US20050064556A1
2005-03-24
10/860,277
2004-06-04
A method for the production of Tissue Factor Pathway Inhibitor (TFPI) and Tissue Factor Pathway Inhibitor 2 (TFPI-2), and muteins thereof is disclosed wherein the protein is retained within a yeast cell during growth of the yeast cell and recovered from an insoluble fraction prepared from yeast cells containing the protein.
Get notified when new applications in this technology area are published.
C12N15/81 » CPC main
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression; Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
C07K14/8114 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof; Protease inhibitors; Endopeptidase (E.C. 3.4.21-99) inhibitors; Serine protease (E.C. 3.4.21) inhibitors Kunitz type inhibitors
A61K38/00 » CPC further
Medicinal preparations containing peptides
The present invention relates to a method for the production of factor VIIa/TF/Xa binding proteins, more specifically to the production of Tissue Factor Pathway Inhibitor (TFPI) and Tissue Factor Pathway Inhibitor 2 (TFPI-2), and muteins thereof in yeast cells and isolation of such polypetides from within the yeast cell.
Tissue Factor Pathway Inhibitor (TFPI) inhibits the coagulation cascade in at least two ways: preventing formation of factor VIIa/tissue factor complex and by binding to the active site of factor Xa. The primary sequence of TFPI deduced from cDNA sequence, indicates that the protein contains three Kunitz-type enzyme inhibitor domains. The first of these domains is required for the inhibition of the factor VIIa/tissue factor complex. The second Kunitz-type domain is needed for the inhibition of factor Xa. The function of the third Kunitz-type domain is unknown. TFPI has no known enzymatic activity and is thought to inhibit its protease targets in a stoichiometric manner; namely, binding of one TFPI Kunitz-type domain to the active site of one protease molecule. The carboxy-terminal end of TFPI is believed to have a role in cell surface localization via heparin binding and by interaction with phospholipid. TFPI is also known as Lipoprotein Associated Coagulation Inhibitor (LACI), Tissue Factor Inhibitor (TFI), and Extrinsic Pathway Inhibitor (EPI).
Mature TFPI is 276 amino acids in length with a negatively charged amino terminal end and a positively charged carboxy-terminal end. TFPI contains 18 cysteine residues and forms 9 disulphide bridges when correctly folded. The primary sequence also contains three Asn-X-Ser/Thr N-linked glycosylation consensus sites, the asparagine residues located at positions 145, 195 and 256. The carbohydrate component of mature TFPI is approximately 30% of the mass of the protein. However, data from proteolytic mapping and mass spectral data imply that the carbohydrate moieties are heterogeneous. TFPI is also found to be phosphorylated at the serine residue in position 2 of the protein to varying degrees. The phosphorylation does not appear to affect TFPI function.
TFPI has been shown to prevent mortality in a lethal Escherichia coli (E. coli) septic shock baboon model. Creasey et al, J. Clin. Invest. 91:2850-2860 (1993). Administration of TFPI at 6 mg/kg body weight shortly after infusion of a lethal dose of E. coli resulted in survival in all five TFPI-treated animals with significant improvement in quality of life compared with a mean survival time for the five control animals of 39.9 hours. The administration of TFPI also resulted in significant attenuation of the coagulation response, of various measures of cell injury and significant reduction in pathology normally observed in E. coli sepsis taret organs, including kidneys, adrenal glands, and lungs.
Due to its clot-inhibiting properties, TFPI may also be used to prevent thrombosis during microvascular surgery. For example, U.S. Pat. No. 5,276,015 discloses the use of TFPI in a method for reducing thrombogenicity of microvascular anastomoses wherein TFPI is administered at the site of the microvascular anastomoses contemporaneously-with microvascular reconstruction.
Recently, another protein with a high degree of structural identity to TFPI has been identified. Sprecher et al, Proc. Nat. Acad. Sci., USA 91:3353-3357 (1994). The predicted secondary structure of this protein, called TFPI-2, is virtually identical to TFPI with 3 Kunitz-type domains, 9 cysteine-cysteine linkages, an acidic amino terminus and a basic carboxy-terminal tail. The three Kunitz-type domains of TFPI-2 exhibit 43%, 35% and 53% primary sequence identity with TFPI Kunitz-type domains 1, 2, and 3, respectively. Recombinant TFPI-2 strongly inhibits the amidolytic activity of factor VIIa/tissue factor. By contrast, TFPI-2 is a weak inhibitor of factor Xa amidolytic activity.
TFPI has been isolated from human plasma and from human tissue culture cells including HepG2, Chang liver and SK hepatoma cells. Recombinant TFPI has been expressed in mouse C127 cells, baby hamster kidney cells, Chinese hamster ovary cells and human SK hepatoma cells. Recombinant TFPI from the mouse C127 cells has been shown in animal models to inhibit tissue-factor induced coagulation. Frequently, however, TFPI produced in mammalian cells is degraded by proteolytic cleavage. The protein is most often cleaved at the arginine at positions 83 and 199.
A non-glycosylated form of recombinant TFPI has been produced and isolated from Escherichia coli (E. coli) cells as disclosed in U.S. Pat. No. 5,212,091. This form of TFPI has been shown to be active in the inhibition of bovine factor Xa and in the inhibition of human tissue factor-induced coagulation in plasma. In some assays, the E. coli-produced TFPI has been shown to be more active than TFPI derived from SK hepatoma cells. However, TFPI produced in E. coli cells is frequently modified in ways that increase heterogeneity of the protein. These modifications include proteolytic degradation, carbamylation, and N-terminal modifications. Different forms of TFPI may also be found resulting from inappropriate internal translation initiation by E. coli ribosomes.
Methods have also been disclosed for purification of TFPI from yeast cell culture medium, such as in Petersen et al, J. Biol. Chem. 18:13344-13351 (1993). In these cases, recombinant TFPI is secreted from the yeast cell. TFPI recovered in such protocols is also frequently heterogeneous due perhaps to proteolytic degradation and variable glycosylation. Therefore, a need exists in the art to produce mature TFPI that is authentic (i.e. having the correct N-terminal amino acid sequence), full-length and homogeneous.
SUMMARY OF THE INVENTIONThe invention relates to a method for producing factor VIIa/TF/Xa binding proteins, including TFPI, TFPI-2, and muteins thereof, the method including the steps of incubating yeast cells transformed with a replicable cloning vehicle, the replicable cloning vehicle comprising a first nucleotide sequence encoding the factor VIIa/TF/Xa binding protein, under conditions favorable for production of the factor VIIa/TF/Xa binding protein, wherein the factor VIIa/TF/Xa binding protein is retained within the yeast cell, preparing an insoluble fraction of the transformed yeast cells containing the factor VIIa/TF/Xa binding protein, and isolating the factor VIIa/TF/Xa binding protein contained in the insoluble fraction. The DNA encoding the factor VIIa/TF/Xa binding protein may be immediately preceded in frame by a second nucleotide seqence, the first and said second nucleotide sequences together encoding a fusion peptide, the fusion peptide capable of being cleaved within the yeast cells to produce authentic factor VIIa/TF/Xa binding protein. The second nucleotide sequence may encode ubiquitin. The yeast cells may be from the genus Saccharomyces, particularly Saccharomyces cerevisiae and may have a genotype selected from the group consisting of: VH6, AB122, and JSC310.
The invention also relates to the factor VIIa/TF/Xa binding protein produced by the method of the invention. Where the factor VIIa/TF/Xa binding protein is a mutein of TFPI, the mutein of TFPI may have an arginine in the P1-reactive site of Kunitz-type domain 1.
BRIEF DESCRIPTION OF THE DRAWINGSFIG. 1A and 1B show the activity of TFPI produced by the method of the invention.
FIG. 2 depicts a schematic of a replicable cloning vehicle (designated pLACI 4.1) including a DNA sequence coding for the TFPI protein.
FIG. 3 depicts sequence encoding a ubiquitin-TFPI fusion protein [SEQ ID NO: 1] used to produce TFPI containing the authentic primary sequence in the method of the invention.
FIG. 4 shows a Coomassie stained PAGE gel of TFPI contained in an insoluble fraction within yeast cells after an initial purification.
DETAILED DESCRIPTION OF THE INVENTIONAs used herein, the term “factor VIIa/TF/Xa binding protein” refers to proteins capable of binding to the factor VIIa/TF complex thereby inhibiting the function of the complex and further capable of binding factor Xa thereby inhibiting its function. Full-length mature TFPI, TFPI-2 and muteins thereof are encompassed by this term. Preferably, the factor VIIa/TF/Xa binding protein is TFPI.
It has now been found that production of factor VIIa/TF/Xa binding proteins, specifically TFPI in yeast, wherein the TFPI is not secreted but is retained within the cells in an insoluble fraction, leads to recovery of authentic (i.e. having the correct N-terminal amino acid sequence), full-length and homogeneous TFPI. As used herein, the term “TFPI” refers to the 276 amino acid polypeptide as described in Girard et al, Nature, 338:518-520 (1989). As used herein, TFPI-2 refers to the 213 amino acid polypeptide as described in Sprecher et al, Proc. Nat. Acad. Sci., USA 91:3353-3357 (1994).
Yeast expression systems that can be used in the present invention for the production of factor VIIa/TF/Xa binding protein are known to one of ordinary skill in the art. Such expression systems require, at a minimum, a yeast promoter which is a DNA sequence that is capable of binding yeast RNA polymerase and initiating the downstream (5′-3′) transcription of a coding sequence (e.g. DNA encoding TFPI or TFPI-2) into mRNA. The promoter herein will have a transcription initiation region which is usually placed proximal to the 5′ end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site (the “TATA box”) and a transcription initiation site. A yeast promoter herein may also have a second domain called an upstream activator sequence (UAS), which, if present, is usually distal to the structural gene (i.e. further upstream) relative to the transcription initiation region. The UAS also governs regulation of expression. Regulated expression may be either positive or negative, thereby either enhancing or reducing transcription as desired.
Yeast is a fermenting organism with an active metabolic pathway, therefore sequences encoding enzymes in the metabolic pathway provide particularly useful promoter sequences for the purpose of the present invention. Examples include alcohol dehydrogenase (ADH) (EPO Publ. No. 284 044), enolase, glucokinase, glucose-6-phosphate isomerase, glyceraldehyde-3-phosphate-dehydrogenase (GAP or GAPDH), hexokinase, phosphofructokinase, 3-phosphoglycerate mutase, and pyruvate kinase (PyK) (EPO Publ. No. 329 203). The yeast PHO5 gene, encoding acid phosphatase and described in Myanohara et al Proc. Natl. Acad. Sci. USA 80:1 (1983), also provides useful promoter sequences for the present invention.
In addition, synthetic promoters which do not occur in nature also function as yeast promoters herein. For example, UAS sequences of one yeast promoter may be joined with the transcription activation region of another yeast promoter, creating a hybrid promoter. Examples of such hybrid promoters include the ADH regulatory sequence linked to the GAP transcription activation region as described in U.S. Pat. Nos. 4,876,197 and 4,880,734, the disclosures of which are herein incorporated by reference. Other examples of hybrid promoters include promoters which consist of the regulatory sequences of either the ADH2, GAL4, GAL10, OR PHO5 genes, combined with the transcriptional activation region of a glycolytic enzyme gene such as GAP or PyK, as described in EPO Publ. No. 164 556. Furthermore, a yeast promoter can include naturally occurring promoters of non-yeast origin that have the ability to bind yeast RNA polymerase and initiate transcription. Examples of such promoters include those described in the following references: Cohen et al, Proc. Natl. Acad. Sci. USA 77:1078 (1980); Henikoff et al, Nature 283:835 (1981); Hollenberg et al, Curr. Topics Microbiol. Immunol. (1981) 96:119; Hollenberg et al, “The Expression of Bacterial Antibiotic Resistance Genes in the Yeast Saccharomyces cerevisiae,” in: Plasmids of Medical Environmental and Commercial Importance (eds. K. N. Timmis and A. Puhler) (1979); Mercerau-Puigalon et al, (1980) Gene 11:163; Panthier et al, Curr. Genet. 2:109 (1980).
The production of fusion proteins in a yeast expression system is preferred for the purpose of the present invention. More specifically, a DNA sequence encoding the N-terminal portion of an endogenous yeast protein, or other stable protein, is fused to the 5′ end of the factor VIIa/TF/Xa binding protein encoding sequences. Upon expression, this construct will provide a fusion of the two amino acid sequences. For example, the yeast or human superoxide dismutase (SOD) gene, can be linked at the 5′ terminus of the TFPI gene and the resulting fusion protein expressed in yeast. The DNA sequence at the junction of the two amino acid sequences may or may not encode a cleavable site as described in EPO Publ. No. 196 056. Preferably, the site is cleavable. A preferred fusion protein is a ubiquitin-TFPI fusion protein. Such a fusion protein is made with the ubiquitin sequence that preferably retains a site for a processing enzyme which allows a ubiquitin-specific processing protease to cleave the ubiquitin from the desired polypeptide. Through this method, therefore, mature factor VIIa/TF/Xa binding protein having an authentic amino terminus can be produced in and isolated from within the yeast cell. Use of the ubiquitin protein fusion technique is reviewed in Barr ei al, in RECOMBINANT SYSTEMS IN PROTEIN EXPRESSION (Elsevier Science Publishers B.V., 1991), pp. 37-46.
Usually, transcription termination sequences recognized by yeast are regulatory regions located 3′ to the translation stop codon and, together with the promoter, flank the coding sequence. These sequences direct the transcription of an mRNA which can be translated into the polypeptide encoded by the DNA. Yeast-recognized termination sequences from genes, such as those coding for alpha-factor and for glycolytic enzymes, can be used herein.
Usually, the above described components, comprising a promoter, optionally a leader, the factor VIIa/TF/Xa binding protein encoding sequence, and transcription termination sequence, are put together into expression constructs. Expression constructs herein can be maintained in a replicon, such as an extrachromosomal element (e.g., a plasmid) capable of stable maintenance in a host, such as yeast or bacteria. The replicon may have two replication systems, thus allowing the replicon to be maintained, for example, in yeast for expression and in a procaryotic host for cloning and amplification. Examples of such yeast-bacteria shuttle vectors that are useful herein include YEp24 as described in Botstein et al, (1979) Gene 8:17-24; pCl/1, as described in Brake et al, (1984) Proc. Natl. Acad. Sci USA 81:4642-4646; and YRp17, as described in Stinchcomb et al, (1982) J. Mol. Biol. 158:157. In addition, a replicon may be either a high or low copy number plasmid. A high copy number plasmid will generally have a copy number ranging from about 5 to about 200, and usually about 10 to about 150. Either a high or low copy number vector may be selected, depending upon the effect of the vector and the foreign protein on the host. See e.g., Brake et al, supra.
Alternatively, the expression constructs can be integrated into the yeast genome with an integrating vector. Integrating vectors usually contain at least one sequence homologous to a yeast chromosome that allows the vector to integrate, and preferably contain two homologous sequences flanking the expression construct. Integrations appear to result from recombinations between homologous DNA in the vector and the yeast chromosome. An integrating vector may be directed to a specific locus in yeast by selecting the appropriate homologous sequence for inclusion in the vector, as described in Orr-Weaver et al, Methods in Enzymol. 101:228-245 (1983). One or more expression construct may integrate, possibly affecting levels of recombinant protein produced. Rine et al, Proc. Natl. Acad. Sci. USA 80:6750 (1983). The chromosomal sequences included in the vector can occur either as a single segment in the vector, which results in the integration of the entire vector, or two segments homologous to adjacent segments in the chromosome and flanking the expression construct in the vector, which can result in the stable integration of only the expression construct.
Usually, extrachromosomal and integrating expression constructs may contain selectable markers to allow for the selection of yeast strains that have been transformed. Selectable markers may include biosynthetic genes that can be expressed in the yeast host, such as ADE2, HIS4, LEU2, TRP1, and ALG7, and the G418 resistance gene, which confer resistance in yeast cells to tunicamycin and G418, respectively. In addition, a suitable selectable marker may also provide yeast with the ability to grow in the presence of toxic compounds, such as metal. For example, the presence of CUP1 allows yeast to grow in the presence of copper ions as described in Butt et al, Microbiol. Rev. 51:351 (1987).
Alternatively, the above described components can be put together into transformation vectors. Transformation vectors are usually comprised of a selectable marker that is either maintained in a replicon or developed into an integrating vector, as described above.
Expression and transformation vectors, either extrachromosomal replicons or integrating vectors, have been developed for transformation into many yeasts. For example, expression vectors have been developed for, inter alia, the following yeasts: Candida albicans (Kurtz, et al, Mol. Cell. Biol. 6:142 (1986)), Candida maltosa (Kunze, et al, J. Basic Microbiol. 25:141 (1985)), Hansenula polymorpha (Gleeson, et al, J. Gen. Microbiol. 132:3459 (1986); Roggenkamp et al, Mol. Gen. Genet. 202:302 (1986)), Kluyveromyces fragilis (Das, et al, J. Bacteriol. 158:1165 (1984)), Kluyveromyces lactis (De Louvencourt etal, J. Bacteriol. 154:737 (1983); Van den Berg et al, Bio/Technology 8:135 (1990)), Pichia guillerimondii (Kunze et al, J. Basic Microbiol. 25:141 (1985)), Pichia pastoris (Cregg, et al, Mol. Cell. Biol. 5:3376 (1985); U.S. Pat. Nos. 4,837,148 and 4,929,555), Saccharomyces cerevisiae (Hinnen et al, Proc. Natl. Acad. Sci. USA 75:1929 (1978); Ito et al, J. Bacteriol. 153:163 (1983)), Schizosaccharomyces pombe (Beach and Nurse, Nature 300:706 (1981)), and Yarrowia lipolytica (Davidow, et al, Curr. Genet. 10:380471(1985) and Gaillardin, et al, Curr. Genet. 10:49 (1985)).
Transformation procedures that may be used herein to transform yeast cells include electroporation, as described in “Guide to Yeast Genetics and Molecular Biology,” Vol 194 METHODS IN ENZYMOLOGY, C. Guthrie and G. R. Fink, (Academic Press 1991). Other procedures include the transformation of spheroplasts or the transformation of alkali cation-treated intact cells. Such procedures are described in, for example, Kurtz et al, Mol. Cell. Biol. 6:142 (1986); Kunze et al, J. Basic Microbiol. 25:141 (1985), for Candida; Gleeson et al, J. Gen. Microbiol. 132:3459 (1986); Roggenkamp et al., Mol. Gen. Genet. 202:302, for Hansenula (1986); Das et al, J. Bacteriol. 158:1165(1984); De Louvencourt et al, J. Bacteriol. 154:1165 (1983); Van den Berg et al, Bio/Technology 8:135 (1990) for Kluyveromyces; Cregg et al, Mol. Cell. Biol. 5:3376 (1985); Kunze et al, J. Basic Microbiol. 25:141 (1985); U.S. Pat. No. 4,837,148 and U.S. Pat. No. 4,929,555, for Pichia; Hinnen et al, Proc. Natl. Acad. Sci. USA 75:1929 (1978); Ito et al, J. Bacteriol. 153:163 (1983), for Saccharomyces; Beach and Nurse Nature 300:706 (1981), for Schizosaccharomyces; Davidow et al, Curr. Genet. 10:39 (1985); Gaillardin et al, Curr. Genet. 10:49 (1985), for Yarrowia.
Muteins of TFPI or TFPI-2 may also be prepared according to the method of the invention. Muteins within the scope of this definition include: (a) TFPI or TFPI-2 muteins having 1-5 conservative amino acid substitutions that do not substantially change the conformation of the molecule; (b) TFPI or TFPI-2 muteins with amino acid substitutions that eliminate one or more of the sites for N-linked glycosylation; (c) TFPI muteins having 1-5 amino acid substitutions that change a residue of TFPI to a corresponding residue of TFPI-2; (d) TFPI-2 muteins having 1-5 amino acid substitutions that change a residue of TFPI-2 to a corresponding residue of TFPI; (e) TFPI or TFPI-2 muteins with amino acid substitutions in P1-reactive sites in one or more Kunitz-type domains; and (f) TFPI or TFPI-2 muteins with amino acid substitutions at positions within 5 amino acids of the P1-reactive sites in one or more Kunitz-type domains. In a preferred embodiment, the lysine residue in the P1-reactive site of the first Kunitz-type domain of TFPI is replaced with arginine. The mutein has the following sequence:
| [SEQ ID NO: 3] |
| Asp Ser Glu Glu Asp Glu Glu His Thr Ile Ile Thr Asp Thr Glu Leu | |
| Pro Pro Leu Lys Leu Met His Ser Phe Cys Ala Phe Lys Ala Asp Asp | |
| Gly Pro Cys Arg Ala Ile Met Lys Arg Phe Phe Phe Asn Ile Phe Thr | |
| Arg Gln Cys Glu Glu Phe Ile Tyr Gly Gly Cys Glu Gly Asn Gln Asn | |
| Arg Phe Glu Ser Leu Glu Glu Cys Lys Lys Met Cys Thr Arg Asp Asn | |
| Ala Asn Arg Ile Ile Lys Thr Thr Leu Gln Gln Glu Lys Pro Asp Phe | |
| Cys Phe Leu Glu Glu Asp Pro Gly Ile Cys Arg Gly Tyr Ile Thr Arg | |
| Tyr Phe Tyr Asn Asn Gln Thr Lys Gln Cys Glu Arg Phe Lys Tyr Gly | |
| Gly Cys Leu Gly Asn Met Asn Asn Phe Glu Thr Leu Glu Glu Cys Lys | |
| Asn Ile Cys Glu Asp Gly Pro Asn Gly Phe Gln Val Asp Asn Tyr Gly | |
| Thr Gln Leu Asn Ala Val Asn Asn Ser Leu Thr Pro Gln Ser Thr Lys | |
| Val Pro Ser Leu Phe Glu Phe His Gly Pro Ser Trp Cys Leu Thr Pro | |
| Ala Asp Arg Gly Leu Cys Arg Ala Asn Glu Asn Arg Phe Tyr Tyr Asn | |
| Ser Val Ile Gly Lys Cys Arg Pro Phe Lys Tyr Ser Gly Cys Gly Gly | |
| Asn Glu Asn Asn Phe Thr Ser Lys Gln Glu Cys Leu Arg Ala Cys Lys | |
| Lys Gly Phe Ile Gln Arg Ile Ser Lys Gly Gly Leu Ile Lys Thr Lys | |
| Arg Lys Arg Lys Lys Gln Arg Val Lys Ile Ala Tyr Glu Glu Ile Phe | |
| Val Lys Asn Met. |
Muteins may be prepared by appropriate mutagenesis of the sequence of the recombinant cloning vehicle encoding TFPI or TFPI-2. Techniques for mutagenesis include, without limitation, site specific mutagenesis. Site-specific mutagenesis can be carried out using any number of procedures known in the art. These techniques are described, for example, by Smith, 1985, Annual Review of Genetics, 19:423, and modifications of some of the techniques are described in Methods in Enzymology, 154, part E, (eds.) Wu and Grossman (1987), chapters 17, 18, 19, and 20. Site specific mutagenesis may also be carried out using the Gapped Duplex site-directed mutagenesis method. The general procedure is described by Kramer, et al., in chapter 17 of the Methods in Enzymology, supra. Other techniques for generating point mutations in a nucleic acid sequence PCR techniques, including overlapping PCR, are decribed in PCR PROTOCOLS: A GUIDE TO METHODS AND APPLICATIONS, (eds.) Innis, Gelfand, Sninsky and White (Academic Press, 1990).
Formulation and Administration
LACI made by the method of the invention may be administered at a concentration that is therapeutically effective to treat and prevent septic shock. To accomplish this goal, the LACI made by the method of the invention is preferably administered intravenously. Methods to accomplish this administration are known to those of ordinary skill in the art.
Before administration to patients, formulants may be added to the LACI made by the method of the invention. A liquid formulation may be used. For example, these formulants may include oils, polymers, vitamins, carbohydrates, amino acids, salts, buffers, albumin, surfactants, or bulking agents. Carbohydrates which may be used in the formulation include sugar or sugar alcohols such as mono, di, or polysaccharides, or water soluble glucans. The saccharides or glucans can include fructose, dextrose, lactose, glucose, mannose, sorbose, xylose, maltose, sucrose, dextran, pullulan, dextrin, alpha and beta cyclodextrin, soluble starch, hydroxethyl starch and carboxymethylcellulose, or mixtures thereof Sucrose is most preferred. Sugar alcohol is defined as a C4 to C8 hydrocarbon having an —OH group and includes galactitol, inositol, mannitol, xylitol, sorbitol, glycerol, and arabitol. Mannitol is most preferred. These sugars or sugar alcohols mentioned above may be used individually or in combination. There is no fixed limit to amount used as long as the sugar or sugar alcohol is soluble in the aqueous preparation. Preferably, the sugar or sugar alcohol concentration is between 1.0 w/v % and 7.0 w/v %, more preferable between 2.0 and 6.0 w/v %. Preferably amino acids include levorotary (L) forms of carnitine, arginine, and betaine; however, other amino acids may be added. Preferred polymers include polyvinylpyrrolidone (PVP) with an average molecular weight between 2,000 and 3,000, or polyethylene glycol (PEG) with an average molecular weight between 3,000 and 5,000. It is also preferred to use a buffer in the composition to minimize pH changes in the solution before lyophilization or after reconstitution. Most any physiological buffer may be used, but citrate, phosphate, succinate, and glutamate buffers or mixtures thereof are preferred. Most preferred is a citrate buffer. Further, the use of sulfates should be avoided in preparation of the formulation. Preferably, the concentration is from 0.01 to 0.3 molar. Surfactants that can be added to the formulation are shown in EP Nos. 270,799 and 268,110.
Additionally, the LACI made by the method of the invention can be chemically modified by covalent conjugation to a polymer to increase its circulating half-life, for example. Preferred polymers, and methods to attach them to peptides, are shown in U.S. Pat. Nos. 4,766,106, 4,179,337, 4,495,285, and 4,609,546 which are all hereby incorporated by reference in their entireties. Preferred polymers are polyoxyethylated polyols and polyethyleneglycol (PEG). PEG is soluble in water at room temperature and has the general formula: R(O—CH2—CH2)nO—R where R can be hydrogen, or a protective group such as an alkyl or alkanol group. Preferably, the protective group has between 1 and 8 carbons, more preferably it is methyl. The symbol n is a positive integer, preferably between 1 and 1,000, more preferably between 2 and 500. The PEG has a preferred average molecular weight between 1000 and 40,000, more preferably between 2000 and 20,000, most preferably between 3,000 and 12,000. Preferably, PEG has at least one hydroxy group, more preferably it is a terminal hydroxy group. It is this hydroxy group which is preferably activated to react with a free amino group on the inhibitor. However, it will be understood that the type and amount of the reactive groups may be varied to achieve a covalently conjugated PEG/LACI.
Water soluble polyoxyethylated polyols are also useful in the present invention. They include polyoxyethylated sorbitol, polyoxyethylated glucose, polyoxyethylated glycerol (POG), etc. POG is preferred. One reason is because the glycerol backbone of polyoxyethylated glycerol is the same backbone occurring naturally in, for example, animals and humans in mono-, di-, triglycerides. Therefore, this branching would not necessarily be seen as a foreign agent in the body. The POG has a preferred molecular weight in the same range as PEG. The structure for POG is shown in Knauf et al., 1988, J. Bio. Chem. 263:15064-15070, and a discussion of POG/protein conjugates is found in U.S. Pat. No. 4,766,106, both of which are hereby incorporated by reference in their entireties.
After the liquid pharmaceutical composition is prepared, it is preferably lyophilized to prevent degradation and to preserve sterility. Methods for lyophilizing liquid compositions are known to those of ordinary skill in the art. Just prior to use, the composition may be reconstituted with a sterile diluent (Ringer's solution, distilled water, or sterile saline, for example) which may include additional ingredients. Upon reconstitution, the composition is preferably administered to subjects using those methods that are known to those skilled in the art.
Administration to Affected Individuals
LACI made by the method of the invention is useful to treat mammals with sepsis or septic shock. Generally, conditions are characterized by high fever (>38.5° C.) or hypothermia (>35.5° C.), low blood pressure, tachypnea (>20 breaths/minute), tachycardia (>100 beats/minute), leukocytosis (>15,000 cells/mm3) and thrombocytopenia (<100,000 platelets/mm3). The LACI made by the method of the invention is preferably administered as soon as the subject is suspected of being septic; presenting a >20% drop in fibrinogen or appearance of fibrin split products, a rise in the subject's temperature and the diagnosis of leukopenia and hypotension associated with septic shock. As stated above, intravenous administration is preferred. Generally, LACI made by the method of the invention is given at a dose between 1 μg/kg and 20 mg/kg, more preferably between 20 μg/kg and 10 mg/kg, most preferably between 1 and 7 mg/kg. Preferably, it is given as a bolus dose, to increase circulating levels by 10-20 fold and for 4-6 hours after the bolus dose. Continuous infusion may also be used after the bolus dose. If so, LACI may be infused at a dose between 5 and 20 μg/kg/minute, more preferably between 7 and 15 μg/kg/minute.
The LACI made by the method of the invention may be given in combination with other agents which would be effective to treat septic shock. For example, the following may be administered in combination with the LACI made by the method of the invention: antibiotics that can treat the underlying bacterial infection; monoclonal antibodies that are directed against bacterial cell wall components; monoclonal antibodies and soluble receptors that can complex with cytokines that are involved in the sepsis pathway, including, but not limited to tumor necrosis factor (TNF), Interleukin-1, γ-interferon and interleukin-8; and generally any agent or protein that can interact with cytokines or complement proteins in the sepsis pathway to reduce their effects and to attenuate sepsis or septic shock.
Antibiotics useful in the present invention include those in the general category of: beta-lactam rings (penicillin), amino sugars in glycosidic linkage (amino glycosides), macrocyclic lactone rings (macrolides), polycyclic derivatives of napthacenecarboxamide (tetracyclines), nitrobenzene derivatives of dichloroacetic acid, peptides (bacitracin, gramicidin, and polymyxin), large rings with a conjugated double bond system (polyenes), sulfa drugs derived from sulfanilarnide (sulfonamides), 5-nitro-2-furanyl groups (nitrofurans), quinolone carboxylic acids (nalidixic acid), and many others. Other antibiotics and more versions of the above specific antibiotics may be found in Encyclopedia of Chemical Technology, 3rd Edition, Kirk-Othymer (ed.), Vol. 2, pages 782-1036 (1978) and Vol. 3, pages 1-78, Zinsser, MicroBiology, 17th Edition W. Joklik et al (Eds.) pages 235-277 (1980), or Dorland's Illustrated Medical Dictionary, 27th Edition, W.B. Saunders Company (1988).
Other agents which may be combined with the LACI made by the method of the invention include monoclonal antibodies directed to cytokines involved in the sepsis pathway, such as those monoclonal antibodies directed to IL-6 or M-CSF, such as shown in PCT US90/07411; monoclonal antibodies directed to TNF, such as shown in U.S. Pat. No. 4,603,106; inhibitors of proteins that cleave the mature TNF prohormone from the cell in which it was produced, such as shown in PCT US90/03266 and PCT US93/06120; antagonists of IL-1, such as shown in PCT US91/02460; inhibitors of IL-6 cytokine action such as activin, such as shown in PCT US90/00321; and receptor based inhibitors of various cytokine such as IL-1. Antibodies to or small molecule inhibitors of complement protein may also be employed.
Generally, the LACI made by the method of the invention may be useful for those diseases that occur due to the up-regulation of tissue factor brought on by injury, trauma, endotoxin, TNF, cancer, IL-1 or other agents or conditions.
The present invention will now be illustrated by reference to the following examples which set forth particularly advantageous embodiments. However, it should be noted that these embodiments are illustrative and are not to be construed as restricting the invention in any way.
EXAMPLES Example 1The shuttle vector pBS24 is described in Barr et al, EXPRESSION SYSTEMS & PROCESSES FOR rDNA PRODUCTS (American Chemical Society, 1991), pp 51-64). pBS24Ub is a derivative of pBS24.1, and contains an expression cassette flanked by unique Bam HI and Sal I restriction sites, the glucose regulatable ADH2/GAP promoter and a synthetic ubiquitin (Ub) gene. For construction of Ub fusions, a unique SstII site is generated in the 3′ end of the Ub gene. The presence of the SstII site allows in-frame insertion of nucleotide sequences for expression as ubiquitin fusion peptides. Insertion can be accomplished by use of synthetic DNA adapters or PCR methodologies. In either case, the 5′-junction sequence will be:
| [SEQ ID NO: 4] |
| ARG GLY GLY | ||
| C CGC GGY GGC | ||
| G GCG CCA CCG | ||
| SstII |
PCR was used to construct the ubiquitin/TFPI gene fusion in the 15.4 kb plasmid pLACI 4.1 shown in FIG. 3. TFPI encoding nucleic acid was amplified using standard PCR procedures with the primers LACI4 and LACI3. LACI4 hybridizes to the 10 nucleotides at the 5′ end of nucleic acid mature encoding TFPI and also contains ubiquitin sequence with the SstII restriction site. LACI3 hybridizes to the 15 nucleotides at the 3′ end of nucleic acid encoding mature TFPI and also trailing sequence with a Sal I restriction site. The sequences of these primers are as follows:
| LACI4 | GCTCCGCGGTGGCGATTCTGAGG | [SEQ ID NO: 5] | ||
| LACI3 | TCTGTCGACTCACATATTTTTAAC | [SEQ ID NO: 6] |
pLACI 4.1 was used to transform three strains of Saccharomyces cerevisiae: VH6 (MAT α, cir°, lett-2-112,-3, ura3, FoA, pep4::His3), AB122 (MAT α, cir°, leu2, ura3-52, prb1-1112, pep4-3, prc1-407) and JSC310 (as AB122, +ADR1 overexpression). Transformants of VH6 produced TFPI at levels of approximately 5% of total protein, transformants of AB122 produced TFPI at levels of approximately 10% of total protein and transformants of JSC310 produced TFPI at levels of approximately 15% of total protein. The stability of TFPI is somewhat surprising in view of prior studies showing that proteins synthesized as ubiquitin fusions and having N-terminal aspartate after removal of the ubiquitin are unstable in the yeast cell (e.g. half-life <3 min.). See Finley, “The Yeast Ubiquitin System” in: The Molecular and Cellular Biology of the Yeast Saccharomyces: Gene Expression. (1992).
Example 2Part A
TFPI was purified from S. cerevisiae VH6 cells according to the method disclosed in U.S. Pat. No. 5,212,091, which is herein incorporated by reference, specifically at columns 9-10. An insoluble fraction (also referred to as a membrane fraction) was prepared by Dyno-Mill glass bead extraction in TEN (50 mM Tris.HCl pH7.8; 50 mM NaCl; 5 mM EDTA). Approximately 3 μg of total protein from this fraction was run out on 14% SDS-PAGE gel and transferred to nitrocellulose membranes. The nitrocellulose blots were probed with rabbit polyclonal antisera generated to the first fifteen amino acids of the mature TFPI peptide sequence. The resulting blot (FIG. 5) shows a significant band of homogeneous, full-length TFPI. Expression of TFPI into the insoluble fraction was also verified using comparative Coomassie-stained 14% SDS-PAGE gels. (See FIG. 4). Yeast cells were grown with plasmid-containing DNA encoding the TFPI protein, or with the identical plasmid without DNA encoding the TFPI protein. Approximately 10 μg of yeast whole cell lysate or insoluble fraction from the two cultures was loaded onto the gel. A unique 36 kD band was detected only in the lanes prepared from cultures carrying the TFPI-producing plasmid.
Sulfonation and Q Sepharose® fractionation were performed as specified in U.S. Pat. No. 5,212,091. Refolding of the isolated TFPI was also performed essentially as described except that dialysis was performed in 5 M urea, 0.3 M NaCl, 20 mM Tris.HCl pH 7.8, 0.04% NP40, 2 mM L-cysteine, 0.5 mM EDTA for 4-6 at room temperature and then 4° C. overnight, after which dialysis bags were transferred to 2 M urea, 1 mM L-cysteine for 48 hours at 4° C. For S Sepharose® fractionation, the refolded TFPI was equilibrated in 2 M urea, 50 mM NaPO4, 0.1 M NaCl prior to column loading. Wash buffer contained 2 M urea, 50 mM NaPO4, 0.25 M NaCl and TFPI was step-eluted with buffer containing 2 M urea, 50 mM NaPO4, 0.8 M NaCl. Fractions containing TFPI were pooled and dialyzed against PBS/1.5 M urea at 4° C. overnight.
N-terminal sequencing of the product recovered by this method gave the following correct sequence:
Asp Ser Glu Glu Asp Glu Glu His Thr Ile Ile Thr Asp Thr Glu Leu Pro Pro [SEQ ID NO: 6]
corresponding to authentic mature TFPI at >90% purity.
The recovered product was also tested in the factor Xa amidolytic assay and prothrombin time clotting assays (both described in Wun et al, J. Biol. Chem. 265:16096 (1990)) to assess activity. The data from these assays are displayed in FIGS. 1A and 1B, respectively. PBS buffer was used as a control in the factor Xa Inhibition Assay and PBS buffer as well as normal human serum (NHS) were used as controls in the prothrombin clotting assay. The yeast-produced TFPI inhibited factor Xa activity at a 50% inhibitory concentration of approximately 20 ng/ml and displayed an inhibitory concentration in the prothrombin clotting assay of 1 μg/ml. These results indicate that TFPI produced according to the method of the invention is biologically active.
Example 3The method of the invention can also be used to produce TFPI in large scale, i.e. 10 liter or greater batches. Yeast strain AB122 was transformed with pLACI 4.1 and grown in selective medium containing Yeast Nitrogen Base without amino acids (Difco), supplemented with 87 mg/L adenine, 43.5 mg/L L-tryptophan, 43.5 mg/L L-histidine, 43.5 mg/L L-arginine, 43.5 mg/L L-methionine, 65.2 mg/L L-tyrosine, 109 mg/L L-phenylalanine, 65.2 mg/L L-lysine and 8% glucose. Aliquots of the transformed cells were preserved by adding glycerol to 15% and storage at −70° C. S. cerevisiae strain AB122 transformed with pLACI4.1 has was deposited with the ATCC on Jul. 19, 1994 and has been given Accession Number 74291.
Inoculum for the 10 liter fermenter was prepared by addition of 1% v/v frozen, transformed culture into fresh selective media as described in the previous paragraph. The inoculum was then grown in shake flasks for 24-48 hours. Inoculum was then added 0.5% v/v to the contents of a 10 liter fermentation vessel. The media in the vessel contained the following ingredients prior to sterilization:
The contents of the fermentation vessel were then sterilized in situ and the following sterile ingredients added to complete the medium:
During growth of cells in the fermentation vessel, the medium was maintained at a temperature of 30° C. pH 6.0 was maintained by addition of NaOH or phosphoric acid as needed. Agitation was begun at 600 r.p.m. and increased as needed to maintain D.O >30%. Aeration was 1 vvm air. Starting at 15 h after inoculation, a mixture of sterile glucose (25% w/v) and glycerol (6.8% w/v) was added to the fermentor at a rate of 0.1 ml/min/L. At 39 hours, the rate of addition of this mixture was decreased to 0.05 ml/min/L. The culture was terminated at 96 hours. Peak expression of TFPI (1 mg/ml) occurred by 72 h post-inoculation.
The foregoing discussion and examples only illustrate the present invention, persons of ordinary skill in the art will appreciate that the invention can be implemented in other ways, and the invention is defined solely by reference to the claims. Further, all references, patents and patent applications cited in the foregoing specification are incorporated herein by reference.
1-11. (canceled)
12. A method for producing a protein capable of binding a factor VIIa/TF complex, comprising:
(a) transforming yeast cells with a vehicle comprising a first nucleotide sequence encoding a protein comprising the amino acid sequence of TFPI shown in SEQ ID NO:3 or a mutein thereof;
(b) incubating the transformed yeast cells under conditions favorable for production of the protein, wherein the protein is retained within the yeast cells;
(c) preparing an insoluble fraction of the transformed yeast cells containing the protein; and
(d) recovering the protein from the insoluble fraction.
13. The method of claim 12 wherein the amino acid sequence of the protein consists essentially of the amino acid sequence of TFPI shown in SEQ ID NO:3.
14. The method of claim 12 wherein the protein is a mutein of TFPI.
15. The method of claim 12 wherein the protein consists essentially of a mutein of TFPI.
16. The method of claim 12 wherein the first nucleotide sequence is preceded in frame by a second nucleotide sequence, wherein said first and said second nucleotide sequences together encode a fusion protein capable of being cleaved within the yeast cells to release the protein capable of binding the factor VIIa/TF complex.
17. The method of claim 16 wherein the second nucleotide sequence encodes ubiquitin.
18. The method of claim 16 wherein the second nucleotide sequence encodes superoxide dismutase.
19. A method for producing a protein capable of binding factor Xa, comprising:
(a) transforming yeast cells with a vehicle comprising a first nucleotide sequence encoding a protein comprising the amino acid sequence of TFPI shown in SEQ ID NO:3 or a mutein thereof;
(b) incubating the transformed yeast cells under conditions favorable for production of the protein, wherein the protein is retained within the yeast cells;
(c) preparing an insoluble fraction of the transformed yeast cells containing the protein; and
(d) recovering the protein from the insoluble fraction.
20. The method of claim 19 wherein the amino acid sequence of the protein consists essentially of the amino acid sequence of TFPI shown in SEQ ID NO:3.
21. The method of claim 19 wherein the protein is a mutein of TFPI.
22. The method of claim 19 wherein the protein consists essentially of a mutein of TFPI.
23. The method of claim 19 wherein the first nucleotide sequence is preceded in frame by a second nucleotide sequence, wherein said first and said second nucleotide sequences together encode a fusion protein capable of being cleaved within the yeast cells to release the protein capable of binding the factor Xa.
24. The method of claim 23 wherein the second nucleotide sequence encodes ubiquitin.
25. The method of claim 23 wherein the second nucleotide sequence encodes superoxide dismutase.