries, allowing for real-time analysis of binding affinity and specificity to optimize the screening process (Wittrup, K. D. (2001) Curr. Opin. Biotechnol., 12, 395-399). Additionally, the ease of genetic manipulation, high transformation efficiency, and rapid growth rate make E. coli a well-suited host for display. A broad range of bacterial surface display systems have been developed allowing for insertional or terminally fused peptides and proteins to be displayed on the cell surface.

Expression of antigens on the surface of bacteria has been demonstrated by fusions to LamB (Charbit et al, 1988, Gene, 7_0, 181-189 and Bradbury et al, 1993, Bio/Technology, 1565-1568), Omp A (Pistor and Hobom, 1989, Klin. Wochenschr., £6, 110-116), fimbriae (Hedegaard and Klemm, 1989, Gene, J35, 115-124 and Hofnung, 1991, Methods Cell Biol., 34, 77-105), IgA protease β domain (Klauser et al, 1990, EMBO J., 9, 1991-1999) and flagellae (Newton et al, 1989, Science, 244, 70-72).

In one embodiment, cell display combinatorial libraries are disclosed, for example, U.S. Pat. No. 6,214,613 to K. Higuchi et al. “Expression Screening Vector”. For example, the display of proteins on cell surfaces can provide a support, similar to the immobilization of a protein on, for example, sepharose. Rather than covalently link a soluble protein to an inert support matrix, an expressed protein can be displayed on a cell surface. Hence, cell surface display can be used to circumvent separate expression, purification, and immobilization of binding proteins and enzymes. In addition, the biomolecules can be secreted from the cell rather than displayed on the surface.

In one embodiment, eukaryotic cell display libraries can be used in the practice of the present invention, wherein the library comprises a plurality of expressed biomolecules. Eukaryotic cell display libraries include, for example, yeast, insect, plant, and mammalian libraries. Cells can be in a cell line or can be a primary culture cell type.

Methods of modifying mammalian cells for surface display are known including cell surface display procedures. See, for example, U.S. Pat. No. 6,255,071 to Beach et al. (Jul. 3, 2001); U.S. Pat. No. 6,207,371 to Zambrowicz et al. (Mar. 27, 2001); and U.S. Pat. No. 6,136,566 to Sands et al. (Oct. 24, 2000). See also, for example, Holmes et al., J. Immunol. Methods, 1999, 230: 141-147; Chesnut et al. J. Immunol. Methods, 1996, 193: 17-27; Chou et al., Biotechnol Bioeng, 1999, 65: 160-169.

In one embodiment, yeast surface display libraries are utilized. Yeast surface display libraries and the methods of creating said libraries are described in, for example, U.S. Pat. No. 6,300,065 to Kieke et al. (Oct. 9, 2001); U.S. Pat. No. 6,331,391 to Wittrup et al. (Dec. 18, 2001); U.S. Pat. Nos. 6,423,538 and 6,300,065.

Yeast surface display libraries are further presented in Bhatia et al., Biotechnol Prog. Jun. 6, 2003; 19(3):1033-1037; and Feldhaus et al., Nat Biotechnol. February 2003; 21(2):163-70.

Primers and Amplification

The nucleic acids of the present embodiments, also referred to herein as polynucleotides, may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. A coding sequence which encodes an immunoglobulin or a region thereof (e.g., a V region, a D segment, a J region, a C region, etc.) for use according to the present embodiments may be identical to the coding sequence known in the art for any given immunoglobulin gene regions or polypeptide domains (e.g., V-region domains, CDR3 domains, etc.), or may be a different coding sequence, which, as a result of the redundancy or degeneracy of the genetic code, encodes the same immunoglobulin region or polypeptide.

In some embodiments, oligonucleotide primers are provided in an oligonucleotide primer set that comprises a plurality of V-segment primers and a plurality of J-segment primers, where the primer set is capable of amplifying rearranged DNA encoding adaptive immune receptors in a biological sample that comprises lymphoid cell DNA. Suitable primer sets are known in the art and disclosed herein.

In certain embodiments the primer set is designed to include a plurality of V sequence-specific primers that includes, for each unique V region gene (including pseudogenes) in a sample, at least one primer that can specifically anneal to a unique V region sequence; and for each unique J region gene in the sample, at least one primer that can specifically anneal to a unique J region sequence.

Primer design may be achieved by routine methodologies in view of known BCR genomic sequences. Accordingly, the primer set is preferably capable of amplifying every possible V-J combination that may result from DNA rearrangements in the BCR locus. As also described below, certain embodiments contemplate primer sets in which one or more V primers may be capable of specifically annealing to a unique sequence that may be shared by two or more V regions but that is not common to all V regions, and/or in which one or more J primers may be capable of specifically annealing to a unique sequence that may be shared by two or more J regions but that is not common to all J regions, and/or in which one or more C primers may be capable of specifically annealing to a unique sequence that may be shared by two or more C regions but that is not common to all C regions.

In particular embodiments, oligonucleotide primers for use in the compositions and methods described herein may comprise or consist of a nucleic acid of at least about 15 nucleotides long that has the same sequence as, or is complementary to, a 15 nucleotide long contiguous sequence of the target V-, C-, or J-segment (i.e., portion of genomic polynucleotide encoding a V-region, C-region, or J-region polypeptide). Longer primers, e.g., those of about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, or 50, nucleotides long that have the same sequence as, or sequence complementary to, a contiguous sequence of the target V-, C-, or J-region encoding polynucleotide segment, will also be of use in certain embodiments. All intermediate lengths of the presently described oligonucleotide primers are contemplated for use herein. As would be recognized by the skilled person, the primers may have additional sequence added (e.g., nucleotides that may not be the same as or complementary to the target V-, or C-, or J-region encoding polynucleotide segment), such as restriction enzyme recognition sites, adaptor sequences for sequencing, barcode sequences, and the like (see e.g., primer sequences provided in the Tables). Therefore, the length of the primers may be longer, such as about 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 80, 85, 90, 95, 100 or more nucleotides in length or more, depending on the specific use or need.

Also contemplated for use in certain embodiments are adaptive immune receptor V-segment, C-segment, or J-segment oligonucleotide primer variants that may share a high degree of sequence identity to the oligonucleotide primers for which nucleotide sequences are presented herein. Thus, in these and related embodiments, adaptive immune receptor V-segment, C-segment, or J-segment oligonucleotide primer variants may have substantial identity to the adaptive immune receptor V-segment, C-segment, or J-segment oligonucleotide primer sequences disclosed herein, for example, such oligonucleotide primer variants may comprise at least 70% sequence identity, preferably at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity compared to a reference polynucleotide sequence such as the oligonucleotide primer sequences disclosed herein, using the methods described herein (e.g., BLAST analysis using standard parameters). One skilled in this art will recognize that these values can be appropriately adjusted to determine corresponding ability of an oligonucleotide primer variant to anneal to an adaptive immune receptor segment-encoding polynucleotide by taking into account codon degeneracy, reading frame positioning and the like.

Typically, oligonucleotide primer variants will contain one or more substitutions, additions, deletions and/or insertions, preferably such that the annealing ability of the variant oligonucleotide is not substantially diminished relative to that of an adaptive immune receptor V-segment or J-segment oligonucleotide primer sequence that is specifically set forth herein.

In certain preferred embodiments, the V-segment, C-segment, and J-segment oligonucleotide primers as described herein are designed to include nucleotide sequences such that adequate information is present within the sequence of an amplification product of a rearranged adaptive immune receptor (e.g., BCR) gene to identify uniquely the specific V, specific C, and the specific J genes that give rise to the amplification product in the rearranged adaptive immune receptor locus (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 base pairs of sequence upstream of the V gene recombination signal sequence (RSS), preferably at least about 22, 24, 26, 28, 30, 32, 34, 35, 36, 37, 38, 39 or 40 base pairs of sequence upstream of the V gene recombination signal sequence (RSS), and in certain preferred embodiments greater than 40 base pairs of sequence upstream of the V gene recombination signal sequence (RSS); and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 base pairs downstream of the J gene RSS, preferably at least about 22, 24, 26, 28 or 30 base pairs downstream of the J gene RSS, and in certain preferred embodiments greater than 30 base pairs downstream of the J gene RSS); and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 base pairs downstream or upstream of the C gene RSS, preferably at least about 22, 24, 26, 28 or 30 base pairs downstream or upstream of the C gene RSS, and in certain preferred embodiments greater than 30 base pairs downstream or upstream of the C gene RSS).

This feature stands in contrast to oligonucleotide primers described in the art for amplification of Ig-encoding gene sequences, which rely primarily on the amplification reaction merely for detection of presence or absence of products of appropriate sizes for V, C, and J segments (e.g., the presence in PCR reaction products of an amplicon of a particular size indicates presence of a V, C, or J segment but fails to provide the sequence of the amplified PCR product and hence fails to confirm its identity, such as the common practice of spectratyping).

Oligonucleotides (e.g., primers) can be prepared by any suitable method, including direct chemical synthesis by a method such as the phosphotriester method of Narang et al., 1979, Meth. Enzymol. 68:90-99; the phosphodiester method of Brown et al., 1979, Meth. Enzymol. 68:109-151; the diethylphosphoramidite method of Beaucage et al., 1981, Tetrahedron Lett. 22:1859-1862; and the solid support method of U.S. Pat. No. 4,458,066, each incorporated herein by reference. A review of synthesis methods of conjugates of oligonucleotides and modified nucleotides is provided in Goodchild, 1990, Bioconjugate Chemistry 1(3): 165-187, incorporated herein by reference. IG primers and methods of using said primers are described in U.S. Patent Application Publication Nos. US 2012-0058902 and US 2010-0330571, incorporated herein by reference.

The term “primer,” as used herein, refers to an oligonucleotide capable of acting as a point of initiation of DNA synthesis under suitable conditions. Such conditions include those in which synthesis of a primer extension product complementary to a nucleic acid strand is induced in the presence of four different nucleoside triphosphates and an agent for extension (e.g., a DNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature.

A primer is preferably a single-stranded DNA. The appropriate length of a primer depends on the intended use of the primer but typically ranges from 6 to 50 nucleotides, or in certain embodiments, from 15-35 nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template. A primer need not reflect the exact sequence of the template nucleic acid, but must be sufficiently complementary to hybridize with the template. The design of suitable primers for the amplification of a given target sequence is well known in the art and described in the literature cited herein.

As described herein, primers can incorporate additional features which allow for the detection or immobilization of the primer but do not alter the basic property of the primer, that of acting as a point of initiation of DNA synthesis. For example, primers may contain an additional nucleic acid sequence at the 5′ end which does not hybridize to the target nucleic acid, but which facilitates cloning, detection, or sequencing of the amplified product. The region of the primer which is sufficiently complementary to the template to hybridize is referred to herein as the hybridizing region.

As used herein, a primer is “specific,” for a target sequence if, when used in an amplification reaction under sufficiently stringent conditions, the primer hybridizes primarily to the target nucleic acid. Typically, a primer is specific for a target sequence if the primer-target duplex stability is greater than the stability of a duplex formed between the primer and any other sequence found in the sample. One of skill in the art will recognize that various factors, such as salt conditions as well as base composition of the primer and the location of the mismatches, will affect the specificity of the primer, and that routine experimental confirmation of the primer specificity will be needed in many cases. Hybridization conditions can be chosen under which the primer can form stable duplexes only with a target sequence. Thus, the use of target-specific primers under suitably stringent amplification conditions enables the selective amplification of those target sequences which contain the target primer binding sites.

In some embodiments, primers for use in amplifying the phage-containing nucleic acid sequence encoding the antigen hybridize to one or more synthetic polynucleotide sequences flanking said nucleic acid sequence encoding the antigen.

In particular embodiments, primers for use in the methods described herein comprise or consist of a nucleic acid of at least about 15 nucleotides long that has the same sequence as, or is complementary to, a 15 nucleotide long contiguous sequence of the target V, C, or J segment. Longer primers, e.g., those of about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, or 50, nucleotides long that have the same sequence as, or sequence complementary to, a contiguous sequence of the target V, C, or J segment, will also be of use in certain embodiments. All intermediate lengths of the aforementioned primers are contemplated for use herein. As would be recognized by the skilled person, the primers may have additional sequence added (e.g., nucleotides that may not be the same as or complementary to the target V, C, or J segment), such as restriction enzyme recognition sites, adaptor sequences for sequencing, barcode sequences, and the like (see e.g., primer sequences provided herein). Therefore, the length of the primers may be longer, such as 55, 56, 57, 58, 59, 60, 65, 70, 75, nucleotides in length or more, depending on the specific use or need. For example, in one embodiment, the forward and reverse primers are both modified at the 5′ end with the universal forward primer sequence compatible with a DNA sequencer.

Also contemplated for use in certain embodiments are adaptive immune receptor V-segment, C-segment, or J-segment oligonucleotide primer variants that may share a high degree of sequence identity to the oligonucleotide primers for which nucleotide sequences are presented herein. Thus, in these and related embodiments, adaptive immune receptor V-segment, C-segment, or J-segment oligonucleotide primer variants may have substantial identity to the adaptive immune receptor V-segment, C-segment, or J-segment oligonucleotide primer sequences disclosed herein, for example, such oligonucleotide primer variants may comprise at least 70% sequence identity, preferably at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity compared to a reference polynucleotide sequence such as the oligonucleotide primer sequences disclosed herein, using the methods described herein (e.g., BLAST analysis using standard parameters). One skilled in this art will recognize that these values can be appropriately adjusted to determine corresponding ability of an oligonucleotide primer variant to anneal to an adaptive immune receptor segment-encoding polynucleotide by taking into account codon degeneracy, reading frame positioning and the like.

Typically, oligonucleotide primer variants will contain one or more substitutions, additions, deletions and/or insertions, preferably such that the annealing ability of the variant oligonucleotide is not substantially diminished relative to that of an adaptive immune receptor V-segment, C-segment, or J-segment oligonucleotide primer sequence that is specifically set forth herein. As also noted elsewhere herein, in preferred embodiments adaptive immune receptor V-segment, C-segment, and J-segment oligonucleotide primers are designed to be capable of amplifying a rearranged BCR sequence that includes the coding region for CDR3.

In some embodiments, the primers for use in the multiplex PCR methods of the present disclosure may be functionally blocked to prevent non-specific priming of non-T or B cell sequences. For example, the primers may be blocked with chemical modifications as described in U.S. Patent Application Publication No. US 2010-0167353. According to certain herein disclosed embodiments, the use of such blocked primers in the present multiplex PCR reactions involves primers that may have an inactive configuration wherein DNA replication (i.e., primer extension) is blocked, and an activated configuration wherein DNA replication proceeds. The inactive configuration of the primer is present when the primer is either single-stranded, or when the primer is specifically hybridized to the target DNA sequence of interest but primer extension remains blocked by a chemical moiety that is linked at or near to the 3′ end of the primer.

The activated configuration of the primer is present when the primer is hybridized to the target nucleic acid sequence of interest and is subsequently acted upon by RNase H or another cleaving agent to remove the 3′ blocking group, thereby allowing an enzyme (e.g., a DNA polymerase) to catalyze primer extension in an amplification reaction. Without wishing to be bound by theory, it is believed that the kinetics of the hybridization of such primers are akin to a second order reaction, and are therefore a function of the B cell gene sequence concentration in the mixture. Blocked primers minimize non-specific reactions by requiring hybridization to the target followed by cleavage before primer extension can proceed. If a primer hybridizes incorrectly to a sequence that is related to the desired target sequence but which differs by having one or more non-complementary nucleotides that result in base-pairing mismatches, cleavage of the primer is inhibited, especially when there is a mismatch that lies at or near the cleavage site. This strategy to improve the fidelity of amplification reduces the frequency of false priming at such locations, and thereby increases the specificity of the reaction. As would be recognized by the skilled person, reaction conditions, particularly the concentration of RNase H and the time allowed for hybridization and extension in each cycle, can be optimized to maximize the difference in cleavage efficiencies between highly efficient cleavage of the primer when it is correctly hybridized to its true target sequence, and poor cleavage of the primer when there is a mismatch between the primer and the template sequence to which it may be incompletely annealed.

As described in U.S. Patent Application Publication No. US 2010-0167353, a number of blocking groups are known in the art that can be placed at or near the 3′ end of the oligonucleotide (e.g., a primer) to prevent extension. A primer or other oligonucleotide may be modified at the 3′-terminal nucleotide to prevent or inhibit initiation of DNA synthesis by, for example, the addition of a 3′ deoxyribonucleotide residue (e.g., cordycepin), a 2′,3′-dideoxyribonucleotide residue, non-nucleotide linkages or alkane-diol modifications (U.S. Pat. No. 5,554,516). Alkane diol modifications which can be used to inhibit or block primer extension have also been described by Wilk et al., (1990 Nucleic Acids Res. 18 (8):2065), and by Arnold et al. (U.S. Pat. No. 6,031,091). Additional examples of suitable blocking groups include 3′ hydroxyl substitutions (e.g., 3′-phosphate, 3′-triphosphate or 3′-phosphate diesters with alcohols such as 3-hydroxypropyl), 2′3′-cyclic phosphate, 2′ hydroxyl substitutions of a terminal RNA base (e.g., phosphate or sterically bulky groups such as triisopropyl silyl (TIPS) or tert-butyl dimethyl silyl (TBDMS)). 2′-alkyl silyl groups such as TIPS and TBDMS substituted at the 3′-end of an oligonucleotide are described by Laikhter et al., U.S. Patent Application Publication No. US 2007-0218490, which is incorporated herein by reference. Bulky substituents can also be incorporated on the base of the 3′-terminal residue of the oligonucleotide to block primer extension.

In some embodiments, the oligonucleotide may comprise a cleavage domain that is located upstream (e.g., 5′ to) of the blocking group used to inhibit primer extension. As examples, the cleavage domain may be an RNase H cleavage domain, or the cleavage domain may be an RNase H2 cleavage domain comprising a single RNA residue, or the oligonucleotide may comprise replacement of the RNA base with one or more alternative nucleosides. Additional illustrative cleavage domains are described in U.S. Patent Application Publication No. US 2010-0167353.

In one embodiment, a multiplex PCR system may use 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or more forward primers, wherein each forward primer is complementary to a single functional BCR V segment or a small family of functional BCR V segments; and, for example, thirteen reverse primers, each specific to a BCR J segment. In another embodiment, a multiplex PCR reaction may use four forward primers each specific to one or more functional BCR V segments and four reverse primers each specific for one or more BCR J segments. In another embodiment, a multiplex PCR reaction may use 84 forward primers each specific to one or more functional V segments and six reverse primers each specific for one or more J segments.

Thermal cycling conditions may follow methods of those skilled in the art. For example, using a PCR Express™ thermal cycler (Hybaid, Ashford, UK), the following cycling conditions may be used: 1 cycle at 95° C. for 15 minutes, 25 to 40 cycles at 94° C. for 30 seconds, 59° C. for 30 seconds and 72° C. for 1 minute, followed by one cycle at 72° C. for 10 minutes. As will be recognized by the skilled person, thermal cycling conditions may be optimized, for example, by modifying annealing temperatures, annealing times, number of cycles and extension times. As would be recognized by the skilled person, the amount of primer and other PCR reagents used, as well as PCR parameters (e.g., annealing temperature, extension times and cycle numbers), may be optimized to achieve desired PCR amplification efficiency.

Alternatively, in certain related embodiments also contemplated herein, “digital PCR” methods can be used to quantitate the number of target genomes in a sample, without the need for a standard curve. In digital PCR, the PCR reaction for a single sample is performed in a multitude of more than 100 microcells or droplets, such that each droplet either amplifies (e.g., generation of an amplification product provides evidence of the presence of at least one template molecule in the microcell or droplet) or fails to amplify (evidence that the template was not present in a given microcell or droplet). By simply counting the number of positive microcells, it is possible directly to count the number of target genomes that are present in an input sample. Digital PCR methods typically use an endpoint readout, rather than a conventional quantitative PCR signal that is measured after each cycle in the thermal cycling reaction (see, e.g., Pekin et al., 2011 Lab. Chip 11(13):2156; Zhong et al., 2011 Lab. Chip 11(13):2167; Tewhey et al., 2009 Nature Biotechnol. 27:1025; 2010 Nature Biotechnol. 28:178). Accordingly, any of the herein described compositions (e.g., adaptive immune receptor gene-specific oligonucleotide primer sets) and methods may be adapted for use in such digital PCR methodology, for example, the ABI QuantStudio™ 12K Flex System (Life Technologies, Carlsbad, Calif.), the QuantaLife™ digital PCR system (BioRad, Hercules, Calif.) or the RainDance™ microdroplet digital PCR system (RainDance Technologies, Lexington, Mass.).

Synthetic Polynucleotides

In one embodiment, synthetic polynucleotides may comprise at least a barcode sequence, an adaptor sequence, and a sequencing platform tag sequence. In some embodiments, the synthetic polynucleotides comprise at least one barcode sequence, at least one adaptor sequence, and at least one sequencing platform tag sequence. In some embodiments, the synthetic polynucleotides flank nucleotide sequences that encode the antigens or epitopes of the antigen display library.

In one embodiment, the synthetic polynucleotide sequences comprise primer hybridization sites that allow for the amplification of the entire nucleic acid sequence encoding the antigen.

Adaptors

The herein described oligonucleotides may in certain embodiments comprise first (U1) and second (U2) (and optionally third (U3) and fourth (U4)) universal adaptor oligonucleotide sequences, or may lack either or both of U1 and U2 (or U3 or U4). A universal adaptor oligonucleotide U thus may comprise either nothing or an oligonucleotide having a sequence that is selected from (i) a first universal adaptor oligonucleotide sequence, and (ii) a first sequencing platform-specific oligonucleotide sequence that is linked to and positioned 5′ to a first universal adaptor oligonucleotide sequence, and U2 may comprise either nothing or an oligonucleotide having a sequence that is selected from (i) a second universal adaptor oligonucleotide sequence, and (ii) a second sequencing platform-specific oligonucleotide sequence that is linked to and positioned 5′ to a second universal adaptor oligonucleotide sequence. A similar relationship pertains for U3 and U4.

U1 and/or U2 may, for example, comprise universal adaptor oligonucleotide sequences and/or sequencing platform-specific oligonucleotide sequences that are specific to a single-molecule sequencing technology being employed, for example the HiSeq™ or GeneAnalyzer™-2 (GA-2) systems (Illumina, Inc., San Diego, Calif.) or another suitable sequencing suite of instrumentation, reagents and software. Inclusion of such platform-specific adaptor sequences permits direct quantitative sequencing of the presently described dsDNA amplification products into which U has been incorporated as described herein, using a nucleotide sequencing methodology such as the HiSeq™ or GA2 or equivalent. This feature therefore advantageously permits qualitative and quantitative characterization of the dsDNA composition.

For example, dsDNA amplification products may be generated that have universal adaptor sequences at both ends, so that the adaptor sequences can be used to further incorporate sequencing platform-specific oligonucleotides at each end of each template.

Without wishing to be bound by theory, platform-specific oligonucleotides may be added onto the ends of such dsDNA using 5′ (5′-platform sequence-universal adaptor-1 sequence-3′) and 3′ (5′-platform sequence-universal adaptor-2 sequence-3′) oligonucleotides in three cycles of denaturation, annealing and extension, so that the relative representation in the dsDNA composition of each of the component dsDNAs is not quantitatively altered. Unique identifier sequences (e.g., barcode sequences B that are associated with and thus identify individual V and/or J regions, or sample-identifier barcodes as described herein) are placed adjacent to the adaptor sequences, thus permitting quantitative sequencing in short sequence reads, in order to characterize the DNA population by the criterion of the relative amount of each unique sequence that is present.

Non-limiting examples of additional adaptor sequences are shown in Table 1 and set forth in SEQ ID NOs: 1-22.

TABLE 1
Exemplary Adaptor Sequences
SEQ
Adaptor ID
(primer) name Sequence NO:
T7 Promotor AATACGACTCACTATAGG 1
T7 Terminator GCTAGTTATTGCTCAGCGG 2
T3 ATTACCCTCAACTAAAGG 3
SP6 GATTTAGGTGACACTATAG 4
M13F(−21) TGTAAAACGACGGCCAGT 5
M13F(−40) GTTTTCCCAGTCACGAC 6
M13R Reverse CAGGAAACAGCTATGACC 7
AOX1 Forward GACTGGTTCCAATTGACAGC 8
AOX1 Reverse GCAAATGGCATTCTGACATCC 9
pGEX Forward GGGCTGGCAGCCACGTTTGGTG 10
(GST 5,
pGEX 5′)
pGEX Reverse CCGGGAGCTGCATGTGTCAGAGG 11
(GST 3,
pGEX 3′)
BGH Reverse AACTAGAAGGCACAGTCGAGGC 12
GFP  CACTCTCGGCATGGACGAGC 13
(C′ terminal,
CFP, YFP or
BFP)
GFP Reverse TGGTGCAGATGAACTTCAGG 14
GAG GTTCGACCCCGCCTCGATCC 15
GAG Reverse TGACACACATTCCACAGGGTC 16
CYC1 Reverse GCGTGAATGTAAGCGTGAC 17
pFastBacF* 5′-d(GGATTATTCATACCGTCCCA)-3′ 18
pFastBacR* 5′-d(CAAATGTGGTATGGCTGATT)-3′ 19
pBAD Forward* 5′-d(ATGCCATAGCATTTTTATCC)-3′ 20
pBAD Reverse* 5′-d(GATTTATCTGTATCAGG)-3′ 21
CMV-Forward* 5′-d(CGCAAATGGGCGGTAGGCGTG)-3′ 72
*d = deoxy

Barcodes

As described herein, certain embodiments contemplate designing oligonucleotide sequences to contain short signature sequences that permit unambiguous identification of the polynucleotide sequence into which they are incorporated, and hence of at least one primer responsible for amplifying that product, without having to sequence the entire amplification product. In the herein described oligonucleotides, such barcodes B (e.g., B1, B2) are each either nothing or each comprise an oligonucleotide B that comprises an oligonucleotide barcode sequence of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50 or more contiguous nucleotides (including all integer values therebetween), wherein in each of the plurality of oligonucleotide sequences B comprises a unique oligonucleotide sequence which uniquely identifies a particular V and/or J oligonucleotide primer sequence.

Exemplary barcodes may comprise a first barcode oligonucleotide of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleotides that uniquely identifies each oligonucleotide primer (e.g., a V or a J primer) in the primer composition, and optionally in certain embodiments a second barcode oligonucleotide of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleotides that uniquely identifies each partner primer in a primer set (e.g., a J or a V primer), to provide barcodes of, respectively, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 nucleotides in length, but these and related embodiments are not intended to be so limited. Barcode oligonucleotides may comprise oligonucleotide sequences of any length, so long as a minimum barcode length is obtained that precludes occurrence of a given barcode sequence in two or more product polynucleotides having otherwise distinct sequences (e.g., V and J sequences).

Thus, the minimum barcode length, to avoid such redundancy amongst the barcodes that are used to uniquely identify different V-J sequence pairings, is X nucleotides, where 4x is greater than the number of distinct template species that are to be differentiated on the basis of having non-identical sequences. In practice, barcode oligonucleotide sequence read lengths may be limited only by the sequence read-length limits of the nucleotide sequencing instrument to be employed. For certain embodiments, different barcode oligonucleotides that will distinguish individual species of template oligonucleotides should have at least two nucleotide mismatches (e.g., a minimum hamming distance of 2) when aligned to maximize the number of nucleotides that match at particular positions in the barcode oligonucleotide sequences.

The skilled artisan will be familiar with the design, synthesis, and incorporation into a larger oligonucleotide or polynucleotide construct, of oligonucleotide barcode sequences of, for instance, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35 or more contiguous nucleotides, including all integer values therebetween. For non-limiting examples of the design and implementation of oligonucleotide barcode sequence identification strategies, see, e.g., de Carcer et al., 2011 Adv. Env. Microbiol. 77:6310; Parameswaran et al., 2007 Nucl. Ac. Res. 35(19):330; Roh et al., 2010 Trends Biotechnol. 28:291.

Typically, barcodes are placed in oligonucleotides at locations where they are not found naturally, i.e., barcodes comprise nucleotide sequences that are distinct from any naturally occurring oligonucleotide sequences that may be found in the vicinity of the sequences adjacent to which the barcodes are situated (e.g., V and/or J sequences). Such barcode sequences may be included, according to certain embodiments described herein, as elements B1 and/or B2 of the presently disclosed oligonucleotides. Accordingly, certain of the herein described oligonucleotide compositions may in certain embodiments comprise one, two or more barcodes, while in certain other embodiments some or all of these barcodes may be absent. In certain embodiments all barcode sequences will have identical or similar GC content (e.g., differing in GC content by no more than 20%, or by no more than 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10%).

Sequencing

Sequencing may be performed using any of a variety of available high through-put single molecule sequencing machines and systems. Illustrative sequence systems include sequence-by-synthesis systems such as the Illumina Genome Analyzer and associated instruments (Illumina, Inc., San Diego, Calif.), Helicos Genetic Analysis System (Helicos BioSciences Corp., Cambridge, Mass.), Pacific Biosciences PacBio RS (Pacific Biosciences, Menlo Park, Calif.), Ion Torrent™ (ThermoFisher Scientific, Waltham, Mass.), or other systems having similar capabilities. Sequencing is achieved using a set of sequencing oligonucleotides that hybridize to a defined region within the amplified DNA molecules. The sequencing oligonucleotides are designed such that the V- and J-encoding gene segments can be uniquely identified by the sequences that are generated, based on the present disclosure and in view of known adaptive immune receptor gene sequences that appear in publicly available databases.

The term “gene” means the segment of DNA involved in producing a polypeptide chain such as all or a portion of an Ig polypeptide (e.g., a CDR3-containing polypeptide); it includes regions preceding and following the coding region “leader and trailer” as well as intervening sequences (introns) between individual coding segments (exons), and may also include regulatory elements (e.g., promoters, enhancers, repressor binding sites and the like), and may also include recombination signal sequences (RSSs) as described herein.

In certain embodiments, the amplified J-region or C-region encoding gene segments may each have a unique sequence-defined identifier tag of 2, 3, 4, 5, 6, 7, 8, 9, 10 or about 15, 20 or more nucleotides, situated at a defined position relative to a RSS site. However, these and related embodiments need not be so limited and also contemplate other relatively short nucleotide sequence-defined identifier tags that may be detected in J-region encoding gene segments and defined based on their positions relative to an RSS site. These may vary between different adaptive immune receptor encoding loci.

The recombination signal sequence (RSS) consists of two conserved sequences (heptamer, 5′-CACAGTG-3′, and nonamer, 5′-ACAAAAACC-3′), separated by a spacer of either 12+/−1 bp (“12-signal”) or 23+/−1 bp (“23-signal”). A number of nucleotide positions have been identified as important for recombination including the CA dinucleotide at position one and two of the heptamer, and a C at heptamer position three has also been shown to be strongly preferred as well as an A nucleotide at positions 5, 6, 7 of the nonamer. (Ramsden et. al 1994; Akamatsu et. al. 1994; Hesse et. al. 1989). Mutations of other nucleotides have minimal or inconsistent effects. The spacer, although more variable, also has an impact on recombination, and single-nucleotide replacements have been shown to significantly impact recombination efficiency (Fanning et. al. 1996; Larijani et. al 1999; Nadel et. al. 1998). Criteria have been described for identifying RSS polynucleotide sequences having significantly different recombination efficiencies (Ramsden et. al 1994; Akamatsu et. al. 1994; Hesse et. al. 1989; and Cowell et. al. 1994). Accordingly, the sequencing oligonucleotides may hybridize adjacent to a four base tag within the amplified J-encoding gene segments at positions +11 through +14 downstream of the RSS site. For example, sequencing oligonucleotides for BCRs may be designed to anneal to a consensus nucleotide motif observed just downstream of this “tag”, so that the first four bases of a sequence read will uniquely identify the J-encoding gene segment (see, e.g., International PCT Publication No. WO 2012/027503).

The average length of the CDR3-encoding region, for the BCR, defined as the nucleotides encoding the BCR polypeptide between the second conserved cysteine of the V segment and the conserved phenylalanine of the J segment, is 35+/−3 nucleotides. Accordingly and in certain embodiments, PCR amplification using V-segment oligonucleotide primers with J-segment oligonucleotide primers that start from the J segment tag of a particular BCR J region (e.g., BCR JH as described herein) will nearly always capture the complete V-D-J junction in a 50 base pair read. The average length of the IGH CDR3 region, defined as the nucleotides between the conserved cysteine in the V segment and the conserved phenylalanine in the J segment, is less constrained than at the TCRβ locus, but will typically be between about 10 and about 70 nucleotides. Accordingly and in certain embodiments, PCR amplification using V-segment oligonucleotide primers with J-segment oligonucleotide primers that start from the IGH J segment tag will capture the complete V-D-J junction in a 100 base pair read.

PCR primers that anneal to and support polynucleotide extension on mismatched template sequences are referred to as promiscuous primers. In certain embodiments, the IG J-segment reverse PCR primers may be designed to minimize overlap with the sequencing oligonucleotides, in order to minimize promiscuous priming in the context of multiplex PCR. In one embodiment, the IG J-segment reverse primers may be anchored at the 3′ end by annealing to the consensus splice site motif, with minimal overlap of the sequencing primers. Generally, the IG V and J-segment primers may be selected to operate in PCR at consistent annealing temperatures using known sequence/primer design and analysis programs under default parameters.

Disclosed herein are unexpectedly advantageous approaches for uniquely and unambiguously labeling individual, sequence-distinct Ig encoding gene segments or mRNA transcripts thereof, or cDNA that has been reverse transcribed from such mRNA transcripts, by performing such labeling prior to conventional steps of expanding a population of such gene segments or transcripts thereof (including reverse transcripts) through established nucleic acid amplification techniques. Without wishing to be bound by theory, by labeling individual Ig encoding gene segments or transcripts thereof (including complementary DNA generated by reverse transcription) as described herein, prior to commonly practiced amplification steps which are employed to generate DNA copies in sufficient quantities for sequencing, the present embodiments offer unprecedented sensitivity in the detection and quantification of diverse Ig encoding sequences, while at the same time avoiding misleading, inaccurate or incomplete results that may occur due to biases in oligonucleotide primer utilization during multiple rounds of nucleic acid amplification from an original sample, using a sequence-diverse set of amplification primers.

Also described herein, in certain embodiments, are unprecedented compositions and methods that permit quantitative determination of the sequences encoding both polypeptides in an adaptive immune receptor heterodimer from a single cell, such as both IGH and IGL from a B cell. By providing the ability to obtain such information from a complex sample such as a sample containing a heterogeneous mixture of T and/or B cells from a subject, these and related embodiments permit more accurate determination of the relative representation in a sample of particular T and/or B cell clonal populations than has previously been possible.

Certain embodiments contemplate modifications as described herein to oligonucleotide primer sets that are used in multiplexed nucleic acid amplification reactions to generate a population of amplified rearranged DNA molecules from a biological sample containing rearranged genes encoding adaptive immune receptors, prior to quantitative high throughput sequencing of such amplified products. Multiplexed amplification and high throughput sequencing of rearranged BCR encoding DNA sequences are described, for example, in Robins et al., 2009 Blood 114:4099; Robins et al., 2010 Sci. Translat. Med. 2:47ra64; Robins et al., 2011 J. Immunol. Meth. doi:10.1016/j.jim.2011.09. 001; Sherwood et al. 2011 Sci. Translat. Med. 3:90ra61; U.S. Patent Application Nos. 61/550,311 and 61/569,118; US Patent Application Publication Nos. US 2012-0058902 and US 2010-0330571; International PCT Publication Nos. WO 2010/151416, WO 2011/106738, and WO 2012/027503; accordingly these disclosures are incorporated by reference and may be adapted for use according to the embodiments described herein.

According to certain embodiments, in a sample containing a plurality of sequence-diverse Ig encoding gene segments, such as a sample comprising DNA (or mRNA transcribed therefrom or cDNA reverse-transcribed from such mRNA) from lymphoid cells in which DNA rearrangements have taken place to encode functional Ig heterodimers (or in which non-functional IG pseudogenes have been involved in DNA rearrangements), a plurality of individual Ig encoding sequences may each be uniquely tagged with a specific oligonucleotide barcode sequence as described herein, through a single round of nucleic acid amplification (e.g., polymerase chain reaction PCR). The population of tagged polynucleotides can then be amplified to obtain a library of tagged molecules, which can then be quantitatively sequenced by existing procedures such as those described, for example, in U.S. Patent Application Nos. 61/550,311 and 61/569,118; US Patent Application Publication Nos. US 2012-0058902 and US 2010-0330571; International PCT Publication Nos. WO 2010/151416, WO 2011/106738, and WO 2012/027503, each of which is incorporated by reference in their entireties.

In the course of these sequence reads, the incorporated barcode tag sequence is sequenced and can be used as an identifier in the course of compiling and analyzing the sequence data so obtained. In certain embodiments, it is contemplated that for each barcode tag sequence, a consensus sequence for the associated IG sequences may be determined. A clustering algorithm can then be applied to identify molecules generated from the same original clonal cell population. By such an approach, sequence data of high quality can be obtained in a manner that overcomes inaccuracies associated with sequencing artifacts.

An exemplary embodiment is depicted in FIG. 1, according to which from a starting template population of genomic DNA or cDNA from a lymphoid cell-containing population, two or more cycles of PCR are performed using an oligonucleotide primer composition that contains primers having the general formula U1-B1n-X as described herein. As shown in FIG. 1, the J-specific primer 110a contains a J primer sequence 100 that is complementary to a portion of the J segment, a barcode tag (BC1) 101 in FIG. 1, or B1n in the generic formula) and also includes a first external universal adaptor sequence (U1) 102, while the V-specific primer 110b includes a V primer sequence 103 that is complementary to a portion of the V segment and a second external universal adaptor sequence (U2) 104.

The invention need not be so limited, however, and also contemplates related embodiments, such as those where the barcode may instead or may in addition be present as part of the V-specific primer and is situated between the V-sequence and the second universal adaptor. It will be appreciated that based on the present disclosure, those skilled in the art can design other suitable primers by which to introduce the herein described barcode tags to uniquely label individual IG encoding gene segments. For example, in FIG. 1, the V and J primers can each comprise a barcode (BC1, BC2) and a universal adaptor sequence (U1, U2). U1 and U2 may be the same or a different universal adaptor sequence.

As described herein, a large number (up to 4n where n is the length of the barcode sequence) of different barcode sequences are present in the oligonucleotide primer composition that contains primers having the general formula U1-B1n-X as described herein, such that the PCR products of the large number of different amplification events following specific annealing of appropriate V- and J-specific primers are differentially labeled. In some embodiments, the number of barcode sequences is up to or smaller than 4n. In one embodiment, a barcode of length n=8 is used. The length of the barcode “n” determines the possible number of barcodes (4n as described herein), but in some embodiments, a smaller subset is used to avoid closely related barcodes or barcodes with different annealing temperatures. In other embodiments, as described herein, sets of m and n barcode sequences are used in subsequent amplification steps (e.g., to individually label each rearranged IG sequence and then to uniformly label (“tailing”) a set of sequences obtained from the same source, or sample In preferred embodiments, the V and J primers 100 and 103 are capable of promoting the amplification of an Ig encoding sequence that includes the CDR3 encoding sequence, which in FIG. 1 includes the NDN region 111. As also indicated in FIG. 1, following no more than two amplification cycles, the first amplification primer set 110a, 110b is separated from the double-stranded DNA product. By such a step, it is believed according to non-limiting theory that contamination of the product preparation by subsequent rounds of amplification is avoided, where contaminants could otherwise be produced by amplifying newly formed double-stranded DNA molecules with amplification primers that are present in the complex reaction but which are primers other than those used to generate the double-stranded DNA in the first one or two amplification cycles. A variety of chemical and biochemical techniques are known in the art for separating double-stranded DNA from oligonucleotide amplification primers.

Once the first amplification primer set 110a, 110b is removed, by which the unique barcode tag sequences have been introduced, the tagged double-stranded DNA (dsDNA) products can be amplified using a second amplification primer set 120a, 120b as described herein and depicted in FIG. 1, to obtain a DNA library suitable for sequencing. The second amplification primer set advantageously exploits the introduction, during the preceding step, of the universal adaptor sequences 102, 104 (e.g., U1 and U2 in FIG. 1) into the dsDNA products. Accordingly, because these universal adaptor sequences have been situated external to the unique barcode tags (BC1) 101 in FIG. 1, the amplification products that comprise the DNA library to be sequenced retain the unique barcode identifier sequences linked to each particular rearranged V-J gene segment combination, whilst being amenable to amplification via the universal adaptors.

In preferred embodiments and as also depicted in FIG. 1, the second amplification primer set 120a, 120b may introduce sequencing platform-specific oligonucleotide sequences (Adap1 105 and Adap2 106 in FIG. 1), however these are not necessary in certain other related embodiments. The second amplification primer set 120a, 120b may also optionally introduce a second oligonucleotide barcode identifier tag (BC2 107 in FIG. 1), such as a single barcode sequence that may desirably identify all products of the amplification from a particular sample (e.g., as a source subject-identifying code) and ease multiplexing multiple samples to allow for higher throughput. The barcode (BC2; 107 in FIG. 1) is a modification that increases the throughput of the assay (e.g., allows samples to be multiplexed on the sequencer), but is not required. Alternatively, a universal primer without adaptors can be used to amplify the tagged molecules. After amplification, the molecules can be additionally tagged with platform specific oligonucleotide sequences. Such inclusion of a second, sample-identifying barcode, may beneficially aid in the identification of sample origins when samples from several different subjects are mixed, or in the identification of inadvertent contamination of one sample preparation with material from another sample preparation. The second amplification primer set may also, as shown in FIG. 1, optionally include a spacer nucleotide (“n6”; 108 in FIG. 1), which may facilitate the operation of the sequencing platform-specific sequences. The spacer improves the quality of the sequencing data, but is not required or present in certain embodiments. The spacer is specifically added to increase the number of random base pairs during the first 12 cycles of the sequencing step of the method. By increasing the diversity of the first 12 cycles, cluster definition and base calling is improved. The spacer nucleotide 108 may be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11-20, 21-30 or more nucleotides of any sequence, typically a randomly generated sequence. Where it may be of concern that the presence of such random sequences will result in uneven annealing rates amongst the oligonucleotide primers containing such sequences, it may be preferred to perform a relatively small number of amplification cycles, typically three, four or five cycles, or optionally 1-6 or no more than eight cycles, to reduce the potential for unevenness in amplification that could skew downstream results.

The resulting DNA library can then be sequenced according to standard methodologies and using available instrumentation as provided herein and known in the art. Where a second, sample-identifying barcode (BC2 107 in FIG. 1) is present, sequencing that includes reading both such barcodes is performed, with the sequence information (V-J junction including CDR3 encoding sequence, along with the first oligonucleotide barcode BC1 101 that uniquely tags each distinct sequence) between the two occurrences of the sample-identifying barcode 107 also being read. Sequencing primers may include, for instance, and with reference to FIG. 1, the universal primer 102 on the J side of NDN 111 for the first read, followed by a barcode sequence BC1 101, a J primer sequence 100 and CDR3 sequences. The second set of amplification primers include a forward primer comprising the platform-specific primer (Adap1 105) on the J side, a spacer sequence comprising random nucleotides (labeled “n6”; 108 in FIG. 1), and BC2 sample-identifying barcodes 107. The reverse primer in the second set of amplification primers includes the universal primer 104 on the V side of NDN 111, a spacer sequence 108 comprising random nucleotides, and a BC2 sample-identifying barcode sequence 107, and optionally a paired-end read using the reverse second sequencing platform-specific primer (Adap2 106). The second sequencing platform-specific primer (Adap2 106) is used to sequence and “read” the spacer sequence 108, the sample-identifying barcode sequence BC2 107, the universal adaptor sequence 104, the V sequence 103, and NDN 111. To capture the CDR3 sequence, one can use J amplification primers, C amplification primers or the V amplification primers.

Sequence data may be sorted using the BC2 sample-identifying barcodes 107 and then further sorted according to sequences that contain a common first barcode BC1 101. Within such sorted sequences, CDR3 sequences may be clustered to determine whether more than one sequence cluster is present using any of a known variety of algorithms for clustering (e.g., BLASTClust, UCLUST, CD-HIT, or others, or as described in Robins et al., 2009 Blood 114:4099). Additionally or alternatively, sequence data may be sorted and selected on the basis of those sequences that are found at least twice. Consensus sequences may then be determined by sequence comparisons, for example, to correct for sequencing errors. Where multiple unique identifier barcode tags (BC1 101) are detected among sequences that otherwise share a common consensus sequence, the number of such barcode tags that is identified may be regarded as reflective of the number of molecules in the sample from the same T cell or B cell clone.

Identifying Both Chains of an Ig Heterodimer from a Single Adaptive Immune Cell

As also noted above, in certain other embodiments there is provided herein a method for determining rearranged DNA sequences (or mRNA sequences transcribed therefrom or cDNA that has been reverse transcribed from such mRNA) encoding first and second polypeptide sequences of an adaptive immune receptor heterodimer in a single lymphoid cell. The method includes uniquely labeling each rearranged DNA sequence with a unique barcode sequence for identifying a particular cell and/or sample, as presented in U.S. Patent Application No. 61/606,617; International PCT Publication No. WO 2014/145992; and US Patent Application Publication No. US 2015-0031043A1.

Non-limiting examples of BCR C-segment primers for 1st cDNA strand synthesis are shown in Table 2 and set forth in SEQ ID NOs. 23-44.

Non-limiting examples of BCR IGH and IGKL primer sequences are shown in Table 3, and set forth in SEQ ID NOs. 45-132. In one embodiment, the pGEXF sequence, SEQ ID NO: 45, and the pGEXR sequence, SEQ ID NO: 46, are added to the 5′ position of primers of the present disclosure. In some embodiments, additional primer sequences are contemplated for adding to the 5′ position of primers of the present disclosure, such as CMV early promoter, LKO.1, LucNrev, M13, MSCV, pBABE, SP6, T3, and T7.

TABLE 2
List of BCR C-segment
primers for 1st cDNA strand synthesis:
SEQ
ID
Name Sequence NO:
Ck GATGAAGACAGATGGTGCAGC 23
Cl-1 GGCGGGAACAGAGTGAC 24
Cl-2 AGGGTGGGAACAGAGTGAC 25
Cl-3 GCTTGAAGCTCCTCAGAGG 26
Cl-4 GGCGGGAACAGAGTGAC 27
IgA AGGCTCAGCGGGAAGAC 28
IgD GAACACATCCGGAGCCTTG 29
IgE GGTGGCATTGGAGGGAATG 30
IgG-1 AAGACCGATGGGCCCTTG 31
IgG-2 CTCTCGGAGGTGCTCCTG 32
IgM AATTCTCACAGGAGACGAGGG 33
Primers from Glanville et al., PNAS 2011
IgM_RACE 5′-GATGGAGTCGGGAAGGAAGTCCTGTGCGAG- 34
3′
IgG_RACE 5′-GGGAAGACSGATGGGCCCTTGGTGG-3′ 35
IgA_RACE 5′-CAGGCAKGCGAYGACCACGTTCCCATC-3′ 36
Igκ_RACE 5′-CATCAGATGGCGGGAAGATGAAGACAGATGG 37
TGC-3′
Igλ_RACE 5′-CCTCAGAGGAGGGTGGGAACAGAGTGAC-3′ 38
Clontech Smarter primers
Smarter 5′-AAGCAGTGGTATCAACGCAGAGTACrGrGrG 39
UAII* rGrG-P-3
Islam 5′-AAGCAGTGGTATCAACGCAGAGTGCAGUGCU 40
UAII** XXXXXXrGrGrG-3′
Smarter 5′-Bio-AAGCAGTGGTATCAACGCAGAGTACT 41
CDS# (30)N−1-N-3′
Smarter 5′-Bio-AAGCAGTGGTATCAACGCAGAGT-3′ 42
IS PCR#
5′RACE 5′-CTAATACGACTCACTATAGGGCAAGCAGTG 43
long GTATCAACGCAGAGT-3′
5′RACE 5′-CTAATACGACTCACTATAGGGC-3′ 44
short
rG = riboguanosine
N−1 = A, C, G, or T; N = A, G, or C
X = any nucleotide
Bio = biotinylated

TABLE 3
BCR IGH and IGKL primer sequences
SEQ ID
Name Sequence NO:
pGEXF GGGCTGGCAAGCCACGTTTGGTG 45
pGEXR CCGGGAGCTGCATGTGTCAGAGG 46
pGEXF_IGK_V_01-05_F_D10 TCTGCATCTGTAGGAGACAGAGTCACCATCACTTG 47
pGEXF_IGK_V_01-08_F_D10 TCTGCATCTACAGGAGACAGAGTCACCATCACTTG 48
pGEXF_IGK_V_01-35_P_D10 CTGCATCTGTAAGGAGACAGTGTCACCATCACTTG 49
pGEXF_IGK_V_1D-08_F_D10 TCTGCATCTACAGGAGACAGAGTCACCATCAGTTG 50
pGEXF_IGK_V_1D-22_P_D10 ACTGCATCTGTAGGAGAGAGAGTCACCATCACTTG 51
pGEXF_IGK_V_1D-35_P_D10 GCATCTGTAAGGAGACAGCGTCACCATCACTTG 52
pGEXF_IGK_V_1D-42_F_D10 GTCTGCATCTGTAGGAGACAGAGTCAGTATCATTTG 53
pGEXF_IGK_V_02-04_P_D10 GGAGAGCCGGCCTCCATCTCCTG 54
pGEXF_IGK_V_02-10_P_D10 CCTGGAGAGCCAGCCTCCATCTCCTG 55
pGEXF_IGK_V_02-18_P_D10 CTGGAGAGCCGGCCTCCATCTCTTG 56
pGEXF_IGK_V_02-19_P_D10 TCTTCCTTGGAGAGCCATCCTCCATTTCCTG 57
pGEXF_IGK_V_02-24_F_D10 GGACAGCCGGCCTCCATCTCCTG 58
pGEXF_IGK_V_02-28_F_D10 TGGAGAGCCGGCCTCCATCTCCTG 59
pGEXF_IGK_V_02-38_P_D10 ATAATATTTGTACATAACTTTGTACTTCATCTCCTG 60
pGEXF_IGK_V_2D-14_P_D10 CCCCTGGAAAGCCAGCCTCTATCTCCTG 61
pGEXF_IGK_V_2D-19_P_D10 CTCTTCCTTGGAGAGCCATCCTCCATTTCCTG 62
pGEXF_IGK_V_2D-24_O_D10 GGACAGCCGGCCTCCATCTCCTT 63
pGEXF_IGK_V_2D-26_F_D10 CCTGGAGAGCAGGCCTCCATGTCCTG 64
pGEXF_IGK_V_03-07_F_D10 CCAGGGGAAAGAGCCACCCTCTCCTG 65
pGEXF_IGK_V_03-07_P_D10 TCCAGGGGAAAGAGTCACCCTCTCCTG 66
pGEXF_IGK_V_03-25_P_D10 TCTTTGTCTCTGGAGAAAAAAGCCACCCTGACTTG 67
pGEXF_IGK_V_03-31_P_D10 TCTCTAGGGGAAAAAGCCACCCTCACCTA 68
pGEXF_IGK_V_03-34_P_D10 GGGGAAGGAGCCACCCTCACCTG 69
pGEXF_IGK_V_04-01_F_D10 GGGCGAGAGGGCCACCATCAACTG 70
pGEXF_IGK_V_05-02_F_D10 GCGACTCCAGGAGACAAAGTCAACATCTCCTG 71
pGEXF_IGK_V_06-21_0_D10 CTGTGACTCCAAAGGAGAAAGTCACCATCACCTG 72
pGEXF_IGK_V_6D-41_F_D10 ACTCCAGGGGAGAAAGTCACCATCACCTG 73
pGEXF_IGK_V_07-03_P_D10 CAGGACAGAGGGCCACCATCACCTG 74
pGEXF_IGL_V_01-36_F_D10 CCCAGGCAGAGGGTCACCATCTCCTG 75
pGEXF_IGL_V_01-40_F_D10 CCAGGGCAGAGGGTCACCATCTCCTG 76
pGEXF_IGL_V_01-44_F_D10 CCGGGCAGAGGGTCACCATCTCTTG 77
pGEXF_IGL_V_01-51_F_D10 CCCCAGGACAGAAGGTCACCATCTCCTG 78
pGEXF_IGL_V_01-62_P_D10 CCACAAGGCAGAGGCTCACTGTCTCCTG 79
pGEXF_IGL_V_02-08_F_D10 GTCTCCTGGACAGTCAGTCACCATCTCCTG 80
pGEXF_IGL_V_02-14_F_D10 GTCTCCTGGACAGTCGATCACCATCTCCTG 81
pGEXF_IGL_V_02-33_O_D10 TCCTGGACAGTCGGTCACCATCTCCTG 82
pGEXF_IGL_V_02-34_P_D10 CTGGGACTTGGGGTAAACAGTCACCATCTTCTG 83
pGEXF_IGL_V_03-01_F_D10 CCAGGACAGACAGCCAGCATCACCTG 84
pGEXF_IGL_V_03-02_P_D10 CTTTGGGACGTACGGCCAGGATCATCTG 85
pGEXF_IGL_V_03-04_P_D10 CTTTGGGACAGATGGCCAGGATCACCTG 86
pGEXF_IGL_V_03-06_P_D10 CCAGGACAGGCAGCCATGATCACCTG 87
pGEXF_IGL_V_03-07_P_D10 TGGGACAGAGGGCCAGGATCACCTA 88
pGEXF_IGL_V_03-09_FP_D10 GGGACAGGCGGCCAGGATTACCTG 89
pGEXF_IGL_V_03-10_F_D10 CCAGGACAAACGGCCAGGATCACCTG 90
pGEXF_IGL_V_03-12_F_D10 CACAGCACAGATGGCCAGGATCACCTG 91
pGEXF_IGL_V_03-13_P_D10 CCAGGACAGACAGCCAGGATCAGCTG 92
pGEXF_IGL_V_03-15_P_D10 CCCCAGGACAGATGACCAGGATCACCTG 93
pGEXF_IGL_V_03-16_F_D10 CCCTAGGACAGATGGCCAGGATCACCTG 94
pGEXF_IGL_V_03-17_P_D10 GTGTCTGTGGACAGTCAGCAAGGGTAACCTG 95
pGEXF_IGL_V_03-19_F_D10 GGCCTTGGGACAGACAGTCAGGATCACATG 96
pGEXF_IGL_V_03-21_F_D10 CCCCAGGAAAGACGGCCAGGATTACCTG 97
pGEXF_IGL_V_03-22_FP_D10 CCCAGGACAGAAAGCCAGGATCACCTG 98
pGEXF_IGL_V_03-24_P_D10 CAGTAGCTCCAGGACAGATGACTAGGATCACCTG 99
pGEXF_IGL_V_03-25_F_D10 CAGGACAGACGGCCAGGATCACCTG 100
pGEXF_IGL_V_03-26_P_D10 CCTGGGACAGTCAGCCAGGGTAACCTG 101
pGEXF_IGL_V_03-27_F_D10 CGGGACAGACAGCCAGGATCACCTG 102
pGEXF_IGL_V_03-29_P_D10 CCCAGGACAGACACCCAGGATCACCTG 103
pGEXF_IGL_V_03-30_P_D10 CCCCATTACAGATGGCCAGGATCACCTG 104
pGEXF_IGL_V_03-31_P_D10 GCCTTGGGATAGACAGCCAGGATCACCTG 105
pGEXF_IGL_V_03-32_O_D10 CCTTGGGACAAATGGCCAGGATCACCTG 106
pGEXF_IGL_V_04-03_F_D10 CTGGGAGCCTCGATCAAGCTCACCTG 107
pGEXF_IGL_V_04-60_F_D10 CCTGGGATCCTCGGTCAAGCTCACCTG 108
pGEXF_IGL_V_04-69_F_D10 GGGAGCCTCGGTCAAGCTCACCTG 109
pGEXF_IGL_V_05-37_F_D10 TCCTGGAGAATCCGCCAGACTCACCTG 110
pGEXF_IGL_V_05-39_F_D10 TCTCCTGGAGCATCAGCCAGATTCACCTG 111
pGEXF_IGL_V_05-45_F_D10 TCCTGGAGCATCAGCCAGTCTCACCTG 112
pGEXF_IGL_V_05-48_O_D10 TCCTGGAGCATCAGCCAGACTCACCTG 113
pGEXF_IGL_V_05-52_F_D10 GCATCTTCTGGAGCATCAGTCAGACTCACCTG 114
pGEXF_IGL_V_07-35_P_D10 CCCAGGAGGGACAGTCACTCTCACCTA 115
pGEXF_IGL_V_07-43_F_D10 CCCAGGAGGGACAGTCACTCTCACCTG 116
pGEXF_IGL_V_08-61_F_D10 CCCCTGGAGGGACAGTCACACTCACTTG 117
pGEXF_IGL_V_09-49_F_D10 TGGGAGCCTCGGTCACACTCACCTG 118
pGEXF_IGL_V_10-54_F_D10 CTTGAGACAGACCGCCACACTCACCTG 119
PGEXF_IGK_V_del_D10 GTAAATAATTGCATTTTTTAATGACCGTGGGTCTGTG 120
pGEXR_IGK_J_01_F_D10 TTCTACTCACGTTTGATTTCCACCTTGGTCCC 121
pGEXr_IGKJ_02_F_D10 AAGTACTTACGTTTGATCTCCAGCTTGGTCCC 122
pGEXr_IGK_J_03_F_D10 ACAGATGTACTTACGTTTGATATCCACTTTGGTCCC 123
pGEXr_IGK_J_04_F_D10 CACTTACGTTTGATCTCCACCTTGGTCCC 124
pGEXr_IGK_J_05_F_D10 GAAAAATTACTTACGTTTAATCTCCAGTCGTGTCCC 125
pGEXr_IGL_J_01_F_D10 CTTACCTAGGACGGTGACCTTGGTCCC 126
pGEXr_IGL_J_02_F_D10 ACCTAGGACGGTCAGCTTGGTCCC 127
pGEXr_IGL_J_04_O_D10 AAGAAGAGACTCATCTAAAATGATCAGCTGGGTTCC 128
pGEXr_IGL_J_05_O_D10 ATCTAGGACGGTCAGCTCCGTCCC 129
pGEXr_IGL_J_06_F_D10 GAGGACGGTCACCTTGGTGCC 130
pGEXr_IGL_J_07_F_D10 AGGACGGTCAGCTGGGTGCC 131
pGEXr_IGK_del_F_D10 CTGCAGACTCATGAGGAGTCGCCC 132

High-Throughput Pairing of Rearranged Nucleic Acid Sequences Encoding Adaptive Immune Receptor Heterodimer Polypeptides

In certain embodiments, the methods of the present invention include the step of determining from the combined population of cells, a plurality of cognate pairs of first and second rearranged nucleic acid sequences encoding first and second polypeptides of the adaptive immune receptor heterodimers. The present invention is not intended to be limited to any one pairing method and contemplates that many methods known in the art, including those herein disclosed, may be suitable for practicing the claimed invention.

In a preferred embodiment, the methods for determining pairs of BCR heterodimers are those described in International PCT Publication No. WO 2014/145992 which is incorporated by reference in its entirety. Other methods for pairing polypeptide chains of BCR heterodimers are described in International PCT Publication No. WO 2013/188831, which is incorporated by reference in its entirety. By way of illustration, but not limitation, one exemplary embodiment of the methods of the invention is summarized herein as follows.

The method of the invention relies on the observation that rearranged first and second nucleotide sequences are nearly unique for each clonal population of adaptive immune cells. Distinctive first and second sequences arise through recombination of gene segments and template-independent deletion or insertion of nucleotides at the V-J, V-D, and D-J junctions in somatic cells during lymphocyte development. This extraordinary diversity means that mRNAs encoding the heterodimeric polypeptide chains of a specific adaptive immune cell clone will usually be present only in sets of cells that include that clone. This extreme diversity may be leveraged by splitting a sample of adaptive immune cells into multiple subsets and then sequencing the first and second mRNA molecules to determine the presence or absence of each polypeptide chain in each subset. The first and second sequences from a clone should be seen in the same subsets of adaptive immune cells, and only those subsets.

In some embodiments, the method can involve extracting genomic DNA, rather than mRNA from cells in a sample, to amplify up the polypeptide chains of a specific adaptive immune receptor heterodimer.

Pairing the heterodimeric polypeptide chains then becomes a statistical problem: to declare a unique pairing, one must show that it is highly improbable for a given clone to occupy the same collection of adaptive immune cell subsets as another clone. The probability that a given clone occupies the same collection of adaptive immune cell subsets as another clone is close to zero for thousands of clones in an experiment using the methods of the invention.

In other embodiments, the method of the invention can be tuned to pair cognate adaptive immune receptor chains in any desired frequency range simply by changing the number of input adaptive immune cells per well. Other embodiments can also assay cognate pairs from multiple frequency bands in a single experiment by stratifying the number of input adaptive immune cells into subsets.

As described above, the method can be used to accurately pair BCR sequences at high-throughput. For example, the methods of the invention can be used to pair a first polypeptide chain of an adaptive immune receptor heterodimer comprising a BCR light chain and a second polypeptide of the adaptive immune receptor heterodimer comprising a BCR heavy chain. In another example, the methods of the invention can be used to pair a first polypeptide of an adaptive immune receptor heterodimer comprising an immunoglobulin heavy (IGH) chain and a second polypeptide of the adaptive immune receptor heterodimer that is selected from an immunoglobulin light IGL or an IGK chain.

The method provides steps for identifying a plurality of cognate pairs comprising a first polypeptide and a second polypeptide that form an adaptive immune receptor heterodimer, said adaptive immune receptor heterodimer comprising a B cell receptor (BCR) from a single clone in a sample, the sample comprising a plurality of lymphoid cells from a mammalian subject. As described above, the method includes steps for distributing a plurality of lymphoid cells among a plurality of containers, each container comprising a plurality of lymphoid cells; generating a library of amplicons in the plurality of containers by performing multiplex PCR of cDNA molecules that have been reverse-transcribed from mRNA molecules obtained from the plurality of lymphoid cells. The library of amplicons include: i) a plurality of first adaptive immune receptor amplicons encoding the first polypeptide, each comprising a unique variable (V) region encoding sequence, a unique J region encoding sequence or both a unique J region encoding sequence and a unique C region encoding sequence, at least one barcode sequence, at least one universal adaptor sequence, and a sequencing platform tag sequence, and ii) a plurality of second adaptive immune receptor amplicons encoding the second polypeptide, each comprising a unique V region encoding sequence, a unique J region encoding sequence or both a unique J region encoding sequence and a unique C region encoding sequence, at least one barcode sequence, at least one universal adaptor sequence, and a sequencing platform tag sequence. The method also includes steps for performing high-throughput sequencing of the library of amplicons to obtain a data set of a plurality of first and second adaptive immune receptor amplicon sequences.

In addition, the method includes determining a container occupancy pattern for each unique first adaptor immune receptor amplicon sequence by assigning each unique first adaptor immune receptor amplicon sequence to one or more containers, and a container occupancy pattern for each unique second adaptor immune receptor amplicon sequence by assigning each unique second adaptor immune receptor amplicon sequence to one or more containers, wherein each barcode sequence in the unique first or second adaptor immune receptor amplicon sequences is associated with a particular container.

For each possible pairing of a unique first and second adaptive immune receptor amplicon sequence to form a putative cognate pair, the method involves calculating a statistical probability of observing the container occupancy patterns, or observing any larger proportion of shared containers than expected by chance, given that the first and second adaptor immune receptor amplicon sequences do not originate from the same clonal population of lymphoid cells, and identifying a plurality of a putative cognate pairs based on the statistical probability having a score lower than a predetermined likelihood cutoff.

Then, for each identified putative cognate pair, a false discovery rate estimation can be determined for a possible false pairing of the unique first adaptor immune receptor amplicon sequence and the unique second adaptor immune receptor amplicon sequence. The method includes steps for identifying a plurality of cognate pairs of unique first and second adaptive immune receptor sequences as true cognate pairs that encode said adaptive immune receptors in said sample based on said statistical probability and said false discovery rate estimation.

In some embodiments, the statistical score can be a p-value calculated for pairing each putative cognate pair of unique first and second adaptive immune receptor amplicon sequences. In one embodiment, calculating the statistical score comprises calculating a probability that the unique first and second adaptive immune receptor amplicon sequences should jointly occupy as many or more containers than they are observed to jointly occupy, assuming no true cognate pairing and given the number of containers occupied by said unique first adaptive immune receptor amplicon sequence and the number of containers occupied by the unique second adaptive immune receptor amplicon sequence.

Essentially, given any two adaptive immune receptor sequences, the method analyzes whether the two sequences co-occur in more containers than would be expected by chance. Given a total of N containers, a first adaptive immune receptor sequence (A) observed in a total of X containers, a second adaptive immune receptor sequence (B) observed in a total of Y containers, and Z containers in which both adaptive immune receptor sequences (A) and (B) are observed, the method provides that given sequence (A) is found in X out of N containers (X I N) and sequence (B) is found in Y out of N (Y I N) containers, a calculation of the probability that both sequences are found in Z or more containers.

In some embodiments, the lower the probability that the observed number of overlapping containers between A and B sequences could occur by chance, the more highly likely that their co-occurrence is not by chance, but is instead due to true cognate pairing.

Next, identifying a plurality of a putative cognate pairs that have a high likelihood of pairing based on the statistical probability can comprise for each unique first adaptor immune receptor amplicon sequence identifying the unique second adaptor immune receptor amplicon sequence that has the lowest p-value score of matching, or for each unique second adaptor immune receptor amplicon sequence finding the unique first adaptor immune receptor amplicon sequence that has the lowest p-value score of matching.

In other embodiments, determining a false discovery rate estimation comprises: calculating p-values for each of the plurality of putative cognate pairs identified in the sample; comparing the p-values for all of the plurality of putative cognate pairs with an expected p-value distribution, said expected p-value distribution calculated to represent an experiment where no true cognate pairs are present; and determining for each putative cognate pair, an expected proportion of false positive results such that all p-values at or below the p-value of the putative cognate pair are determined to represent a true cognate pairing.

In certain embodiments, calculating the expected p-value distribution comprises: permuting the containers in which each first and second adaptive immune receptor sequence has been observed in an otherwise-identical experiment with no true cognate pairs, and calculating the distribution of p-values associated with each putative cognate pair.

The method includes identifying a plurality of cognate pairs of unique first and second adaptive immune receptor sequences as true cognate pairs by selecting a plurality of putative cognate pairs that have p-values below a threshold calculated based on the false discovery rate estimation.

In one embodiment, the identified cognate pair of unique first and second adaptive immune receptor amplicon sequences has a false discovery rate estimation of less than 1%. In other embodiments, the identified cognate pair of unique first and second adaptive immune receptor amplicon sequences has a false discovery rate estimation of less than 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%.

The method can also include contacting each of said plurality of containers, under conditions and for a time sufficient to promote reverse transcription of mRNA molecules obtained from said plurality of lymphoid cells, with a first reverse transcription primer set. In certain embodiments, the (A) first oligonucleotide reverse transcription primer set comprises primers capable of reverse transcribing a plurality of mRNA sequences encoding the plurality of first and second adaptive immune receptor polypeptides for generating a plurality of first and second reverse-transcribed adaptive immune receptor cDNA amplicons, wherein the plurality of first reverse-transcribed adaptive immune receptor cDNA amplicons encoding the first adaptive immune receptor polypeptide comprise 1) a unique V region encoding gene sequence, and 2) a unique J region encoding gene sequence or both a unique J region encoding gene sequence and a unique C region encoding gene sequence, and wherein the plurality of second reverse-transcribed adaptive immune receptor cDNA amplicons encoding the second adaptive immune receptor polypeptide comprise 1) a unique V region encoding gene sequence, and 2) a unique J region encoding gene sequence or both a unique J region encoding gene sequence and a unique C region encoding gene sequence.

The first and second reverse-transcribed adaptive immune receptor cDNA amplicons are then amplified in a second reaction. The reaction begins by contacting each of said plurality of containers, under conditions and for a time sufficient to promote a multiplex PCR amplification of the first and second reverse-transcribed adaptive immune receptor cDNA amplicons with a second (B) and third (C) oligonucleotide primer sets. In some aspects, the (B) second oligonucleotide primer set comprises forward and reverse primers capable of amplifying the plurality of first reverse-transcribed adaptor immune receptor cDNA amplicons, wherein said forward and reverse primers each are capable of hybridizing to the first reverse-transcribed adaptive immune receptor cDNA amplicons.

Each pair of forward and reverse primers in the second oligonucleotide primer set is capable of amplifying the first reverse-transcribed adaptive immune receptor cDNA amplicons. The forward primers in the second oligonucleotide primer set comprise a first universal adaptor sequence and a region complementary to the V region encoding gene sequence. The reverse primers in the second oligonucleotide primer set comprise a second universal adaptor sequence and a region complementary to the J region encoding gene sequence or the C region encoding gene sequence.

The (C) third oligonucleotide primer set comprises forward and reverse primers capable of amplifying the plurality of reverse-transcribed second adaptive immune receptor cDNA amplicons. Each pair of forward and reverse primers in the third oligonucleotide primer set is capable of amplifying the second reverse-transcribed adaptive immune receptor cDNA amplicons. In one aspect, the forward primers in the third oligonucleotide primer set comprise a first universal adaptor sequence and a region complementary to the V region encoding gene sequence. The reverse primers in the third oligonucleotide primer set comprise a second universal adaptor sequence and a region complementary to the J region encoding gene sequence or complementary to the C region encoding gene sequence.

The method also includes generating i) a plurality of third adaptive immune receptor amplicons each comprising a unique V region encoding gene sequence, or complement thereof, a unique J region encoding gene sequence or both a unique J region encoding gene sequence and a unique C region encoding gene sequence, or complement thereof, and the first and second universal adaptor sequences, and ii) a plurality of fourth adaptive immune receptor amplicons each comprising a unique V region encoding gene sequence, or complement thereof, a unique J region encoding gene sequence or both a unique J region encoding gene sequence and a unique C region encoding gene sequence, or complement thereof, and the first and second universal adaptor sequences.

The plurality of third adaptive immune receptor amplicons and the plurality of fourth adaptive immune receptor amplicons are then amplified with additional primers. The method includes contacting each of the plurality of containers, under conditions and for a time sufficient to promote a second multiplex PCR amplification of the plurality of third and fourth adaptive immune receptor amplicons with a fourth (D) oligonucleotide primer set and fifth (E) oligonucleotide primer set.

In one embodiment, the (D) fourth oligonucleotide primer set comprises forward and reverse primers capable of amplifying the plurality of third adaptor immune receptor amplicons, wherein the forward and reverse primers each are capable of hybridizing to the third adaptive immune receptor amplicons. Each pair of forward and reverse primers in the fourth oligonucleotide primer set is capable of amplifying said third adaptor immune receptor amplicons.

The forward primer in the fourth oligonucleotide primer set comprises a sequencing platform tag sequence and a region complementary to the first universal adaptor sequence in the plurality of third adaptive immune receptor amplicon and the reverse primer comprises a sequencing platform tag sequence and a region complementary to the second universal adaptor sequence in the plurality of third adaptive immune receptor amplicons. In another embodiment, either one or both of the forward and reverse primers in the fourth oligonucleotide primer set comprises a unique barcode sequence associated with the container in which the fourth oligonucleotide primer set is introduced.

The (E) fifth oligonucleotide primer set comprises forward and reverse primers capable of amplifying the plurality of fourth adaptor immune receptor amplicons, wherein the forward and reverse primers each are capable of hybridizing to the fourth adaptive immune receptor amplicons. Each pair of forward and reverse primers in said fourth oligonucleotide primer set is capable of amplifying said plurality of fourth adaptor immune receptor amplicons. The forward primer in the fifth oligonucleotide primer set comprises a sequencing platform tag sequence and a region complementary to the first universal adaptor sequence in the plurality of fourth adaptive immune receptor amplicons, and the reverse primer in the fifth oligonucleotide primer set comprises a sequencing platform tag sequence and a region complementary to the second universal adaptor sequence in the plurality of fourth adaptive immune receptor amplicons.

Either one or both of the forward and reverse primers of the fourth oligonucleotide primer set comprises a unique barcode sequence associated with the container in which the fourth oligonucleotide primer set is introduced, thereby generating the library of amplicons comprising the plurality of first adaptive immune receptor amplicons and the plurality of second adaptive immune receptor amplicons.

Next, the method includes combining the library of amplicons from the plurality of containers into a mixture for sequencing. Methods for high-throughput sequencing are described in detail above and in U.S. Patent Application Publication Nos. US 2012-0058902 and US 2010-0330571; and International PCT Publication Nos. WO 2011/106738 and WO 2012/027503, each of which are incorporated by reference in their entireties.

In one aspect, the plurality of first adaptive immune receptor amplicons comprise a C region encoding sequence. In some aspects, the plurality of second adaptive immune receptor amplicons comprise a C region encoding sequence.

In some cases, the sample comprises a blood sample. In another embodiment, the sample comprises a tissue sample. In certain embodiments, the sample comprises a sample purified or cultured human lymphoid cells. In other embodiments, the container comprises at least 104 lymphoid cells. In another embodiment, the sample comprises at least 104 cells.

The method is applicable to various adaptive immune receptor loci, as described above, such as pairing of a BCR heavy chain and a BCR light chain, or an IGK chain.

Where the first polypeptide of the adaptive immune receptor heterodimer is an IGH chain and the second polypeptide of the adaptive immune receptor heterodimer is both IGL and IGK, then three different amplification primer sets are used comprising: a first oligonucleotide amplification primer set for IGH, a second oligonucleotide amplification primer set for IGK, and a third oligonucleotide amplification primer set for IGL.

Thus, the methods and compositions of the invention can be found useful in many applications in immunology, medicine, and therapeutic development. The methods of the invention offer opportunities for investigating connections between the primary sequences of a collection of selected immune receptors and the target(s) (and epitopes) that caused their selection. With attention to experimental design and control of variables (e.g., HLA type), the methods of the invention can be a useful approach for identifying critical BCRs from tumor-infiltrating lymphocytes, for establishing new criteria for responsiveness to routine or experimental vaccination, and for epidemiological analysis of public exposures and shared responses. The methods of the invention also provide information on the relative contribution of each independent chain to a given response. In addition, our approach provides data on whether there might be physical BCR chain attributes that govern a particular immune response. For example, constraints on the length or biophysical parameters of one or both chains for a given type of response to a given type of antigenic challenge. The methods of the invention can be run with standard laboratory supplies and equipment, without the need for specialized expertise, and the starting sample type has a broad potential range (tumor samples, sorted cells, cells in suspension, etc.). This technology is designed to be scalable and accessible to a variety of laboratories.

It is important to recognize that the methods of the invention can be applied to and will work equally well with BCR heavy and light chains (IGH with IGK or IGL). Given the practical interest in monoclonal antibody development, as well as the general importance of the humoral immune response, the methods of the invention have the potential to become an important technology for biomedical discovery.

Combination of BCR Heterodimer High-Throughput Pairing with Identification of BCR Antigen-Specificity

In one embodiment, an antigen library of interest is created in an M13 phage display library, wherein cDNA encoding the antigens are ligated to a phage gene encoding the minor or major coat protein. In one embodiment, the gene encoding the minor coat protein is pIII, and the gene encoding the major coat protein is pVIII.

In one embodiment, said phage gene is introduced into a host bacterial cell for rapid reproduction of the host cell comprising the phage gene. In a further embodiment, once adequate bacterial growth has occurred, the bacterial cells are lysed and mature phage are isolated and washed in a buffered solution.

In one embodiment, the cDNA encoding the antigens is at least 9 base pairs (bp), 12 bp, 15 bp, 18 bp, 21 bp, 24 bp, 27 bp, 30 bp, 33 bp, 36 bp, 37 bp, 40 bp, 43 bp, 46 bp, 49 bp, 60 bp, 90 bp, 120 bp, 150 bp, 270 bp, 360 bp, 480 bp, 540 bp, or 660 bp in length.

In one embodiment, the cDNA encoding the antigens are flanked by a synthetic polynucleotide sequence, and wherein the synthetic polynucleotide sequence comprises at least one barcode sequence, at least one universal adaptor sequence, and at least one sequencing platform tag sequence. In some embodiments, the synthetic polynucleotide sequences flanking the cDNA encoding the antigens all share at least one common primer binding site. In some embodiments, the synthetic polynucleotide sequences flanking the cDNA encoding the antigens each comprise a unique tag or barcode.

In one embodiment, each synthetic polynucleotide sequence is at least 20 bp, 25 bp, 30 bp, 35 bp, 40 bp, 45 bp, 50 bp, 55 bp, 60 bp, 65 bp, 70 bp, 75 bp, 80 bp, 85 bp, 90 bp, 95 bp, 100 bp, 125 bp, 150 bp, 175 bp, 200 bp, 250 bp, 300 bp, 400 bp, 500 bp, or 650 bp in length.

In one embodiment, B-cells comprising extracellular B-cell receptors (BCRs) are isolated from a host and washed at least twice in a buffered solution. In a further embodiment, the B-cells are added to a buffered solution comprising phage of the phage display library, wherein the solution is mixed for a period of at least 5 hours at either 25° C. or 37° C. At the end of the mixing period, B-cells are enriched for those that have phage bound to the BCR. In one embodiment, the enrichment is carried out with the use of flow cytometry.

In one embodiment, the B-cells are introduced into the solution at a B-cell:phage ratio of at least 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:17, 1:19, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:60, 1:70, 1:80, 1:90, 1:100, 1:125, 1:150, 1:175, 1:200, 1:300, 1:400, 1:500, 1:750, or 1:1,000.

In one embodiment, the B-cells bound to antigens of the phage display library are distributed into a plurality of aliquots. In further embodiments, mRNA from B-cells bound to antigens of the phage display library are isolated, as are nucleic acids from the phage. For each aliquot, reverse transcription primers, as described herein, are utilized to reverse transcribe mRNA comprising rearranged CDR3 regions of the B-cells that direct incorporation of an oligonucleotide barcode and a universal adapter resulting in cDNA from each of the light and heavy chain sequences comprising a barcode and a universal adaptor, wherein each of the oligonucleotide reverse transcription primers that are contacted with the contents of a single aliquot share at least one common barcode sequence.

In one embodiment, the reverse transcription primers hybridize to the V, J, or C segments of each rearranged DNA sequence encoding a light chain and/or a heavy chain.

In one embodiment, as described herein, amplification primers that hybridize to the universal adaptor sequence are used to amplify the light and heavy chain cDNA sequences. In one embodiment, the amplified light and heavy chain cDNA sequences are quantitatively sequenced to obtain a data set of sequences that includes the B-cell light and heavy chain sequences and associated barcodes for each aliquot.

In one embodiment, the sequenced amplification products are sorted based on the unique barcode to identify light and heavy chain sequences that were amplified from the same aliquot and determining an aliquot occupancy pattern for each unique light and heavy chain sequence. In a further embodiment, the light and heavy chain sequences that are paired are identified based on whether the sequences occur together or do not occur together in a plurality of aliquots based on a statistical probability of observing said aliquot occupancy pattern.

In one embodiment, the nucleic acids isolated from the phage are sequenced, and the paired light and heavy chain sequences previously identified are used to determine whether the antigen encoding sequences are matched to the paired BCR heterodimer based on whether or not the sequences occur together in a plurality of aliquots.

The methods of identifying antigen-specific B-cell receptors can be found useful not only in the ability to begin developing an immune repertoire library that correlates to known antigenic sequences, but in the multitude of applications in immunology, medicine, and patient care. Such a method allows for the surveillance of the BCR repertoire of any given patient and making a quick evaluation of an acute or chronic state of disease with sensitivity and speed of assessment both considerably greater than methods presently known in the art. The methods of the invention offer opportunities for investigating the creation of chimeric BCR receptors as well as adoptive transfers of known disease-fighting B-cells expressing a desirable receptor in the treatment of disease. The methods of the invention can be run with standard laboratory supplies and equipment, without the need for specialized expertise, and the starting sample type has a broad potential range (tumor samples, sorted cells, cells in suspension, etc.). This technology is designed to be scalable and accessible to a variety of laboratories.

It is important to recognize that the methods of the invention can be applied to and will work equally well with BCR heavy and light chains (IGH with IGK or IGL). Given the practical interest in monoclonal antibody development, as well as the general importance of the humoral immune response, the methods of the invention have the potential to become an important technology for biomedical discovery.

INCORPORATION BY REFERENCE

All references, articles, publications, patents, patent publications, and patent applications cited herein are incorporated by reference in their entireties for all purposes. However, mention of any reference, article, publication, patent, patent publication, and patent application cited herein is not, and should not be taken as an acknowledgment or suggestion in any form that they constitute valid prior art or form part of the common general knowledge in any country in the world.

Claims

The invention claimed is:

1. A method for identifying antigen-specific B-cell receptor (BCR) sequences comprising:

(A) incubating a plurality of B-cells with an antigen library displayed by an organism capable of displaying antigens;

(B) distributing the B-cells bound to antigens of the antigen library into a plurality of aliquots;

(C) isolating nucleic acids from B-cells bound to antigens of the antigen library and from the organism displaying said antigens;

(D) sequencing the following elements from each of the aliquots;

(i) B-cell heavy chain sequence,

(ii) B-cell light chain sequence, and

(iii) a nucleotide sequence encoding the antigen bound to the BCR; and

(E) identifying the sequenced elements of (D) that occur together in more than one aliquot thereby identifying antigen-specific BCR sequences.

2. The method of claim 1, wherein (A) is immediately followed by enriching for B-cells bound to species of the antigen library.

3. The method of claim 2, wherein enriching for B-cells bound to species of the antigen library comprises flow cytometry.

4. The method of claim 1, wherein (C) is immediately followed by generating a library of amplicons by performing multiplex PCR on the isolated nucleic acids.

5. The method of claim 1, wherein the plurality of B-cells are isolated from a human.

6. The method of claim 1, wherein a plurality of B-cells comprises at least 104 cells.

7. The method of claim 1, wherein said antigen library is a phage display library, a bacterial surface display library, or a yeast surface display library.

8. The method of claim 7, wherein said antigen library is a phage display library, and wherein the phage is selected from the group consisting of T7, M13, fd, f1, T4, and Lambda.

9. The method of claim 1, wherein said antigen library comprises antigens selected from the group consisting of bacterial antigens, viral antigens, fungal antigens, protist antigens, plant antigens, vertebrate antigens, mammalian antigens, and any combination thereof.

10. The method of claim 1, wherein the antigen library comprises a whole-genome library of an organism.

11. The method of claim 10, wherein the organism is a mammalian pathogen.

12. The method of claim 11, wherein the mammalian pathogen is a human pathogen.

13. The method of claim 1, wherein the B-cells express BCRs on the cell surface.

14. The method of claim 1, wherein the antigen library comprises a plurality of antigens, and wherein the nucleotide sequence encoding each antigen is flanked by a synthetic polynucleotide sequence.

15. The method of claim 14, wherein the synthetic polynucleotide sequence comprises at least one barcode sequence.

16. The method of claim 14, wherein the synthetic polynucleotide sequence comprises at least one universal adaptor sequence flanking the antigen.

17. The method of claim 14, wherein the synthetic polynucleotide comprises at least one universal adaptor sequence, a sequencing platform tag sequence, and at least one barcode sequence.

18. The method of claim 1, wherein the nucleotide sequence encoding the antigen is a cDNA.

19. The method of claim 1, further comprising:

(i) for each aliquot, reverse transcribing mRNA comprising rearranged CDR3 regions of the B-cells using oligonucleotide reverse transcription primers that direct incorporation of an oligonucleotide barcode and a universal adapter resulting in cDNA from each of the light and heavy chain sequences comprising a barcode and a universal adaptor, such that amplicons in an aliquot comprises the same unique barcode;

(ii) amplifying the cDNA using amplification primers to obtain amplification products;

(iii) quantitatively sequencing the amplification products of (ii) to obtain a data set of sequences that includes the B-cell light and heavy chain sequences and associated barcodes for each aliquot;

(iv) sorting amplification products based on the unique barcode to identify light and heavy chain sequences that were amplified from the same aliquot and determining an aliquot occupancy pattern for each unique light and heavy chain sequence; and

(v) identifying light and heavy chain sequences as paired immune receptor chains based on whether the sequences occur together or do not occur together in a plurality of aliquots based on a statistical probability of observing said aliquot occupancy pattern.

20. The method of claim 19, wherein each of the oligonucleotide reverse transcription primers that are contacted with the contents of a single aliquot share a common barcode sequence.

21. The method of claim 19, wherein the amplification primers further comprise an additional barcode, an n6 spacer, and/or a sequencing oligonucleotide.

22. The method of claim 19, wherein the amplification primers specifically hybridize to the universal adapter added to the cDNA in step (ii).

23. The method of claim 19, wherein the reverse transcription primers specifically hybridize to V, J, or C segments of each rearranged DNA sequence encoding a light chain and heavy chain polypeptide.

24. The method of claim 23 further comprising clustering the sorted amplification products in step (iv) based on the V, J, and/or C segments of each rearranged DNA sequence.

25. A method for identifying antigen-specific B-cell receptor (BCR) sequences comprising:

(A) incubating a plurality of B-cells with a phage antigen display library;

(B) distributing the B-cells bound to antigens of the antigen library into a plurality of aliquots;

(C) isolating mRNA from B-cells bound to antigens of the antigen library and nucleic acids from the phage;

(D) for each aliquot, reverse transcribing mRNA comprising rearranged CDR3 regions of the B-cells using oligonucleotide reverse transcription primers that direct incorporation of an oligonucleotide barcode and a universal adapter resulting in cDNA from each of the light and heavy chain sequences comprising a barcode and a universal adaptor, wherein each of the oligonucleotide reverse transcription primers that are contacted with the contents of a single aliquot share a common barcode sequence;

(E) amplifying the light and heavy chain cDNA sequences using amplification primers to obtain amplification products;

(F) quantitatively sequencing the amplification products of (E) to obtain a data set of sequences that includes the B-cell light and heavy chain sequences and associated barcodes for each aliquot;

(G) sorting amplification products based on the unique barcode to identify light and heavy chain sequences that were amplified from the same aliquot and determining an aliquot occupancy pattern for each unique light and heavy chain sequence;

(H) identifying light and heavy chain sequences as paired immune receptor chains based on whether the sequences occur together or do not occur together in a plurality of aliquots based on a statistical probability of observing said aliquot occupancy pattern;

(I) generating a library of amplicons by performing PCR on the isolated nucleic acids from the phage, followed by sequencing the library of amplicons; and

(J) identifying the paired immune receptor chains in (H) and the nucleic acids in (I) based on whether the sequences occur together or do not occur together in a plurality of aliquots.

26. The method of claim 25, wherein the amplification primers further comprise an additional barcode, an n6 spacer, and/or a sequencing oligonucleotide.

27. The method of claim 25, wherein the amplification primers specifically hybridize to the universal adapter added to the cDNA in (E).

28. The method of claim 25, wherein the reverse transcription primers specifically hybridize to V, J, or C segments of each rearranged DNA sequence encoding a light chain and heavy chain polypeptide.

29. The method of claim 25 further comprising clustering the sorted amplification products in (G) based on the V, J, and/or C segments of each rearranged DNA sequence.

30. The method of claim 25, wherein the isolated nucleic acids from the phage comprise RNA, step (I) is immediately preceded by reverse transcribing RNA comprising antigens of the antigen display library.

Resources

Images & Drawings included:

Sources:

Recent applications in this class:

Recent applications for this Assignee: