Molecular marker significantly associated with vitamin E content in soybeans, kompetitive allele specific polymerase chain reaction primers combination and application thereof

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority to Chinese Patent Application No. 202311719318.0, filed on Dec. 13, 2023, the contents of which are hereby incorporated by reference.

INCORPORATION BY REFERENCE STATEMENT

This statement, made under Rules 77 (b) (5) (ii) and any other applicable rule incorporates into the present specification of an XML file for a “Sequence Listing XML” (see Rule 831 (a)), submitted via the USPTO patent electronic filing system or on one or more read-only optical discs (see Rule 1.52 (e) (8)), identifying the names of each file, the date of creation of each file, and the size of each file in bytes as follows:

• • File name: PPH-US 2024-7162 Sequence
  • Creation date: Oct. 19, 2024
  • Byte size: 5,213

TECHNICAL FIELD

The present disclosure relates to the field of molecular genetics and breeding, and in particular to a molecular marker significantly associated with vitamin E content in soybeans, a Kompetitive Allele Specific polymerase chain reaction (KASP) primers combination and an application thereof.

BACKGROUND

Vitamin E (VE), also known as tocopherol, consists of eight homologs of alpha (α), beta (β), gamma (γ) and delta (δ) tocopherols and their corresponding trienyl tocopherols. At room temperature, the bioactivities are =α>β>γ>δ, with α-tocopherol having the strongest physiological activity and y-tocopherol having the strongest antioxidant capacity, while β-tocopherol is very low in content and is generally ignored in studies of VE content. Vitamin E has been shown to be effective in improving immunity, anti-aging, anti-infertility, anti-cancer and prevention of cardiovascular diseases. Natural sources of vitamin E are mainly economic oil crops, including soybeans, sunflower seeds and rapeseed. Among them, the vitamin E content of soybeans is at the top of the list, ranging from 0.09% to 0.28%. As a natural antioxidant in soybean oil, Vitamin E serves to protect the flavor and prolong the storage life of fats and oils that affect seed longevity, and to ensure seed viability after prolonged storage. Therefore, it is of great production importance to study rapid and effective molecular breeding techniques concerning soybean vitamin E traits for molecularly assisted genetic improvement of soybean vitamin E quality traits.

Traditional soybean breeding for vitamin E involves single-plant selection based on the content of vitamin E fractions in the breeding progeny, which is not only time-consuming and labor-intensive but also susceptible to environmental interference with low accuracy. Assisted selection by developing specific molecular markers utilizing base differences in the target genes is an optimal method to improve the selection efficiency of soybeans with high vitamin E content. With the advantages of early selection, independence from environmental influences as well as accuracy, speed and efficiency, molecular markers have become an accurate and efficient tool in crop breeding. Among them, Kompetitive allele specific PCR (KASP) is a homogenous, fluorescence-based genotyping variant of polymerase chain reaction. It is based on allele-specific oligo extension and fluorescence resonance energy transfer for signal generation. There are two allele-specific forward primers, and a common reverse primer for the KASP markers based on the allele SNP, and each forward primer has specific sequence that binds to different fluorescent markers. Forward primers with sequences that bind to different fluorescence and common reverse primers amplify DNA from samples by PCR, and the allelic variation may then be reflected by different fluorescence signals.

Studies have shown that the vitamin E content of soybean is a complex quantitative trait that is regulated by multiple genes and is susceptible to environmental influences. Currently, several quantitative trait loci (QTL) controlling vitamin E content in soybean have been reported in existing studies. Single nucleotide polymorphism (SNP) mainly refers to DNA sequence polymorphism caused by variation in a single nucleotide at the genomic level. Genome wide association study (GWAS), as an effective gene targeting tool, enables rapid and accurate mining of SNP significantly associated with soybean vitamin E. Based on the identified SNP significantly associated with soybean vitamin E, the KASP markers closely associated with the content of soybean vitamin E are developed and used for the selection of soybean vitamin E at the early stage of the breeding process (low generation), which is a significant contribution to reducing the workload of the breeding process and accelerating the progress of the breeding process, and at the same time, the economic benefits are obvious. Therefore, it is particularly important to develop KASP molecular markers for breeding assistance based on mining SNP significantly associated with soybean vitamin E to realize molecular-assisted selection of target traits at early stage in order to improve the breeding efficiency.

SUMMARY

The objective of the present disclosure is to provide a molecular marker significantly associated with vitamin E content in soybeans, a Kompetitive Allele-Specific polymerase chain reaction (KASP) primers combination and an application thereof, so as to solve the problems existing in the prior art. The KASP primers combination developed by the present disclosure is capable of directly distinguishing and detecting specifically the A or T bases of SNP mutation sites, which has good application value and enables pre-selection and molecular-assisted breeding of vitamin E content traits in soybeans, and is of great theoretical and practical guidance for accelerating the process of genetic improvement in breeding for vitamin E content and improving the efficiency of breeding selection.

In order to achieve the above objectives, the present disclosure provides the following scheme.

The present disclosure provides a molecular marker significantly associated with vitamin E content in soybeans, where the molecular marker has a nucleotide sequence as shown in SEQ ID NO. 1, with an A/T mutation at a 21st base.

The present disclosure also provides a KASP primer set for detecting the molecular marker, including an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO. 2, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO. 3 and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO. 4.

The present disclosure also provides a detection kit of the molecular marker, including the KASP primer set.

The present disclosure also provides an application of the KASP primer set or the detection kit in identifying vitamin E content in soybeans.

The present disclosure also provides a method for identifying vitamin E content in soybeans, including the following steps:

• • using a genomic DNA of a soybean sample to be detected as a template, performing fluorescence quantitative PCR amplification on the template by using the KASP primer set or the detection kit, reading a fluorescence signal after PCR amplification, analyzing and converting the fluorescence signal, identifying a genotype, and determining soybean vitamin E content to be high (≥160.0 μg/g) or low (≤30.0 μg/g) based on the genotype;
  • if the genotype is identified as TT, the soybean sample to be detected is determined to have a high vitamin E content; if the genotype identified is AA, the soybean sample to be detected is judged to have a low vitamin E content.

Optionally, a procedure of the fluorescence quantitative PCR amplification includes: activation at 94 degrees Celsius (° C.) for 15 minutes (min); denaturation at 94° C. for 20 seconds (sec), annealing at 61-55° C. for 60 sec, decreasing 0.6° C. per cycle for 10 cycles; denaturation at 94° C. for 20 sec, annealing at 55° C. for 60 sec for 26 cycles.

Optionally, a system of the fluorescence quantitative PCR amplification includes: 25 nanogram per microliter (ng/μL) DNA template 2 μL, 2×KASP Master mix 5 μL, KASP mixed primer 0.14 μL, where a volume ratio of the upstream primer F1, upstream primer F2 and downstream primer R is 2:2:5, and water 2.86 μL.

The present disclosure also provides an application of the KASP primer set or the detection kit in screening soybean varieties or strains with high vitamin E content.

The present disclosure also provides an application of the KASP primer set or the detection kit in molecular marker-assisted breeding of soybean vitamin E content traits.

Optionally, high and low vitamin E content of different soybean isolated generations are identified using the KASP primer set or the detection kit, and single plants or strains with high vitamin E content are selected for cultivation.

The present disclosure achieves the following technical effects.

The SNP significantly associated with soybean vitamin E provided by the present disclosure is obtained from 264 representative soybean germplasm resources (including 52 local species and 212 cultivars) screened by genome wide association study (GWAS) based on the phenotypic data of soybean vitamin E components, and the phenotypic variance explained rate of this SNP locus reaches 9.6%, which is located in a position of 980,498 bp of chromosome 12, soybean genome v2.0, providing technical support for molecular marker-assisted breeding of soybean vitamin E content traits.

The KASP primers combination developed by the present disclosure is capable of directly distinguishing and detecting specifically the A or T bases of the SNP mutation site, and when the high or low content of soybean vitamin E is identified using this KASP primers combination, it is capable of clearly separating the two genotypes, in which the triangles close to the Y-axis are the T allele-carrying soybean varieties, and the content of soybean vitamin E in this genotype is relatively high; the black dots near the X-axis represent soybean varieties carrying allele AA, which has a relatively low content of vitamin E in soybeans. The KASP primers combination developed by the present disclosure has good application value and may realize pre-selection and molecular-assisted breeding for soybean vitamin E content traits, which is of great theoretical and practical guidance significance for accelerating the process of genetic improvement in breeding for vitamin E content and improving the efficiency of breeding selection.

BRIEF DESCRIPTION OF THE DRA WINGS

In order to explain the embodiments of the present disclosure or the technical scheme in the prior art more clearly, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present disclosure, and other drawings may be obtained according to these drawings without creative work for ordinary people in the field.

FIG. 1A is a Manhattan plot of the genome wide association study (GWAS) results for y-tocopherol, with the solid line represents the significant threshold-log (p-value) ≥5.

FIG. 1B is a Quantile-Quantile plot (QQ-plot) of the GWAS results for y-tocopherol.

FIG. 1C is a Manhattan plot of the GWAS results for 8-tocopherol, with the solid line represents the significant threshold-log (p-value) ≥5.

FIG. 1D is a QQ-plot of the GWAS results for 8-tocopherol.

FIG. 1E is a Manhattan plot of the GWAS results for TVe, with the solid line represents the significant threshold-log (p-value) ≥5.

FIG. 1F is a QQ-plot of the GWAS results for TVe.

FIG. 2 shows the genotyping results of different soybean varieties with special primers for KASP markers. The triangles near the Y axis and the black dots near the X axis represent soybean varieties with T allele and soybean varieties with A allele, respectively.

DETAILED DESCRIPTION OF THE EMBODIMENTS

A number of exemplary embodiments of the present disclosure are now described in detail, and this detailed description should not be considered as a limitation of the present disclosure, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present disclosure.

It should be understood that the terminology described in the present disclosure is only for describing specific embodiments and is not used to limit the present disclosure. In addition, for the numerical range in the present disclosure, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Intermediate values within any stated value or stated range, as well as each smaller range between any other stated value or intermediate values within the stated range are also included in the present disclosure. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this present disclosure relates. Although the present disclosure only describes the preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure. All documents mentioned in this specification are incorporated by reference to disclose and describe methods and/or materials related to the documents. In case of conflict with any incorporated document, the contents of this specification shall prevail.

It is obvious to those skilled in the art that many improvements and changes may be made to the specific embodiments of the present disclosure without departing from the scope or spirit of the present disclosure. Other embodiments will be apparent to the skilled person from the description of the present disclosure. The description and embodiments of the present disclosure are exemplary only.

The terms “including”, “comprising”, “having” and “containing” used in this specification are all open terms, which means including but not limited to.

Embodiment 1 Obtaining Nucleotide Mutation Site (SNP) with Significant Correlation of Vitamin E Content in Soybean

1. DNA Extraction and High-Throughput Sequencing

From 1084 soybean germplasm resources, 264 representative soybean germplasm resources are selected (Table 1), including 52 landraces and 212 cultivars, which constitute the micro-core germplasm resources. Genomic DNA of 264 soybean leaves is extracted by CTAB method, and re-sequenced by 10× whole genome.

TABLE 1
Names and numbers of natural soybean
populations used for resequencing and
genome wide association study (GWAS)

	S/N	Names
	NPS001	NJ009
	NPS002	Binhai green bean
		036
	NPS003	NJ015
	NPS004	NJ022
	NPS011	Liyang green bean
		172
	NPS012	Su 18-28
	NPS013	Xuchi No.3
	NPS014	Su 998
	NPS015	8301
	NPS016	NX-661
	NPS017	NX-F4-2
	NPS018	NX-23-25
	NPS019	NX-F5-1
	NPS020	NX-NC-39
	NPS021	NX-F7-13
	NPS022	NX-F4-4
	NPS023	NX-9484
	NPS024	NX-F4-3
	NPS025	NX-F5-8
	NPS026	NX-NC-16
	NPS027	NX-F5-5
	NPS028	NX-F5-3
	NPS029	NX-F7-59
	NPS030	Gui 0513-2
	NPS031	Gui 160
	NPS032	Guichundou 113
	NPS033	Huachun No. 6
	NPS034	Ji 1507
	NPS035	Huachun No. 2
	NPS036	Quandou 16
	NPS037	Pudou No. 5
	NPS039	Yuechun 20132
	NPS040	12B5
	NPS041	Zhe 98002
	NPS042	Xinghuadou No. 1
	NPS043	Shoudou No. 3
	NPS044	Liaoxiandou No.
		12
	NPS045	Xu bean 20
	NPS046	Huai 9822
	NPS047	Wandou 16
	NPS048	Dongxin 2008-1
	NPS049	Xu 8418
	NPS050	Tongshan Swan
		Eggs
	NPS051	Wandou 30
	NPS052	Qihuang 39
	NPS053	Xudou No. 3
	NPS054	Mix-selected large
		white carob
	NPS055	Xudou No. 2
	NPS056	Zheng 9805
	NPS057	Huaidou No. 5
	NPS058	Huai 87-22
	NPS059	Dongxin No. 3
	NPS060	Zhonghuang 68
	NPS061	Huaidou No. 3
	NPS062	Huaidou No. 1
	NPS063	Si 92-288
	NPS064	Xudou No. 4
	NPS065	Sidou 10-743
	NPS066	Xudou No. 8
	NPS067	Huaidou No. 9
	NPS068	Guandou No. 3
	NPS069	Wandou 20001
	NPS070	Xing dou No. 3
	NPS071	Zhoudou 23
	NPS072	Hedou No. 2
	NPS073	Wandou 21116
	NPS074	Pudou 206
	NPS075	Fendou 92
	NPS076	Meng 119807-2
	NPS077	Fendou 78
	NPS078	Huaidou No. 4
	NPS079	Xu 8212
	NPS080	Xu 78107-6
	NPS081	Xu 7027-19
	NPS082	Huaidou 12
	NPS083	Zheng 1440
	NPS084	Jihuang 13
	NPS085	Huai 91-07
	NPS086	Xuzhou 126
	NPS087	Xudou 135
	NPS088	8133-7
	NPS089	Xudou No. 11
	NPS090	Huaidou No. 6
	NPS09	Xu bean 21
	NPS092	Xu bean 18
	NPS093	Ji NF58
	NPS094	Fu 04-35
	NPS095	Zheng 1539
	NPS096	Huaidou 11
	NPS097	Hedou 29
	NPS098	Wandou 33
	NPS099	Suike 8
	NPS100	Siyang 209
	NPS102	Qihuang28
	NPS103	Huaidou 13
	NPS104	Luodou 1
	NPS106	Xudou 16
	NPS107	Xu 8133-2
	NPS108	Zhonghuang 24
	NPS109	Han 12-204
	NPS110	Hedou 28
	NPS111	Ganyun big four
		grains
	NPS112	Ji bean 17
	NPS113	Huaidou No. 7
	NPS114	Jindou 26
	NPS115	Lu 99-10
	NPS116	Zhonghuang 37
	NPS117	Fendou 57
	NPS118	Huai'an Wuzuidou
		A and B
	NPS119	Dafeng small
		green bean 038
	NPS120	Zhoudou 19
	NPS121	Xudou 135
	NPS122	Fendou 6No. 1
	NPS123	Meng 9418
	NPS124	Si 91840
	NPS125	Zhu 9715
	NPS126	Ji B9
	NPS127	Fudou No. 1
	NPS128	Zhongdou 20
	NPS129	Binhai Big White
		Flower
	NPS130	Shangdou No. 7
	NPS131	Zhoudou No. 13
	NPS132	Zhu 9712-1
	NPS133	Shang 951099
	NPS134	Zhoudou No. 5
	NPS135	Yudou 27
	NPS136	Xu 9210-2
	NPS137	Kaidou No. 4
	NPS138	Meng 9449
	NPS139	He 93-1
	NPS140	Doujiao 73
	NPS141	Shanning No. 9
	NPS142	Shanning No. 10
	NPS144	Shangdou No. 1
	NPS145	Meng 9235
	NPS146	Meng 91413
	NPS147	Fu 9605
	NPS148	Zhonghuang 41
	NPS149	Zhongyou 98C
	NPS150	Gaofeng No. 1
	NPS151	Zhongyou
		884-295
	NPS152	Zhongyou
		92-3214
	NPS153	Yudou No. 2
	NPS154	Lindou No. 10
	NPS155	Xu 0701
	NPS156	Peiyuan No. 1
	NPS157	Jining 98-10645
	NPS158	Jining 98-11497
	NPS160	Huai 98-24
	NPS161	Zhongdou No. 5
	NPS162	Jidou 7
	NPS163	Mengdou 8206
	NPS164	Zheng 92029
	NPS165	Wandou 24
	NPS166	Zhu 944
	NPS167	Zhou 9528-2
	NPS168	Hedou No. 6
	NPS169	Haoyu 56
	NPS170	Jidou 1No. 2
	NPS171	Zhongdou 20
	NPS172	Zhoudou 12
	NPS174	Wandou 28
	NPS175	Wandou 905
	NPS176	Zhonghuang 309
	NPS177	Shi 1064
	NPS178	Zheng 15283
	NPS179	Zhongzuo 11-817
	NPS180	Lu 0126
	NPS181	Suike 45
	NPS182	Wandou 0954
	NPS183	Ji 16-J10
	NPS184	Ji 16-J16
	NPS185	Fandou No. 9
	NPS186	Fandou 1510
	NPS187	Nannong 1609
	NPS188	Nannong 1608
	NPS189	Shangdou H28
	NPS190	Shi 1415
	NPS191	Weidou 13
	NPS192	Zhongdou 5701
	NPS193	Zhou11019-2-1
	NPS194	Luo4904
	NPS195	Xu0366-9
	NPS196	Zhudou 26
	NPS197	Liudou 109
	NPS198	Huadou No. 4
	NPS199	Hi J14109
	NPS201	Huachun No. 3
	NPS202	Huachun No. 9
	NPS203	Diandou No. 4
	NPS204	Diandou 86-5
	NPS205	Pudou 611
	NPS206	Wandou 24
	NPS207	Wandou 37
	NPS208	Wandou 38
	NPS209	Zhonghuang 302
	NPS210	Zhonghuang 306
	NPS211	Guichun No. 1
	NPS212	Guichun No. 11
	NPS213	Guichun No. 12
	NPS214	Guichun 16
	NPS215	Guichundou 107
	NPS216	Guichundou 111
	NPS217	Guichundou 112
	NPS219	Gui 0508-3
	NPS223	Gui 1603
	NPS224	Gui 26BC2-7
	NPS225	Qiandou No. 6
	NPS226	Qiandou No. 8
	NPS227	Zhongdou 33
	NPS228	Zhongdou 41
	NPS229	Xiangchundou 24
	NPS230	Quandou No. 4
	NPS231	Quandou 17
	NPS232	East China Sea big
		soybean 132
	NPS233	Sudou 13
	NPS234	Taixingjiu 110
	NPS235	Nannong 15-3
	NPS236	Nantong 072
	NPS237	Pudong Flat 130
	NPS238	12144
	NPS239	Xiangyu No. 1
	NPS240	12078
	NPS241	Suxian 16-12
	NPS242	Tongdou No. 6
	NPS243	Danyang late season
		bean 161
	NPS244	8416 Taizhou
		Baihuawu B
	NPS245	Suxia 5006
	NPS246	Shuyang small 020
	NPS247	Pudongguan green
		bean
	NPS248	Haimenyang 104
	NPS249	Nannong S5-1
	NPS250	Su 16-12
	NPS251	12108
	NPS252	Nantong 071
	NPS253	YIxingwan 120
	NPS254	Nantong small
		yellow shell 070
	NPS255	Qidong dill bean 062
	NPS256	12120
	NPS258	East China Sea peach
		005
	NPS259	Tongdou 07-195
	NPS260	Dongtai A 044
	NPS261	C019
	NPS263	Qidong Green Ox
		065
	NPS264	C019
	NPS265	C18
	NPS266	Yancheng 041
	NPS267	nameless
	NPS268	nameless
	NPS269	Happy Green
	NPS270	Qihuang 34-2
	NPS271	L2015D-4
	NPS272	Su 14-2
	NPS273	Binhai black bean
		100
	NPS274	Nannong 415
	NPS294	August white
	NPS295	Binhaiju 033
	NPS296	Xinyi Great Purple
		Flower
	NPS297	Pixian Langxing 147
	NPS298	Haimen green bean
		057
	NPS299	Sudou 18
	NPS300	Sudou 16
	NPS301	Qihuang 35
	NPS302	Lu 93060

Note: all of the above 264 soybean materials in the form of the corresponding numbers in Table 1 appear in the published literature (Zhang, W., Xu, W., Zhang, H. et al. Comparative selective signature analysis and high-resolution GWAS reveal a new candidate gene controlling seed weight in soybean. Theor Appl Genet (2021). https://doi.org/10.1007/s00122-021-03774-6).

2. Determination of Vitamin E Content

From each family line, 10.00 to 15.00 g of soybean seeds of full grain and uniform size are selected and crushed by sample milling (FOSS, Knifetec1095) for 60 sec; 0.2 g of crushed soybean powder sample is weighed, and added with 0.05 g of vitamin C (Vc) and 4 mL of 80% ethanol solution to mix, and then ultrasonicated for 30 min at low temperature in a water bath; then, 8 mL of n-hexane solution is added; finally, after ultrasonication at low temperature water bath for 30 min and centrifugation, the supernatant is taken and passed through 0.22 μm organic phase filtration membrane. Using high performance liquid chromatography (HPLC) and external standard method, the isomers of vitamin E tocopherol are quantitatively analyzed. The chromatographic column is a product of DIKMA Company, and the packing of chromatographic column is symmetry, with diamond C18, 5 μm, and the column size is 250.0 mm×4.6 mm; the excitation wavelength of fluorescence detector is 290 nm and the emission wavelength is 300 nm. The mobile phase is methanol with a flow rate of 1.0 mL/min, and column temperature 35° C., the sampling volume is 20 μL, and the detection duration is 10 min. The peak areas of γ-tocopherol and δ-tocopherol are substituted into the regression equation for quantitative analysis. TVe is the sum of α-tocopherol, γ-tocopherol and δ-tocopherol values.

3. Genome-Wide Association Study (GWAS)

Using GAPIT algorithm package in R language software, the calculation model is mixed linear model (MLM) for genome-wide association study (GWAS). After elimination and filtering, 199 SNP loci significantly associated with vitamin E content in soybeans are detected (FIG. 1A-FIG. 1F), among them, the SNP locus S12_980498, which is significantly associated with soybean vitamin E with 9.6% explained phenotypic variance, is located at chromosome 12, position 980,498 bp in soybean genome v2.0.

The gene sequence containing the SNP locus is shown in SEQ ID NO. 1:

AAACTTTATATTATTTTATT[A/T]ATGTTATTCACTATTCATCCAGCA

ATGTAATGTACATGGTAAAAAATTGTTCAGTAACTCAATTATGTTTGTG

GTGTGTTATTTTTTTTGTTGTCATATATTTTAGTGTGTATGAAATGGAC

CCTTAAAAGAATAATGACGAGATCCTAAACTAACACCATTTCATATTCA

TACTAATGAAAAGAAGGAGAAGAGGAAACACGTGGTGTCATAGTTTGGG

TCAATTTGGAATGGGCTGAAATGACAGGGCCAGAAGGAATTGGGCCCTT

GGAGAAGTAGGCTTGGGGCCCATTGGTTGGAGGAACAAATAAAGGAAGG

GAAGGGAAGAGTGAAAGCGAGACGTTAGCTGGGCAAAGCAACCGGACAC

ACCCCAACCTGACTT

(Note: the 21 bp of the sequence shown in SEQ ID NO. 1 is an SNP locus, and there is A/T mutation at this locus).

Embodiment 2 Development of Specific Primers for KASP Marker

Using the Primer-BLAST function of NCBI (https://www.ncbi.nlm.nih.gov/), three primers are designed according to the sequence of SEQ ID NO. 1, namely, the upstream primer F1 (SEQ ID NO. 2), the upstream primer F2 (SEQ ID NO. 3) and the downstream primer R (SEQ ID NO. 4), where F1 and F2 respectively include the FAM and HEX fluorescent junction sequences (underlined), the sequences of which are shown below:

• • forward primer F1 (SEQ ID NO. 2):

5′-GAAGGTGACCAAGTTCATGCTAAACTTTATATTATTTTATTT-3′;

• • forward primer F2 (SEQ ID NO. 3):

5′-GAAGGTCGGAGTCAACGGATTAAACTTTATATTATTTTATTA-3′;

• • reverse primer R (SEQ ID NO. 4):

5′-AAGTCAGGTTGGGGTGTGTC-3′.

Embodiment 3 Detection of Genotypes of SNP Loci in Different Soybean Varieties and its Application

Twenty-eight soybean materials are randomly selected, and the genomic DNA of soybean samples is extracted respectively. Using the genomic DNA as a template, the PCR amplification products are obtained by using the special primers developed in Embodiment 2. PCR amplification is carried out in ABI7500 real-time fluorescence quantitative PCR instrument. After PCR, the instrument performs genotyping according to fluorescence signals. The amplification systems are all 10 μL reaction systems: 25 ng/μL soybean sample DNA template 2 μL, 2×KASP Master mix 5 μL, KASP mixed primer 0.14 μL, where F1:F2:R=2:2:5 (V/V/V), and water 2.86 μL. The reaction conditions include activation at 94° C. for 15 min, denaturing at 94° C. for 20 sec, annealing at 61-55° C. for 60 sec, decreasing 0.6° C. per cycle for 10 cycles; denaturing at 94° C. for 20 sec, annealing at 55° C. for 60 sec for 26 cycles.

After the reaction is completed, ABI7500 real-time fluorescence quantitative PCR instrument directly reads the fluorescence data of PCR reaction products, and the result is shown in FIG. 2.

The triangles near the Y-axis are the loci carrying the T allele variant with genotype TT, and there are 17 soybean varieties with average y-tocopherol, 8-tocopherol, and TVe contents of 215.37 micrograms per gram (μg/g), 24.36 μg/g, and 256.43 μg/g, respectively; When the amplification reaction is carried out, the detection sample will combine with the specific FAM detection primer and release the blue fluorescent groups. With the increase of the number of PCR reaction cycles, the blue fluorescent signal is enhanced.

The black dots near the X-axis are the loci carrying the A allelic variant with genotype AA, and there are 11 copies with average γ-tocopherol, δ-tocopherol, and TVe contents of 160.35 μg/g, 17.69 μg/g, and 190.25 μg/g, respectively; when the amplification reaction is carried out, the detection sample will combine with the specific HEX detection primer and release the red fluorescent groups. With the increase of the number of PCR reaction cycles, the red fluorescent signal will be enhanced.

According to Embodiment 1, it is found that in the association analysis population containing 264 soybean materials (13 materials are genotyped as deletion at SNPS12_980498), the average contents of γ-tocopherol, δ-tocopherol and TVe of 129 soybean materials with AA genotype are 160.88 μg/g, 19.24 μg/g and 192.69 μg/g, respectively. The average contents of γ-tocopherol, δ-tocopherol and TVe in 122 soybean materials with TT genotype are 214.52 μg/g, 25.35 μg/g and 256.65 μg/g, respectively.

Accordingly, when soybeans are measured using the KASP marker-specific primers developed in Embodiment 2, if a blue fluorescent signal appears in the result, the soybean is determined to be a genotype with a high content of vitamin E. If a red fluorescent signal appears in the result, the soybean is determined to be a genotype with a low vitamin E content. The detection results are consistent with those of Embodiment 1.

The above-mentioned embodiments only describe the preferred mode of the present disclosure, and do not limit the scope of the present disclosure. Under the premise of not departing from the design spirit of the present disclosure, various modifications and changes made by ordinary technicians in the field to the technical scheme of the present disclosure shall fall within the protection scope determined by the claims of the present disclosure.