-
2025-09-23
19/014,935
2025-01-09
US 12,421,549 B1
2025-09-23
-
-
Kenneth R Horlick
Renner, Kenner, Greive, Bobak, Taylor & Weber
2045-01-09
Smart Summary: A new method and kit allow for quick and accurate testing of red blood cell (RBC) blood groups using advanced sequencing technology. It uses special primers to examine 25 blood group genes across 17 different blood group systems in just three tests. This approach is efficient and cost-effective, making it easier to identify both common and rare blood types. Unlike older methods, it can also distinguish between different gene variations, providing more detailed results. Overall, this innovation improves the way blood groups are analyzed and understood. š TL;DR
A method and a kit for genotyping of multi-system red blood cell (RBC) blood group based on next-generation sequencing (NGS) are provided. Multiplex PCR capture primer sets and amplification reaction conditions thereof can be designed using Illumina as a platform to simultaneously detect full-length coding regions and spliced flanking regions of 25 blood group genes in 17 RBC blood group systems among three reactions, thereby enabling rapid genotyping of the 17 RBC blood group systems and multiple key rare blood groups therein. The method and the kit are based on high-throughput sequencing and have a high detection efficiency and a low average cost; the method and the kit also break through a limitation of existing blood group gene detection technology that cannot distinguish haplotypes; moreover, variations including known mutation sites and unknown mutation sites can be detected to obtain comprehensive and accurate detection results.
Get notified when new applications in this technology area are published.
C12Q1/6881 » CPC main
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
C12Q1/6874 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
C12Q1/6806 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
C12Q2600/16 » CPC further
Oligonucleotides characterized by their use Primer sets for multiplex assays
C12P19/34 IPC
Preparation of compounds containing saccharide radicals; Preparation of nitrogen-containing carbohydrates; N-glycosides; Nucleotides Polynucleotides, e.g. nucleic acids, oligoribonucleotides
This patent application claims the benefit and priority of Chinese Patent Application No. 2024104330574, filed with the China National Intellectual Property Administration on Apr. 10, 2024, the disclosure of which is incorporated by reference herein in its entirety as part of the present application.
A computer readable XML file entitled āSequence Listingā, that was created on Dec. 26, 2024, with a file size of 364, 120 bytes, contains the sequence listing for this application, has been filed with this application, and is hereby incorporated by reference in its entirety.
The present disclosure belongs to the technical field of blood group genotyping, and specifically relates to a method and a kit for genotyping of 25 coding genes in 17 red blood cell (RBC) blood group systems based on next-generation sequencing (NGS).
A human blood group system consists of red blood cell (RBC) surface antigens (proteins, glycoproteins, or glycolipids). The blood group system is inherited and controlled by a single gene or a gene cluster of two or three closely-linked homologous genes. As of July 2023, there are a total of 378 RBC blood group antigens recognized by the International Society of Blood Transfusion (ISBT), of which 360 belong to 45 blood group systems. Human RBCs selectively express antigens from different blood group systems, which constitute each person's unique blood group combination. In addition to ABO, there are 17 most clinically important RBC blood group systems in China, including H, RH (including RHD and RHCE), MNS, Kidd, Diego, Duffy, Lewis, Kell, P1Pk, GLOB, Lutheran, Yt, SC, DO, CO, LW, and JR.
To ensure the safety of clinical blood transfusion, a primary factor is that blood groups of the donor and the patient are consistent. There are two problems:
First, unconventional blood group systems cause adverse reactions to blood transfusions. Nowadays, ABO and RhD blood groups (conventional blood groups) are those that medical institutions conduct routine test and homotype transfusion; for blood group systems (non-conventional blood groups) other than the above two, routine test is omitted due to technical and cost limitations. Therefore, for patients with chronic blood transfusions, multiple transfusions of unconventional blood with an incompatible blood group may stimulate the immune system to produce blood group alloantibodies, triggering transfusion reactions that may even be life-threatening in severe cases. According to statistics from Serious Hazards of Transfusion (SHOT) in the UK, all hemolytic transfusion reactions in the past five years were caused by incompatible transfusions with unconventional blood group systems. A key to solving this problem lies in matching blood transfusions with unconventional blood group systems in patients with chronic blood transfusions.
Second, the supply of blood for rare blood groups should be guaranteed. A rare blood group does not refer to a specific blood group, but refers to a blood group whose frequency is less than one in a thousand among all people. For example, the above-mentioned 17 most clinically important blood group systems in China mainly include 31 key rare blood groups. Blood of rare blood groups is an extremely scarce resource. It is currently the only way to solve the problem of blood supply for clinical rare blood types by conducting large-scale screening among blood donors to find those with rare blood groups and freezing blood of the rare blood groups. However, the difficulty in screening rare blood groups is that there is no technology suitable for simultaneous detection of multiple blood group systems yet at home and abroad.
RBC blood group identification belongs to the field of in vitro diagnostics, and identification methods include serological test and genetic diagnosis. The serological test is the most traditional blood group identification method as well as a commonly used blood group identification method in clinical medical institutions. The RBC blood group is identified by specific reaction in vitro between serum (antibody reagent) containing known specific antibodies and the antigens on a RBC surface to be tested, showing the advantages of simple operation, rapidity, and easy interpretation. However, the serological test is limited by the availability of blood group antibody reagents, and most unconventional blood group systems do not have commercially available antibody reagents globally; a few commercially available reagents completely depend on imports, and are expensive and in short supply. This is a ābottleneckā faced by the current in vitro diagnostic industry of blood groups.
When the serological test was limited, RBC blood group genetic diagnosis based on PCR and sequencing came into being. There are 1,568 alleles listed in a blood group gene mutation database of the National Center for Biotechnology Information (NCBI). Blood type can be predicted by detecting the coding genes of blood group antigens and analyzing genetic polymorphism characteristics. The most significant advantage of genotyping to detect blood groups is to supplement and overcome the deficiencies of serology. For example, diseases, drugs, and treatments (especially recent blood transfusions) interfere with the serological test, making blood group results ambiguous; there are individuals with genetic mutations that result in reduced antigen expression or with unexpected antibodies. In addition, for rare blood groups for which serological test antibody reagents are not available, genotyping is the only way to predict the blood group.
The blood group genetic testing technologies currently widely used in clinical and blood collection and supply institutions in China are polymerase chain reaction-sequence specific primer (PCR-SSP) and first-generation sequencing (Sanger). A prerequisite for the PCR-SSP to identify blood group alleles is to clarify DNA sequences and single nucleotide polymorphisms (SNPs) in order to prepare corresponding primers or probes. Therefore, this technique is not suitable for detecting mutations of unknown sequences or blood group gene with high polymorphism. The Sanger is a gold standard for genetic testing, and can accurately obtain the nucleotide sequence of a target gene or a certain fragment and identify unknown mutations. However, this technique cannot directly distinguish between two haplotypes and may sometimes produce ambiguous typing results. Moreover, as low-to-medium-throughput genetic testing techniques, the PCR-SSP and Sanger are in a high cost and less efficient for screening rare blood groups. In this case, next-generation sequencing (NGS), also known as high-throughput sequencing, is more appropriate. The NGS determines a DNA sequence while synthesizing same by capturing newly synthesized end tags, and allows the detection of one single haplotype DNA sequence to avoid ambiguous typing results. In addition, the NGS has an extremely high detection throughput and can greatly increase the detection throughput, and is highly suitable for large-scale screening of rare blood groups.
A purpose of the present disclosure is to provide a method and a kit for genotyping of 25 coding genes in 17 red blood cell (RBC) blood group systems based on next-generation sequencing (NGS). In the present disclosure, the method based on NGS and multiplex PCR effectively improves both accuracy and detection efficiency for the genotyping of RBC blood group, and can save the manpower in genotyping of the RBC blood group to a certain extent.
The present disclosure provides a primer set for simultaneously detecting genotyping of 17 RBC blood group systems, including primers with nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 336.
Preferably, a first primer set includes the primers with the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 108;
The present disclosure further provides a kit for simultaneously detecting genotyping of 17 RBC blood group systems, including the primer set and a PCR reaction solution.
Preferably, the first primer set, the second primer set, and the third primer set in the primer set are packaged independently.
The present disclosure further provides a method for simultaneously detecting genotyping of 17 RBC blood group systems, including the following steps: (1) subjecting three capture and amplification systems to first amplification separately to obtain three first amplification products, where the three capture and amplification systems are prepared by using a nucleic acid extracted from a sample as a template and a first primer set with nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 108, a second primer set with nucleotide sequences shown in SEQ ID NO: 109 to SEQ ID NO: 222, and a third primer set with nucleotide sequences shown in SEQ ID NO: 223 to SEQ ID NO: 336, respectively;
(2) purifying the three first amplification products separately, and subjecting three resulting purified first amplification products to second amplification with a sequencing universal adapter carrying an index separately to obtain three second amplification products; and
(3) purifying and mixing the three second amplification products to allow sequencing to obtain the genotyping of the RBC blood group systems.
Preferably, the sample in step (1) is selected from the group consisting of a whole blood sample, a plasma sample, and a paraffin tissue sample.
Preferably, the three capture and amplification systems in step (1) each have a volume of 25 μL, and include 1 μL of a mixture of the first primer set or the second primer set or the third primer set, 3 μL of an enzyme mixture Pxp-1st-mix, 1 μL of the template, and nuclease-free water as a balance.
Preferably, a PCR reaction program of the first amplification in step (1) includes: initial denaturation at 98° C. for 20 min; 9 cycles of denaturation at 98° C. for 15 s, annealing at 62° C. for 20 min, extension at 68° C. for 60 s, and extension at 72° C. for 60 s; extension at 72° C. for 5 min; and heat preservation at 10° C.
Preferably, a system of the second amplification in step (2) has a volume of 12.5 μL, and includes 6.5 μL of an enzyme mixture Pxp-2nd-mix, 4 μL for one of the three purified first amplification products, 1 μL of a universal adapter N5XX, and 1 μL of a universal adapter A7XX.
Preferably, a PCR reaction program of the second amplification in step (2) includes: initial denaturation at 98° C. for 2 min; 23 cycles of denaturation at 98° C. for 15 s, extension at 68° C. for 60 s, and extension at 72° C. for 60 s; extension at 72° C. for 10 min; and heat preservation at 4° C.
Beneficial effects: the present disclosure provides a PCR primer set and a kit for genotyping and capturing 25 coding genes of 17 RBC blood group systems based on a MiSeq NGS platform of the Illumina platform. The primer and kit can simultaneously detect multiple samples and multiple genes, including hereditary mutations such as point mutations and short indels. The kit effectively improves detection efficiency and accuracy, while reducing costs, simplifying operating steps, and providing flexible packaging specifications.
In the present disclosure, a detection method for detecting 31 key rare blood groups of 17 RBC blood group systems is constructed based on the primer set or kit. High-throughput sequencing is conducted to simultaneously detect 17 RBC blood group system-related genes to improve detection efficiency and reduce costs. The high-throughput gene sequencing can break through the limitations of traditional detection technology and improve detection sensitivity. Meanwhile, variations including known mutation sites and unknown mutation sites can be detected to obtain comprehensive and accurate detection results. By sequencing 17 RBC blood group system-related genes and their mutation sites, specific gene sequence information can be obtained, thereby providing accurate and efficient detection for rare blood group detection.
FIG. 1 shows a flow chart for RBC blood group identification using the primer set or kit of the present disclosure;
FIG. 2 shows an electrophoresis pattern of primer specificity verification in Example 1;
FIG. 3 shows an electrophoresis pattern of primer detection sensitivity verification in Example 2; and
FIG. 4 shows results of the repeatability verification of primer detection in Example 3.
The present disclosure provides a primer set for simultaneously detecting genotyping of 17 RBC blood group systems, including primers with nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 336.
In the present disclosure, the RBC blood group system and corresponding genetic information are shown in Table 1.
| TABLE 1 |
| Gene information of the 17 RBC blood group systems |
| Number | ||||||||
| Blood | Number | Number | Number | of | ||||
| group | of | of | of | primer | ||||
| No. | ISBT No. | system | Coding gene | Chromosome | sites | types | bases | pairs |
| 1 | ISBT 018 | H | FUT1 | chr19 | 75 | 57 | 58 | 8 |
| FUT2 | chr19 | 31 | 37 | 32 | 6 | |||
| SLC35C1 | chr11 | 6 | 4 | 3 | 3 | |||
| 2 | ISBT 004 | RH | RhD | chr1 | 249 | 387 | 231 | 12 |
| RhCE | chr1 | 130 | 183 | 136 | 10 | |||
| 3 | ISBT 002 | MNS | GYPA | chr4 | 45 | 44 | 123 | 3 |
| GYPB | chr4 | 24 | 15 | 14 | 3 | |||
| 4 | ISBT 009 | Kidd | SLC14A1(JK) | chr18 | 29 | 32 | 49 | 7 |
| 5 | ISBT 010 | Diego | SLC4A1(DI) | chr17 | 39 | 40 | 19 | 5 |
| 6 | ISBT 008 | Duffy | ACKR1(FY) | chr1 | 21 | 24 | 229 | 6 |
| 7 | ISBT 007 | Lewis | FUT3 | chr19 | 42 | 60 | 38 | 6 |
| FUT6 | chr19 | 37 | 20 | 21 | 5 | |||
| FUT7 | chr9 | 2 | 2 | 1 | 1 | |||
| 8 | ISBT 006 | Kell | KEL | chr7 | 96 | 94 | 67 | 16 |
| 9 | ISBT 003 | P1Pk | A4GALT | chr22 | 39 | 41 | 198 | 7 |
| 10 | ISBT 028 | GLOB | B3GALNT1 | chr3 | 14 | 14 | 15 | 6 |
| 11 | ISBT 005 | Lutheran | BCAM(LU) | chr19 | 50 | 42 | 332 | 11 |
| KLF1 | chr19 | 58 | 56 | 148 | 9 | |||
| GATA1 | chrX | 1 | 1 | 1 | 1 | |||
| 12 | ISBT 011 | Yt | ACHE | chr7 | 4 | 4 | 4 | 2 |
| 13 | ISBT 013 | SC | ERMAP | chr1 | 7 | 6 | 8 | 3 |
| 14 | ISBT 014 | DO | ART4 | chr12 | 19 | 14 | 22 | 7 |
| 15 | ISBT 015 | CO | AQP1 | chr7 | 9 | 9 | 450 | 4 |
| 16 | ISBT 016 | LW | ICAM4 | chr19 | 2 | 2 | 11 | 1 |
| 17 | ISBT 032 | JR | ABCG2 | chr4 | 43 | 37 | 1946 | 26 |
| Total | 1072 | 1225 | 4156 | 168 | ||||
The present disclosure is based on 1,072 blood group system typing sites of 25 genes shown in Table 1: H (ISBT 018), Rh (ISBT 004), MNS (ISBT 002), Kidd (JK, ISBT 009), Diego (DI, ISBT 010), Duffy (FY, ISBT 008), Lewis (ISBT 007), Kell (ISBT 006), P1Pk (ISBT 003), Globoside (GLOB, ISBT 028), Lutheran (LU, ISBT 005), YT (ISBT 011), Scianna (SC, ISBT 013), Dombrock (DO, ISBT 014), Colton (CO, ISBT 015), Landsteiner-Wiener (LW, ISBT 016), and Junior (JR, ISBT 032). The present disclosure develops a multiplex PCR-based RBC blood type NGS typing primer set, kit and method adapted to the Illumina sequencing platform. The primer set is designed based on the target region of the above gene. The target region preferably includes the full length of the coding region sequences of the 25 antigen-coding genes of the above-mentioned 17 blood group systems and the splicing flanking region within 100 bp to 150 bp. In the present disclosure, the 26 genes are preferably selected from the University of California Santa Cruz (UCSC) database; the typing sites have been disclosed in databases and literature, most of which are collected in the ISBT database, and a small number are derived from literature.
In the present disclosure, the specific primers in the primer set are completely complementary or partially complementary to the above-mentioned target region. Preferably, each pair of specific primers for the target region contains two parts, labeled as 3ā²-end Tag1 and 5ā²-end Tag2. A fragment sequence of the 3ā²-end Tag1 is completely complementary or partially complementary to the target region, and is preferably a nucleic acid molecule with a specific sequence, with an unlimited number of bases, preferably 20 to 40. The 5ā²-end Tag2 is used to combine with the universal primer during the amplification of the target region, thus completing the specific labeling of the amplification products of the target regions of different samples to be tested. The 5ā²-end Tag2 has preferably 3 to 20, more preferably 4 to 10 bases.
In the present disclosure, a total of 168 pairs of primers are designed based on the above genes and design principles. Each pair of primers contains mutation sites in the gene. The size of a target region amplified by each pair of primers is 150 bp to 300 bp, with wide coverage and multiple detection sites; the primers have a relatively uniform Tm value (57° C. to 63° C.); the primers show desirable specificity, stability, and uniformity during multiplex amplification, and have non-specific amplification. The primers preferably further include specific modifications, and the modified primers are not easily degraded by nucleases; specifically, the primer-specific modifications include one or more of thio modification, deoxyuracil modification, 5ā²-reverse dT modification, and 5ā²-amino modification. A thio-modified primer is a derivative in which the double-bonded oxygen atom on the oligonucleotide chain is replaced by a sulfur atom, and can resist the degradation of nuclease and enhance the stability of the primer. Each deoxythymine in the oligonucleotide sequence of a deoxyuracil-modified primer is replaced by deoxyuracil, and can increase the double-stranded dissolution temperature by 1.7° C., thereby increasing the stability of the double-stranded. The 5ā² end of the oligonucleotide sequence in a 5ā²-reverse dT-modified primer contains a reverse dT, thereby forming a cross-link, which can inhibit the degradation of exonucleases during the extension of DNA polymerase. The 5ā²-amino modification includes C6 amino modification and C12 amino modification. The former can be used to connect some compounds that do not affect its function even near the oligonucleotide, while the latter is used to ligate the affinity purification group and some fluorescent marks.
In the present disclosure, according to the nature of each primer, such as the amplification interval, Tm value, primer sequence, and actual expansion during the later test, the primer set is divided into 3 pools, which are specifically shown in Table 2. The number marked after the sequence in Table 2 is the number of SEQ ID NO. For example, (1) indicates that the nucleotide sequence of a sequence is serialized as SEQ ID NO: 1. The primer set 1 includes: RB_018, RB_023, RB_026, RB_029, RB_032, RB_034, RB_037, RB_039, RB_063, RB_016, RB_053, RB_055, RB_057, RB_048, RB_051, RB_070, RB_064, RB_066, RB_068, RB_118, RB_123, RB_106, RB_108, RB_110, RB_013, RB_003, RB_093, RB_097, RB_099, RB_101, RB_104, RB_042, RB_126, RB_077, RB_079, RB_082, RB_085, RB_087, RB_089, RB_091, RB_125, RB_130, RB_134, RB_137, RB_144, RB_146, RB_149, RB_153, RB_155, RB_157, RB_160, RB_167, RB_138, RB_140, and their nucleotide sequences are shown in SEQ ID NO: 1 to SEQ ID NO: 108 in sequence.
The primer set 2 includes: RB_020, RB_021, RB_022, RB_025, RB_027, RB_031, RB_035, RB_058, RB_060, RB_062, RB_015, RB_054, RB_046, RB_049, RB_052, RB_071, RB_072, RB_074, RB_065, RB_067, RB_069, RB_117, RB_120, RB_122, RB_105, RB_109, RB_112, RB_114, RB_010, RB_012, RB_002, RB_005, RB_007, RB_095, RB_098, RB_102, RB_041, RB_043, RB_045, RB_127, RB_081, RB_084, RB_088, RB_075, RB_131, RB_133, RB_136, RB_143, RB_147, RB_150, RB_152, RB_156, RB_158, RB_161, RB_163, RB_165, RB_141, and their nucleotide sequences are shown in SEQ ID NO: 109 to SEQ ID NO: 222 in sequence.
The primer set 3 includes: RB_019, RB_024, RB_028, RB_030, RB_033, RB_036, RB_038, RB_059, RB_061, RB_017, RB_056, RB_047, RB_050, RB_073, RB_116, RB_119, RB_121, RB_124, RB_107, RB_111, RB_113, RB_115, RB_009, RB_011, RB_014, RB_001, RB_004, RB_006, RB_008, RB_092, RB_094, RB_096, RB_100, RB_103, RB_040, RB_044, RB_076, RB_078, RB_080, RB_083, RB_086, RB_090, RB_128, RB_129, RB_132, RB_135, RB_142, RB_145, RB_148, RB_151, RB_154, RB_159, RB_162, RB_164, RB_166, RB_168, RB_139, and their nucleotide sequences are shown in SEQ ID NO: 223 to SEQ ID NO: 336 in sequence.
| TABLEā2ā |
| Informationāofāprimerāpairs |
| Targetāgene | |||
| PrimerāID | fragment | Sequenceāofāforwardāprimer | Sequenceāofāreverseāprimer |
| RB_001 | FUT1-1 | AGTCTCCCTGGCTCTCAAGGā(SEQāID | CGATGGACAGGAGGCTACACā(SEQāID |
| NO:ā273) | NO:ā274) | ||
| RB_002 | FUT1-2 | CAGAGTCTGGCAGGGTGAAGā(SEQāID | TTTTCGTGGTCACCAGCAACā(SEQāID |
| NO:ā169) | NO:ā170) | ||
| RB_003 | FUT1-3 | GTGTAGCCTCCTGTCCATCGā(SEQāID | GTGGGGACTATCTGCAGGTTā(SEQāID |
| NO:ā51) | NO:ā52) | ||
| RB_004 | FUT1-4 | TTGCTGGTGACCACGAAAACā(SEQāID | CTTCCACCATCTCCGGGAACā(SEQāID |
| NO:ā275) | NO:ā276) | ||
| RB_005 | FUT1-5 | CACACTCTGCGCCTCTTCCā(SEQāIDā | TTTATCCTGCCTGCCATGCAā(SEQāID |
| NO:ā171) | NO:ā172) | ||
| RB_006 | FUT1-6 | CTCAAGTCCGCGTACTCCTCā(SEQāID | CACCTGGACTGTCTACCCCAā(SEQāID |
| NO:ā277) | NO:ā278) | ||
| RB_007 | FUT1-7 | CGTGGCATACTGTCCCATCTā(SEQāID | CTGGCCTTCCTGCTAGTCTGā(SEQāID |
| NO:ā173) | NO:ā174) | ||
| RB_008 | FUT1-8 | CGGTCTGGACACAGGATCGā(SEQāID | CCTGGGACTAAGGAGTGCTGā(SEQāID |
| NO:ā279) | NO:ā280) | ||
| RB_009 | FUT2-1 | GCCTCCATCTCCCAGCTAACā(SEQāID | AGGCGGCCTATTGCATTGATā(SEQāID |
| NO:ā267) | NO:ā268) | ||
| RB_010 | FUT2-2 | CGATCAATGCAATAGGCCGCā(SEQāID | GGGATGTGGCGGTATTCCTCā(SEQāID |
| NO:ā165) | NO:ā166) | ||
| RB_011 | FUT2-3 | CCTGGCAGAACTACCACCTGā(SEQāID | ATAGTCCCCTCGGCGAACATā(SEQāID |
| NO:ā269) | NO:ā270) | ||
| RB_012 | FUT2-4 | GAGGAGGCCCAGAAGTTCCTā(SEQāID | CAGCAAACACCACATCACCGā(SEQāID |
| NO:ā167) | NO:ā168) | ||
| RB_013 | FUT2-5 | TCGTGGTCACCAGTAATGGCā(SEQāID | GTCGGGGAGGGTGTAATTGGā(SEQāID |
| NO:ā49) | NO:ā50) | ||
| RB_014 | FUT2-6 | GCGGAGACACCATCTACCTGā(SEQāID | GAGGGAGGCAGAGAAGGAGAā(SEQāID |
| NO:ā271) | NO:ā272) | ||
| RB_015 | SLC35C1-1 | AACCTCTGCCTCAAGTACGTCā(SEQāID | TGACCACTCTATCCCCCGTGā(SEQāID |
| NO:ā129) | NO:ā130) | ||
| RB_016 | SLC35C1-2 | GAGGGCCGCAATACTCAGTCā(SEQāID | TTCGTGGTGTAGATGGCGTTā(SEQāID |
| NO:ā19) | NO:ā20) | ||
| RB_017 | SLC35C1-3 | CATCGGCTACGTGACAGGACā(SEQāID | TCTTCTCGCTGTCTTTGGGGā(SEQāID |
| NO:ā241) | NO:ā242) | ||
| RB_018 | RhD-1 | GCCCTCAAGTAGGTGTTGGAā(SEQāID | CCCTGCTATTTGCTCCTGTGAā(SEQāID |
| NO:ā1) | NO:ā2) | ||
| RB_019 | RhD-2 | AAATCTCGTCTGCTTCCCCCā(SEQāID | GATCCAGCCACCATCCCAATā(SEQāID |
| NO:ā223) | NO:ā224) | ||
| RB_020 | RhD-3 | AAGATCTGACCGTGATGGCGā(SEQāID | GAACCTGTCCTTTCGGGGTCā(SEQāID |
| NO:ā109) | NO:ā110) | ||
| RB_021 | RhD-4 | TTCTCAGTCGTCCTGGCTCTCā(SEQāID | TTCAAAACCCTGGAAACCCCAā(SEQāID |
| NO:ā111) | NO:ā112) | ||
| RB_022 | RhD-5 | GAGGATGCCGACACTCACTGā(SEQāID | TCAGCCCAAGTAGGAGACCAā(SEQāID |
| NO:ā113) | NO:ā114) | ||
| RB_023 | RhD-6 | GACCTTTGGAGCAGGAGTGTā(SEQāID | GTCCTGTTAGACCCAAGTGCTā(SEQāID |
| NO:ā3) | NO:ā4) | ||
| RB_024 | RhD-7 | CTCGAGGCTCAGACCTTTGGā(SEQāID | TTAGACCCAAGTGCTGCCCAā(SEQāID |
| NO:ā225) | NO:ā226) | ||
| RB_025 | RhD-8 | GCTTCCTTTACCCACACGCTā(SEQāID | CCTTCAGCCAAAGCAGAGGAā(SEQāID |
| NO:ā115) | NO:ā116) | ||
| RB_026 | RhD-9 | GTCTCACCTGCCAATCTGCTā(SEQāID | CCCAGCTAAGGACTCTGCACā(SEQāID |
| NO:ā5) | NO:ā6) | ||
| RB_027 | RhD-10 | CTGATGCCCAAGTGACCACCā(SEQāID | AGGAGATGGGGCACATAGACā(SEQāID |
| NO:ā117) | NO:ā118) | ||
| RB_028 | RhD-11 | TGAGATTAAAAATCCTGTGCTCCAā(SEQ | GTTCCTCCTGCAATGCTCCTā(SEQāID |
| IDāNO:ā227) | NO:ā228) | ||
| RB_029 | RhD-12 | GGCTGTTTCAAGAGATCAAGCCā(SEQ | TTCTCTGACTCCAGTGCCTGā(SEQāID |
| IDāNO:ā7) | NO:ā8) | ||
| RB_030 | RhCE-13 | TCTGTCTCTGACCTTGTTTCATā(SEQāID | GGCTGTTTCAAGAGATCAAGCCā(SEQ |
| NO:ā229) | IDāNO:ā230) | ||
| RB_031 | RhCE-14 | GAAAGGTGGCCTCACACTGAā(SEQāID | CCTGGCAATGGCACTACTGAā(SEQāID |
| NO:ā119) | NO:ā120) | ||
| RB_032 | RhCE-15 | CCCAGCTAAGGACTCTGCACā(SEQāID | GTCTCACCTGCCAATCTGCTā(SEQāID |
| NO:ā9) | NO:ā10) | ||
| RB_033 | RhCE-16 | CTTCAGCCAAAGCAGAGAGCā(SEQāID | GCTGGTCACTTGCAGCAAGAā(SEQāID |
| NO:ā231) | NO:ā232) | ||
| RB_034 | RhCE-17 | TTAGACCCAAGTGCTGCCCAā(SEQāID | CTCGAGGCTCAGACCTTTGGā(SEQāID |
| NO:ā11) | NO:ā12) | ||
| RB_035 | RhCE-18 | CTCAGCCCAAGTATGAGACCAā(SEQāID | TTTCTCCAAGGACCATCAGGGā(SEQāID |
| NO:ā121) | NO:ā122) | ||
| RB_036 | RhCE-19 | AATGGAGCTTTTGGCCCTTTTCā(SEQāID | TCAGTCATCCTGGCTCTCCTTCā(SEQāID |
| NO:ā233) | NO:ā234) | ||
| RB_037 | RhCE-20 | GAACCTGTCCTTTCGGGGTCā(SEQāID | AAGATCTGACCGTGATGGCGā(SEQāID |
| NO:ā13) | NO:ā14) | ||
| RB_038 | RhCE-21 | GATCCAGCCACCATCCCAATā(SEQāID | AAATCTCGTCTGCTTCCCCCā(SEQāID |
| NO:ā235) | NO:ā236) | ||
| RB_039 | RhCE-22 | CCTGCTATTTGCTCCTGTGAā(SEQāID | CTCAAGCCCTCAAGTAGGTGTā(SEQāID |
| NO:ā15) | NO:ā16) | ||
| RB_040 | GYPA-1 | TGGTGTACAACATGATGGTTTGAā(SEQ | TGTACAACAGGGTGAATGGAGTā(SEQ |
| IDāNO:ā291) | IDāNO:ā292) | ||
| RB_041 | GYPA-2 | CTCCTAGAGCTGTTCACACTGGā(SEQ | AGGCAAGGTGATGTTATGCTGAā(SEQāID |
| IDāNO:ā181) | NO:ā182) | ||
| RB_042 | GYPA-3 | AGGCATTTGAAACAAGCAATGGAā(SEQ | AAGGAAACCCGCAGAACAGTā(SEQāID |
| IDāNO:ā63) | NO:ā64) | ||
| RB_043 | GYPA-4 | GCAGTGACAGGTCCCCTAAAā(SEQāID | CTGCTCAGTCACCTCGTTCTā(SEQāID |
| NO:ā183) | NO:ā184) | ||
| RB_044 | GYPA-5 | TGTCACGAAAGCTTGAGAACTGā(SEQ | GCTCTATGTCCACGCAGTCAā(SEQāID |
| IDāNO:ā293) | NO:ā294) | ||
| RB_045 | GYPA-6 | GCAGTGACAGGTCCCCTAAAā(SEQāID | TTATGGTCCGCTCAGTCACCā(SEQāID |
| NO:ā185) | NO:ā186) | ||
| RB_046 | JK-1 | TGGCTAATCTGGAGGGCTCTā(SEQāID | ACCTTTAAGCTGGTTGGCAAGā(SEQāID |
| NO:ā133) | NO:ā134) | ||
| RB_047 | JK-2 | CTTCCAGACAAACCCGTGGTā(SEQāID | TGCCCACAGTAACTGGTCAGā(SEQāID |
| NO:ā245) | NO:ā246) | ||
| RB_048 | JK-3 | GCAAGTGCAACCAAAGCTCAā(SEQāID | GGCATTTTGAAAACCAATTGTAACT |
| NO:ā27) | (SEQāIDāNO:ā28) | ||
| RB_049 | JK-4 | CAGCCTGCTTTGTCACATGCā(SEQāID | GCGAATGTGAGAAGCCAGTGā(SEQāID |
| NO:ā135) | NO:ā136) | ||
| RB_050 | JK-5 | ACCAGTGGGAGTTGGTCAGAā(SEQāID | CCCATTGGTCCCTAGGAAGCā(SEQāID |
| NO:ā247) | NO:ā248) | ||
| RB_051 | JK-6 | CCTGAGTTCTGACCCCTCCTā(SEQāID | CAGAACCCTGGCCCTGATTTā(SEQāID |
| NO:ā29) | NO:ā30) | ||
| RB_052 | JK-7 | GTAATCAGGGCACTGTGCATTCā(SEQ | TGGACTTCAGGAGCATTTCCCā(SEQāID |
| IDāNO:ā137) | NO:ā138) | ||
| RB_053 | DI-1 | GCCACTCACACACTGAAGCTCā(SEQāID | TGGGGTGTGATAGGCACTGACā(SEQāID |
| NO:ā21) | NO:ā22) | ||
| RB_054 | DI-2 | ATGAAGACCAGCAGAGCAGGā(SEQāID | AGTTCCCAAGTGCCTCCAACā(SEQāID |
| NO:ā131) | NO:ā132) | ||
| RB_055 | DI-3 | GCTGTTCTTGAACTTGCGCAā(SEQāID | GGTATTTTCCAGCCCAAGCCā(SEQāID |
| NO:ā23) | NO:ā24) | ||
| RB_056 | DI-4 | CAACACCACCAGCAGGATGAā(SEQāID | CCCTGCTGGTGTTTGAGGAAā(SEQāID |
| NO:ā243) | NO:ā244) | ||
| RB_057 | DI-5 | TGCACTGCAGTGGAGATCAGā(SEQāID | ACTCTTGCCTCTGACCCTCTā(SEQāID |
| NO:ā25) | NO:ā26) | ||
| RB_058 | FY-1 | CCATCCTGGTCTCTTGGTGCā(SEQāID | AGGCCATCAGAGTTACACCGā(SEQāID |
| NO:ā123) | NO:ā124) | ||
| RB_059 | FY-2 | ATGGCCTCCTCTGGGTATGTā(SEQāID | AGCATGAAGAGGACAGTGCTā(SEQāID |
| NO:ā237) | NO:ā238) | ||
| RB_060 | FY-3 | GCACTGCCCTTCTTCATCCTā(SEQāID | GCTGAGCCATACCAGACACAā(SEQāID |
| NO:ā125) | NO:ā126) | ||
| RB_061 | FY-4 | TCTTCCGCTGGCAGCTCTā(SEQāIDāNO: | CCACTCCCCAAATTCCCACAā(SEQāID |
| 239 | NO:ā240) | ||
| RB_062 | FY-5 | CACTGTAGCCTGTCTTGCCAā(SEQāID | AAAATTGCCAGGGCTTCTGCā(SEQāID |
| NO:ā127) | NO:ā128) | ||
| RB_063 | FY-6 | TTGTCAACATGTCTGGCCCAā(SEQāID | AAGAAACCACCCGCTTCACAā(SEQāID |
| NO:ā17) | NO:ā18) | ||
| RB_064 | FUT3-1 | GAGAGAGGGTTGGCCACAAAā(SEQāID | AGGAGCTGGACAAGGACCAā(SEQāID |
| NO:ā33) | NO:ā34) | ||
| RB_065 | FUT3-2 | TGGTCCTTGTCCAGCTCCTā(SEQāIDāNO: | CCAAGGGGACCATGATGGAGā(SEQāID |
| 145) | NO:ā146) | ||
| RB_066 | FUT3-3 | ACAGCGTCTCCATCATGGTCā(SEQāID | CAGCGACTCCGACATCTTCAā(SEQāID |
| NO:ā35) | NO:ā36) | ||
| RB_067 | FUT3-4 | CTGAGTCCGGCTTCCAGTTGā(SEQāID | CCAACCCTAAGTCACGCCTCā(SEQāID |
| NO:ā147) | NO:ā148) | ||
| RB_068 | FUT3-5 | GCGTGACTTAGGGTTGGACAā(SEQāID | TTCTCCTACCTGCGTGTGTCā(SEQāID |
| NO:ā37) | NO:ā38) | ||
| RB_069 | FUT3-6 | TGGAAAGGCCATGTCCGTAGā(SEQāID | ACTCTGACCCATGGATCCCCā(SEQāID |
| NO:ā149) | NO:ā150) | ||
| RB_070 | FUT6-1 | GCGTGTCTGGTACCTGGATTā(SEQāID | CCCAGCAGAAGCAACTACGAā(SEQāID |
| NO:ā31) | NO:ā32) | ||
| RB_071 | FUT6-2 | TCGTAGTTGCTTCTGCTGGGā(SEQāID | GGAACCATGATGGAGACGCTā(SEQāID |
| NO:ā139) | NO:ā140) | ||
| RB_072 | FUT6-3 | GTCTTGGCCGAGAGGTTGAGā(SEQāID | TCATGTACAACCCCAGTGCCā(SEQāID |
| NO:ā141) | NO:ā142) | ||
| RB_073 | FUT6-4 | TTGGGGACTCCATGCTGAACā(SEQāID | ACAAACCCATAGCTCTGCCCā(SEQāID |
| NO:ā249) | NO:ā250) | ||
| RB_074 | FUT6-5 | ATGGGTTTGTTAAAAGGCCACGā(SEQ | TCTCCCCACTTCCCAGATACTā(SEQāID |
| IDāNO:ā143) | NO:ā144) | ||
| RB_075 | FUT7-7 | GTGGGTGTGGCTAGGAGACTā(SEQāID | TCACCATCCTTGTCTGGCACā(SEQāID |
| NO:ā195) | NO:ā196) | ||
| RB_076 | KEL-1 | ACAGCGGAAATACCTGGCAAā(SEQāID | CACTTGATCCCCTGGTTCCCā(SEQāID |
| NO:ā295) | NO:ā296) | ||
| RB_077 | KEL-2 | GGGACTTCCATGAGCTTCAGTā(SEQāID | GGGTTTTGGGTACTGTGTGGAā(SEQāID |
| NO:ā67) | NO:ā68) | ||
| RB_078 | KEL-3 | CCAACGTCTGCAGCATTCTCTā(SEQāID | ATGCTCCTGGGAGCTGATTCā(SEQāID |
| NO:ā297) | NO:ā298) | ||
| RB_079 | KEL-4 | CTCCCTTGTGGTCTTCCCTTā(SEQāID | CTCCCTTGTGGTCTTCCCTTā(SEQāID |
| NO:ā69) | NO:ā70) | ||
| RB_080 | KEL-5 | ATCATAACACCTGTCGGCCCā(SEQāID | GGGAGGGACTGTGTAGGTCTā(SEQāID |
| NO:ā299) | NO:ā300) | ||
| RB_081 | KEL-6 | CATACCTGTGTTGGGGGTGAā(SEQāID | TGGTCCCATTGGTGTTTGTCAā(SEQāID |
| NO:ā189) | NO:ā190) | ||
| RB_082 | KEL-7 | GGAGGGTCAGAGAAGTGACGAā(SEQ | GCCACTGGGCTGTATACTCAā(SEQāID |
| IDāNO:ā71) | NO:ā72) | ||
| RB_083 | KEL-8 | ATCCCCATCTCGCTTGTTCCā(SEQāID | AGCCCTTTTCCAAGGGTCAGā(SEQāID |
| NO:ā301) | NO:ā302) | ||
| RB_084 | KEL-9 | TGCCCAATTCCCCAATCACAā(SEQāID | TCCTGAACAGGAGCCACTCAā(SEQāID |
| NO:ā191) | NO:ā192) | ||
| RB_085 | KEL-10 | AATACACCCGCTCCTCTCCTā(SEQāID | GGAGCTGCCTTCACGAGTATā(SEQāID |
| NO:ā73) | NO:ā74) | ||
| RB_086 | KEL-11 | GCGGCGAACCTCTGCTTTAGā(SEQāID | ATCCCCTCCCCCAGTTAGCā(SEQāIDāNO: |
| NO:ā303) | 304) | ||
| RB_087 | KEL-12 | GAGAGGAAGATCCCCATGCCā(SEQāID | CCTTCCTCCAGATCTTTCGGGā(SEQāID |
| NO:ā75) | NO:ā76) | ||
| RB_088 | KEL-13 | GTCTCCTCCCAGCAAGGTTCā(SEQāID | CCAGTCTCTCTTGTGCCCAGā(SEQāID |
| NO:ā193) | NO:ā194) | ||
| RB_089 | KEL-14 | GTCCAACTGTGTCTTCGCCAā(SEQāID | AGAGCCGATCCAGACAATGGā(SEQāID |
| NO:ā77) | NO:ā78) | ||
| RB_090 | KEL-15 | AGCATCTTCCACCCTGCTTTā(SEQāID | AGCCCTTGTCTTTTTGCCTCTā(SEQāID |
| NO:ā305) | NO:ā306) | ||
| RB_091 | KEL-16 | GGCTGACTAGGTTAGGGGGTā(SEQāID | TCACCTCTTGGTTCCTCCCAā(SEQāID |
| NO:ā79) | NO:ā80) | ||
| RB_092 | A4GALT-1 | GGGCCCCTCACAAGTACATTā(SEQāID | CTGAGGCCTTCTACCCCATCā(SEQāID |
| NO:ā281) | NO:ā282) | ||
| RB_093 | A4GALT-2 | ATGGGGTAGAAGGCCTCAGGā(SEQāID | TCTCAAGAACCTGCGGAACCā(SEQāID |
| NO:ā53) | NO:ā54) | ||
| RB_094 | A4GALT-3 | CCGTTGTAGTGGTCCACGAAā(SEQāID | CTGGGAGCCCTACCTGCTā(SEQāIDāNO: |
| NO:ā283) | 284) | ||
| RB_095 | A4GALT-4 | CATGAGTGCGATCCTGGAGGā(SEQāID | TTCATGTGCTCGGTGGAGTCā(SEQāID |
| NO:ā175) | NO:ā176) | ||
| RB_096 | A4GALT-5 | CGGAAGCCCTTTCATCAGGAā(SEQāID | ATCTACTGGCACGTTGTGGGā(SEQāID |
| NO:ā285) | NO:ā286) | ||
| RB_097 | A4GALT-6 | CCCACAACGTGCCAGTAGATā(SEQāID | TTGGCTCTGGCTGATGTTCAā(SEQāID |
| NO:ā55) | NO:ā56) | ||
| RB_098 | A4GALT-7 | CCTCCTCCCCACTGCGAGā(SEQāIDāNO: | CGCAAGGGCTCTGGGGACā(SEQāIDāNO: |
| 177) | 178) | ||
| RB_099 | B3GALNT1-1 | GTAAGCCAGCACACTGACCTā(SEQāID | GCAGCCCATGGCTTTTCTTCā(SEQāID |
| NO:ā57) | NO:ā58) | ||
| RB_100 | B3GALNT1-2 | GGGCTGCAATCACACGTCTCā(SEQāID | TCCTTTCAAGGTGTTCCCTCCā(SEQāID |
| NO:ā287) | NO:ā288) | ||
| RB_101 | B3GALNT1-3 | TCCTTGGCACCAAATCTCTGGā(SEQāID | GCCCCAATGCCAAGTACGTAā(SEQāID |
| NO:ā59) | NO:ā60) | ||
| RB_102 | B3GALNT1-4 | TCAGTGTCTGTCTTCATTACGTā(SEQāID | CCAGGCAGGCCATTAGAGTTā(SEQāID |
| NO:ā179) | NO:ā180) | ||
| RB_103 | B3GALNT1-5 | GGCATTGGGGCAAAACTCAGā(SEQāID | TGACCTCCCACCCTTCAGATā(SEQāID |
| NO:ā289) | NO:ā290) | ||
| RB_104 | B3GALNT1-6 | ATCTGAAGGGTGGGAGGTCAā(SEQāID | TCTCTGGACTGTCCTTCCGAā(SEQāID |
| NO:ā61) | NO:ā62) | ||
| RB_105 | LU-1 | AGCTCAGTTGCTCTCTTGCAā(SEQāID | AACAAGGAGTGTGGCTTGGTā(SEQāID |
| NO:ā157) | NO:ā158) | ||
| RB_106 | LU-2 | AGCTGCAGAGAGAAAGGACCā(SEQāID | CACACGTAGTCTCGCTCGTCā(SEQāID |
| NO:ā43) | NO:ā44) | ||
| RB_107 | LU-3 | CTGAGATGCAGGGCTCTGAGā(SEQāID | GGATGCCCGAGGACACTTACā(SEQāID |
| NO:ā259) | NO:ā260) | ||
| RB_108 | LU-4 | CGTGTTTGGTAAGTGTCCTCGā(SEQāID | CTGTCCCCTCCTCCTCCAGā(SEQāIDāNO: |
| NO:ā45) | 46) | ||
| RB_109 | LU-5 | CGACTTCAGAGTCCCAGCTCā(SEQāID | GCTGCTCACCTGGGTTCATā(SEQāIDāNO: |
| NO:ā159) | 160) | ||
| RB_110 | LU-6 | CGATCTCTCCCAGAGGGCTAā(SEQāID | CTCATGAGGTGTGGAGCCTGā(SEQāID |
| NO:ā47) | NO:ā48) | ||
| RB_111 | LU-7 | CCTTAGATCCCACGGAGCACā(SEQāID | CAGATCAGGTGGCTGCCTAAā(SEQāID |
| NO:ā261) | NO:ā262) | ||
| RB_112 | LU-8 | CCATGCTGTCGCTCAGTTCTā(SEQāID | CGAGCAGAAGATGGAGTCCCā(SEQāID |
| NO:ā161) | NO:ā162) | ||
| RB_113 | LU-9 | CTGGACAAACAGGACGAGTTCā(SEQāID | CTCCAGCTGAGTTTGGGGTCā(SEQāID |
| NO:ā263) | NO:ā264) | ||
| RB_114 | LU-10 | CTGATCGGAGCCTCCATAGCā(SEQāID | CTCACTGCAGGGACAGGATGā(SEQāID |
| NO:ā163) | NO:ā164) | ||
| RB_115 | LU-11 | GCACCGGTGAGTGACTGAGā(SEQāID | TCATTGCAGATAGCAGGCCACā(SEQāID |
| NO:ā265) | NO:ā266) | ||
| RB_116 | KLF1-1 | CCCATCCCCAGTCACTAGGAā(SEQāID | GGACATGACTGGGCAGACAGā(SEQāID |
| NO:ā251) | NO:ā252) | ||
| RB_117 | KLF1-2 | CCTCTGCAACCCTTCTTCCCā(SEQāID | GACTGCAGAGGATCCAGGTGā(SEQāID |
| NO:ā151) | NO:ā152) | ||
| RB_118 | KLF1-3 | TCTCGGCTATCACACCTGGAā(SEQāID | GCTCCTCGGGTGGCTACTTCā(SEQāID |
| NO:ā39) | NO:ā40) | ||
| RB_119 | KLF1-4 | TACCCGGACAGTAGCCCGTAā(SEQāID | GGCTTTTGGGTTCGGAGGATā(SEQāID |
| NO:ā253) | NO:ā254) | ||
| RB_120 | KLF1-5 | GGAAGTAGCCACCCGAGGAGā(SEQāID | CGAGACTCTGGGCGCATATGā(SEQāID |
| NO:ā153) | NO:ā154) | ||
| RB_121 | KLF1-6 | ATCCTCCGAACCCAAAAGCCā(SEQāID | CCCTCCACGTGAAGTCTGAGā(SEQāID |
| NO:ā255) | NO:ā256) | ||
| RB_122 | KLF1-7 | GAGGAGATCCAGGTCCCAGGā(SEQāID | GACAGGCAAACAAGACCCCTā(SEQāID |
| NO:ā155) | NO:ā156) | ||
| RB_123 | KLF1-8 | CCCCAAGATCTGTGACTGTGGā(SEQāID | CCCTCGAAGGGGCTATCACAā(SEQāID |
| NO:ā41) | NO:ā42) | ||
| RB_124 | KLF1-9 | GGTCCAGGTGCTGGGTAAAAā(SEQāID | TGATAGCAGCCTCCAACGTCā(SEQāID |
| NO:ā257) | NO:ā258) | ||
| RB_125 | GATA1-1 | CCTTTCCCTGGACCCCTACTā(SEQāID | ACACACCCACAATTTCAGGACTā(SEQ |
| NO:ā81) | IDāNO:ā82) | ||
| RB_126 | YT-1 | TAGACCCATGGTGGCTTTCCā(SEQāID | CCTTCGTGCCTGTGGTAGATā(SEQāID |
| NO:ā65) | NO:ā66) | ||
| RB_127 | YT-2 | ACACTCTGGAAGGTTGTAGCGā(SEQāID | TCCTTCTCCTCCTCCTCTGGā(SEQāID |
| NO:ā187) | NO:ā188) | ||
| RB_128 | ERMAP-1 | TGCTTGGCAGGCAGTATCTTā(SEQāID | CCCTGACAGCCTTTTCCAGTā(SEQāID |
| NO:ā307) | NO:ā308) | ||
| RB_129 | ERMAP-2 | CTCCCAGTTGGCCTTGTCTCā(SEQāID | TCTCTCACTAGCACCGTCCTā(SEQāID |
| NO:ā309) | NO:ā310) | ||
| RB_130 | ERMAP-3 | GGATGGGAAGGACCAGGATGā(SEQāID | TTGCCACAAATGACCCTGGGā(SEQāID |
| NO:ā83) | NO:ā84) | ||
| RB_131 | ART4-1 | TGCTCAGGTTCCCAGTTGACā(SEQāID | CTACACAGGGGCCACCATTCā(SEQāID |
| NO:ā197) | NO:ā198) | ||
| RB_132 | ART4-2 | GAATGGTGGCCCCTGTGTAGā(SEQāID | TAGAGCCATGGCCTCTGTTGā(SEQāID |
| NO:ā311) | NO:ā312) | ||
| RB_133 | ART4-3 | AGCTGGATTGCTGAGGTGAGā(SEQāID | AAAAGCCCACTTAGCCTGGCā(SEQāID |
| NO:ā199) | NO:ā200) | ||
| RB_134 | ART4-4 | GGCCATGGCTCTAGTAAAGTCAā(SEQ | TCGACTTCGACTTCGCACCā(SEQāIDāNO: |
| IDāNO:ā85) | 86) | ||
| RB_135 | ART4-5 | TTAAGCCAGGCTAAGTGGGCā(SEQāID | AAATCTGCAACCACATTCACCAā(SEQāID |
| NO:ā313) | NO:ā314) | ||
| RB_136 | ART4-6 | CGGGTGAATGCTCTGTTGGAā(SEQāID | TCAGGATGAAGCTGCAAGGGā(SEQāID |
| NO:ā201) | NO:ā202) | ||
| RB_137 | ART4-7 | TCAGTCTCATCCGTAACCGTā(SEQāID | GACTTCGGCATTCCCCTGAAā(SEQāID |
| NO:ā87) | NO:ā88) | ||
| RB_138 | AQP1-1 | CCGGCCCTATAAATAGGCCCā(SEQāID | CGACACCTTCACGTTGTCCTā(SEQāID |
| NO:ā105) | NO:ā106) | ||
| RB_139 | AQP1-2 | GGGCTTCAAATACCCGGTGGā(SEQāID | GGTGATGCCTGAGAGGATGGā(SEQāID |
| NO:ā335) | NO:ā336) | ||
| RB_140 | AQP1-3 | CCGTGCCCTCATGTACATCAā(SEQāID | TCTCTACGTGACCTCCAGCAā(SEQāID |
| NO:ā107) | NO:ā108) | ||
| RB_141 | AQP1-4 | TTCTCCCTCCAACCTCTCCCā(SEQāID | GGTCAGGCTTACCATGGGACā(SEQāID |
| NO:ā221) | NO:ā222) | ||
| RB_142 | ICAM4-1 | GCTCAATTGCAGCAACAGCTā(SEQāID | GCCCCTGTCCCTCACTGTAā(SEQāIDāNO: |
| NO:ā315) | 316) | ||
| RB_143 | ABCG2-1 | CACCTGCATTCCTTGGCTCTā(SEQāID | CTGACCTCGTAATCCACCCGā(SEQāID |
| NO:ā203) | NO:ā204) | ||
| RB_144 | ABCG2-2 | CGGCCTCCCAAAGTACTAGGā(SEQāID | CGAGCAAAAGGGGAAAAGCCā(SEQāID |
| NO:ā89) | NO:ā90) | ||
| RB_145 | ABCG2-3 | GCGGGTTCAAGCGATTCTACā(SEQāID | CCTAGTACTTTGGGAGGCCGā(SEQāID |
| NO:ā317) | NO:ā318) | ||
| RB_146 | ABCG2-4 | GCTCAGGATCTCAGGATGCGā(SEQāID | GTGCTGTGCCCACTCAAAAGā(SEQāID |
| NO:ā91) | NO:ā92) | ||
| RB_147 | ABCG2-5 | GTTTGCACCAGGGCATCATTā(SEQāID | GCCTTTGGTTAAGACCGAGCā(SEQāID |
| NO:ā205) | NO:ā206) | ||
| RB_148 | ABCG2-6 | TCTCTAGGACTGAGAAGGGAGTā(SEQ | AACCCACTGAGCACAGAAGTā(SEQāID |
| IDāNO:ā319) | NO:ā320) | ||
| RB_149 | ABCG2-7 | TGGCAGTGCAGGTTTCTCTCā(SEQāID | GTTTCATGTTGGCCAGGCTGā(SEQāID |
| NO:ā93) | NO:ā94) | ||
| RB_150 | ABCG2-8 | ATCTTTTGGCTTCCCTGGGCā(SEQāID | CTTGTCCAACGTGCATGTGGā(SEQāID |
| NO:ā207) | NO:ā208) | ||
| RB_151 | ABCG2-9 | TGGAGTTGCACTCTACCTCAā(SEQāID | TGAAAGCCCATGGATCAACCTā(SEQāID |
| NO:ā321) | NO:ā322) | ||
| RB_152 | ABCG2-10 | CGGGGAAGCCATTGGTGTTTā(SEQāID | AGTTGTGCCTGTCTTCCCATā(SEQāID |
| NO:ā209) | NO:ā210) | ||
| RB_153 | ABCG2-11 | AGGCCACGTGATTCTTCCACā(SEQāID | AGGCTCCTTTAAGGAACAGTGGā(SEQ |
| NO:ā95) | IDāNO:ā96) | ||
| RB_154 | ABCG2-12 | CATTCGCGCACAACTCACTTā(SEQāID | TGTTTACCTTGCCCTGCTCCā(SEQāID |
| NO:ā323) | NO:ā324) | ||
| RB_155 | ABCG2-13 | AGCTTGGGAATGCAGTCACAā(SEQāID | TGGTAGGGACTTGAAGAGGGTā(SEQāID |
| NO:ā97) | NO:ā98) | ||
| RB_156 | ABCG2-14 | GCAAACACAGTTCAGACTCACCā(SEQ | TCCCAAACATACGGTGACCTā(SEQāID |
| IDāNO:ā211) | NO:ā212) | ||
| RB_157 | ABCG2-15 | CTCTGACCTGCTGCTATGGCā(SEQāID | ACAACATTGGAGACCGAGGGā(SEQāID |
| NO:ā99) | NO:ā100) | ||
| RB_158 | ABCG2-16 | GGTGCAACTGACTTCACCCAā(SEQāID | AACAGACAAGTCTAGCCTGCCā(SEQāID |
| NO:ā213) | NO:ā214) | ||
| RB_159 | ABCG2-17 | GAGCTATAGAGGCCTGGGGAā(SEQāID | ATCCACTGATTGCAAAGCCACā(SEQāID |
| NO:ā325) | NO:ā326) | ||
| RB_160 | ABCG2-18 | AGCCACCACATTGCTAAACTā(SEQāID | TAGCCTTACCTCCCTCACCCā(SEQāID |
| NO:ā101) | NO:ā102) | ||
| RB_161 | ABCG2-19 | AGTATCCCAAGGCCTCCTGAā(SEQāID | CAAAGTCAGGCTGAACTAGAGCā(SEQ |
| NO:ā215) | IDāNO:ā216) | ||
| RB_162 | ABCG2-20 | TCAGGAGCAAAAGGACAGCAā(SEQāID | TCTTACAGGACTGGCACACGā(SEQāID |
| NO:ā327) | NO:ā328) | ||
| RB_163 | ABCG2-21 | ACCTTGGAGTCTGCCACTTTā(SEQāID | AAGGATGATGTTGTGATGGGCAā(SEQāID |
| NO:ā217) | NO:ā218) | ||
| RB_164 | ABCG2-22 | GTTGTTGCAAGCCGAAGAGCā(SEQāID | CAGGCTTTGCAGACATCTATGGā(SEQāID |
| NO:ā329) | NO:ā330) | ||
| RB_165 | ABCG2-23 | TCAGCCAAAGCACTTACCCAā(SEQāID | TATAGCATGTGTTGGAGGGAAAā(SEQāID |
| NO:ā219) | NO:ā220) | ||
| RB_166 | ABCG2-24 | AGAACCAGACCTGACATGCGā(SEQāID | CATGAAACCTGGTCTCAACGCā(SEQāID |
| NO:ā331) | NO:ā332) | ||
| RB_167 | ABCG2-25 | GCCAGTTTCTTGGAAATAGCCAā(SEQ | GGAAACACCAATGGCTTCCCā(SEQāID |
| IDāNO:ā103) | NO:ā104) | ||
| RB_168 | ABCG2-26 | CGGGGAAGCCATTGGTGTTTā(SEQāID | AGTTGTGCCTGTCTTCCCATā(SEQāID |
| NO:ā333) | NO:ā334) | ||
The present disclosure further provides a kit for simultaneously detecting genotyping of 17 RBC blood group systems, including the primer set, and a PCR reaction solution and a quality control.
In the present disclosure, the first primer set, the second primer set, and the third primer set in the primer set are packaged independently. The PCR reaction solution is preferably PCR Buffer, high-fidelity DNA polymerase, and nuclease-free water. In the examples, enzyme mixtures Pxp-1st-mix and Pxp-2nd-mix that mix the PCR Buffer with the high-fidelity DNA polymerase are selected, and the enzyme mixtures Pxp-1st-mix and Pxp-2nd-mix each preferably include commercial ingredients, such as main components in the enzyme mixture: high-fidelity enzyme and 5ĆHF PCR Buffer: Thermo Fisher scientific's āPhusion Hot Start II DNA Polymerase (2 U/μL)ā, F565L; dNTP (dATP, dTTP, dCTP, dGTP): Sangon (BBI) A620046, A670046, A640046, 660046.
In the present disclosure, the quality control is preferably a human normal genomic DNA.
The present disclosure further provides a method for detecting genotyping of 17 RBC blood group systems, including the following steps as shown in FIG. 1: (1) subjecting three capture and amplification systems to first amplification separately to obtain three first amplification products, where the three capture and amplification systems are prepared by using a nucleic acid extracted from a sample as a template and a first primer set, a second primer set, and a third primer set, respectively;
(2) purifying the three first amplification products separately, and subjecting three resulting purified first amplification products to second amplification with a sequencing universal adapter carrying an index separately to obtain three second amplification products; and
(3) purifying and mixing the three second amplification products to allow sequencing to obtain the genotyping of the RBC blood group systems.
In the present disclosure, three capture and amplification systems are subjected to first amplification separately to obtain three first amplification products, where the three capture and amplification systems are prepared by using a nucleic acid extracted from a sample as a template and a first primer set, a second primer set, and a third primer set, respectively. Preferably, the sample is extracted using magnetic beads, the concentration and purity are measured, and the nucleic acid is quantitatively diluted. Since nano-scale superparamagnetic carboxyl magnetic beads can reversibly adsorb nucleic acid molecules under different salt concentrations and hydrophobic environments, the nucleic acid molecules can be specifically adsorbed based on this. High-purity nucleic acid samples can be obtained through subsequent washing and elution. Concentration and purity are measured using Qubit or NanoDrop. According to a measured nucleic acid sample concentration, the nucleic acid sample is diluted to 50-250 ng/μL with 10 mM Tris-HCl, preferably 100-200 ng/μL serves as a starting concentration for amplification and library construction.
In the examples of the present disclosure, a quality of the diluted nucleic acid is preferably further evaluated by 1.5% agarose gel electrophoresis at 150 V for 30 min. The quality of the extracted nucleic acid is determined based on the uniformity and integrity of the agarose gel electrophoresis results. High integrity or slight degradation of the nucleic acid does not affect the library construction. The extracted nucleic acids are grouped and labeled separately after passing the concentration measurement, purity measurement, and agarose gel electrophoresis test. The sample is selected from the group consisting of a whole blood sample, a plasma sample, and a paraffin tissue sample. Nucleic acids are extracted from the above samples and diluted to the starting concentration for amplification and library construction. 3 tubes of capture and amplification system are constructed according to the grouping of the pools, where a primer pair of each pool is regarded as 1 tube. The three capture and amplification systems each have a volume of 25 L, and include preferably 1 μL of a mixture of the first primer set or the second primer set or the third primer set, 3 μL of an enzyme mixture Pxp-1st-mix, 1 μL of the template, and nuclease-free water as a balance. In the mixture of each pool primer set, 26 μL of Tris-HCl and 124 μL of primer set are preferably used to form a pool 1 primer with a total volume of 150 μL and a final concentration of 200 nM; except that the primers GATA1_001, KLF1_004, KLF1_008, and LU_004 are all 2 μL, and the primer Rh_020 is 5 μL, the other primers are all 1 μL. 32 μL of Tris-HCl and 168 μL of primer set are used to form a pool 2 primer with a total volume of 200 μL and a final concentration of 150 nM; except that the primer A4GALT_007 is 6 μL, the primers ABCG2_019, ABCG2_023, FUT_007, KLF1_005, KLF1_007, LU_001, LU_005, LU_008, MNS_002, and Rh_018 are 2 μL, the primer YT_002 is 3 μL, and the primer Rh_010 is 11 μL, the other primers are all 1 μL. 8 μL of Tris-HCl and 142 μL of primer set are used to form a pool 3 primer with a total volume of 150 μL and a final concentration of 200 nM; except that the primers A4GALT_005, ABCG2_006, ABCG2_024, KLF1_003, KLF1_006, LU_007, MNS_001, Rh_011, Rh_013, and SLC35C1_003 are 2 μL, the primer Rh_021 is 5 μL, the other primers are all 1 μL. When constructing each pool primer solution, each primer in each pool primer set has a concentration of 30 μM.
In the present disclosure, the three capture and amplification systems are preferably subjected to first amplification to obtain three first amplification products (pre-library products). Preferably, a PCR reaction program of the first amplification includes: initial denaturation at 98° C. for 20 min; 9 cycles of denaturation at 98° C. for 15 s, annealing at 62° C. for 20 min, extension at 68° C. for 60 s, and extension at 72° C. for 60 s; extension at 72° C. for 5 min; and heat preservation at 10° C.
In the present disclosure, the three first amplification products are purified separately, and three resulting purified pre-library products are subjected to second amplification with a sequencing universal adapter carrying an index separately to obtain three second amplification products (library construction products). The purification preferably includes purifying the PCR amplification products (pre-library products) of each sample using purification magnetic beads, removing the remaining primers, gDNA, and dNTPs in the PCR products and recovering the amplification products.
In the present disclosure, after the purification is completed, sequencing universal adapters (N5XX and A7XX) carrying an index are used to further PCR-amplify the purified products. A reaction system of the PCR amplification is calculated as 12.5 μL, and preferably includes: enzyme mixture Pxp-2nd-mix 6.5 μL; pre-library product 4 μL; universal adapter N5XX 1 μL, universal adapter A7XX 1 μL, with a total volume of 12.5 μL. The same sample includes 3 pre-library products, which are added to 3 tubes of PCR master mix containing the same universal adapter. The PCR reaction program is preferably: initial denaturation at 98° C. for 2 min; 23 cycles of denaturation at 98° C. for 15 s, extension at 68° C. for 60 s, and extension at 72° C. for 60 s; extension at 72° C. for 10 min; and heat preservation at 4° C.
In the present disclosure, after the PCR products are obtained, the library construction products of each sample are preferably separately purified using purification magnetic beads. The remaining primers and dNTPs are removed from the PCR product and the amplification products are recovered; the concentration and purity are measured, and the sample quality is tested by 1.5% agarose gel electrophoresis. After passing the test, the sample is diluted and mixed at equal concentrations, and then sequenced uniformly. The RBC blood group is determined based on sequencing results (Table 3). The mixed sample refers to mixing the products of the same sample amplified and purified in the first step using three sets of primers, and the purified products amplified in the second step using adapters carrying the same index. The sample mixing requirements: different samples are amplified in the second step using adapters carrying different indexes; 3 pools of the same sample are amplified in the second step using adapters with the same index.
| TABLE 3 |
| Polymorphisms of each gene |
| Nucleotide | Initiation | Termination | Nucleotide | Initiation | Termination | ||
| Gene | change | site | site | Gene | change | site | site |
| RHD | c.1G | 25272548 | 25272548 | GYPB | 270 + 5T | 143997545 | 143997545 |
| RHD | c.3A | 25272550 | 25272550 | GYPB | 270 + 5A | 143997545 | 143997545 |
| RHD | c.8G | 25272555 | 25272555 | GYPB | c.251G | 143997559 | 143997559 |
| RHD | c.17T | 25272564 | 25272564 | GYPB | c.236G | 143997574 | 143997574 |
| RHD | c.19T | 25272566 | 25272566 | GYPB | c.230T | 143997580 | 143997580 |
| RHD | c.26A | 25272573 | 25272573 | GYPB | c.208T | 143997602 | 143997602 |
| RHD | c.28T | 25272575 | 25272575 | GYPB | c.173C | 143999413 | 143999413 |
| RHD | c.29A | 25272576 | 25272576 | GYPB | c.173G | 143999413 | 143999413 |
| RHD | c.29C | 25272576 | 25272576 | GYPB | c.161G | 143999425 | 143999425 |
| RHD | c.41G | 25272588 | 25272588 | GYPB | c.161A | 143999425 | 143999425 |
| RHD | c.41T | 25272588 | 25272588 | GYPB | c.143T | 143999443 | 143999443 |
| RHD | c.48C | 25272595 | 25272595 | GYPB | c.143C | 143999443 | 143999443 |
| RHD | c.52G | 25272599 | 25272599 | GYPB | c.72G | 144001249 | 144001249 |
| RHD | c.53C | 25272600 | 25272600 | GYPB | c.72T | 144001249 | 144001249 |
| RHD | c.62C | 25272609 | 25272609 | GYPB | c.71A | 144001250 | 144001250 |
| RHD | c.65A | 25272612 | 25272612 | GYPB | c.71G | 144001250 | 144001250 |
| RHD | c.67C | 25272614 | 25272614 | GYPB | c.67A | 144001254 | 144001254 |
| RHD | c.67T | 25272614 | 25272614 | GYPB | c.67T | 144001254 | 144001254 |
| RHD | c.68A | 25272615 | 25272615 | GYPB | c.65C | 144001256 | 144001256 |
| RHD | c.73T | 25272620 | 25272620 | GYPB | c.65G | 144001256 | 144001256 |
| RHD | c.91A | 25272638 | 25272638 | GYPB | c.60A | 144001261 | 144001261 |
| RHD | c.92C | 25272639 | 25272639 | GYPB | c.60G | 144001261 | 144001261 |
| RHD | c.93_94insT | 25272640 | 25272641 | GYPB | c.59T | 144001262 | 144001262 |
| RHD | c.120A | 25272667 | 25272667 | GYPB | c.59G | 144001262 | 144001262 |
| RHD | c.130_ | 25272677 | 25272679 | FUT3 | c.1067A | 5843773 | 5843773 |
| 132delCTC | FUT3 | c.1060G | 5843780 | 5843780 | |||
| RHD | c.147del | 25272694 | 25272694 | FUT3 | c.1029G | 5843811 | 5843811 |
| RHD | 148 + 1a | 25272696 | 25272696 | FUT3 | c.980A | 5843860 | 5843860 |
| RHD | 148 + 5c | 25272700 | 25272700 | FUT3 | c.975A | 5843865 | 5843865 |
| RHD | c.150C | 25284574 | 25284574 | FUT3 | c.974T | 5843866 | 5843866 |
| RHD | c.157T | 25284581 | 25284581 | FUT3 | c.968C | 5843872 | 5843872 |
| RHD | c.161C | 25284585 | 25284585 | FUT3 | c.962A | 5843878 | 5843878 |
| RHD | c.163C | 25284587 | 25284587 | FUT3 | c.882T | 5843958 | 5843958 |
| RHD | c.173T | 25284597 | 25284597 | FUT3 | c.858G | 5843982 | 5843982 |
| RHD | c.176A | 25284600 | 25284600 | FUT3 | c.808G | 5844032 | 5844032 |
| RHD | c.178C | 25284602 | 25284602 | FUT3 | c.808A | 5844032 | 5844032 |
| RHD | c.182C | 25284606 | 25284606 | FUT3 | c.760A | 5844080 | 5844080 |
| RHD | c.182T | 25284606 | 25284606 | FUT3 | c.735C | 5844105 | 5844105 |
| RHD | c.186G | 25284610 | 25284610 | FUT3 | c.732T | 5844108 | 5844108 |
| RHD | c.186T | 25284610 | 25284610 | FUT3 | c.667A | 5844173 | 5844173 |
| RHD | c.200G | 25284624 | 25284624 | FUT3 | c.655A | 5844185 | 5844185 |
| RHD | c.201A | 25284625 | 25284625 | FUT3 | c.612G | 5844228 | 5844228 |
| RHD | c.203A | 25284627 | 25284627 | FUT3 | c.571A | 5844269 | 5844269 |
| RHD | c.203C | 25284627 | 25284627 | FUT3 | c.560T | 5844280 | 5844280 |
| RHD | c.208T | 25284632 | 25284632 | FUT3 | c.548T | 5844292 | 5844292 |
| RHD | c.209A | 25284633 | 25284633 | FUT3 | c.522A | 5844318 | 5844318 |
| RHD | c.220G | 25284644 | 25284644 | FUT3 | c.508A | 5844332 | 5844332 |
| RHD | c.223T | 25284647 | 25284647 | FUT3 | c.484G | 5844356 | 5844356 |
| RHD | c.227A | 25284651 | 25284651 | FUT3 | c.484A | 5844356 | 5844356 |
| RHD | c.242C | 25284666 | 25284666 | FUT3 | c.478T | 5844362 | 5844362 |
| RHD | c.251C | 25284675 | 25284675 | FUT3 | c.451G | 5844389 | 5844389 |
| RHD | c.254G | 25284678 | 25284678 | FUT3 | c.370G | 5844470 | 5844470 |
| RHD | c.254T | 25284678 | 25284678 | FUT3 | c.314T | 5844526 | 5844526 |
| RHD | c.260A | 25284684 | 25284684 | FUT3 | c.304A | 5844536 | 5844536 |
| RHD | c.287A | 25284711 | 25284711 | FUT3 | c.258T | 5844582 | 5844582 |
| RHD | c.301A | 25284725 | 25284725 | FUT3 | c.202C | 5844638 | 5844638 |
| RHD | c.307C | 25284731 | 25284731 | FUT3 | c.179G | 5844661 | 5844661 |
| RHD | c.329C | 25284753 | 25284753 | FUT3 | c.179A | 5844661 | 5844661 |
| RHD | c.329T | 25284753 | 25284753 | FUT3 | c.104A | 5844736 | 5844736 |
| RHD | 336 ā 2del | 25290639 | 25290639 | FUT3 | c.61T | 5844779 | 5844779 |
| RHD | c.340G | 25290645 | 25290645 | FUT3 | c.59G | 5844781 | 5844781 |
| RHD | c.340T | 25290645 | 25290645 | FUT3 | c.55A | 5844785 | 5844785 |
| RHD | c.341A | 25290646 | 25290646 | FUT3 | c.47C | 5844793 | 5844793 |
| RHD | c.346A | 25290651 | 25290651 | FUT3 | c.41A | 5844799 | 5844799 |
| RHD | c.346C | 25290651 | 25290651 | FUT3 | c.13G | 5844827 | 5844827 |
| RHD | c.347T | 25290652 | 25290652 | FUT3 | c.13A | 5844827 | 5844827 |
| RHD | c.359A | 25290664 | 25290664 | FUT6 | c.1002C | 5831566 | 5831566 |
| RHD | c.365T | 25290670 | 25290670 | FUT6 | c.1002G | 5831566 | 5831566 |
| RHD | c.374A | 25290679 | 25290679 | FUT6 | c.977G | 5831591 | 5831591 |
| RHD | c.376C | 25290681 | 25290681 | FUT6 | c.977A | 5831591 | 5831591 |
| RHD | c.379T | 25290684 | 25290684 | FUT6 | c.971C | 5831597 | 5831597 |
| RHD | c.394A | 25290699 | 25290699 | FUT6 | c.971T | 5831597 | 5831597 |
| RHD | c.395A | 25290700 | 25290700 | FUT6 | c.945C | 5831623 | 5831623 |
| RHD | c.399T | 25290704 | 25290704 | FUT6 | c.945A | 5831623 | 5831623 |
| RHD | c.410A | 25290715 | 25290715 | FUT6 | c.907C | 5831661 | 5831661 |
| RHD | c.410C | 25290715 | 25290715 | FUT6 | c.907G | 5831661 | 5831661 |
| RHD | c.410T | 25290715 | 25290715 | FUT6 | c.879C | 5831689 | 5831689 |
| RHD | c.413G | 25290718 | 25290718 | FUT6 | c.879T | 5831689 | 5831689 |
| RHD | c.446A | 25290751 | 25290751 | FUT6 | c.855G | 5831713 | 5831713 |
| RHD | c.455A | 25290760 | 25290760 | FUT6 | c.855A | 5831713 | 5831713 |
| RHD | c.455C | 25290760 | 25290760 | FUT6 | c.739G | 5831829 | 5831829 |
| RHD | c.458C | 25290763 | 25290763 | FUT6 | c.739A | 5831829 | 5831829 |
| RHD | c.485G | 25290790 | 25290790 | FUT6 | c.738C | 5831830 | 5831830 |
| RHD | 486 + 1a | 25290792 | 25290792 | FUT6 | c.738T | 5831830 | 5831830 |
| RHD | 486 + 2a | 25290793 | 25290793 | FUT6 | c.730C | 5831838 | 5831838 |
| RHD | c.490A | 25300949 | 25300949 | FUT6 | c.730G | 5831838 | 5831838 |
| RHD | c.492A | 25300951 | 25300951 | FUT6 | c.729T | 5831839 | 5831839 |
| RHD | c.494G | 25300953 | 25300953 | FUT6 | c.729C | 5831839 | 5831839 |
| RHD | c.497C | 25300956 | 25300956 | FUT6 | c.527G | 5832041 | 5832041 |
| RHD | c.505C | 25300964 | 25300964 | FUT6 | c.527T | 5832041 | 5832041 |
| RHD | c.509C | 25300968 | 25300968 | FUT6 | c.499_501insC | 5832067 | 5832069 |
| RHD | c.509G | 25300968 | 25300968 | FUT6 | c.376C | 5832192 | 5832192 |
| RHD | c.510A | 25300969 | 25300969 | FUT6 | c.376T | 5832192 | 5832192 |
| RHD | c.510T | 25300969 | 25300969 | FUT6 | c.370C | 5832198 | 5832198 |
| RHD | c.513A | 25300972 | 25300972 | FUT6 | c.370T | 5832198 | 5832198 |
| RHD | c.514T | 25300973 | 25300973 | FUT6 | c.336C | 5832232 | 5832232 |
| RHD | c.520A | 25300979 | 25300979 | FUT6 | c.336A | 5832232 | 5832232 |
| RHD | c.525A | 25300984 | 25300984 | FUT6 | c.172G | 5832396 | 5832396 |
| RHD | c.535C | 25300994 | 25300994 | FUT6 | c.172A | 5832396 | 5832396 |
| RHD | c.539A | 25300998 | 25300998 | FUT6 | c.63G | 5832505 | 5832505 |
| RHD | c.539C | 25300998 | 25300998 | FUT6 | c.63A | 5832505 | 5832505 |
| RHD | c.542C | 25301001 | 25301001 | FUT6 | c.18G | 5832550 | 5832550 |
| RHD | c.544A | 25301003 | 25301003 | FUT6 | c.18A | 5832550 | 5832550 |
| RHD | c.560C | 25301019 | 25301019 | FUT7 | c.329G | 137031410 | 137031410 |
| RHD | c.579C | 25301038 | 25301038 | FUT7 | c.329A | 137031410 | 137031410 |
| RHD | c.594T | 25301053 | 25301053 | KEL | c.2107A | 142941344 | 142941344 |
| RHD | c.602G | 25301061 | 25301061 | KEL | c.2030G | 142942441 | 142942441 |
| RHD | c.605T | 25301064 | 2530106 | KEL | c.2027A | 142942444 | 142942444 |
| RHD | c.607G | 25301066 | 25301066 | KEL | c.2024G | 142942447 | 142942447 |
| RHD | c.611C | 25301070 | 25301070 | KEL | c.2024A | 142942447 | 142942447 |
| RHD | c.621C | 25301080 | 25301080 | KEL | c.2023T | 142942448 | 142942448 |
| RHD | c.634A | 25301093 | 25301093 | KEL | c.1975del | 142942496 | 142942496 |
| RHD | c.634C | 25301093 | 25301093 | KEL | c.1947G | 142942524 | 142942524 |
| RHD | c.634T | 25301093 | 25301093 | KEL | c.1868G | 142942948 | 142942948 |
| RHD | 634 + 5t | 25301098 | 25301098 | KEL | c.1868A | 142942948 | 142942948 |
| RHD | 635 ā 2c | 25301518 | 25301518 | KEL | c.1790C | 142943026 | 142943026 |
| RHD | 635 ā 2g | 25301518 | 25301518 | KEL | c.1790T | 142943026 | 142943026 |
| RHD | c.635A | 25301520 | 25301520 | KEL | c.1763G | 142943284 | 142943284 |
| RHD | c.640T | 25301525 | 25301525 | KEL | c.1757G | 142943290 | 142943290 |
| RHD | c.658C | 25301543 | 25301543 | KEL | c.1719T | 142943328 | 142943328 |
| RHD | c.661A | 25301546 | 25301546 | KEL | c.1678G | 142943511 | 142943511 |
| RHD | c.661T | 25301546 | 25301546 | KEL | c.1664A | 142943525 | 142943525 |
| RHD | c.667G | 25301552 | 25301552 | KEL | c.1643A | 142943546 | 142943546 |
| RHD | c.668C | 25301553 | 25301553 | KEL | c.1643G | 142943546 | 142943546 |
| RHD | c.671G | 25301556 | 25301556 | KEL | c.1596A | 142943593 | 142943593 |
| RHD | c.674T | 25301559 | 25301559 | KEL | c.1546T | 142943829 | 142943829 |
| RHD | c.676C | 25301561 | 25301561 | KEL | c.1490T | 142944324 | 142944324 |
| RHD | c.677A | 25301562 | 25301562 | KEL | c.1481T | 142944333 | 142944333 |
| RHD | c.680C | 25301565 | 25301565 | KEL | c.1481A | 142944333 | 142944333 |
| RHD | c.684_686del | 25301569 | 25301571 | KEL | c.1477T | 142944337 | 142944337 |
| RHD | c.686A | 25301571 | 25301571 | KEL | c.1475G | 142944339 | 142944339 |
| RHD | c.689T | 25301574 | 25301574 | KEL | c.1475A | 142944339 | 142944339 |
| RHD | c.697A | 25301582 | 25301582 | KEL | c.1420T | 142944394 | 142944394 |
| RHD | c.697C | 25301582 | 25301582 | KEL | c.1391C | 142944665 | 142944665 |
| RHD | c.700T | 25301585 | 25301585 | KEL | c.1391T | 142944665 | 142944665 |
| RHD | c.704C | 25301589 | 25301589 | KEL | c.1377A | 142944679 | 142944679 |
| RHD | c.705_707del | 25301590 | 25301592 | KEL | c.1298T | 142946223 | 142946223 |
| RHD | c.712A | 25301597 | 25301597 | KEL | c.1283G | 142946238 | 142946238 |
| RHD | c.722T | 25301607 | 25301607 | KEL | c.1283T | 142946238 | 142946238 |
| RHD | c.727A | 25301612 | 25301612 | KEL | c.1271C | 142946250 | 142946250 |
| RHD | c.728G | 25301613 | 25301613 | KEL | c.1271T | 142946250 | 142946250 |
| RHD | c.730C | 25301615 | 25301615 | KEL | c.1268T | 142946253 | 142946253 |
| RHD | c.731T | 25301616 | 25301616 | KEL | c.1217G | 142946304 | 142946304 |
| RHD | c.733C | 25301618 | 25301618 | KEL | c.1217A | 142946304 | 142946304 |
| RHD | c.739C | 25301624 | 25301624 | KEL | c.1216T | 142946305 | 142946305 |
| RHD | c.740G | 25301625 | 25301625 | KEL | c.1145G | 142952567 | 142952567 |
| RHD | c.744T | 25301629 | 25301629 | KEL | c.1145A | 142952567 | 142952567 |
| RHD | c.751C | 25301636 | 25301636 | KEL | c.1088A | 142952624 | 142952624 |
| RHD | c.758A | 25301643 | 25301643 | KEL | c.1042T | 142953839 | 142953839 |
| RHD | c.766C | 25301651 | 25301651 | KEL | c.986T | 142953895 | 142953895 |
| RHD | c.770T | 25301655 | 25301655 | KEL | c.986C | 142953895 | 142953895 |
| RHD | c.780A | 25301665 | 25301665 | KEL | c.965C | 142953916 | 142953916 |
| RHD | c.785del | 25301670 | 25301670 | KEL | c.965T | 142953916 | 142953916 |
| RHD | c.787A | 25301672 | 25301672 | KEL | c.948A | 142953933 | 142953933 |
| RHD | c.809A | 25303329 | 25303329 | KEL | 924 + 1a | 142954184 | 142954184 |
| RHD | c.809G | 25303329 | 25303329 | KEL | 924 + 1t | 142954184 | 142954184 |
| RHD | c.818A | 25303338 | 25303338 | KEL | c.913G | 142954195 | 142954195 |
| RHD | c.818T | 25303338 | 25303338 | KEL | c.913A | 142954195 | 142954195 |
| RHD | c.819A | 25303339 | 25303339 | KEL | c.905T | 142954203 | 142954203 |
| RHD | c.826C | 25303346 | 25303346 | KEL | c.905C | 142954203 | 142954203 |
| RHD | c.830A | 25303350 | 25303350 | KEL | c.903del | 142954205 | 142954205 |
| RHD | c.833A | 25303353 | 25303353 | KEL | c.877C | 142954231 | 142954231 |
| RHD | c.835A | 25303355 | 25303355 | KEL | c.877T | 142954231 | 142954231 |
| RHD | c.838A | 25303358 | 25303358 | KEL | c.875A | 142954233 | 142954233 |
| RHD | c.842G | 25303362 | 25303362 | KEL | c.875G | 142954233 | 142954233 |
| RHD | c.845A | 25303365 | 25303365 | KEL | c.842A | 142954266 | 142954266 |
| RHD | c.848T | 25303368 | 25303368 | KEL | c.841T | 142954267 | 142954267 |
| RHD | c.851T | 25303371 | 25303371 | KEL | c.841C | 142954267 | 142954267 |
| RHD | c.854A | 25303374 | 25303374 | KEL | c.787A | 142954321 | 142954321 |
| RHD | c.871T | 25303391 | 25303391 | KEL | c.780G | 142954328 | 142954328 |
| RHD | c.872G | 25303392 | 25303392 | KEL | c.780T | 142954328 | 142954328 |
| RHD | c.874C | 25303394 | 25303394 | KEL | c.758A | 142954350 | 142954350 |
| RHD | c.880C | 25303400 | 25303400 | KEL | c.758G | 142954350 | 142954350 |
| RHD | c.881T | 25303401 | 25303401 | KEL | c.745G | 142954363 | 142954363 |
| RHD | c.884A | 25303404 | 25303404 | KEL | c.745A | 142954363 | 142954363 |
| RHD | c.884C | 25303404 | 25303404 | KEL | c.743A | 142954365 | 142954365 |
| RHD | c.885T | 25303405 | 25303405 | KEL | c.743G | 142954365 | 142954365 |
| RHD | c.895G | 25303415 | 25303415 | KEL | c.742C | 142954366 | 142954366 |
| RHD | c.916A | 25303436 | 25303436 | KEL | c.742T | 142954366 | 142954366 |
| RHD | c.919A | 25303439 | 25303439 | KEL | 736 ā 1c | 142954371 | 142954371 |
| RHD | c.922T | 25303442 | 25303442 | KEL | c.730del | 142954470 | 142954470 |
| RHD | c.932G | 25303452 | 25303452 | KEL | c.715T | 142954485 | 142954485 |
| RHD | c.938T | 25303458 | 25303458 | KEL | c.578T | 142957921 | 142957921 |
| RHD | c.953A | 25306609 | 25306609 | KEL | c.578C | 142957921 | 142957921 |
| RHD | c.957A | 25306613 | 25306613 | KEL | c.578G | 142957921 | 142957921 |
| RHD | c.968T | 25306624 | 25306624 | KEL | c.574T | 142957925 | 142957925 |
| RHD | c.983A | 25306639 | 25306639 | KEL | c.539G | 142957960 | 142957960 |
| RHD | c.993delC | 25306649 | 25306649 | KEL | c.539A | 142957960 | 142957960 |
| RHD | c.993G | 25306649 | 25306649 | KEL | c.539C | 142957960 | 142957960 |
| RHD | c.998A | 25306654 | 25306654 | KEL | c.538T | 142957961 | 142957961 |
| RHD | c.1006C | 25306662 | 25306662 | KEL | 526 ā 2g | 142957975 | 142957975 |
| RHD | c.1012G | 25306668 | 25306668 | KEL | c.389G | 142960939 | 142960939 |
| RHD | c.1013C | 25306669 | 25306669 | KEL | c.389A | 142960939 | 142960939 |
| RHD | c.1015A | 25306671 | 25306671 | KEL | c.388C | 142960940 | 142960940 |
| RHD | c.1016A | 25306672 | 25306672 | KEL | c.388T | 142960940 | 142960940 |
| RHD | c.1018A | 25306674 | 25306674 | KEL | c.382T | 142960946 | 142960946 |
| RHD | c.1019T | 25306675 | 25306675 | KEL | c.306A | 142961022 | 142961022 |
| RHD | c.1025C | 25306681 | 25306681 | KEL | c.246A | 142961082 | 142961082 |
| RHD | c.1034A | 25306690 | 25306690 | KEL | c.230T | 142961098 | 142961098 |
| RHD | c.1048C | 25306704 | 25306704 | KEL | 223 + 1a | 142961359 | 142961359 |
| RHD | c.1048G | 25306704 | 25306704 | KEL | c.184_185insT | 142961398 | 142961399 |
| RHD | c.1057A | 25306713 | 25306713 | A4GALT | c.631G | 42693321 | 42693321 |
| RHD | c.1059G | 25306715 | 25306715 | A4GALT | c.631C | 42693321 | 42693321 |
| RHD | c.1060A | 25306716 | 25306716 | A4GALT | c.241_243del | 42693709 | 42693711 |
| RHD | c.1061A | 25306717 | 25306717 | A4GALT | c.903G | 42693049 | 42693049 |
| RHD | c.1063A | 25306719 | 25306719 | A4GALT | c.903C | 42693049 | 42693049 |
| RHD | c.1070A | 25306726 | 25306726 | A4GALT | c.287A | 42693665 | 42693665 |
| RHD | c.1073C | 25306729 | 25306729 | A4GALT | c.299T | 42693653 | 42693653 |
| RHD | c.1107C | 25317033 | 25317033 | A4GALT | c.301del | 42693651 | 42693651 |
| RHD | c.1121A | 25317047 | 25317047 | A4GALT | c.418_428delins | 42693524 | 42693534 |
| RHD | c.1132G | 25317058 | 25317058 | A4GALT | c.470_496delins | 42693456 | 42693482 |
| RHD | c.1136T | 25317062 | 25317062 | A4GALT | c.473A | 42693479 | 42693479 |
| RHD | c.1145C | 25317071 | 25317071 | A4GALT | c.504dupC | 42693447 | 42693449 |
| RHD | c.1148C | 25317074 | 25317074 | A4GALT | c.914T | 42693038 | 42693038 |
| RHD | c.1152C | 25317078 | 25317078 | A4GALT | c.548A | 42693404 | 42693404 |
| RHD | 1154 ā 8a | 25321881 | 25321881 | A4GALT | c.987G | 42692965 | 42692965 |
| RHD | c.1154C | 25321889 | 25321889 | A4GALT | c.987A | 42692965 | 42692965 |
| RHD | c.1168G | 25321903 | 25321903 | A4GALT | c.559C | 42693393 | 42693393 |
| RHD | c.1169C | 25321904 | 25321904 | A4GALT | c.560A | 42693392 | 42693392 |
| RHD | c.1170C | 25321905 | 25321905 | A4GALT | c.656T | 42693296 | 42693296 |
| RHD | c.1177C | 25321912 | 25321912 | A4GALT | c.657del | 42693295 | 42693295 |
| RHD | c.1184T | 25321919 | 25321919 | A4GALT | c.732dupG | 42693219 | 42693221 |
| RHD | c.1187G | 25321922 | 25321922 | A4GALT | c.751T | 42693201 | 42693201 |
| RHD | c.1193T | 25321928 | 25321928 | A4GALT | c.752T | 42693200 | 42693200 |
| RHD | c.1194C | 25321929 | 25321929 | A4GALT | c.796del | 42693156 | 42693156 |
| RHD | c.1195A | 25321930 | 25321930 | A4GALT | c.783A | 42693169 | 42693169 |
| RHD | c.1199C | 25321934 | 25321934 | A4GALT | c.972_997del | 42692955 | 42692980 |
| RHD | c.1199T | 25321934 | 25321934 | A4GALT | c.1029dupC | 42692922 | 42692924 |
| RHD | c.1200T | 25321935 | 25321935 | A4GALT | c.201dupC | 42693750 | 42693752 |
| RHD | c.1203A | 25321938 | 25321938 | A4GALT | c.418T | 42693534 | 42693534 |
| RHD | c.1207T | 25321942 | 25321942 | A4GALT | c.498A | 42693454 | 42693454 |
| RHD | c.1208T | 25321943 | 25321943 | A4GALT | c.68dupT | 42693883 | 42693885 |
| RHD | c.1210C | 25321945 | 25321945 | A4GALT | c.290T | 42693662 | 42693662 |
| RHD | c.1212A | 25321947 | 25321947 | A4GALT | c.902del | 42693050 | 42693050 |
| RHD | c.1213G | 25321948 | 25321948 | A4GALT | c.388dupA | 42693563 | 42693565 |
| RHD | c.1215C | 25321950 | 25321950 | A4GALT | c.367C | 42693585 | 42693585 |
| RHD | c.1219_1224del | 25321954 | 25321959 | A4GALT | c.547_548del | 42693404 | 42693405 |
| RHD | c.1221A | 25321956 | 25321956 | A4GALT | c.480_ | 42693457 | 42693472 |
| RHD | c.1222C | 25321957 | 25321957 | 495dupGGCCGTGCAGGGGCGC | |||
| RHD | c.1224C | 25321959 | 25321959 | A4GALT | Exon 1 Deletion | 42720797 | 42720870 |
| RHD | c.1226T | 25321961 | 25321961 | B3GALNT1 | c.376G | 161086379 | 161086379 |
| RHD | c.1227A | 25321962 | 25321962 | B3GALNT1 | c.376A | 161086379 | 161086379 |
| RHD | c.1228G | 25328898 | 25328898 | B3GALNT1 | c.202T | 161086553 | 161086553 |
| RHD | c.1229C | 25328899 | 25328899 | B3GALNT1 | c.292_293insA | 161086462 | 161086463 |
| RHD | c.1238G | 25328908 | 25328908 | B3GALNT1 | c.433T | 161086322 | 161086322 |
| RHD | c.1241T | 25328911 | 25328911 | B3GALNT1 | c.537_538insA | 161086217 | 161086218 |
| RHD | c.1248_ | 25328918 | 25328919 | B3GALNT1 | c.648C | 161086107 | 161086107 |
| 1249insG | B3GALNT1 | c.797C | 161085958 | 161085958 | |||
| RHD | c.1250C | 25328920 | 25328920 | B3GALNT1 | c.811A | 161085944 | 161085944 |
| RHD | c.1252_ | 25328922 | 25328923 | B3GALNT1 | c.959A | 161085796 | 161085796 |
| 1253insT | B3GALNT1 | c.203del | 161086552 | 161086552 | |||
| RHD | c.1252A | 25328922 | 25328922 | B3GALNT1 | c.456G | 161086299 | 161086299 |
| RHCE | c.1254C | 25362427 | 25362427 | B3GALNT1 | c.449G | 161086306 | 161086306 |
| RHCE | 1228 ā 2g | 25362455 | 25362455 | B3GALNT1 | c.598del | 161086157 | 161086157 |
| RHCE | c.1154C | 25362527 | 25362527 | LU | c.99_104del | 44811241 | 44811246 |
| RHCE | c.1132C | 25375370 | 25375370 | LU | c.123insGG | 44811265 | 44811267 |
| RHCE | c.1132G | 25375370 | 25375370 | LU | Exons 3 | 44812163 | 44812391 |
| RHCE | c.1130T | 25375372 | 25375372 | Deletion | |||
| RHCE | c.1118T | 25375384 | 25375384 | LU | c.212G | 44812170 | 44812170 |
| RHCE | 1074 ā 2g | 25375428 | 25375428 | LU | c.212A | 44812170 | 44812170 |
| RHCE | c.1044_ | 25385740 | 25385747 | LU | c.223C | 44812181 | 44812181 |
| 1050dupGCTTCAT | LU | c.223T | 44812181 | 44812181 | |||
| RHCE | c.1025T | 25385759 | 25385759 | LU | c.230A | 44812188 | 44812188 |
| RHCE | c.1007A | 25385777 | 25385777 | LU | c.230G | 44812188 | 44812188 |
| RHCE | c.1007T | 25385777 | 25385777 | LU | c.282C | 44812240 | 44812240 |
| RHCE | c.1006G | 25385778 | 25385778 | LU | c.282G | 44812240 | 44812240 |
| RHCE | c.1006T | 25385778 | 25385778 | LU | c.326G | 44812284 | 44812284 |
| RHCE | c.966_ | 25385816 | 25385818 | LU | c.326A | 44812284 | 44812284 |
| 968delinsC | LU | c.340G | 44812298 | 44812298 | |||
| RHCE | c.963del | 25385821 | 25385821 | LU | c.340A | 44812298 | 44812298 |
| RHCE | c.941C | 25385843 | 25385843 | LU | c.361T | 44812319 | 44812319 |
| RHCE | c.938delC | 25388977 | 25388977 | LU | c.419A | 44812377 | 44812377 |
| RHCE | c.919A | 25388996 | 25388996 | LU | Exons 4 | 44812478 | 44812548 |
| RHCE | c.916G | 25388999 | 25388999 | Deletion | |||
| RHCE | c.908A | 25389007 | 25389007 | LU | c.469G | 44812513 | 44812513 |
| RHCE | c.907del | 25389008 | 25389008 | LU | c.469A | 44812513 | 44812513 |
| RHCE | c.890C | 25389025 | 25389025 | LU | c.524G | 44813269 | 44813269 |
| RHCE | c.872T | 25389043 | 25389043 | LU | c.524A | 44813269 | 44813269 |
| RHCE | c.827A | 25389088 | 25389088 | LU | c.524T | 44813269 | 44813269 |
| RHCE | c.818C | 25389097 | 25389097 | LU | c.611T | 44813544 | 44813544 |
| RHCE | c.818T | 25389097 | 25389097 | LU | c.611A | 44813544 | 44813544 |
| RHCE | c.807A | 25389108 | 25389108 | LU | c.662C | 44813595 | 44813595 |
| RHCE | 801 + 1a | 25390748 | 25390748 | LU | c.662T | 44813595 | 44813595 |
| RHCE | c.800A | 25390750 | 25390750 | LU | c.679C | 44813612 | 44813612 |
| RHCE | c.787G | 25390763 | 25390763 | LU | c.679T | 44813612 | 44813612 |
| RHCE | c.774A | 25390776 | 25390776 | LU | c.691T | 44813624 | 44813624 |
| RHCE | c.748A | 25390802 | 25390802 | LU | c.711C | 44813644 | 44813644 |
| RHCE | c.744C | 25390806 | 25390806 | LU | c.711T | 44813644 | 44813644 |
| RHCE | c.744T | 25390806 | 25390806 | LU | c.711A | 44813644 | 44813644 |
| RHCE | c.734C | 25390816 | 25390816 | LU | c.714C | 44813647 | 44813647 |
| RHCE | c.733C | 25390817 | 25390817 | LU | c.714T | 44813647 | 44813647 |
| RHCE | c.733G | 25390817 | 25390817 | LU | c.824C | 44814191 | 44814191 |
| RHCE | c.730A | 25390820 | 25390820 | LU | c.824T | 44814191 | 44814191 |
| RHCE | c.728G | 25390822 | 25390822 | LU | c.905C | 44814272 | 44814272 |
| RHCE | c.722T | 25390828 | 25390828 | LU | c.905T | 44814272 | 44814272 |
| RHCE | c.712A | 25390838 | 25390838 | LU | c.1274A | 44818820 | 44818820 |
| RHCE | c.712G | 25390838 | 25390838 | LU | c.1274C | 44818820 | 44818820 |
| RHCE | c.697C | 25390853 | 25390853 | LU | c.1289C | 44818835 | 44818835 |
| RHCE | c.697G | 25390853 | 25390853 | LU | c.1289T | 44818835 | 44818835 |
| RHCE | c.695C | 25390855 | 25390855 | LU | c.1340C | 44819059 | 44819059 |
| RHCE | c.689C | 25390861 | 25390861 | LU | c.1340T | 44819059 | 44819059 |
| RHCE | c.685_687del | 25390863 | 25390865 | LU | c.1495C | 44819367 | 44819367 |
| RHCE | c.679_683del | 25390867 | 25390871 | LU | c.1495T | 44819367 | 44819367 |
| RHCE | c.676C | 25390874 | 25390874 | LU | c.1615A | 44819487 | 44819487 |
| RHCE | c.676del | 25390874 | 25390874 | LU | c.1615G | 44819487 | 44819487 |
| RHCE | c.676G | 25390874 | 25390874 | LU | c.1742A | 44819705 | 44819705 |
| RHCE | c.674G | 25390876 | 25390876 | LU | c.1742T | 44819705 | 44819705 |
| RHCE | c.667T | 25390883 | 25390883 | KLF1 | c.1071A | 12884903 | 12884903 |
| RHCE | c.662C | 25390888 | 25390888 | KLF1 | c.1048T | 12884926 | 12884926 |
| RHCE | c.662G | 25390888 | 25390888 | KLF1 | c.1045del | 12884929 | 12884929 |
| RHCE | c.659A | 25390891 | 25390891 | KLF1 | c.1040A | 12884934 | 12884934 |
| RHCE | c.649C | 25390901 | 25390901 | KLF1 | c.1022A | 12884952 | 12884952 |
| RHCE | 634 + 1t | 25391993 | 25391993 | KLF1 | c.1004C | 12884970 | 12884970 |
| RHCE | c.602C | 25392026 | 25392026 | KLF1 | c.1002del | 12884972 | 12884972 |
| RHCE | c.554A | 25392074 | 25392074 | KLF1 | c.1001T | 12884973 | 12884973 |
| RHCE | c.538C | 25392090 | 25392090 | KLF1 | c.994G | 12884980 | 12884980 |
| RHCE | c.527T | 25392101 | 25392101 | KLF1 | c.991G | 12884983 | 12884983 |
| RHCE | c.526A | 25392102 | 25392102 | KLF1 | c.991T | 12884983 | 12884983 |
| RHCE | c.520A | 25392108 | 25392108 | KLF1 | c.983T | 12884991 | 12884991 |
| RHCE | c.512G | 25392116 | 25392116 | KLF1 | c.983A | 12884991 | 12884991 |
| RHCE | c.506A | 25392122 | 25392122 | KLF1 | c.977G | 12884997 | 12884997 |
| RHCE | c.506C | 25392122 | 25392122 | KLF1 | c.973A | 12885001 | 12885001 |
| RHCE | c.501A | 25392127 | 25392127 | KLF1 | c.968G | 12885006 | 12885006 |
| RHCE | c.500A | 25392128 | 25392128 | KLF1 | c.954dupG | 12885019 | 12885021 |
| RHCE | c.500T | 25392128 | 25392128 | KLF1 | c.948del | 12885026 | 12885026 |
| RHCE | c.497T | 25392131 | 25392131 | KLF1 | c.947A | 12885027 | 12885027 |
| RHCE | c.494C | 25392134 | 25392134 | KLF1 | c.946A | 12885028 | 12885028 |
| RHCE | c.491G | 25392137 | 25392137 | KLF1 | c.939A | 12885035 | 12885035 |
| RHCE | 487 ā 5g | 25392146 | 25392146 | KLF1 | 914 ā 1c | 12885061 | 12885061 |
| RHCE | 486 + 5a | 25402591 | 25402591 | KLF1 | c.902ins T | 12885327 | 12885329 |
| RHCE | 486 + 1a | 25402595 | 25402595 | KLF1 | c.899C | 12885331 | 12885331 |
| RHCE | c.473A | 25402609 | 25402609 | KLF1 | c.895T | 12885335 | 12885335 |
| RHCE | c.464G | 25402618 | 25402618 | KLF1 | c.887C | 12885343 | 12885343 |
| RHCE | c.461C | 25402621 | 25402621 | KLF1 | c.874T | 12885356 | 12885356 |
| RHCE | 460G | 25402622 | 25402622 | KLF1 | c.868C | 12885362 | 12885362 |
| RHCE | c.455A | 25402627 | 25402627 | KLF1 | c.826G | 12885404 | 12885404 |
| RHCE | c.380T | 25402702 | 25402702 | KLF1 | c.826T | 12885404 | 12885404 |
| RHCE | c.377G | 25402705 | 25402705 | KLF1 | c.809A | 12885421 | 12885421 |
| RHCE | c.375G | 25402707 | 25402707 | KLF1 | c.802T | 12885428 | 12885428 |
| RHCE | c.374A | 25402708 | 25402708 | KLF1 | c.796T | 12885434 | 12885434 |
| RHCE | c.365C | 25402717 | 25402717 | KLF1 | c.663del | 12885567 | 12885567 |
| RHCE | c.365T | 25402717 | 25402717 | KLF1 | c.637T | 12885593 | 12885593 |
| RHCE | c.364C | 25402718 | 25402718 | KLF1 | c.621G | 12885609 | 12885609 |
| RHCE | c.361T | 25402721 | 25402721 | KLF1 | c.569del | 12885661 | 12885661 |
| RHCE | c.350_358del | 25402724 | 25402732 | KLF1 | c.551_ | 12885674 | 12885679 |
| RHCE | c.356A | 25402726 | 25402726 | 556delinsA | |||
| RHCE | c.344C | 25402738 | 25402738 | KLF1 | c.533A | 12885697 | 12885697 |
| RHCE | c.344G | 25402738 | 25402738 | KLF1 | c.519_525dupC | 12885699 | 12885716 |
| RHCE | c.341A | 25402741 | 25402741 | GGCGCC | |||
| RHCE | c.340C | 25402742 | 25402742 | KLF1 | c.519_520insC | 12885709 | 12885712 |
| RHCE | c.340T | 25402742 | 25402742 | KLF1 | c.519G | 12885711 | 12885711 |
| RHCE | 335 + 3t | 25408680 | 25408680 | KLF1 | c.517del | 12885713 | 12885713 |
| RHCE | c.308T | 25408710 | 25408710 | KLF1 | c.472del | 12885758 | 12885758 |
| RHCE | c.307C | 25408711 | 25408711 | KLF1 | c.384insC | 12885845 | 12885847 |
| RHCE | c.307T | 25408711 | 25408711 | KLF1 | c.380A | 12885850 | 12885850 |
| RHCE | c.286A | 25408732 | 25408732 | KLF1 | c.310_311insG | 12885918 | 12885920 |
| RHCE | c.286G | 25408732 | 25408732 | KLF1 | c.262_284dup | 12885924 | 12885990 |
| RHCE | c.254C | 25408764 | 25408764 | KLF1 | c.304C | 12885926 | 12885926 |
| RHCE | c.254G | 25408764 | 25408764 | KLF1 | c.298T | 12885932 | 12885932 |
| RHCE | c.221A | 25408797 | 25408797 | KLF1 | c.204del | 12886026 | 12886026 |
| RHCE | c.208T | 25408810 | 25408810 | KLF1 | c.196T | 12886034 | 12886034 |
| RHCE | c.203G | 25408815 | 25408815 | KLF1 | c.151del | 12886079 | 12886079 |
| RHCE | c.202G | 25408816 | 25408816 | KLF1 | c.114del | 12886116 | 12886116 |
| RHCE | c.201G | 25408817 | 25408817 | KLF1 | c.109T | 12886121 | 12886121 |
| RHCE | c.187C | 25408831 | 25408831 | KLF1 | c.90A | 12886140 | 12886140 |
| RHCE | c.178A | 25408840 | 25408840 | KLF1 | c.86G | 12887055 | 12887055 |
| RHCE | c.150T | 25408868 | 25408868 | KLF1 | promoter | 12887479 | 12887479 |
| RHCE | 149 ā 1a | 25408870 | 25408870 | GATA1 | c.1240C | 48794162 | 48794162 |
| RHCE | 148 + 5a | 25420634 | 25420634 | ACHE | c.1057C > A | 100893176 | 100893176 |
| RHCE | c.122A | 25420665 | 25420665 | ACHE | c.266G > A | 100893967 | 100893967 |
| RHCE | c.122G | 25420665 | 25420665 | ACHE | c.169G > A | 100894064 | 100894064 |
| RHCE | c.106A | 25420681 | 25420681 | ACHE | c.101G > A | 100894132 | 100894132 |
| RHCE | c.106G | 25420681 | 25420681 | ERMAP | c.169G > A | 42830851 | 42830851 |
| RHCE | c.105T | 25420682 | 25420682 | ERMAP | c.178C > G | 42830860 | 42830860 |
| RHCE | c.98C | 25420689 | 25420689 | ERMAP | c.139G > A | 42830821 | 42830821 |
| RHCE | c.93_94insT | 25420693 | 25420694 | ERMAP | c.242G > A | 42830924 | 42830924 |
| RHCE | c.94G | 25420693 | 25420693 | ERMAP | c.103G > A | 42830785 | 42830785 |
| RHCE | c.80_84del | 25420703 | 25420707 | ERMAP | c.307 308delGA | 42830989 | 42830990 |
| RHCE | c.84A | 25420703 | 25420703 | ERMAP | c.994C > T | 42829761 | 42829761 |
| RHCE | c.79_81del | 25420706 | 25420708 | ART4 | c.144 + 2T > C | 14842968 | 14842968 |
| RHCE | c.48C | 25420739 | 25420739 | ART4 | c.145 ā 2A > G | 14841155 | 14841155 |
| RHCE | c.48G | 25420739 | 25420739 | ART4 | c.185T > C | 14841113 | 14841113 |
| RHCE | c.28T | 25420759 | 25420759 | ART4 | c.268C > T | 14841030 | 14841030 |
| RHCE | 1 ā 10t | 25420796 | 25420796 | ART4 | c.323G > T | 14840975 | 14840975 |
| FUT1 | c.1047C | 48750235 | 48750235 | ART4 | c.343_350del | 14840948 | 14840955 |
| FUT1 | c.1047G | 48750235 | 48750235 | ART4 | c.350C > T | 14840948 | 14840948 |
| FUT1 | c.991A | 48750291 | 48750291 | ART4 | c.405C > A | 14840893 | 14840893 |
| FUT1 | c.990del | 48750292 | 48750292 | ART4 | c.431C > A | 14840867 | 14840867 |
| FUT1 | c.980A | 48750302 | 48750302 | ART4 | c.432C > A | 14840866 | 14840866 |
| FUT1 | c.980C | 48750302 | 48750302 | ART4 | c.442C > T | 14840856 | 14840856 |
| FUT1 | c.958A | 48750324 | 48750324 | ART4 | c.547T > G | 14840749 | 14840749 |
| FUT1 | c.948C | 48750334 | 48750334 | ART4 | c.566C > T | 14840732 | 14840732 |
| FUT1 | c.948G | 48750334 | 48750334 | ART4 | c.674T > A | 14843243 | 14843243 |
| FUT1 | c.944C | 48750338 | 48750338 | ART4 | c.793A > G | 14840505 | 14840505 |
| FUT1 | c.944T | 48750338 | 48750338 | ART4 | c.793A > G | 14840505 | 14840505 |
| FUT1 | c.917T | 48750365 | 48750365 | ART4 | c.793A > G | 14840505 | 14840505 |
| FUT1 | c.903_ | 48750379 | 48750380 | ART4 | c.793A > G | 14840505 | 14840505 |
| 904insAAC | ART4 | c.793A > G | 14840505 | 14840505 | |||
| FUT1 | c.896C | 48750386 | 48750386 | AQP1 | del all or part | 30911853 | 30912293 |
| FUT1 | c.881_882del | 48750400 | 48750401 | exon 1 | |||
| FUT1 | c.882T | 48750400 | 48750400 | AQP1 | c.112C > T | 30912021 | 30912021 |
| FUT1 | c.881T | 48750401 | 48750401 | AQP1 | c.113C > T | 30912022 | 30912022 |
| FUT1 | c.880T | 48750402 | 48750402 | AQP1 | c.134C > T | 30912043 | 30912043 |
| FUT1 | c.832A | 48750450 | 48750450 | AQP1 | c.140A > G | 30912049 | 30912049 |
| FUT1 | c.826C | 48750456 | 48750456 | AQP1 | c.232delG | 30912141 | 30912141 |
| FUT1 | c.826T | 48750456 | 48750456 | AQP1 | c.308_309insT | 30912217 | 30912218 |
| FUT1 | c.801C | 48750481 | 48750481 | AQP1 | c.576C > A | 30922590 | 30922590 |
| FUT1 | c.801T | 48750481 | 48750481 | AQP1 | c.601delG | 30922614 | 30922614 |
| FUT1 | c.786C | 48750496 | 48750496 | ICAM4 | c.299A > G | 10287311 | 10287311 |
| FUT1 | c.785A | 48750497 | 48750497 | ICAM4 | c.346_355del | 10287358 | 10287367 |
| FUT1 | c.785G | 48750497 | 48750497 | ABCG2 | c.2T > C | 88139994 | 88139994 |
| FUT1 | c.776A | 48750506 | 48750506 | ABCG2 | c.34G > A | 88139962 | 88139962 |
| FUT1 | c.776T | 48750506 | 48750506 | ABCG2 | c.34G > A | 88139962 | 88139962 |
| FUT1 | c.768del | 48750514 | 48750514 | ABCG2 | c.34G > A | 88139962 | 88139962 |
| FUT1 | c.748T | 48750534 | 48750534 | ABCG2 | 187_197delATATTATCGAA | 88139799 | 88139809 |
| FUT1 | c.725G | 48750557 | 48750557 | ABCG2 | c.244_245insC | 88132594 | 88132595 |
| FUT1 | c.725T | 48750557 | 48750557 | ABCG2 | c.263 + 1G > A | 88132575 | 88132575 |
| FUT1 | c.721C | 48750561 | 48750561 | ABCG2 | c.289A > T | 88131892 | 88131892 |
| FUT1 | c.695A | 48750587 | 48750587 | ABCG2 | c.337C > T | 88131844 | 88131844 |
| FUT1 | c.695G | 48750587 | 48750587 | ABCG2 | c.376C > T | 88131805 | 88131805 |
| FUT1 | c.694C | 48750588 | 48750588 | ABCG2 | c.420_421insA | 88131171 | 88131172 |
| FUT1 | c.694T | 48750588 | 48750588 | ABCG2 | c.421C > A | 88131171 | 88131171 |
| FUT1 | c.689C | 48750593 | 48750593 | ABCG2 | c.421C > A | 88131171 | 88131171 |
| FUT1 | c.684A | 48750598 | 48750598 | ABCG2 | c.421C > A | 88131171 | 88131171 |
| FUT1 | c.684G | 48750598 | 48750598 | ABCG2 | c.421C > A | 88131171 | 88131171 |
| FUT1 | c.682G | 48750600 | 48750600 | ABCG2 | c.439C > T | 88131153 | 88131153 |
| FUT1 | c.661T | 48750621 | 48750621 | ABCG2 | c.440G > A | 88131152 | 88131152 |
| FUT1 | c.659A | 48750623 | 48750623 | ABCG2 | c.455T > C | 88131137 | 88131137 |
| FUT1 | c.658T | 48750624 | 48750624 | ABCG2 | c.458C > T | 88131134 | 88131134 |
| FUT1 | c.655C | 48750627 | 48750627 | ABCG2 | c.542_543insA | 88121782 | 88121782 |
| FUT1 | c.649T | 48750633 | 48750633 | ABCG2 | c.565_566del | 88121758 | 88121759 |
| FUT1 | c.586C | 48750696 | 48750696 | ABCG2 | c.706C > T | 88118244 | 88118244 |
| FUT1 | c.586T | 48750696 | 48750696 | ABCG2 | c.706C > T | 88118244 | 88118244 |
| FUT1 | c.551_552del | 48750730 | 48750731 | ABCG2 | c.730C > T | 88118220 | 88118220 |
| FUT1 | c.548G | 48750734 | 48750734 | ABCG2 | c.736C > T | 88118214 | 88118214 |
| FUT1 | c.547A | 48750735 | 48750735 | ABCG2 | c.784G > T | 88118166 | 88118166 |
| FUT1 | c.545A | 48750737 | 48750737 | ABCG2 | c.791_792delTT | 88118158 | 88118159 |
| FUT1 | c.538C | 48750744 | 48750744 | ABCG2 | c.875_878dupACTT | 88115022 | 88115025 |
| FUT1 | c.538T | 48750744 | 48750744 | ABCG2 | c.986_987delTA | 88113510 | 88113511 |
| FUT1 | c.522A | 48750760 | 48750760 | ABCG2 | c.1017_1019delCTC | 88113478 | 88113480 |
| FUT1 | c.513C | 48750769 | 48750769 | ABCG2 | c.1111_1112delAC | 88113385 | 88113386 |
| FUT1 | c.513G | 48750769 | 48750769 | ABCG2 | c.1384G > A | 88099432 | 88099432 |
| FUT1 | c.491A | 48750791 | 48750791 | ABCG2 | c.1515del | 88097585 | 88097585 |
| FUT1 | c.462A | 48750820 | 48750820 | ABCG2 | c.1515del | 88097585 | 88097585 |
| FUTI | c.462C | 48750820 | 48750820 | ABCG2 | c.1591C > T | 88097509 | 88097509 |
| FUTI | c.461A | 48750821 | 48750821 | ABCG2 | c.1714A > C | 88095543 | 88095543 |
| FUT1 | c.461G | 48750821 | 48750821 | ABCG2 | c.1723C > T | 88095534 | 88095534 |
| FUT1 | c.460C | 48750822 | 48750822 | ABCG2 | c.1789_1790insT | 88094607 | 88094608 |
| FUT1 | c.442T | 48750840 | 48750840 | ABCG2 | c.1819T > C | 88094578 | 88094578 |
| FUT1 | c.424T | 48750858 | 48750858 | ABCG2 | c.1819T > C | 88094578 | 88094578 |
| FUT1 | c.423A | 48750859 | 48750859 | ABCG2 | c.1820 + 1g > a | 88094576 | 88094576 |
| FUT1 | c.422A | 48750860 | 48750860 | ABCG2 | c.1841T > G | 88092361 | 88092361 |
| FUT1 | c.422G | 48750860 | 48750860 | ABCG2 | c.1858G > A | 88092344 | 88092344 |
| FUT1 | c.371G | 48750911 | 48750911 | ABCG2 | 27-kb deletion | 88165417 | 88165645 |
| FUT1 | c.349T | 48750933 | 48750933 | ABCG2 | 27-kb deletion | 88164336 | 88164501 |
| FUT1 | c.328A | 48750954 | 48750954 | ABCG2 | 27-kb deletion | 88164178 | 88164315 |
| FUT1 | c.293T | 48750989 | 48750989 | ABCG2 | 27-kb deletion | 88158437 | 88158666 |
| FUT1 | c.269T | 48751013 | 48751013 | ABCG2 | 27-kb deletion | 88158199 | 88158398 |
| FUT1 | c.235C | 48751047 | 48751047 | ABCG2 | 27-kb deletion | 88157873 | 88158062 |
| FUT1 | c.35T | 48751247 | 48751247 | ABCG2 | 27-kb deletion | 88156758 | 88156907 |
| FUT2 | c.4A | 48702960 | 48702960 | ABCG2 | 27-kb deletion | 88150594 | 88150739 |
| FUT2 | c.40G | 48702996 | 48702996 | ABCG2 | 27-kb deletion | 88145144 | 88145356 |
| FUT2 | c.113T | 48703069 | 48703069 | ABCG2 | 27-kb deletion | 88139952 | 88140181 |
| FUT2 | c.244A | 48703200 | 48703200 | FY | c.125G | 159205564 | 159205564 |
| FUT2 | c.244G | 48703200 | 48703200 | FY | c.265T | 159205704 | 159205704 |
| FUT2 | c.278T | 48703234 | 48703234 | FY | c.298A | 159205737 | 159205737 |
| FUT2 | c.302T | 48703258 | 48703258 | FY | c.680A | 159206119 | 159206119 |
| FUT2 | c.379T | 48703335 | 48703335 | FY | c.125A | 159205564 | 159205564 |
| FUT2 | c.385A | 48703341 | 48703341 | FY | c.145T | 159205584 | 159205584 |
| FUT2 | c.385T | 48703341 | 48703341 | FY | c.266A | 159205705 | 159205705 |
| FUT2 | c.400A | 48703356 | 48703356 | FY | c.901T | 159206340 | 159206340 |
| FUT2 | c.412A | 48703368 | 48703368 | FY | c.281_295del | 159205720 | 159205734 |
| FUT2 | c.428A | 48703384 | 48703384 | FY | c.408A | 159205847 | 159205847 |
| FUT2 | c.481A | 48703437 | 48703437 | FY | c.287A | 159205726 | 159205726 |
| FUT2 | c.569A | 48703525 | 48703525 | FY | c.327del | 159205766 | 159205766 |
| FUT2 | c.571T | 48703527 | 48703527 | FY | c.395A | 159205834 | 159205834 |
| FUT2 | c.628T | 48703584 | 48703584 | FY | c.719del | 159206158 | 159206158 |
| FUT2 | c.658T | 48703614 | 48703614 | FY | ā69C | 159205371 | 159205371 |
| FUT2 | c.664T | 48703620 | 48703620 | FY | c.296 | 159205735 | 159205935 |
| FUT2 | c.665A | 48703621 | 48703621 | 496delinsAGGCCACTG | |||
| FUT2 | c.685_686del | 48703641 | 48703642 | FY | c.407A | 159205846 | 159205846 |
| FUT2 | c.685A | 48703641 | 48703641 | FY | c.781A | 159206220 | 159206220 |
| FUT2 | c.688_690del | 48703644 | 48703646 | FY | c.179_180del | 159205618 | 159205619 |
| FUT2 | c.716A | 48703672 | 48703672 | FY | c.895A | 159206334 | 159206334 |
| FUT2 | c.747_ | 48703703 | 48703704 | FY | c.151del | 159205590 | 159205590 |
| 748insGTG | GYPA | c.250G | 114118735 | 114118735 | |||
| FUT2 | c.778del | 48703734 | 48703734 | GYPA | c.250C | 114118735 | 114118735 |
| FUT2 | c.818A | 48703774 | 48703774 | GYPA | c.244C | 114118741 | 114118741 |
| FUT2 | c.849A | 48703805 | 48703805 | GYPA | c.244A | 114118741 | 114118741 |
| FUT2 | c.853A | 48703809 | 48703809 | GYPA | c.242T | 114118743 | 114118743 |
| FUT2 | c.868A | 48703824 | 48703824 | GYPA | c.242G | 114118743 | 114118743 |
| FUT2 | c.950T | 48703906 | 48703906 | GYPA | c.240G | 114118745 | 114118745 |
| JK | c.130A | 45730450 | 45730450 | GYPA | c.240T | 114118745 | 114118745 |
| JK | c.838G | 45739554 | 45739554 | GYPA | c.239T | 114118746 | 114118746 |
| JK | c.511C | 45736496 | 45736496 | GYPA | c.239C | 114118746 | 114118746 |
| JK | c.28A | 45730348 | 45730348 | GYPA | c.232G | 144119686 | 144119686 |
| JK | c.226A | 45731089 | 45731089 | GYPA | c.232A | 144119686 | 144119686 |
| JK | c.742A | 45739241 | 45739241 | GYPA | GYP del exon 3 | 144119686 | 144119781 |
| JK | c.838A | 45739554 | 45739554 | GYPA | c.230C | 144119688 | 144119688 |
| JK | c.548T | 45736533 | 45736533 | GYPA | c.230T | 144119688 | 144119688 |
| JK | c.718A | 45739217 | 45739217 | GYPA | c.226G | 144119692 | 144119692 |
| JK | c.202T | 45731065 | 45731065 | GYPA | c.226A | 144119692 | 144119692 |
| JK | c.582G | 45736567 | 45736567 | GYPA | c.217C | 144119701 | 144119701 |
| JK | c.956T | 45748385 | 45748385 | GYPA | c.217T | 144119701 | 144119701 |
| JK | c.561A | 45736546 | 45736546 | GYPA | c.212C | 144119706 | 144119706 |
| JK | 342 ā 1a | 45734273 | 45734273 | GYPA | c.203C | 144119715 | 144119715 |
| JK | c.723del | 45739222 | 45739222 | GYPA | c.197C | 144119721 | 144119721 |
| JK | c.866G | 45739582 | 45739582 | GYPA | c.197A | 144119721 | 144119721 |
| JK | c.27_50del | 45730347 | 45730370 | GYPA | c.191A | 144119727 | 144119727 |
| JK | 811 + 5A | 45739315 | 45739315 | GYPA | c.164_166del | 144119752 | 144119754 |
| JK | 342 ā 1c | 45734273 | 45734273 | GYPA | c.160C | 144119758 | 144119758 |
| JK | c.222A | 45731085 | 45731085 | GYPA | c.148C | 144119770 | 144119770 |
| JK | c.499G | 45736484 | 45736484 | GYPA | c.148T | 144119770 | 144119770 |
| JK | 663 + 1t | 45736649 | 45736649 | GYPA | c.140T | 144119778 | 144119778 |
| JK | c.871C | 45739587 | 45739587 | GYPA | c.140A | 144119778 | 144119778 |
| JK | c.896A | 45739612 | 45739612 | GYPA | c.140C | 144119778 | 144119778 |
| JK | c.191A | 45731054 | 45731054 | GYPA | c.138T | 144119780 | 144119780 |
| JK | c.194A | 45731057 | 45731057 | GYPA | c.138A | 144119780 | 144119780 |
| JK | c.512A | 45736497 | 45736497 | GYPA | c.107C | 144120519 | 144120519 |
| JK | c.437C | 45734369 | 45734369 | GYPA | c.107G | 144120519 | 144120519 |
| JK | c.536G | 45736521 | 45736521 | GYPA | c.72T | 144120554 | 144120554 |
| DI | c.2561T | 44251253 | 44251253 | GYPA | c.72G | 144120554 | 144120554 |
| DI | c.2561C | 44251253 | 44251253 | GYPA | c.71G | 144120555 | 144120555 |
| DI | c.1972A | 44254581 | 44254581 | GYPA | c.71A | 144120555 | 144120555 |
| DI | c.1972G | 44254581 | 44254581 | GYPA | c.68A | 144120558 | 144120558 |
| DI | c.1669A | 44255804 | 44255804 | GYPA | c.68C | 144120558 | 144120558 |
| DI | c.1669G | 44255804 | 44255804 | GYPA | c.67T | 144120559 | 144120559 |
| DI | c.1643T | 44255830 | 44255830 | GYPA | c.59C | 144120567 | 144120567 |
| DI | c.1643C | 44255830 | 44255830 | GYPA | c.59T | 144120567 | 144120567 |
| DI | c.1654T | 44255819 | 44255819 | GYPA | c.58T | 144120568 | 144120568 |
| DI | c.1654A | 44255819 | 44255819 | SLC35C1 | c.439C | 45806240 | 45806240 |
| DI | c.1294T | 44257796 | 44257796 | SLC35C1 | c.588G | 45810828 | 45810828 |
| DI | c.1294C | 44257796 | 44257796 | SLC35C1 | c.923C | 45811163 | 45811163 |
| DI | c.1694C | 44255779 | 44255779 | SLC35C1 | c.439T | 45806240 | 45806240 |
| DI | c.1694G | 44255779 | 44255779 | SLC35C1 | c.923G | 45811163 | 45811163 |
| DI | c.1707A | 44255766 | 44255766 | SLC35C1 | c.588del | 45810828 | 45810828 |
| DI | c.1707C | 44255766 | 44255766 | ||||
| DI | c.1967A | 44254586 | 44254586 | ||||
| DI | c.1967G | 44254586 | 44254586 | ||||
| DI | c.1966T | 44254587 | 44254587 | ||||
| DI | c.1966C | 44254587 | 44254587 | ||||
| DI | c.1663C | 44255810 | 44255810 | ||||
| DI | c.1663T | 44255810 | 44255810 | ||||
| DI | c.1937A | 44254616 | 44254616 | ||||
| DI | c.1936T | 44254617 | 44254617 | ||||
| DI | c.1936C | 44254617 | 44254617 | ||||
| DI | c.1937G | 44254616 | 44254616 | ||||
| DI | c.1681T | 44255792 | 44255792 | ||||
| DI | c.1681C | 44255792 | 44255792 | ||||
| DI | c.1287T | 44257803 | 44257803 | ||||
| DI | c.1681G | 44255792 | 44255792 | ||||
| DI | c.1287A | 44257803 | 44257803 | ||||
| DI | c.1696T | 44255777 | 44255777 | ||||
| DI | c.1696C | 44255777 | 44255777 | ||||
| DI | c.1696G | 44255777 | 44255777 | ||||
| DI | c.1653C | 44255820 | 44255820 | ||||
| DI | c.1653G | 44255820 | 44255820 | ||||
| DI | c.1438A | 44257538 | 44257538 | ||||
| DI | c.1438G | 44257538 | 44257538 | ||||
| DI | c.1462A | 44257514 | 44257514 | ||||
To further illustrate the present disclosure, the primer set, the kit, and the method for genotyping multi-RBC blood group system based on NGS provided by the present disclosure are described in detail below in connection with examples, but these examples should not be construed as limiting the claimed scope of the present disclosure.
S1. A genomic DNA was extracted separately from 5 whole blood samples (H07951D, H07949D, H07934D, H07936D, H07939D), 5 plasma samples (H07945D, H07942D, H07943D, H07948D, H07938D), and 4 paraffin tissue samples (H07929D, H07940D, H07941D, H07947D) using magnetic beads, the concentration and purity were measured, and then 10 mM Tris-HCl was added to dilute each sample to 200 ng/μL. The quality of each sample was tested using 1.5% agarose gel electrophoresis, and qualified samples were included in the group and labeled separately.
S2. The primer pairs of each pool in Table 2 were used to prepare 3 amplification systems, including: specific primer mix 1 μL (pool1, pool2, and pool3); enzyme mix Pxp-1st-mix 3 μL; genome template 1 μL (200 ng); nuclease-free water 7.5 μL, total volume 12.5 μL. There were 3 tubes of specific primer mixture in total, and 1 sample needed to be divided into 3 tubes for PCR.
A PCR reaction program of the first amplification included: initial denaturation at 98° C. for 20 min; 9 cycles of denaturation at 98° C. for 15 s, annealing at 62° C. for 20 min, extension at 68° C. for 60 s, and extension at 72° C. for 60 s; extension at 72° C. for 5 min; and heat preservation at 10° C.
S3. The PCR amplification products (pre-library products) of each sample were purified using purification magnetic beads. The remaining primers, gDNA and dNTPs were removed from the PCR product, and the amplification products were recovered.
S4. The purified products were further amplified by PCR using universal sequencing adapters (N5XX and A7XX) carrying an index.
A reaction system of the PCR amplification included: enzyme mixture Pxp-2nd-mix 6.5 μL; pre-library product 4 μL; universal adapter N5XX 1 μL, universal adapter A7XX 1 μL, with a total volume of 12.5 μL. The same sample included 3 pre-library products, which were added to 3 tubes of PCR master mix containing the same universal adapter.
The PCR reaction program was preferably: initial denaturation at 98° C. for 2 min; 23 cycles of denaturation at 98° C. for 15 s, extension at 68° C. for 60 s, and extension at 72° C. for 60 s; extension at 72° C. for 10 min; and heat preservation at 4° C.
As shown in FIG. 2, the amplification products of 14 samples all showed clear and bright target bands in the range of 200 bp to 500 bp, which was consistent with the expected design. Moreover, there was an extremely low primer-dimer content, and the size of the primer-dimer was obviously different from that of the amplified target fragment. This indicated that the PCR amplification primers and detection methods could break through the limitation of traditional methods, thus producing a large number of primer dimers to enhance the primer capture efficiency.
Using steps S1 to S4 in Example 1, primer detection sensitivity verification was conducted on the genomic samples extracted from 4 whole blood samples (H08215D, H07953D, H07997D, H07951D), 4 plasma samples (H07949D, H07934D, H07936D, H07945D), and 3 tissue samples (H07942D, H07943D, H07948D) that passed the quality inspection. The samples in each case had a starting concentration of 200 ng/μL, and were diluted in 5-fold, 10-fold, and 20-fold concentration gradients. After dilution, the samples had concentrations of 40 ng/μL, 20 ng/μL, and 10 ng/μL, and were labeled with the sample name and concentration, respectively.
As shown in FIG. 3, the amplification products of the 11 samples were mainly concentrated at 200 bp to 500 bp, which was consistent with the expected design. Moreover, there was an extremely low primer-dimer content, and the size of the primer-dimer was obviously different from that of amplified target fragment. All 11 samples had clear and bright target bands at different template usage levels, and the target band could still be successfully amplified even if the template content was as low as 10 ng. This indicated that the PCR amplification primer and detection method of the present disclosure could break through the limitations of traditional methods and improve a detection sensitivity.
Using the same method as in Example 1, primer detection repeatability verification was conducted on the genome sample extracted from whole blood samples (H07939D, H07938D), plasma samples (H07929D, H07940D), and paraffin tissue samples (H07941D, H07947D) that passed the quality inspection. Each of the 6 samples was amplified by 2 different operators on 2 different laboratory platforms according to steps S2 to S4 in Example 1, with a sample injection volume of 1 μL. The 6 samples were amplified by different operators in different laboratories using primers specific for a causative gene of large vestibular aqueduct syndrome.
As shown in FIG. 4, a total of 12 amplification products from 6 samples were mainly concentrated at 200 bp to 500 bp and there were no other non-specific bands, which was consistent with the expected design. Moreover, there was an extremely low primer-dimer content, and the size of the primer-dimer was obviously different from that of amplified target fragment. There was no difference in the test results between different operators and different experimental platforms. This showed that the PCR amplification primer and detection method of the present disclosure had desirable repeatability.
17-System Blood Group Genotyping and Rare Blood Group Detection Based on Targeted Capture NGS Technology
1. Experimental Material Sources:
From the blood samples of voluntary blood donors tested by the Shenzhen Blood Center Rare Blood Group Bank from 2018 to 2023, 20 different types of rare blood group samples were selected, namely: No. 1 and 2 Hā, No. 3 RHnull, No. 4 and 5 Dāā, No. 6 CCDEE, No. 7 S+sā, No. 8 Sāsā, No. 9 Fy(aāb+), No. 10 Fy(aābā), No. 11 Le(a+bā), No. 12 Jk(aābā), No. 13 K+, No. 14 Jr(aā), No. 15 Di(a+bā), No. 16 Di(aābā), No. 17 InLu, No. 18 p, No. 19 RHD mixed field of view, and No. 20 RHCcEe mixed field of view.
These samples covered four types that were detected by different detection technologies and could not be solved by traditional serology, PCR-SSP, and Sanger, but could only achieve clear results through this technology of the present disclosure:
(1) When collecting venous blood, a sample of 5 mL/(person) was retained in an EDTA-Na2 anticoagulant tube and stored at 4° C.
(2) Blood group serological test was conducted within 72 h for 31 key rare blood groups in 17 target blood group systems. Only 11 rare blood groups were suitable for serological technology, while the remaining 20 rare blood groups could not be detected by serological test since there were no commercially available antibody reagents or the detection principle was not applicable.
(3) Genomic DNA was extracted from the 20 samples within 72 h, and genotyping was conducted using PCR-SSP, Sanger, and the technology of the present disclosure in sequence.
3. Experimental Results:
(1) Blood type serological test results: among the 20 samples in Table 4, only 13 cases obtained clear blood group results through serological test, namely: No. 1 and 2 Hā, No. 3 RHnull, No. 4 and 5 Dāā, No. 6 CCDEE, No. 7 S+sā, No. 8 Sāsā, No. 9 Fy(aāb+), No. 10 Fy(aābā), No. 11 Le(a±bā), No. 12 Jk(aābā), No. 13 K+. There were 2 cases that could not be interpreted since their serological results showed mixed fields of view, while the other 5 cases were not suitable for serological test.
| TABLE 4 |
| Serological identification results of 20 rare blood group specimens |
| Results |
| H | RH | MNS | Kidd | Diego | Duffy | Lewis | Kell | (rare |
| Sample | Anti- | Anti- | Anti- | Anti- | Anti- | Anti- | Anti- | Anti- | Anti- | Anti- | Anti- | Anti- | Anti- | Anti- | Anti- | Anti- | Anti- | blood |
| NO | H | D | C | c | E | e | S | s | Jka | Jkb | Dia | Fya | Fyb | Lea | Leb | K | k | group) |
| 1 | 0 | + | + | + | + | + | 0 | + | + | 0 | + | + | 0 | 0 | + | 0 | + | Hā |
| 2 | 0 | + | + | + | + | + | + | + | + | + | + | + | 0 | 0 | + | 0 | + | Hā |
| 3 | + | 0 | 0 | 0 | 0 | 0 | 0 | + | + | 0 | + | + | + | 0 | + | 0 | + | RHnull |
| 4 | + | + | 0 | 0 | 0 | 0 | 0 | + | + | + | 0 | + | + | 0 | + | 0 | + | Dāā |
| 5 | + | + | 0 | 0 | 0 | 0 | + | + | 0 | + | + | + | + | 0 | + | 0 | + | Dāā |
| 6 | + | + | + | 0 | + | 0 | 0 | + | + | + | 0 | + | 0 | 0 | + | 0 | + | CCDEE |
| 7 | + | + | + | + | + | + | + | 0 | + | + | + | + | 0 | 0 | + | 0 | + | S + sā |
| 8 | + | + | + | + | + | + | 0 | 0 | 0 | + | + | + | 0 | 0 | + | 0 | + | S ā sā |
| 9 | + | + | + | + | + | + | 0 | + | 0 | + | + | 0 | + | 0 | + | 0 | + | Fy(a ā b+) |
| 10 | + | + | + | + | + | + | + | + | + | 0 | + | 0 | 0 | 0 | + | 0 | + | Fy(a ā bā) |
| 11 | + | + | + | + | + | + | 0 | + | + | + | + | + | 0 | ± | 0 | 0 | + | Le(a + bā) |
| 12 | + | + | + | + | + | + | 0 | + | 0 | 0 | + | + | 0 | 0 | + | 0 | + | Jk(a ā bā) |
| 13 | + | + | + | + | + | + | 0 | + | + | + | + | + | 0 | 0 | + | + | + | K+ |
| 14 | + | + | + | + | + | + | + | + | + | + | 0 | + | 0 | 0 | + | 0 | + | Unknown |
| 15 | + | + | + | + | + | + | 0 | + | + | + | + | + | 0 | 0 | + | 0 | + | Unknown |
| 16 | + | + | + | + | + | + | 0 | + | + | + | 0 | + | 0 | 0 | + | 0 | + | Unknown |
| 17 | + | + | + | + | + | + | 0 | + | 0 | + | + | + | + | 0 | + | 0 | + | Unknown |
| 18 | + | + | + | + | + | + | 0 | + | 0 | + | + | + | 0 | 0 | + | 0 | + | Unknown |
| 19 | + | mf | + | + | + | + | 0 | + | + | 0 | + | + | + | 0 | + | 0 | + | Unknown |
| 20 | + | + | mf | mf | mf | mf | 0 | + | + | 0 | 0 | + | + | 0 | + | 0 | + | Unknown |
(2) Genotyping results: three different genetic testing technologies were used to conduct genotyping of 20 rare blood group specimens. The results were detailed in Table 5.
In 7 samples, genetic testing technologies based on SNP sites, such as PCR-SSP and MassArray nucleic acid mass spectrometry, were able to confirm blood group results; for example, for rare blood group samples No. 14-16 without commercially available serological detection reagents, their rare blood group types obtained through PCR-SSP were: No. 14 Jr(aā), No. 15 was Di(a+bā), and No. 16 Di(aābā). In the other 13 samples, due to complex and unclear genetic polymorphisms, the primers designed based on SNP sites were off-target and the genotype could not be determined.
Sanger was conducted to sequence the gene coding region, and clear allele types could be directly obtained for 10 pure and mutant samples. Another 7 cases had multiple heterozygous mutation sites, large fragment insertions, and hybrid recombination. In this case, Sanger could not directly differentiate between these different heterozygotes. Because Sanger generally produced mixed signals that were not sufficient to distinguish a relative proportion of multiple alleles, and predictions could only be made based on guesswork. The technology of the present disclosure could solve such problems more accurately. Through SNP detection and haplotype analysis, multiple alleles could be more effectively identified to provide more information to infer haplotypes (allele types). For the No. 17 and No. 18 of rare blood group samples deduced by Sanger without clear results using PCR-SSP genotyping and without commercially available serological detection reagents, their rare blood groups were speculated by Sanger to be: No. 17 InLu, No. 18 p.
There were also 2 cases No. 19 and No. 20 with abnormal blood group serology test results showing mixed fields of view and Sanger showing all double peaks and unable to interpret the results. The Sanger found dual genetic backgrounds that were indistinguishable. The technology of the present disclosure could obtain the blood group chimera allele types by analyzing the relative proportions of SNPs, which were: No. 19 RHD*01 (70%)/RHD*01N.01 (30%), No. 20 RHCE*Ce (20%)/RHCE*cE(80%).
| TABLE 5 |
| Comparison of genotyping results of 20 rare blood group specimens using three |
| different types of genetic testing technologies |
| PCR-SSP and MassArray | |||||||||
| nucleic acid mass | |||||||||
| spectrometry (detection | |||||||||
| technology based on SNP |
| sites) | Sanger | Technology of the present disclosure |
| Whether | Whether | Whether | |||||||||
| blood | blood | blood | Con- | ||||||||
| group | group | group | firmed | Was it | |||||||
| could | could | could | rare | consistent | |||||||
| Experi- | be | Analysis | Experi- | be | Experi- | be | blood | with | |||
| Sample | mental | con- | of | mental | con- | Analysis | mental | con- | Analysis | group | serology |
| NO | results | firmed? | reason | results | firmed? | of reason | results | firmed? | of reason | types | results? |
| 1 | c.881_ | Yes | / | c.881_ | Yes | / | c.881 | Yes | / | Hā | Yes |
| 882delTT | 882delTT | 882delTT | |||||||||
| 2 | Ampli- | No | Complex | c.360- | Spe- | The | c.360-400del | Yes | Allelic | Hā | Yes |
| fication | gene | 400del/c. | culated | sequencing | FUT1*01/ | types | |||||
| failure | poly- | 551_ | result | FUT1* | could be | ||||||
| morphism, | 552delAG | was | 01N.06 | obtained | |||||||
| primer | heterozygous | by | |||||||||
| off- | and | analyzing | |||||||||
| target | the allele | the | |||||||||
| type | relative | ||||||||||
| could not | proportions | ||||||||||
| be | of SNPs | ||||||||||
| directly | |||||||||||
| obtained | |||||||||||
| 3 | Ampli- | No | Whole | RHD + | Yes | / | RHD + | Yes | / | RHnull | Yes |
| fication | gene | RhCE | RhCE | ||||||||
| failure | deletion, | deletion | deletion | ||||||||
| primer | |||||||||||
| off- | |||||||||||
| target | |||||||||||
| 4 | Ampli- | No | Whole | RHD | Yes | / | RHD | Yes | / | Dāā | Yes |
| fication | gene | deletion | deletion | ||||||||
| failure | deletion, | ||||||||||
| primer | |||||||||||
| off- | |||||||||||
| target | |||||||||||
| 5 | Ampli- | No | Large | / | Spe- | Large | CE exons 3- | Yes | Allelic | Dāā | Yes |
| fication | fragment | culated | segment | 9/CE exons | types | ||||||
| failure | recomb- | heterozygous | 2-7 | could be | |||||||
| ination, | recombination, | obtained | |||||||||
| primer | unable to | by | |||||||||
| off- | obtain | analyzing | |||||||||
| target | allele | the | |||||||||
| type | relative | ||||||||||
| proportions | |||||||||||
| of SNPs | |||||||||||
| 6 | Ampli- | No | Complex | c.48G/C, | Spe- | The | RHCE*CE/ | Yes | Allelic | CCDEE | Yes |
| fication | gene | c.150C/T, | culated | sequencing | RHCE* | types | |||||
| failure | poly- | c.178C/A, | result | CE.01 | could be | ||||||
| morphism, | c.201A/GA | was | obtained | ||||||||
| primer | c.203A/G, | multiple | by | ||||||||
| off- | c.307C/T, | heterozygotes | analyzing | ||||||||
| target | c.676G/C, | and | the | ||||||||
| c.722C/T | the allele | relative | |||||||||
| type | proportions | ||||||||||
| could not | of SNPs | ||||||||||
| be | |||||||||||
| directly | |||||||||||
| obtained | |||||||||||
| 7 | c.251GG | Yes | / | c.251C > | Yes | Conventional | c.251C > G in | Yes | / | Sā | Yes |
| G in | homozygous | GYPB*S/ | |||||||||
| GYPB*S/ | mutations, | c.251C > G in | |||||||||
| c.251C > | allelic | GYPB*S | |||||||||
| G in | types | ||||||||||
| GYPB*S | could be | ||||||||||
| obtained | |||||||||||
| 8 | Ampli- | No | Large | c.143C/T, | Spe- | There | GYP*Mur/ | Yes | Serology | JENU | No |
| fication | fragment | c.251GG, | culated | was a | GYP*Mur | test | (actually | ||||
| failure | inserted, | GYP(B1- | large | misjudgment | a | ||||||
| primer | 136- | insertion | discovered! | variant, | |||||||
| off- | B?137- | before | It was | easily | |||||||
| target | 204- | the key | due to | missed) | |||||||
| A205- | SNP site, | limitations | |||||||||
| 229- | resulting | of the | |||||||||
| B230- | in frame | binding | |||||||||
| 366) | shift, and | sites of | |||||||||
| it was a | commercially | ||||||||||
| heterozygous | available | ||||||||||
| mutation, | antibodies | ||||||||||
| the allelic | |||||||||||
| type | |||||||||||
| could not | |||||||||||
| be | |||||||||||
| obtained | |||||||||||
| 9 | c.125AA | Yes | / | c.125AA | Yes | Conventional | FY*B/FY*B | Yes | / | Fy | Yes |
| homozygous | (a ā b+) | ||||||||||
| mutations, | |||||||||||
| allelic | |||||||||||
| types | |||||||||||
| could be | |||||||||||
| obtained | |||||||||||
| 10 | Ampli- | No | Complex | c.287G > | Yes | Unconventional, | FY*01N.04/ | Yes | / | Fy | Yes |
| fication | gene | A/c.287G > | homozygous | FY*01N.04 | (a ā b+) | ||||||
| failure | poly- | A | mutations | ||||||||
| morphism, | could | ||||||||||
| primer | result in | ||||||||||
| off- | allelic | ||||||||||
| target | types | ||||||||||
| 11 | Ampli- | No | Complex | c.13G > A, | Spe- | The | FUT3* | Yes | Allelic | Le | No |
| fication | gene | c.59T > G, | culated | sequencing | 01N.01.05/ | types | (a ā bā) | (blood | |||
| failure | poly- | c.202T > CA | result | FUT3* | could be | group | |||||
| morphism, | c.314C > TA | was | 01N.03.03 | obtained | antigens | ||||||
| primer | c.484G > A. | multiple | by | were | |||||||
| off- | c.508G > A | heterozygotes | analyzing | adsorbed | |||||||
| target | and | the | and | ||||||||
| the allele | relative | difficult | |||||||||
| type | proportions | to | |||||||||
| could not | of SNPs | accurately | |||||||||
| be | identify) | ||||||||||
| directly | |||||||||||
| obtained | |||||||||||
| 12 | Ampli- | No | Complex | c.956C > | Spe- | Single- | JK*01N.04/ | Yes | Allelic | Jk | Yes |
| fication | gene | Tc.516 | culated | base | JK*01N.12 | types | (a ā bā) | ||||
| failure | poly- | 530del | mutations | could be | |||||||
| morphism, | superimpose | obtained | |||||||||
| primer | fragment | by | |||||||||
| off- | deletions, | analyzing | |||||||||
| target | unable to | the | |||||||||
| directly | relative | ||||||||||
| obtain | proportions | ||||||||||
| allelic | of SNPs | ||||||||||
| types | |||||||||||
| 13 | c.578TT | Yes | / | c.578TT | Yes | Conventional | KEL*01.01/ | Yes | / | K+ | Yes |
| homozygous | KEL*01.01 | ||||||||||
| mutations, | |||||||||||
| allelic | |||||||||||
| types | |||||||||||
| could be | |||||||||||
| obtained | |||||||||||
| 14 | c.376TT | Yes | / | c.376TT | Yes | Conventional | ABCG2* | Yes | / | Jr(aā) | Serologically |
| homozygous | 01N.01/ | unidentifiable | |||||||||
| mutations, | ABCG2* | (no | |||||||||
| allelic | 01N.01 | commercially | |||||||||
| types | available | ||||||||||
| could be | antibodies) | ||||||||||
| obtained | |||||||||||
| 15 | c.2561TT | Yes | / | c.2561TT | Yes | Conventional | DI*A/DI*A | Yes | / | Di | Serologically |
| homozygous | (a + bā) | unidentifiable | |||||||||
| mutations, | (no | ||||||||||
| allelic | commercially | ||||||||||
| ypes | available | ||||||||||
| could be | antibodies) | ||||||||||
| obtained | |||||||||||
| 16 | c.1462AA | Yes | / | c.1462AA | Yes | Conventional | DI*02N.01/ | Yes | / | Di | Serologically |
| homozygous | DI*02N.01 | (a ā bā) | unidentifiable | ||||||||
| mutations, | (no | ||||||||||
| allelic | commercially | ||||||||||
| types | available | ||||||||||
| could be | antibodies) | ||||||||||
| obtained | |||||||||||
| 17 | Ampli- | No | Genetic | c.304T > C | Spe- | The | c. 1021T > C | Yes | Allelic | InLu | Yes |
| fication | background | c.1021T > C | culated | sequencing | in KLF1* | types | |||||
| failure | different | result | BGM12/ | could be | |||||||
| from | was | KLF1* | obtained | ||||||||
| that of | multiple | BGM12 | by | ||||||||
| Caucasian | heterozygotes | analyzing | |||||||||
| people, | and | the | |||||||||
| primer | the allele | relative | |||||||||
| off- | type | proportions | |||||||||
| target | could not | of SNPs | |||||||||
| be | |||||||||||
| directly | |||||||||||
| obtained | |||||||||||
| 18 | Ampli- | No | Complex | c.100G > A, | Spe- | There | c. 343A > T in | Yes | Allelic | p | Serologically |
| fication | gene | c.343A > T, | culated | was a | A4GALT* | types | unidentifiable | ||||
| failure | poly- | c.418 | short | P1.01/ | could be | (no | |||||
| morphism, | 428delins | insertion | c.100G > A in | obtained | commercially | ||||||
| primer | before | A4GALT* | by | available | |||||||
| off- | the key | 02N.25 | analyzing | antibodies) | |||||||
| target | SNP site, | the | |||||||||
| resulting | relative | ||||||||||
| in frame | proportions | ||||||||||
| shift, it | of SNPs | ||||||||||
| was | |||||||||||
| superposition | |||||||||||
| of | |||||||||||
| multiple | |||||||||||
| heterozygous | |||||||||||
| mutations, | |||||||||||
| the | |||||||||||
| allelic | |||||||||||
| type | |||||||||||
| could not | |||||||||||
| be | |||||||||||
| directly | |||||||||||
| obtained | |||||||||||
| 19 | Ambig- | No | Blood | Ambiguous | No | Blood | RHD* | Yes | Allelic | Chimera | Serologically |
| uous | group | group | 01(70%)/ | types and | unidentifiable | ||||||
| mosaicism | mosaicism | RHD*01- | proportions | (mixed | |||||||
| led | led to | N.01(30%) | of two | fields | |||||||
| to dual | dual | chimeric | of | ||||||||
| genetic | genetic | genes | view, | ||||||||
| back- | back- | could be | undeter- | ||||||||
| grounds | grounds | obtained | minable) | ||||||||
| that | that | by | |||||||||
| were | were | analyzing | |||||||||
| indis- | indis- | the | |||||||||
| tinguish- | tinguish- | relative | |||||||||
| able | able | proportions | |||||||||
| of SNPs | |||||||||||
| 20 | Ambig- | No | Blood | Ambiguous | No | Blood | RHCE* | Yes | Allelic | Chimera | Serologically |
| uous | group | group | Ce(20%)/ | types and | unidentifiable | ||||||
| mosaicism | mosaicism | RHCE* | proportions | (mixed | |||||||
| led | led to | cE(80%) | of two | fields | |||||||
| to dual | dual | chimeric | of | ||||||||
| genetic | genetic | genes | view, | ||||||||
| back- | back- | could be | undeter- | ||||||||
| grounds | grounds | obtained | minable) | ||||||||
| that | that | by | |||||||||
| were | were | analyzing | |||||||||
| indis- | indis- | the | |||||||||
| tinguish- | tinguish- | relative | |||||||||
| able | able | proportions |
| of SNPs | ||||||||||
| TABLE 6 |
| Quality control results of sequencing 20 rare blood group specimens |
| Sample | Total | ReadMapped | ReadMap | Average | ||||
| NO | Reads | Genome | Target | Uniformity | Specificity | depth | >=20x | >=30x |
| 1 | 1123474 | 852942 | 784878 | 96.01% | 92.01% | 2845 | 97.62% | 94.62% |
| 2 | 1418628 | 891892 | 779782 | 90.97% | 87.42% | 2760 | 95.98% | 92.98% |
| 3 | 1075343 | 820595 | 748465 | 95.68% | 91.20% | 2636 | 96.34% | 92.34% |
| 4 | 1403989 | 1104238 | 954835 | 94.12% | 86.46% | 3404 | 97.76% | 92.76% |
| 5 | 1225134 | 881239 | 814157 | 88.73% | 92.38% | 2952 | 97.01% | 92.01% |
| 6 | 1325877 | 1027290 | 913159 | 90.56% | 88.88% | 3283 | 96.57% | 93.57% |
| 7 | 975678 | 638289 | 598483 | 85.56% | 93.75% | 2142 | 99.18% | 96.18% |
| 8 | 1478933 | 1045310 | 930013 | 96.63% | 88.96% | 3357 | 98.43% | 95.43% |
| 9 | 1373990 | 978968 | 910049 | 90.08% | 92.95% | 3255 | 95.89% | 94.89% |
| 10 | 925554 | 724617 | 672155 | 92.86% | 92.71% | 2425 | 96.74% | 93.74% |
| 11 | 819891 | 513006 | 449650 | 94.27% | 87.63% | 1578 | 98.91% | 93.91% |
| 12 | 1345798 | 866560 | 788917 | 87.42% | 91.03% | 2854 | 97.12% | 96.12% |
| 13 | 1190323 | 929881 | 901651 | 92.74% | 96.95% | 3267 | 99.45% | 98.45% |
| 14 | 1289037 | 793274 | 689141 | 95.39% | 86.87% | 2467 | 95.23% | 94.23% |
| 15 | 1432468 | 1063321 | 979000 | 97.72% | 92.05% | 3515 | 97.07% | 95.07% |
| 16 | 845192 | 674548 | 592861 | 89.16% | 87.87% | 2145 | 99.31% | 96.31% |
| 17 | 1420141 | 866002 | 799689 | 87.31% | 92.33% | 2872 | 97.83% | 93.83% |
| 18 | 1497523 | 1035088 | 939032 | 88.62% | 90.70% | 3325 | 98.27% | 95.27% |
| 19 | 804517 | 635247 | 595731 | 95.05% | 93.77% | 2155 | 98.82% | 96.82% |
| 20 | 1156893 | 796753 | 712979 | 94.28% | 89.48% | 2527 | 97.65% | 94.65% |
Although the above example has described the present disclosure in detail, it is only a part of, not all of, the examples of the present disclosure. Other examples may also be obtained by persons based on the example without creative efforts, and all of these examples shall fall within the protection scope of the present disclosure.
1. A method for simultaneously detecting genotyping of 17 RBC blood group systems, comprising the following steps:
(1) subjecting three capture and amplification systems to first amplification separately to obtain three first amplification products;
(2) purifying the three first amplification products separately, and subjecting three resulting purified first amplification products to second amplification with a sequencing universal adapter carrying an index separately to obtain three second amplification products; and
(3) purifying and mixing the three second amplification products to allow sequencing to obtain the genotyping of the RBC blood group systems;
wherein the three capture and amplification systems are prepared by using a nucleic acid extracted from a sample as a template and a primer set; and wherein the primer set comprises a first primer set having the nucleotide sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 108, a second primer set having the nucleotide sequences as set forth in SEQ ID NO: 109 to SEQ ID NO: 222, and a third primer set having the nucleotide sequences as set forth in SEQ ID NO: 223 to SEQ ID NO: 336, respectively.
2. The method according to claim 1, wherein the sample in step (1) is selected from the group consisting of a whole blood sample, a plasma sample, and a paraffin tissue sample.
3. The method according to claim 1, wherein the three capture and amplification systems in step (1) each have a volume of 25 μL, and comprise 1 μL of a mixture of the first primer set or the second primer set or the third primer set, 3 μL of an enzyme mixture Pxp-1st-mix, 1 μL of the template, and nuclease-free water as a balance.
4. The method according to claim 1, wherein a PCR reaction program of the first amplification in step (1) comprises: initial denaturation at 98° C. for 20 min; 9 cycles of denaturation at 98° C. for 15 s, annealing at 62° C. for 20 min, extension at 68° C. for 60 s, and extension at 72° C. for 60 s; extension at 72° C. for 5 min; and heat preservation at 10° C.
5. The method according to claim 1, wherein a system of the second amplification in step (2) has a volume of 12.5 μL, and comprises 6.5 μL of an enzyme mixture Pxp-2nd-mix, 4 μL for one of the three purified first amplification products, 1 μL of a universal adapter N5XX, and 1 μL of a universal adapter A7XX.
6. The method according to claim 1, wherein a PCR reaction program of the second amplification in step (2) comprises: initial denaturation at 98° C. for 2 min; 23 cycles of denaturation at 98° C. for 15 s, extension at 68° C. for 60 s, and extension at 72° C. for 60 s; extension at 72° C. for 10 min; and heat preservation at 4° C.
7. The method according to claim 3, wherein a PCR reaction program of the first amplification in step (1) comprises: initial denaturation at 98° C. for 20 min; 9 cycles of denaturation at 98° C. for 15 s, annealing at 62° C. for 20 min, extension at 68° C. for 60 s, and extension at 72° C. for 60 s; extension at 72° C. for 5 min; and heat preservation at 10° C.
8. The method according to claim 5, wherein a PCR reaction program of the second amplification in step (2) comprises: initial denaturation at 98° C. for 2 min; 23 cycles of denaturation at 98° C. for 15 s, extension at 68° C. for 60 s, and extension at 72° C. for 60 s; extension at 72° C. for 10 min; and heat preservation at 4° C.