US20050112641A1
2005-05-26
10/952,915
2004-09-30
The invention relates to a composition of polypeptides, characterized in that it contains at least one protein or part of a protein selected from the sequences of amino acids identified in the list of the sequences as SEQ ID NO 1 (VanH), SEQ ID NO 2 (VanA), SEQ ID NO 3 (VanX) or SEQ ID NO 19 (VanC), or any protein or part of a protein recognized by the antibodies directed against VanH, VanA, VanX or VanC, or any protein or part of a protein encoded in a sequence hybridizing with one of the nucleotide sequences identified in the list of the sequences as SEQ ID NO 8, SEQ ID NO 9 or SEQ ID NO 10 or with one of the following sequences V1 or V2 under stringent or only slightly stringent conditions:
| V1: | GGX | GAA | GAT | GGX | TCX | TTX | CAA | GGX |
| G | C | AG | C | G | ||||
| A | ||||||||
| V2: | AAT | ACX | ATX | CCX | GGX | TTT | AC | |
| C | T | C | ||||||
| C |
Get notified when new applications in this technology area are published.
C12N9/0004 » CPC main
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes Oxidoreductases (1.)
C07K14/315 » CPC further
Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
C07K16/1267 » CPC further
Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-positive bacteria
C12N9/00 » CPC further
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes
C12N15/52 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; DNA or RNA fragments; Modified forms thereof Genes encoding for enzymes or proenzymes
C12N15/65 » CPC further
Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor; Recombinant DNA-technology; Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
C12Q1/689 » CPC further
Measuring or testing processes involving enzymes, nucleic acids or microorganisms ; Compositions therefor; Processes of preparing such compositions involving nucleic acids; Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
The invention relates to the polypeptides associated with the expression of resistance to antibiotics of the glycopeptide family, in particular in Gram-positive bacteria, in particular in the family of the Gram-positive cocci. The invention also relates to a nucleotide sequence coding for these polypeptides. It also relates to the use of these polypeptides and their nucleotide sequence as agents for the in vitro detection of resistance to glycopeptides. Among the Gram-positive cocci, the invention relates most particularly to the enterococci, the streptococci and the staphylococci which are of particular importance for the implementation of the invention.
The glycopeptides, which include vancomycin and teicoplanin are antibiotics which inhibit the synthesis of the bacterial cell wall. These antibiotics are very much used for the treatment of severe infections due to Gram-positive cocci (enterococci, streptococci and staphylococci), in particular in the of allergy and resistance to the penicillins. In spite of long clinical usage of vancomycin, this antibiotic has remained active towards almost all of the strains up to 1986, the date at which the first resistant strains were isolated Since then, resistance to the glycopeptides has been detected by many microbiologists in Europe and in the United States, in particular in strains isolated from immunodepressive patients, making necessary a systematic evaluation of the sensitivity of the microbes in hospital environments.
The activity of the glycopeptides depends on the formation of a complex between the antibiotic and the precursors of the peptidoglycan, more than on the direct interaction with enzymes of cell wall metabolism. In particular, it has been observed that the glycopeptides bind to the terminal D-alanyl-D-alanine residues (D-ala-D-ala) of the precursors of the peptidoglycan.
The recent emergence of resistance to the glycopeptides, in particular in the enterococci, has led to certain results being obtained with regard to knowledge of the factors conferring this resistance.
For example it has been observed in a particular strain of enterococci, Enterococcus faecium BM4147, that the determinant of resistance to the glycopeptides is localized on a plasmid of 34 kb, the plasmid pIP816. This determinant has been cloned in E. coli (Brisson Noel et al., 1990, Antimicrob Agents Chemother 34, 924-927).
According to the results hitherto obtained, the resistance to the glycopeptides is associated with the production of a protein of molecular weight of about 40 kDa, the synthesis of this protein being induced by sub-inhibitory concentrations of certain glycopeptides such as vancomycin.
By carrying out a more detailed study of the resistance of certain strains of Gram-positive cocci towards glycopeptides, in particular vancomycin or teicoplanin, the inventors have observed that this resistance might be linked to the expression of several proteins or polypeptides encoded in sequences usually borne by plasmids in the resistant strains. The recent results obtained by the inventors also make it possible to distinguish the genes coding for two phenotypes of resistance, on the one hand strains highly resistant to the glycopeptides, and, on the other, strains with a low level of resistance.
By strain with a high level of resistance is meant a strain of bacteria, in particular a strain of Gram-positive cocci, for which the minimal inhibitory concentrations (MIC) of vancomycin and teichoplaninare higher than 32 and 8 μg/ml, respectively. The MIC of vancomycin towards strains with low-level resistance are included between 16 and 32 μg/ml. These strains are apparently sensitive to teicoplanin.
The inventors have isolated and purified, among the components necessary for the expression of the resistance to the glycopeptides, a particular protein designated VANA or VanA which exhibits a certain homology with D-alanine-D-alanine ligases. VanA is nonetheless functionally distinct from the ligases.
In principle, a gene sequence will be designated by “van . . . and an amino acid sequence by “Van . . . .”
The invention relates to polypeptides or proteins implicated in the expression of resistance to antibiotics of the glycopeptide family and, in particular, to vancomycin and/or teicoplanin as well as to the nucleotide sequences coding for such complexes.
The invention also relates to nucleotide probes which can be used for the detection of resistance to the glycopeptides, in particular by means of the polymerase chain reaction (PCR), or by tests involving antibodies.
The invention relates to a composition of polypeptides, characterized in that it contains at least one protein or part of a protein selected from the amino acid sequences identified in the list of the sequences as SED ID NO 1 (VanH), SEQ ID NO 2 (VanA), SEQ. ID NO 3 (VanX) or SEQ ID NO 19 (VanC), or any protein or part of a protein recognized by the antibodies directed against VanH, VanA, VanX or VanC, or any protein or part of a protein encoded in a sequence hybridizing with one of the nucleotide sequences identified in the list of the sequences as SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10 or SEQ ID NO 21 or with one of the following sequences V1 or V2 under stringent or only slightly stringent conditions:
| V1: | GGX | GAA | GAT | GGX | TCX | TTX | CAA | GGX |
| G | C | AG | C | G | ||||
| A | ||||||||
| V2: | AAT | ACX | ATX | CCX | GGX | TTT | AC | |
| C | T | C | ||||||
| C |
A first particular composition according to the invention implicated in the expression of the resistance to the glycopeptides is characterized in that it comprises at least 3 proteins or any part of one or more of these proteins necessary to confer to Gram-positive bacteria the resistance to antibiotics of the glycopeptide family, in particular to vancomycin and/or teicoplanin or to promote this resistance, in particular in strains of the family of the Gram-positive cocci, these proteins or parts of proteins being
These sequences are also designated, respectively, by ORF3, ORF1 containing the gene VanH, vanA (or ORF2); they characterize the proteins responsible for resistance as obtained from the strain Enterococcus faecium BM4147 described by Leclerq et al (N. Engl. J. Med. 319:157-161).
Another protein, VanC, related to the D-Ala-D-Ala ligases but of different specificity has been characterized in Enterococcus gallinarum BM4173; the vanC gene possesses domains having sufficient homology with the vanA gene for probes corresponding to defined regions of vanA to make possible its detection.
E. gallinarum is a constitutive isolate resistant to low level of vancomycin (Dutka-Malen et al., Antimicrob. Agents Chemother 34 (1990b) 1875-1879).
By the expression “polypeptides” is meant any sequence of amino acids constituting proteins or being of a size less than that of a protein.
The stringent conditions mentioned above are defined according to the usual conditions pertaining to the hybridization of nucleotide sequences. As an example, in the case of the sequences which hybridize with the sequence of the vanA gene (SEQ ID NO 8) it will be possible to apply the following conditions:
The expression of resistance to glycopeptides may be expresses by the persistence of an infection due to microbes usually sensitive to the glycopeptides.
A polypeptide or a protein is necessary for the expression of resistance to the glycopeptides, if its absence makes the strain which contains this polypeptide or this protein more sensitive to the glycopeptides and if this polypeptide or protein is not present in sensitive strains.
Different levels of resistance to the glycopeptides exist in the strains of Gram-positive cocci, in particular.
According to a preferred embodiment of the invention, the polypeptides included in the composition defined above correspond to the combination of the proteins identified in the list of the sequences as SEQ ID NO 1 (VanH), SEQ ID NO 2 (VanA), SEQ ID NO 3 (VanX).
The inventors have thus observed that the expression of resistance to the glycopeptides in Gram-positive bacteria requires the expression of at least three proteins or of polypeptides derived from these proteins.
According to a first particular embodiment of the invention, the polypeptides of the composition are also characterized in that the amino acid sequences necessary for the expression of resistance to antibiotics of the glycopeptide family are under the control of regulatory elements, in particular of the proteins corresponding to the sequences designated by SEQ ID NO 4 and SEQ ID NO 5 in the list of the sequences, and which correspond to a regulatory sequence R and to a sensor sequence S, respectively.
VanS and VanR constitute a two-component regulatory system, VanR being an activator of transcription and VanS stimulating the transcription dependent on VanR. VanS is capable of modulating the level of phosphorylation of VanR in response to the vancomycin present in the external medium and is thus involved in the control of the transcription of the genes for resistance to vancomycin.
These regulatory sequences are in particular capable of increasing the level of resistance, to the extent to which they promote the expression of the proteins responsible for resistance comprised in the polypeptides of the invention.
According to another advantageous embodiment of the invention the polypeptides of the above composition are encoded in the sequence SEQ ID NO 6 identified in the list of the sequences, which represents the sequence coding for the 5 proteins previously described.
Another sequence according to the invention is designated by SEQ ID NO 11 which contains the sequence SEQ ID NO 6 as well as a sequence upstream from SEQ ID NO 6 coding for a transposase (encoded in the (−) strand of the sequence, and a sequence downstream from SEQ ID NO 6 corresponding to the genes vanY and vanZ and at each end reverse repeated sequences of 38 bp. SEQ ID NO 11 constitutes a transpose, the genes of which are implicated at different levels in the establishment of resistance to the glycopeptides.
The invention also relates to the purified proteins belonging to the composition and to the polypeptides described previously. In particular, the invention relates to the purified protein VanA, characterized in that it corresponds to the amino acid sequence SEQ ID NO in the list of the sequences or a protein VanC, encoded in a gene capable of hybridizing with the vanA gene.
The protein VanA contains 343 amino acids and has a calculate molecular mass of 37400 Da. The protein VanC contains 343 amino acids and has a calculated molecular mass of 37504 Da.
Other interesting proteins in the framework of the invention correspond to the sequences identified as SEQ ID NO 1 (VanH), SEQ ID NO 3 (VanX), SEQ ID NO 4 (VanR), SEQ ID NO 5 (VanS) in the list of the sequences.
The sequence identified by the abbreviation SEQ ID NO 1 contains the protein VanH encoded in the gene vanH, this protein contains 322 amino acids and begins with a methionine. This protein is an enzyme implicated in the synthesis of the peptidoglycan and has a molecular mass of 35,754 kDA. VanH exhibits some similarities to dehydrogenases which catalyze the NAD+-dependent oxidation of 2-hydroxy carboxylic acids to form the corresponding 2-keto-carboxylic acids. In fact, the VanH protein might use NADP+rather than NAD+. The VanH protein also contains several residues of reactive sites which probably participate directly in the binding of the substrate and in catalysis. VanH might be implicated in the synthesis of a substrate of the ligase VanA. This substrate of VanA might be a D-α-hydroxy-carboxylic acid, which might be condensed by VanA with D-alanine in the place of a D-amino acid, which might affect the binding of the precursor of the peptidoglycan with vancomycin, as a result of the loss of a hydrogen bond because one of the hydrogen bonds formed between vancomycin and N-acetyl-D-Ala-D-Ala occurs with the NH group of the terminal D-alanine residue. Let it be recalled that “Ala” is the abbreviation for “alanine”.
The inventors have been able to detect some interactions between the proteins VanA and VanH and have in particular been able to describe the following: the nature of the VanA protein (D-alanine: D-alanine ligase with reduced specificity for its substrate) which has made possible resistance to glycopeptides, implies the biosynthesis by VanA of a novel compound different from D-Ala-D-Ala, a peptide which may be incorporated into the peptidoglycans but which is not recognized by vancomycin. In particular, the observation of similarities between the product of the vanH gene and the D-specific α-keto-acid reductases has made it possible to determine that this compound cannot be a D-amino acid but is a D hydroxy acid which when it is bound to D-alanine by VanH, can generate the novel depsipeptide precursor of the peptidoglycan.
The invention also relates to any combination of these different proteins in a resistance complex, as well as to hybrid proteins comprising one or several of the above proteins, or part of these proteins, in combination with a defined amino acid sequence.
Also included in the framework of the invention are nucleotide sequences coding for one of the amino acid sequences described above.
A particular sequence is the nucleotide sequence of about 7.3 kb, corresponding to the HindIII-EcoRI restriction fragment, such as that obtained starting from the plasmid pIP816 described in the publication of Leclerq et al —1988, cited above.
This sequence of 7.3 kb comprises the nucleotide sequence coding for the 3 resistance proteins and the 2 regulatory proteins referred to above. This coding sequence is included in an internal BglII-XbaI fragment. It also comprises a part of the sequences coding for the transposase and the resolvase.
The invention also relates to any nucleotide fragment comprising the above-mentioned restriction fragment as well as any part of the HindIII-EcoRI fragment, in particular the EcoRI-XbaI fragment of about 3.4 kb coding for the 3 resistance proteins or the EcoRV-SacII fragment of about 1.7 kb coding for VanA or also HindIII-EcoRI fragment of about 3.3 kb coding for the 2 regulatory proteins VanR and VanS.
Another definition of a nucleotide sequence of the invention corresponds to a nucleotide fragment containing the following restriction sites in the following order, such as obtained starting from pIP816 mentioned above:
Another nucleotide sequence according to the invention is characterized in that it corresponds to a sequence selected from the sequences identified as SEQ ID NO 7, SEQ ID NO 6, SEQ ID NO 11 or SEQ 20′ ID NO 22, or in that it includes this sequence or any part of this sequence, or also any sequence or part of the sequence of the complementary DNA or any sequence of RNA corresponding to one of these DNAs, capable,
The sequence SEQ ID NO 7 codes for the 3 resistance proteins VanH, VanA and VanX.
The sequence SEQ ID NO 22 and the sequence SEQ ID NO 11 include a transposon shown in FIG. 7a; this transposon contains the genes necessary for the expression of resistance to the glycopeptides as well as the genes associated with this resistance implicated, for example, in the regulation of the expression of the genes necessary to produce the resistance phenotype or implicated in the amount of resistance polypeptide produced.
A specific sequence corresponding to the above definition is one of the following sequences:
| V1: | GGX | GAA | GAT | GGX | TCX | TTX | CAA | GGX |
| G | C | AG | C | G | ||||
| or | A | |||||||
| V2: | AAT | ACX | ATX | CCX | GGX | TTT | AC | |
| C | T | T | ||||||
| C |
V1 and V2 make possible the constitution of probes, if necessary, in combination with other nucleotides, depending on the degree of specificity desired in order to detect vanA and vanC and may also be used as primers in polymerase chain reactions.
Other preferred nucleotide sequences are the sequences SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 21, SEQ ID NO 12 (transposase), SEQ ID NO 13 (resolvase), SEQ ID NO 14 (vanY), SEQ ID NO 15 (vanZ), SEQ ID NO 23 (vanR), SEQ ID NO 24 (vanS) or a variant of one of these sequences provided that it codes for a protein having immunological and/or functional properties similar to those of the proteins encoded in the sequences SEQ ID NO 8 (vanA), SEQ ID NO 9 (vanH), SEQ ID NO 10 (vanX), or SEQ ID NO 21 (vanC), SEQ ID NO 12 (transposase), SEQ ID NO 13 (resolvase), SEQ ID NO 14 (vanY), SEQ ID NO 15 (vanZ), SEQ ID NO 23 (vanR), SEQ ID NO 24 (vanS) or in that it makes possible the detection of strains resistant to antibiotics of the glycopeptide family.
Variants include all of the fragments of the sequences having the following properties.
These sequences code for the resistance proteins VanH, VanA and VanX.
The nucleotide sequence designated by SEQ ID NO 8 corresponds to a DNA fragment of 1029 bp situated between the ATG codon at position 377 and the TGA codon at position 1406 on the plasmid pAT214<FIG. 6).
The invention also relates to a nucleotide sequence coding for the sequence SEQ ID NO 6 corresponding to the sequence coding for the 5 proteins (2 regulatory proteins and 3 resistance proteins), and also comprising the flanking sequences associated with these coding sequences, or comprising this sequence.
Also included in the framework of the invention is a sequence modified with respect to SEQ ID NO 6, characterized in that it lacks the flanking sequences. These flanking sequences are the sequences shown in the following pages and defined as follows:
The sequence designated by SEQ ID NO 6 is also characterized by the fragment bearing the restriction sites in the following order:
The location of the regulatory proteins and the resistance proteins is shown in FIG. 3.
The inventors have identified upstream and downstream from 1 genes vanR, vans, vanH, vanA and vanX, which are necessary for or associated with the expression of resistance to glycopeptides at a given level, genes coding for a transposase and a resolvase (upstream from the group previously mentioned) and genes vanY and vanz, downstream from this group. The genes for the transposase and resolvase might be implicated in transposition functions and the vanY gene coding for a D,D-carboxy peptidase might be implicated in the metabolism of the peptidoglycan, and might contribute to resistance to the glycopeptide in E. faecium BM4147 even though vanR, vanS, vanH, vanA and vanX born by a plasmid in a high number of copies, alone confer a high level of resistance.
Let it be noted that the sequence coding for the transposase is located on the (−) strand of the sequence ID NO 22 which codes for vanR, vanS, vanH, vanA, vanX, vanY, vanZ and the resolvase.
The invention relates not only to the DNA sequences identified in the list of the sequences but also to the complementary DNA sequence and the corresponding RNA sequences. The invention concerns in addition sequences which are equivalent to the former, either in terms of expression of proteins, polypeptides or their fragments described above or in terms of the capacity to detect, for example by chain polymerization procedures, strains of Gram-positive bacteria exhibiting resistance to antibiotics of the glycopeptide family such as vancomycin or teicoplanin.
Recombinant sequences characterized in that they comprise one of the above nucleotide sequences also form part of the invention.
The invention also relates to a recombinant vector characterized in that it includes one of the above nucleotide sequence at a site inessential for its replication, under the control of regulatory elements likely to be implemented in the expression of the resistance to antibiotics of the glycopeptide family, in particular to vancomycin or teicoplanin in a defined host.
Particularly advantageous recombinant vectors for the implementation of the invention are the following vectors: pAT214 containing the EcoRV-SacII fragment of 1761 bp containing a nucleotide sequence coding for the VanA protein; in these vectors the sequences of the invention are advantageously placed under the control of promoters such as the lac promoter.
The invention also relates to a recombinant cell host containing a nucleotide sequence such as that previously described or a vector such as that described above under conditions which make possible the expression of resistance to antibiotics of the glycopeptide family, in particular resistance to vancomycin and/or this host being for example selected from the bacteria, in particular the Gram-positive cocci.
In certain applications it is also possible to use yeasts, fungi, insect or mammalian cells.
The invention also relates to a nucleotide probe characterize in that it is capable of hybridizing with a sequence previously described, this probe being labelled if necessary. These probes may or may not be specific for the proteins of resistance to glycopeptides.
Labels which can be used for the requirements of the invention are the known radioactive labels as well as other labels such as enzymatic labels or chemoluminescent labels.
Probes thus labelled may be used in hybridization tests in order to detect resistance to glycopeptides in Gram-positive bacteria. In this case, conditions of low stringency will be used.
Nucleotide probes according to the invention may be characterized in that they are specific in Gram-positive bacteria for the sequences coding for a resistance protein to the glycopeptides, in particular to vancomycin and/or teicoplanin these probes being in addition universal among these sequences.
By these specific probes is meant any oligonucleotide hybridizing with a nucleotide sequence coding for one of the proteins according to the invention, such as described in the preceding pages, and not exhibiting a cross hybridization reaction or amplification reaction (PCR) with sequences present in all of the sensitive strains.
The universal character of the oligonucleotide which can be used in PCR is defined by their capacity to promote specifically the amplification of a nucleotide sequence implicated in resistance in any one strain of Gram-positive bacteria, resistant to the antibiotics of the glycopeptide family.
The size of the nucleotide probes according to the invention may vary depending on the use desired. For the oligonucleotides which are used in PCR, recourse will be had to fragments of a length which is usual in this procedure. In order to construct probes, it is possibly to take any part of the sequences of the invention, for example probe fragments of 200 nucleotides.
According to a particular embodiment of the invention, a nucleotide probe is selected for its specificity towards a nucleotide sequence coding for a protein necessary for the expression in Gram-positive bacteria of a high level of resistance to antibiotics of the glycopeptide family, in particular to vancomycin and teicoplanin.
As examples, useful probes may be selected from the intragenic part of the vanA gene.
Other useful probes for carrying out the invention are characterized by their universal character, according to the preceding definition, but are not specific for the resistance genes. They may also be used as primers in PCR, and are for example:
| V1: | GGX | GAA | GAT | GGX | TCX | TTX | CAA | GGX |
| G | C | AG | C | G | ||||
| A | ||||||||
| V2: | AAT | ACX | ATX | CCX | GGX | TTT | AC | |
| C | T | C | ||||||
| C |
V1 and V2 hybridize with vanA and vanC and are capable of leading to the detection of proteins associated with resistance to glycopeptides in other micro-organisms.
Other particular probes of the invention have the specific character of a nucleotide sequence coding for a protein necessary for the expression in Gram-positive bacteria of a low level of resistance to antibiotics of the glycopeptide family, in particular to vancomycin in Gram-positive bacteria.
It should also be mentioned that oligonucleotide probes which might be derived from the sequence of the vanA gene coding for the VanA protein may be used indiscriminantly to detect high-level or low-level resistance.
In a particularly preferred manner, a probe of the invention is characterized in that it hybridizes with a chromosomal or non-chromosomal nucleotide sequence of a Gram-positive strain resistant to glycopeptides, in particular to vancomycin and/or teicoplanin, in particular in that it hybridizes with a chromosomal or non-chromosomal nucleotide sequence of a strain of Gram-positive cocci, for example an enterococcal strain and preferably E. faecium 4147 or E. gallinarum.
In order to distinguish strains with a high level of resistance from strains with a low level of resistance it is possible to carry out a hybridization test using conditions of high stringency.
The oligonucleotides of the invention may be obtained from the sequences of the invention by cutting with restriction enzymes, or by chemical synthesis according to the standard methods.
Furthermore, the invention relates to polyclonal or monoclonal antibodies, characterized in that they recognize the polypeptide(s) described above or an amino acid sequence described above.
These antibodies may be obtained according to standard method for antibody production. In particular, in the case of the preparation of monoclonal antibodies, recourse will be had to the method of Köhler and Milstein according to which monoclonal antibodies are prepared by cell fusion between myeloma cells and mouse spleen cells previously immunized with a polypeptide or a composition according to the invention, in conformity with the standard procedure.
The antibodies of the invention can advantageously be used for the detection of the presence of proteins characteristic of resistance to the glycopeptides, in particular to vancomycin and teicoplanin.
Particularly useful antibodies are polyclonal or monoclonal antibodies directed against the protein VanA or VanC. Such antibodies advantageously make it possible to detect strains of bacteria, in particular Gram-positive cocci, exhibiting high-level resistance to the antibiotics of the glycopeptide family. If necessary, a step entailing lysis of the cells of the sample undergoing detection is performed prior to the placing in contact of the sample with the antibodies.
In order to carry out this detection, recourse will advantageously be had to antibodies labelled for example with a radioactive substance or other type of label.
Hence, tests for the detection in Gram-positive bacteria of resistance to the glycopeptides, in particular tests making use of the ELISA procedures, are included in the framework of the invention.
A kit for the in vitro diagnosis of the presence of Gram-positive strains, resistant to the glycopeptides, in particular to vancomycin and/or teicoplanin these strains belonging in particular to the Gram-positive cocci for example enterococci, for example E. faecium or E. gallinarum is characterized in that it comprises:
Furthermore, the agents developed by the inventors offer the very useful advantage of being suitable for the development of a rapid and reliable test or kit for the detection of Gram-positive strains resistant to the glycopeptides by means of the polymerase chain reaction (PCR). Such a test makes it possible to improve the sensitivity of the existing tests which remain rather unreliable and, in certain cases, may make possible the detection of all of the representatives of the family of the genes coding for resistance proteins to the glycopeptides in Gram-positive bacteria.
The carrying out of a test by means of the method of amplification of the genes of these proteins is done by the PCR procedure or by the RPCR procedure (RPCR: abbreviation for reverse polymerase chain reaction).
The RPCR technique makes possible the amplification of the NH2 and COOH terminal regions of the genes it is desired to detect.
Some specific primers make it possible to amplify the genes of the strains with low-level resistance. These primers are selected, for example, from the sequence coding for the resistance protein VanA.
As examples, the following sequences-can be used as primers for the preparation of probes for the detection of an amplification by means of the PCR or RPCR method.
| V1: | GGX | GAA | GAT | GGX | TCX | TTX | CAA | GGX |
| G | C | AG | C | G | ||||
| A | ||||||||
| V2: | AAT | ACX | ATX | CCX | GGX | TTT | AC | |
| C | T | C | ||||||
| C |
X represents one of the bases A, T, C or G or also corresponds in all cases to inosine.
Naturally, the invention relates to the complementary probes of the oligonucleotides previously described as well as possibly to the RNA probes which correspond to them.
A kit for the in vitro diagnosis of the presence of strains of Gram-positive bacteria resistant to the glycopeptides, in particular resistant to vancomycin and/or teicoplanin these strains belonging in particular to the Gram-positive cocci, in particular that they are strains of enterococci, for example E. faecium or E. gallinarum, is characterized in that it contains:
The invention also relates to a procedure for the in vitro detection of the presence of Gram-positive strains resistant to the glycopeptides, in particular to vancomycin and/or teicoplanin these strains belonging in particular to the family of the Gram-positive cocci, in particular in that they are strains of enterococci, for example E. faecium or E. gallinarum, characterized in that it comprises
The detection of the elongation products of the desired sequence may be carried out by a probe identical with the primers used to carry out the PCR or RPCR procedure, or also by a probe different from these primers, this probe being labelled if necessary.
Details relating to the implementation of the PCR procedures may be obtained from the patent applications EP 0229701 and EP 0200362.
Other advantages and characteristics of the invention will become apparent in the examples which follow and from the figures.
FIGURESFIG. 1: electrophoresis on SDS-polyacrylamide gel (SDS-PAGE) of the proteins of the membrane fractions line 1 and line 4, molecular weight standards; line 2, E. faecium BM4147 placed in culture in the absence of vancomycin; line 3, BM4147 placed in culture in the presence of 10 μg/ml of vancomycin. The head of the arrow indicates the position of the VanA protein.
A: Restriction maps of the inserts of the plasmids pAT213 and pAT214. The vector and the DNA insert are distinguished by light and dark segments, respectively. The open arrow represents the vanA gene.
B: Strategy for the nucleotide sequencing of the insert of 1761 bp in the plasmid pAT214. The arrows indicate the direction and extent of the sequencing reactions by the dideoxy method. The synthetic oligonucleotide primer (5′ ATGCTCCTGTCCTTTC 3′ OH) is complementary to the sequence between the positions 0.361 and 378. Only the pertinent restriction sites are given.
FIG. 3: position of the sequences R, S, ORF1, ORF2, ORF3.
FIG. 4: representation of SEQ ID NO 6.
FIG. 5: representation of SEQ ID NO 6 and the corresponding protein.
FIG. 6: sequence of the vanA gene and the corresponding protein.
(a): Localization of the genes vanR, vanS, vanH, vanA, vanX, vanY, vanZ of the gene for the transposase and of the gene for the resolvase as well as the repeated reverse terminal sequences of 38 bp at the end of the transposon.
(b): Mapping of the plasmids. (A) Polylinker pAT29 and derivatives constructed in this study. The arrow labelled P2 indicates the position and orientation of the P2 promoter of aphA-3 (Caillaud et al., 1987, Mol. Gen. Genet. 207:509-513). (B) Insert pAT80. The white rectangles indicate the DNA of pAT29 but they are not shown to scale. The rectangles terminating in an arrow indicate the coding sequences. The arrows shown in vertical and horizontal full lines indicate the position and orientation, respectively, of the apha-1 gene in the derivatives of pAT80. Restriction sites: Ac, AccI; B, BamHI; Bg, BglII; Bs, BssHII E, EcoRI; H, HindIII; Hc, HincII; K, KDnI; P, PstI; S, SmaI; SI, SacI, SII, SacII; Sa, SalI; Sp, SphI; Xb, XbaI. (C) Inserts in pAT86, pAT87, pAT88 and pAT89. The inserts are shown by full lines and the corresponding vectors are indicated in parentheses.
FIG. 8: nucleotide sequence of the transposon shown in FIG. 7 and amino acid sequence of the corresponding proteins. The nucleotide sequence is shown for the (+) strand and for the (−) strand (corresponding to the complementary sequence of the (+) strand for the positions 1 to 3189) on which the coding sequence of the transpose is located.
FIG. 9: Nucleotide sequence of the SacI-PstI fragment of 1347 bp of the plasmid pAT216 containing the vanC gene. The numbering start at the first base G of the SacI restriction site. The potential RBS sequence upstream from the initiation codon ATG of translation at position 215 is underlined. The STOP codon (TGA) is indicated by *. The region coding for the vanC and the deduced amino acid sequence are indicated in bold characters. Sequential overlapping clones were generated by restriction fragments of subcloning of pAT216 in the bacteriophage M13 mp10 (Amersham, England). The universal primer (New England Biolabs Beverly Mass.) was used to sequence the insert in the recombinant phages. The sequencing was performed by the enzymatic dideoxy nucleotide method (Sanger et al., 1977 PNAS 74: 5463-5467) by using the T7 DNA polymerase (Sequenase US B CORP, Cleveland, Ohio) and [∝-35S] dATP (Amersham, England). The reaction products were loaded onto 6% denaturing polyacrylamide gels.
FIG. 10: alignment of the amino acid sequences of VanC, VanA, DdlA and DdlB. The identical (I) amino acids and the conservative (C) substitutions in the 4 sequences are indicated in the alignment. In order to classify the conservative substitutions, the amino acids were grouped as follows: RK, LFPMVI, STQNC, AGW, H, ED and Y. The regions of high homology corresponding to the domains 1, 2, 3 and 4 are underlined. The sequences corresponding to the peptides 1 and 2 are indicated by the arrows.
FIG. 11: description of the oligonucleotides V1 and V2 (A): Amino acid sequence of the peptides 1 and 2 of VanA and of the D-Ala-D-Ala ligases. The number of amino acids between the N-terminus and peptide 1, between the peptides 1 and 2 and the peptide 2 and the C-terminus is indicated. The identical amino acids between at least 2 of the 3 sequences are indicated in bold characters.
(B): Target peptides and deduced nucleotide sequence. X represents any base of the DNA. Peptide 2 in DdlB differs from the target peptide at 2 positions (*).
(C): Nucleotide sequence of V1 and V2. Alternate nucleotides and deoxyinosine (I) which may correspond to any base in the DNA, were used at the positions at which the nucleotide sequences coding for the target peptides vary. The arrows indicate the direction of DNA synthesis. The oligonucleotides were synthesized by the methoxy-phosphoramidite method with a Biosystem DNA 380B machine (Applied Biosystem, Foster City, Calif.). The DNA was isolated from bacterial lysate by extraction with hexadecyl trimethyl ammonium bromide (Inst. biotechnologies, Inc., New Haven, Colo.) (Le Bouguénec et al., 1990, J. Bacteriol. 172:727-734) and used as matrix for the amplification by means of PCR with a controlled heating system “Intelligent Heating Block” IBH101 (Hybarid Ltd., GB) according to the description of Mabila et al. (1990, Plasmid 23:27-34). The amplification products were revealed by electrophoresis on a 0.8% gel, after staining with ethidium bromide.
FIG. 12: Inactivation by insertion of vanC. The vanC gene is shown by an open arrow and the internal EcoRI-HincII fragment of 690 bp is hatched. The DNA of pAT114 is shown by a thin line; the chromosomal DNA of PM4174 by a thick line; the arrows indicate the genes for resistance to the antibiotics: aphA-3 is the gene coding for the 3′-aminoglycoside phosphotransferase; erm is the gene coding for the ERR methyl transferase.
(A): The plasmid pAT217 was constructed by ligation of the EcoRI-Hinc fragment of pAT216 to the suicide vector pAT114 (Trieu-Cuot et al., 1991, Gene 106:21-27), digested with EcoRI and SmaI.
(B): vanC region of the chromosomal DNA of BM4174.
(C): vanC region after integration of pAT217.
FIG. 13: Southern blot analysis of the integration of pAT217 into the vanC gene of BM4174.
(left hand side): Total DNA of BM4175 (line 2) and BM4174 (line 3) digested with EcoRI and resolved by means of electrophoresis on a 1% agarose gel. The DNA of the bacteriophage lambda digested with PstI was used as molecular mass standard (line 1). The DNA was transferred under vacuum to a Nytran membrane (Schleicher and Schül, Germany) by using a Trans-Vac TE80 apparatus (Höfer Scientific Instruments, San Francisco, Calif.) and bound to the membrane through the intermediary of UV light. The hybridization was carried out with the probe C (Middle or the probe aphA-3 specific for pAT114 (Lambert et al., 1985, Annales de l'Institut Pasteur/Microbiol. 136(b): 135-150).
(right hand side): the probes were labelled with 32P by nick translation. The molecular masses (kb) are indicated.
FIG. 14: alignment of the deduced amino acid sequences of VanS derived from E. faecium BM4147 and of PhoR and EnvZ from E. coli. The numbers on the left refer to the position of the first amino acid in the alignment. The numbers on the right refer to the position of the last amino acid of the corresponding line. The identical amino acids are placed in boxes. The dotted lines indicate gaps introduced in order to optimize their similarity. The dashes indicate the positions of the amino acid residues conserved in other HPK. The histidine residues in bold characters in section 1 are potential sites of auto-phosphorylation.
FIG. 15: alignment of the deduced amino acid sequences of VanR from E. faecium BM4147, OmpR and PhoB from E. coli as well as that of CheY from Salmonella typhimurium. The numbers on the right indicate the position of the last amino acid of the corresponding line. The identical amino acids are placed in boxes. The dotted lines indicate the gaps introduced in order to optimize the homologies. The residues in bold characters correspond to the amino acids strongly conserved in the effector domains of other RR. The aspartic acid residue 57 of CheY is phosphorylated by the HPK associated with CheA.
I—Identification of vanAMaterials and Methods for the Identification and Characterization of the vanA Gene
Bacterial Strains and Plasmids
The origin of the plasmids used is given in the table below.
| Strain or plasmid | Source or reference | |
| Escherichia coli | ||
| JM83 | Messing (1979) | |
| AR1062 | Rambach and Hogness (1977) | |
| JM103 | Hannshan (1983) | |
| ST640 | Lugtenberg and van Schijndel | |
| van-Dam (1973) | ||
| Enterococcus faecium | ||
| BM4147 | Leclercq et al (1988) | |
| Plasmid pUC18 | Norrander et al (1983) | |
| pAT213 | Brisson-Noel et al (1990) | |
| pAT214 | Described in this text | |
Enterococcus faecium BM4147 was cultivated in 500 ml of heart brain broth (BHI broth medium) until the optical density (OD600) reaches 0.7. Induction was effected with 10 μg/ml of vancomycin (Eli Lilly Indianapolis Ind.). The subsequent steps were performed at 4° C. The cells were recovered by centrifugation for 10 minutes at 6000 g, washed with a TE buffer (0.01 M TRIS-HCl, 0.002 M EDTA, pH 7.0) and lysed by glass beads (100 μm in diameter) in a Braun apparatus for 2 minutes. The cell debris were separated by centrifugation for 10 minutes at 6000 g. The membranes were collected by centrifugation for 1 hour at 65000 g and resuspended in 0.5 ml of TE buffer.
Preparation of the Minicells
Plasmids were introduced by transformation into the strain E. coli AR1062 prepared in the form of bacterial vesicles. The bacteria vesicles were recovered on sucrose gradients and the proteins were labelled with 50 μCi of [35S]-L-methionine (Amersham, Great Britain) according to the method of Rambach and Hogness (1977, P.N.A.S. USA, 74; 5041-5045).
Preparation of the Membrane Fractions and the Cytoplasmic Fractions of E. coli
E. coli JM83 and strains derived from it were placed in culture in BHI medium until an optical density (OD600) of 0.7 was attained, washed and suspended in a TE buffer. The cell suspension was treated by sonication (ultrasound) for 20 seconds at doses of 50 W in a cell fragmentation apparatus in a Branson B7 sonication apparatus and the intact cells were removed by centrifugation for 10 minutes at 6000 g. The supernatant was fractionated into membrane and cytoplasmic fractions by means of centrifugation for 1 hour at 100,000 g.
Electrophoresis on SDS-polyacrylamide Gel (SDS-PAGE)
The proteins from the bacterial fractions were separated by means of SDS-PAGE on linear gradients of polyacrylamide gels (7.5%-15%) (Laemli 1970, Nature 227: 680-685). The electrophoresis was carried out for 1 hour at 200 V, then for 3 hours at 350 V. The gels were stained with Coomassie blue. The proteins of the extracts were separated on 10% polyacrylamide gels and visualized by means of autoradiography.
Purification of the Protein Band and Determination of the N-Terminal Sequence
The proteins of the membrane fractions of an induced culture of E. faecium BM4147 were separated by means of SDS-PAGE. The gel was electrotransferred for 1 hour at 200 mA to a polyvinylidene difluoride membrane (Immobilon Transfer, Millipore) by using a transfer apparatus (Electrophoresis Unit LKB 2117 Multiphor II) in accordance with the instructions of the manufacturer. The transferred proteins were stained with Ponceau red. The portion of membrane bearing the protein of interest was excised, centered on a Teflon filter and placed in the cartridge of a sequencer (Sequencer Applied Biosystems model 470A). The protein was sequenced by means of the automated Edman degradation (1967, Eur. J. Biochem. 1; 80-81).
Construction of Plasmids
The plasmid pAT213 (Brisson-Noel et al., 1990, Antimicrob. Agents Chemother., 34; 924-927) consists of a EcoRI fragment of DNA of 4.0 kb of the enterococcal plasmid pIP816 cloned at the EcoRI site of a Gram-positive-Gram-negative shuttle vector pAT187 (Trieu-Cuot et al., 1987, FEMS Microbiol. Lett. 48; 289-294). In order to construct pAT214, the EcoRV-SacII DNA fragment of 1761 bp of pAT213 was purified, treated with the Klenow fragment of the DNA polymerase I of E. coli and ligated to the DNA of pUC18 which had previously been digested with SmaI and dephosphorylated (FIG. 2). The cloning (Maniatis et al., 1982 Cold Spring Harbor Laboratory Press) was carried out with restriction endonucleases (Boehringer Mannheim and Pharmacia), with the T4 DNA ligase (Pharmacia) and alkaline phosphatase (Pharmacia) according to the instructions of the manufacturer.
Subcloning in M13 and Nucleotide Sequence
The DNA restriction fragments were subcloned in the polylinker of the replicative forms of the derivatives mp18 and mp19 of the bacteriophage M13 (Norrander et al., 1983, Gene 26; 101-106), obtained from Pharmacia P-L Biochemicals. E. coli JM103 was transfected with recombinant phages and the single-stranded DNA was prepared. The nucleotide sequencing was carried out by the enzymatic di-deoxy nucleotide method (Sanger et al., 1977, P.N.A.S. USA 74; 5463-5467) by using a T7 DNA polymerase (Sequenase, United States Biochemical Corporation, Cleveland, Ohio) and [∝-35S] dATP (Amersham, Great Britain) The reaction products were revealed on 6% polyacrylamide gels containing a denaturing buffer.
Data-Processing Analysis and Data on the Sequence
The complete DNA sequence was assembled by using the computer programs DBCOMP and DBUTIL (Staden, 1980, Nucleic Acids Res 8; 3673-3694). The protein data bank PSEQIP of the Pasteur Institute was screened using an algorithm developed by Clayerie (1984, Nucleic Acids Res 12; 397-407). The alignments between the pairs of amino acid sequences were constructed using the algorithm of Wilbur et al (1983, P.N.A.S. USA 80; 726-730). The statistical significance of the homology was evaluated with the algorithm of Lipman and Pearson (1985, Science 227; 1435-1440).
For each comparison 20 amino acid sequences were used to calculate the mean values and the standard deviations of the random results.
Genetic Complementation Tests
The plasmids were introduced by transformation into E. coli ST640, a temperature-sensitive mutant with an unmodified D-ala-D-ala ligase (Lugtenberg et al 1973, J. Bacteriol 110; 26-34). The transformants were selected at 30° C. on plates containing 100 μg/ml of ampicillin and the presence of the plasmid DNA of the expected size and the restriction maps were verified. Single colonies grown at 30° C. in BHI broth medium containing ampicillin were placed on a BHI agar medium containing both 100 μg/ml of ampicillin and 50 μM of isopropyl-1-thio-β-D-galacto-pyranoside (IPTG) and the plates were incubated at a permissive temperature of 30° C. and at a non-permissive temperature of 42° C. The complementation test was considered to be positive if the colonies were present after 18 hours of incubation at 42° C.
ResultsIdentification of the VanA Protein and its N-Terminal Sequence
The membrane fractions of the E. faecium BM4147 cells placed in culture, on the one hand, under conditions of induction, and, on the other, in the absence of induction, were analysed by means of SDS-PAGE. The sole difference which could be detected, related to the exposure to sub-inhibitory concentrations of vancomycin, was the marked intensification of a band which corresponded to a protein of an estimated molecular weight of about 40 kDa. In the induced cells and in the non-induced cells, the protein band represents the same protein because this band is absent from membranes of a derivative of BM4147 which has lost the pIP816 plasmid. The inducible protein, designated as VanA, was purified after SDS-PAGE and automated Edman degradation was carried out on a 50 pmol. sample. Nine amino acids of the N-terminal sequence of VanA were identified: Met Asn Arg Ile Lys Val Ala Ile Leu.
Sub-Cloning of the vanA Gene
The insert of 4.0 kb of the plasmid pAT213 bears the determinant for resistance to the glycopeptides of E. faecium BM4147. Various restriction fragments of this insert were subcloned in pUC18 and the recombinant plasmids specific for vanA in E. coli were identified by SDS-PAGE analysis of the proteins of the cytoplasmic and membrane fractions or of the extracts of the bacterial vesicles. This approach was used since E. coli is intrinsically resistant to the glycopeptide. The EcoRV-SacII insert of the pAT214 plasmid (FIG. 2) codes for a unique polypeptide of 40 kDa which migrates together with VanA, derived from the membrane preparations of E. faecium BM4147.
Nucleotide Sequence of the Insert in pAT214 and Identification of the vanA Coding Sequence
The nucleotide sequence of the EcoRV-SacII insert of 1761 bp in pAT214 was determined on both strands of the DNA according to the strategy described in FIG. 2. The location of the termination codons (TGA, TAA, TAG) in three reading frames on each DNA strand showed the presence of a unique open reading frame (ORF) which was sufficiently long to code for the VanA protein. This reading frame ORF is located between the TAA codon at position 281 and the TAG codon at position 1406. The amino acid sequence deduced for ORF was compared with that of the N-terminus of VanA. The nine amino acids identified by protein sequencing are encoded in the nucleotide sequence beginning with the ATG (methionine) codon at position 377 (FIG. 3). This codon for the initiation of translation is preceded by a sequence (TGAAAGGAGA), characteristic of a ribosomal binding site (RBS) in Gram-positive bacteria which is complementary to the 8 bases of the rRNA of the 16S subunit of Bacillus subtilis in its sequence (3′OH UCUUUCCUCC 5′) (Moran et al., 1982, Mol. Gen. Genet. 186; 339-346). In this ORF, there is no other ATG or GTG initiation codon between the positions 281 and 377. The sequence of 1029 bp which-extends from the ATG codon at position 377 to the TGA codon at position 1406 codes for a protein containing 343 amino acid residues. The calculated molecular weight of this protein is 37400 Da, which is in agreement with the estimation of 40 kDa obtained by SDS-PAGE analysis.
Homology of the Amino Acid Sequences of VanA and the D-ala-D-ala Ligase Enzymes
The screening of the protein data bank PSEQIP has shown the existence of a sequence homology between VanA and the D-ala-D-ala ligases of E. coli (ECOALA, Robinson et al., 1986, J. Bacteriol. 167; 809-817) and of Salmonella typhimurium (DALIG, Daub et al., 1988, Biochemistry 27; 3701-3708). The calculated percentage of homology between pairs of proteins was included between 28% and 36% for the identical amino acids and between 48% and 55% by taking into consideration homologous amino acids. VanA and DALIG are more closely related. The statistical significance of these similarities wa evaluated by aligning VANA and sequences containing the same composition of amino acids as DALIG or ECOALA (Lipman and Pearson, 1985, Science 227; 1435-1440).
Genetic Complementation Test for the Activity of D-ala-D-ala Ligase
The E. coli strain ST640 is a thermosensitive mutant exhibiting a deficient D-ala-D-ala ligase activity (lugtenberg et al., 1973, J. Bacteriol. 113: 96-104). The plasmids pUC18 and pAT214 were introduced into E. coli ST640 by transformation. The strains ST640 and ST640 (pUC18 grew normally only at the permissive temperature (30° C.) whereas E. coli ST640 (pAT214) grew both at the permissive temperature and at the non-permissive temperature (42° C.).
This test shows that VANA is functionally related to the D-Ala-D-Ala ligases in E. coli and is probably capable of catalysing the same ligation reaction as DALIG.
II—VanS-VanR Two-Component Regulation System for the Control of the Synthesis of Depsipeptides of the Precursor of Peptidoglycans
Materials and Methods
Strains, Plasmids and Conditions of Culture
The restriction fragments of pIP816 (Tra−, Mob+, Vmr) were cloned in derivatives of the vector pAT29 which constitutes a shuttle vector between the Gram-positive and Gram-negative bacteria (oriR pAMβ1, oriR pUC, oriT RK2, spc, lacZ) (Trieu-Cuot et al., 1990, Nucleic Acids Res. 18:4296). This vector was constructed by the inventors and used to transform the strain E. coli JM103 ((lac-proAB), supE, thi, strA, sbcB15, endA, hspR4, F traD36, proAB, LacIq, lacZ M15) (Messing et al., 1983, Methods Enzymol. 101:20-78). The plasmid DNA was prepared by an alkaline lysis protocol on a small scale (Sambrook et al., 1982, Molecular cloning, a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor N.Y.) and introduced by electroporation (Cruz-Rodz A. L. et al., 1990, Mol. Gen. Genet. 224: 152-154) in E. faecalis JH2-2 (FusR, RifR) (Jacob A. E. et al., 1974, J. Bacteriol. 117: 360-372), by using a Gene Pulser apparatus (Bio-Rad laboratories, Richmond, Calif.). The restriction profiles of the purified plasmids from E. faecalis and E. coli were compared in order to detect possible rearrangements of DNA.
The integrative plasmid pAT113 (Mob+, EmR, KmR, oriR PACYC184 attTn1545, lacZ) (Trieu-Cuot et al., Gene 106: 21-27) carries the joined ends of the transposon Tn1545. This vector does not replicate in Gram-positive bacteria but is integrated into the chromosome of the host by illegitimate recombination mediated by the integrase of Tn1545 or of Tn916 (Trieu-Cuot et al. previously mentioned). The integrative plasmids were introduced into E. faecalis BM4148 (strain JH2-2::Tn916) by means of electroporation. This strain is modified by the transposon Tn917 described by Franque A. E. et al. (1981, J. Bacteriol. 145: 494-502).
The cultures were grown in brain-heart broth (BHI—Brain Heart Infusion Broth) or on agar at 37° C. The method of Steers et al (Antibiot. Chemother. Basel. 9: 307-311) was used to determine the minimal inhibitory concentrations (MICs) of the antibiotics on a Mueller-Hinton gelose agar medium.
Recombinant DNA Procedures
The cleavage of DNA with restriction endonucleases (Boehringer Mannheim and Pharmacia), the purification of the DNA restriction fragments from agarose gels, the conversion of the cohesive ends to blunt ends with the Klenow fragment of the DNA polymerase I of E. coli (Boehringer Mannheim), the dephosphorylation of the ends of the DNA with calf intestinal phosphatase (Boehringer Mannheim), the ligation of the DNA fragments with the T4 DNA ligase (Amersham) were carried out according to the standard methods of Sambrook et al (1982, Molecular Cloning, a Laboratory Manual. Cold Spring Harbor Laboratory. Cold Spring Harbor N.Y.).
Construction of Plasmids
The origin of the vectors and the inserts used for the recombinant plasmids constructed here is the following:
(ii) expression vector pAT79: the ClaI-BssHII fragment of 243 bp bearing the P2 promoter of the aphA-3 gene of the enterococcal plasmid pJH1 (Caillaud et al., 1987, Mol. Gen. Genet. 207: 509-513) was inserted between the EcoRI and SacI restriction sites of pAT78.
(iii) plasmid pAT80 and its derivatives: the BglII-XbaI fragment of 5.5 kb of pIP816 was inserted between the BamHI and XbaI sites of pAT78. The resulting plasmid, designated as pAT80 was partially digested with HincII and ligated with the EcoRV fragment containing a gene related to the apha-I gene of the transposon Tn903 (Oka A. et al., 1981, J. Mol. Biol. 147:217-226. This fragment contains the aphA-I gene which codes for the 3′aminoglycoside phosphotransferase of type I conferring resistance to kanamycin. The insertion of aphAI was carried out at three different sites in pAT80, generating the plasmids pAT81, pAT83 and pAT85. The cassettes BamHI and EcoRI containing aphA-1 were inserted at the BamHI (to form the plasmid pAT84) and EcoRI (to form the plasmid pAT82) sites of pAT80.
(iv) plasmids pAT86, pAT87, pAT88 and pAT89: the plasmid pAT86 was constructed by cloning the EcoRI-SacII fragment of 2.803 bp of pAT80 coding for VanH and VanA at a SmaI site of pAT79. pAT87 was obtained by inserting the EcoRI-XbaI fragment of 3.4 kb of pAT80 upstream from the cat gene of the detection vector of promoter pAT78. The plasmid pAT88 resulted from the ligation of pAT78 digested with EcoRI and BamHI to the EcoRI-BamHI fragment of 1.731 bp of pAT80. The BglII-AccI fragment (positions 1 to 2356) of pAT80 was inserted into the polylinker of the integrative vector pAT113, generating pAT89.
Sub-Cloning in M13 and Sequencing
The DNA restriction fragments were subcloned in a polylinker of replicative derivatives of the bacteriophage M13, these derivatives being called mp18 and mp19 (Norrander et al., 1983, Gene 26:101-106). E. coli JM103 was transfected with the recombinant phages and a single-stranded DNA was prepared. The sequencing of the nucleotides was carried out according to the conditions described by Sanger et al. (Proc. Natl. Acad. Sci. USA, 1977, 74: 5463-5467) by using the modified T7 DNA polymerase (Sequenase, United States, Biochemical Corporation Cleveland Ohio) and [∝-35S] dATP (Amersham). The reaction products were resolved on gradient gels of polyacrylamide in a 6% buffer.
Enzymatic Test
The JH2-2 derivatives of E. faecalis were grown to an optical density OD600 of 0.7 in a BHI broth supplemented with spectinomycin (300 μg/ml). The cells were treated with lysozyme, lysed by sonication and the cell debris were centrifuged for 45 minutes at 100,000 g according to the description given by Courvalin et al. (1978, Antimicrob. Agents Chemother. 13:716-725). The formation of 5-thio-2-nitrobenzoate was measured at 37° C. in the presence and in the absence of chloramphenicol and the specific CAT activity was expressed in micromole per minute and per milligram of proteins (Shaw et al., 1975, Methods Enzymol. 43:737-755).
ResultsThe vanH and vanA genes of pIP816 were cloned in a plasmid pAT79 under the control of the heterologous promoter P2 (Caillaud et al., 1987, Mol. Gen. Genet. 207:509-513) and the plasmid pAT86 formed did not confer resistance to vancomycin on the strain E. faecalis JH2-2. These genes are thus not sufficient for the synthesis of peptoglycan in the absence of the antibiotic. Different restriction fragments of pIP816 were cloned in the vector pAT78. The BglII-XbaI fragment of 5.5 kb of pAT80 is the smallest fragment obtained which conferred resistance to vancomycin.
Nucleotide Sequence of the vanR and vanS Genes
The sequence of the insert in pAT80 was determined on both strands of the DNA from the BglII site to the ATG initiation codon for the translation of VanH. Two open reading frames (orf) were detected within the sequence of 2475 bp: the first open reading frame extends from the nucleotide 386 to the nucleotide 1123; at position 431 a sequence characteristic of the RBS sequences in Gram-positive bacteria is found, 6 base pairs upstream from the ATG initiation codon for translation (TGAAAGGGTG); the other initiation codons for translation in this orf are not preceded by this type of sequence. The sequence of 693 bp extending from the ATG codon at position 431 to the TAA codon at position 1124 is capable of coding for a protein of 231 amino acids with a molecular mass of 26,612 Da which is designated as VanR.
In the case of the second open reading frame (from nucleotide 1089 to nucleotide 2255) the amino acid sequence deduced from the first initiation codon in phase (TTG at position 1104) would code for a protein of 384 amino acids having a molecular mass of 43,847 Da and designated as VanS. The TTG codon at position 1116 and the ATG codon at position 1164 are in-phase initiation codons for translation preceded by sequences with low complementarity with the 3′OH terminus of the 16S sub-unit of the rRNA of B. subtilis (GGGGGGTTGG-N-8-TTG and AGAACGAAAA-N-6-ATG, respectively).
Between the last codon of vanS and the initiation codon ATG for the translation of vanH a sequence of 217 bp is to be observed which contains a repeated reverse sequence of 17 bp. This sequence does not function as a terminator of strong transcription.
The comparison of the sequences obtained with data bases has shown that the conserved amino acid residues identified by Stock et al. (1989, Microbiol. Rev. 53:450-490) in the kinase domain of 16 HPK (Histidine Protein Kinase) were detected in the C-terminal part of VanS. VanS possesses two groups of hydrophobic amino acids in the N-terminal region. The histidine residue 164 of VAnS is aligned with the residue His216 of PhoR (Makino et al., 1986, J. Mol. Biol. 192: 549-556) and His 243 of EnvZ (Comeau et al., 1985, 164:578-584) which are presumed sites of autophosphorylation in these proteins.
Similarly, the amino acids 1 to 122 of VanR exhibit similarity with the effector domains of response regulators RR. The aspartic acid 53 of VanR might be a phosphorylation site because this residue is aligned with Asp 57 of Che Y which is phosphorylated by HPK associated with CheA and corresponds to an invariant position in other proteins of the RR type (Stock et al previously mentioned). VanR might belong to the sub-class OmpR-PhoB of RR which activates the initiation of transcription mediated by the RNA polymerase containing the 70S factor of E. coli (Stock et al. previously mentioned).
Inactivation of the van Genes by Insertion
Cassettes of resistance to kanamycin inserted in the group of van genes in the plasmid pAT80 have shown the following: the insertion in vanR suppresses resistance to vancomycin and chloramphenicol; VanR is an activator of transcription necessary for the expression of the genes for resistance to vancomycin. The inactivation of vanS leads to a two-fold reduction of the minimal inhibitory concentration (MIC) of chloramphenicol and to a three-fold reduction of the specific CAT activity but the minimal inhibitory concentration of vancomycin remains unchanged. Hence, VanS is necessary to produce a high level of transcription of the genes for resistance to vancomycin although it is not required for the expression of the phenotype of resistance to vancomycin.
Derivatives of pAT80 bearing insertions in vanH (pAT83), vanA (pAT84) or in the region 1.0 kb downstream from vana (pAT85) have made it possible to obtain resistance to chloramphenicol but not to vancomycin. This dissociated phenotype corresponds to the inactivation of genes coding for enzymes which synthesize the depsipeptide precursors necessary for the assembly of the bacterial cell walls in the presence of vancomycin.
Downstream from the vanA gene the presence of an inactivated orf has been detected in pAT85 in the region of the sequence of 365 bp after the TGA codon of vanA and before the SacII site and this orf contains an in-phase ATG initiation codon preceded by a RBS-like sequence. This sequence codes for a protein necessary for resistance to the glycopeptide, designated as VanX and which comprises maximally about 330 amino acids.
Trans-Activation of the Transcription of the van Genes
The integrative plasmid pAT89 coding for VanR and VanS was introduced into the chromosome of E. faecalis BM4138. The plasmid pAT87 bearing the genes vanH, vanA and vanX cloned upstream from the cat gene lacking the promoter for pAT78 conferred resistance to vancomycin on this strain but not to E. faecalis JH2-2. The level of expression of the cat gene of pAT87 in the strains BM4138::pAT89 and JH2-2 indicated that VanR activates the transcription of the reporter gene localized at the 3′ end of the group of van genes. Similar levels of CAT synthesis were observed for pAT88 which bears a transcription fusion between the 5′ parts of vanA and the cat gene. These results show that in E. faecalis BM4138::pAT89 (pAT87) VanR and VanS encoded in the chromosome activate in a trans manner the transcription of vanA, vanH and vanX of pAT87 making possible the production of resistance to vancomycin.
Moreover, it has been observed that the expression of the gene was essentially constitutive when vanR and vanS were borne by a multicopy plasmid pAT80 and weakly inducible by vancomycin when the genes for the regulatory proteins were present on the chromosome of the host.
III—Characterization of the Sequence of the vanC Gene of Enterococcus gallinarum BM4174
Definition and Use of Universal Primers for the Amplification of Genes Coding for D-Ala-D-Ala Ligases and Related Proteins Implicated in Resistance to Vancomycin
The protein VanA necessary for the expression of a high level of resistance to the glycopeptides in E. faecium BM4147 shares a similarity of about 28 to 36% as regards its amino acids with the D-Ala-D-Ala ligases of E. coli but possesses a different substrate specificity from that of these ligases. Peptides designated as 1 and 2 which are conserved in the sequences of the DdlA and DdlB ligases (Zawadzke, 1991 Biochemistry 30:1673-1682) of E. coli and in the protein VanA were selected in order to synthesize universal primers intended to amplify internal fragments of genes coding for D-Ala-D-Ala ligases or related enzymes. The peptide targets GEDG(S/T) (I/L)QG and NT(I/L)PGFT were translated back as is shown in FIG. IV.1 in order to obtain degenerate oligonucleotides V1 and V2. As the peptides 1 and 2 of VanA, DdlA and DdlB are separated by amino acid sequences of similar length, the predicted size for the amplification product was about 640 bp.
Amplification by means of PCR with the DNA of E. coli JM83 and of E. faecium BM4147 made it possible to amplify products corresponding to the expected size which have then been purified and cloned in the bacteriophage M13 mp10 (Norrander et al., 1983, Gene 26:101-106). The sequencing of the insert obtained with E. coli JM83 has shown that the product of PCR was an internal fragment of ddlA. A probe generated starting from a recombinant phage obtained with the amplification fragment of BM4147 was used for the Southern blot analysis of a DNA of BM4147 and BM4147-1 which is a derivative of BM4147 sensitive to vancomycin and which lacks the plasmid pIP816 (Leclercq et al., 1988, N. Engl. J. Med. 319:157-161). The probe hybridized with the EcoRI DNA fragment of 4 kb from BM4147 but not with the DNA from E. faecium BM4147-1. As the vanA gene is borne by the EcoRI fragment of 4 kb from pIP816, these results indicate that the primers also make possible the amplification of a part of vanA. Thus the oligonucleotides V1 and V2 may amplify fragments of genes coding for different proteins related to the D-Ala-D-Ala ligases, and may do this in different species.
Amplification, Cloning and Sequencing of the vanC Gene
Amplification by means of PCR was carried out on the total DNA of E. gallinarum BM4174 and the amplification product obtained of about 640 bp was cloned in the bacteriophage M13 mp10. The single-stranded DNA isolated from the recombinant phage was used to construct a probe C (Hu et al., 1982, Gene 17:2171-2177). In Southern analysis the probe hybridized with a PstI fragment of 1.7 kb from BM4174 but not with the DNA of BM4147 and BM4147-1.
The DNA of BM4174 was digested with PstI and fragments of 1.5 and 2 kb were purified by electrophoresis on agarose gel and cloned in pUC18 (Norrander et al., 1983, mentioned previously). The recombination plasmids were introduced into E. coli JM83 by transformation and screens by hybridization on colonies (Sambrook et al., 1989, Molecular cloning a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) by using the probe C. A homology was detected with a transformant harbouring a plasmid called pAT216 which contained a PstI insert of 1.7 kb. The sequence of the SacI-PstI part of 1347 bp of the insert of pAT216 was determined on both strands of the DNA. The location of the termination codons in the three reading frames of each strand of DNA revealed the presence of an ORF phase located between the TGA codons at positions 47 and 1244. The initiation codon of transcription ATG at position 215 is preceded by a sequence GAAAGGAAGA characteristic of the RBS sequences complementary to the RNA of the 16S subunit of B. subtilis (Moran et al., 1982, Mol. Gen. Genet. 186:339-346). The sequence of 1029 bp which extends from the ATG codon at position 215 to the TGA codon at position 1244 might code for a protein of 343 amino acids having a calculated molecular mass of 37504 Da designated as VanC. A sequence homology was detected between VanC, VanA and the D-Ala-D-Ala ligases of E. coli. In particular, four domains of strong homology previously found between VanA and the D-Ala-D-Ala ligases of the enterobacteria are also present in VanC. The percentage of identical amino acids calculated for these proteins taken two at a time varied between 29 and 38%. The alignment of the four sequences revealed the presence of 57 invariant amino acids which include the conserved residues of the peptides 1 and 2 used to define the oligonucleotide probes V1 and V2.
Inactivation of the vanC Gene by Insertion
In order to evaluate the contribution of vanC to resistance to vancomycin in E. gallinarum BM4174, the vanC gene was inactivated by insertion. A EcoRI-HincII fragment of 690 bp, internal to vanC was cloned in pAT114 which does not replicate in Gram-positive bacteria. The resulting pAT217 plasmid was introduced into BM4174 by electroporation (Cruz-Rodz et al., 1990, Mol. Gen. Genet. 224:152-154) and the clones supposed to result from a homologous recombination leading to the integration of pAT217 into vanC were selected on erythromycin. The clone BM4175 was compared with BM4174 by Southern hybridization using the probe C and aphA-3 specific for pAT114. The two probes hybridized with the EcoRI fragment of 8.6 kb from BM4175. The probe C hybridized with a fragment of 2.5 kb from BM4174 whereas no signal was observed with the probe aphA-3. The results indicate that the plasmid pAT217 of 6.1 kb was integrated into the vanC gene. The determination of the minimal inhibitory concentration of vancomycin for BM4174 (16 mg/l) and BM4175 (2 mg/l) indicated that the inactivation by insertion in vanC abolishes resistance to vancomycin.
VanC is thus required for resistance to vancomycin. It may thus be supposed that this protein synthesizes a dipeptide or a depsipeptide which is incorporated into the precursors of peptido-glycans and is not recognized by vancomycin.
The sequences which are the object of the invention are given in the following pages after the list of the sequences containing the description of these sequences. In this list of the sequences, the proteins are identified with respect to the position of the nucleotide bases corresponding to the amino acids of the extremities of the proteins.
List of the Sequences(contained in the sequences I (Ia, Ib), II presented below or in the sequence shown in FIG. 5).
Amino Acid Sequences
SEQ ID NO 1 (VanH): sequence of the first resistance protein, corresponding to the amino acid sequence of the open reading frame No. 3, starting at the base 3501 and terminating at the base 4529, containing the sequence coding for the vanH gene between the bases 3564 and 4529 with respect to the sequence shown in FIG. 5 or corresponding to the sequence between the positions of the nucleotides 6018 and 6983 of the sequence Ia.
SEQ ID NO 2 (VanA): sequence of the VanA protein, corresponding to the amino acid sequence of the open reading frame No. 1, starting at the base 4429 and terminating at the base 5553 with respect to the sequence shown in FIG. 5 or corresponding to the sequence between the positions of the nucleotides 6977 and 7807 of the sequence Ia.
SEQ ID NO 3 (VanX) sequence of the third resistance protein, corresponding to the amino acid sequence of the open reading frame No. 3, starting at the base 5526 and terminating at the base 6167 with respect to the sequence shown in FIG. 5 or corresponding to the sequence between the positions of the nucleotides 7816 and 8621 of the sequence Ia.
SEQ ID NO 4 (VanR): sequence of the regulatory protein R, corresponding to the amino acid sequence of the open reading frame No. 1, starting at the base 1477 and terminating at the base 2214 with respect to the sequence shown in FIG. 5 or corresponding to the sequence between the positions of the nucleotides 3976 and 4668 of the sequence Ia.
SEQ ID NO 5 (VanS): sequence of the sensor protein S, corresponding to the amino acid sequence of the open reading frame No. 2, starting at the base 2180 and terminating at the base 3346 with respect to the sequence shown in FIG. 5 or corresponding to the sequence between the positions of the nucleotides 4648 and 5800 of the sequence Ia.
SEQ ID NO 16: sequence of the transposase corresponding to the amino acids included between the nucleotides 150 and 3112 of the sequence Ib.
SEQ ID NO 17: sequence of the resolvase comprising the amino acids situated between the positions of the nucleotides 3187 and 3759 of the sequence Ia.
SEQ ID NO 18: VanY sequence comprising the amino acids situated between the positions of the nucleotides 9046 and 9960 of the sequence Ia.
SEQ ID NO 19: VanZ sequence comprising the amino acids situated between the positions of the nucleotides 10116 and 10598 of the sequence Ia.
SEQ ID NO 20: VanC amino acid sequence shown in list II.
Nucleotide Sequences
SEQ ID NO 6: nucleotide sequence containing the sequence coding for the 5 proteins as well as the flanking sequences, shown in FIG. 5.
SEQ ID NO 7: sequence containing the sequence coding for the 3 resistance proteins as well as the flanking sequences and starting at the base 3501 and terminating at the base 6167, shown in FIG. 5.
SEQ ID NO 8: sequence of the vanA gene, starting at the base 4429 and terminating at the base 5553 of the sequence shown in FIG. 5, or corresponding to the nucleotide sequence situated between the nucleotides 6977 and 7807 of the sequence Ia.
SEQ ID NO 9: sequence coding for the first resistance protein called VanH, starting at the base 3501 and terminating at the base 4529, in particular the sequence vanH, the coding sequence of which is located between the bases 3564 and 4529 of the sequence shown in FIG. 5, or corresponding to the nucleotide sequence situated between the nucleotides 6018 and 6983 of the sequence Ia.
SEQ ID NO 10 sequence coding for the third resistance protein VanX, starting at the base 5526 and terminating at the base 6167 of the sequence shown in FIG. 5, or corresponding to the nucleotide sequence situated between the nucleotides 7816 and 8621 of the sequence Ia.
SEQ ID NO 11: sequence of the transposon coding for the transposase, the resolvase, vanR, VAnS, VanH, VanA, VanX, VanY and VanZ and containing the repeated reverse sequence of 38 bp at its N- and C-termini and corresponding to the sequence Ia.
SEQ ID NO 12: sequence coding for the transposase, starting at the base 150 and terminating at the base 3112 of the sequence Ib.
SEQ ID NO 13: sequence coding for the resolvase, starting at the base 3187 and terminating at the base 3759 of the sequence Ia.
SEQ ID NO 14 sequence coding for VanY, starting at the base 9046 and terminating at the base 9960 of the sequence Ia.
SEQ ID NO 15: sequence coding for VanZ, starting at the base 10116 and terminating at the base 10598 of the sequence Ia.
SEQ ID NO 21: sequence coding for VanC, shown in the list II in relation to the protein VanC.
SEQ ID NO 22 complete sequence Ia of the transposon of E. faecium, starting at the base 1 and terminating at the base 10851.
SEQ ID NO 23 sequence coding for the protein VanR, starting at the base 3976 and terminating at the base 4668 of the sequence Ia.
SEQ ID NO 24: sequence coding for the protein VanS, starting at the base 4648 and terminating at the base 5800 of the sequence Ia.
| 1 | ||||||||||||||||||||
| GGG | GTA | GCG | TCA | GGA | AAA | TGC | GGA | TTT | ACA | ACG | CTA | AGC | CTA | TTT | TCC | TGA | CGA | ATC | CCT | |
| 61 | ||||||||||||||||||||
| CGT | TTT | TAA | CAA | CGT | TAA | GAA | AGT | TTT | AGT | GGT | CTT | AAA | GAA | TTT | AAT | GAG | ACT | ACT | TTC | |
| 121 | ||||||||||||||||||||
| TCT | GAG | TTA | AAA | TGG | TAT | TCT | CCT | AGT | AAA | TTA | ATA | TGT | TCC | CAA | CCT | AAG | GGC | GAC | ATA | |
| 181 | ||||||||||||||||||||
| TGG | TGT | AAC | AAA | TCT | TCA | TTA | AAG | CTA | CCT | GTC | CGT | TTT | TTA | TAT | TCA | ACT | GCT | GTT | GTT | |
| 241 | ||||||||||||||||||||
| AGG | TGG | AGA | GTA | TTC | CAA | ATA | CTT | ATA | GCA | TTG | ATA | ATT | ATG | TTT | AAA | GCA | CTG | GCT | CTT | |
| 301 | ||||||||||||||||||||
| TGC | AAT | TGA | TGC | TGT | ATG | GTG | CGT | TCT | CTA | AGC | TCA | CCT | TGT | TTT | CCG | AAG | AAA | ATA | GCT | |
| 361 | ||||||||||||||||||||
| CTT | GCC | AAT | CCA | TTC | ATG | GCT | TCT | CCT | TTA | TTC | AAT | CCT | CTT | TGT | ATT | TTT | CTT | CTT | AAT | |
| 421 | ||||||||||||||||||||
| GAT | TCA | TCC | GAT | ATA | TAA | TTC | AAA | ATA | AAG | ATC | GTT | TTT | TCT | ATT | CGG | CCC | ATC | TCA | CGT | |
| 481 | ||||||||||||||||||||
| AAG | GCT | GTA | GCT | AAG | CTG | TTT | TGT | CTT | GAA | TAG | GAA | CCT | AGC | TTC | CCC | ATA | ATA | AGG | GAT | |
| 541 | ||||||||||||||||||||
| GCT | GAA | ACT | GTT | CCC | TCC | CTT | ATA | GAA | TGA | GCT | AAT | CGC | AAA | ACA | TCC | TCA | TAA | TTT | TCT | |
| 601 | ||||||||||||||||||||
| TTA | ATG | ACC | TTT | GTA | TTT | ATT | TGT | CCA | CGT | AAA | ATG | GCT | TCT | AGT | TTT | GGA | TAC | TCA | CTT | |
| 661 | ||||||||||||||||||||
| GCT | TTA | TCT | ATC | GTA | AAT | AAT | TTT | GAG | TCC | GAT | AAA | TCC | CTT | ATT | CTT | GGG | GCA | AAT | TTA | |
| 721 | ||||||||||||||||||||
| AAT | CCT | AAT | AAA | TGA | GTC | AGT | CCG | AAT | ATT | TGG | TCA | GTG | TAA | CCG | GCA | GTG | TCT | GTA | TAA | |
| 781 | ||||||||||||||||||||
| TGT | TCC | TCT | ATG | TTT | AGA | TCC | GTC | TCA | TGA | TGT | AAC | AAA | CCA | TCC | AAA | ACA | TGA | ATC | GCA | |
| 841 | ||||||||||||||||||||
| TCT | CTT | GAA | TTA | GTA | TGA | ATA | ATC | TTT | GTG | TAG | TAA | GAA | GAG | AAT | TGA | TCA | CTT | GTA | AAT | |
| 901 | ||||||||||||||||||||
| CGG | TAG | ATG | GTG | GCT | CCT | TTT | CCA | GTT | CCA | TAA | TGT | GGA | TTT | GCA | TCT | GCA | TGT | AGT | GAT | |
| 961 | ||||||||||||||||||||
| GAA | ACA | CCT | AGC | TGC | ATT | CTC | ATA | CCA | TCT | GAC | GAA | GAT | GTT | GTA | CCG | TCG | CCC | CAA | TAG | |
| 1021 | ||||||||||||||||||||
| AAA | GGC | AAT | TGT | AAT | TTA | TGA | TGA | AAG | TTT | ACT | AAT | ATG | GCT | TGG | GCT | TTA | TTC | ATG | GCA | |
| 1081 | ||||||||||||||||||||
| TCT | TCA | TAC | ATG | CGC | CAT | TGA | GAT | ACA | TTG | GCT | AGT | TGC | TTA | TAT | GTA | AGT | CCG | GGT | GTG | |
| 1141 | ||||||||||||||||||||
| GCT | TCG | GCC | ATC | TTG | CTC | AAG | CCA | ATA | TTC | ATT | CCC | ATT | CCT | AAA | AGG | GCA | GCC | ATG | ATA | |
| 1201 | ||||||||||||||||||||
| ATG | ATT | GTT | TCT | TCC | TTA | TCT | GGT | TTT | CGA | TTA | TTG | GAA | GCA | TGA | GTG | AAT | TGC | TCA | TGA | |
| 1261 | ||||||||||||||||||||
| AAT | CCT | GTT | ATA | TGG | GCC | ACA | TCC | ATG | AGT | AAA | TCA | GTT | AAT | TTT | ATT | CTT | GGT | AGC | ATC | |
| 1321 | ||||||||||||||||||||
| TGA | TAA | AGG | CTT | GCA | CTA | AAT | TTT | TTT | GCT | TCT | TCT | GGA | ACA | TCT | TTT | TCT | AAG | CGT | GCA | |
| 1381 | ||||||||||||||||||||
| AGT | GAT | AGC | TTT | CCT | TTT | TCA | AGA | GAA | ACC | CCA | TCT | AAC | TTA | TTG | GAA | TTG | GCA | GCT | AAC | |
| 1441 | ||||||||||||||||||||
| CAC | TTT | AAC | CTT | TCA | TTA | AAG | CTG | CTG | GTT | CTC | TCC | GTT | ATA | TAA | TCT | TCG | AAT | GAT | AAA | |
| 1501 | ||||||||||||||||||||
| CTA | ACT | GAT | AAT | CTC | GTA | TTC | CCC | TTC | GAT | TGA | TTC | CAT | GTA | TCT | TCC | GAA | AAC | AAA | TAT | |
| 1561 | ||||||||||||||||||||
| TCC | TCA | AAA | TCC | CTA | TAT | TGT | CTG | CTG | CCA | ACA | ATG | GAA | ACA | TCT | CCT | GCC | CGA | ACA | TGC | |
| 1621 | ||||||||||||||||||||
| TCC | CGA | AGT | TCT | GTT | AAA | ACA | GCC | ATT | TCA | TAG | TAA | TGA | CGA | TTA | ATT | GTT | GTA | CCA | TCA | |
| 1681 | ||||||||||||||||||||
| TCC | TCG | TAT | AAA | TGT | CTT | TTC | CAT | CGT | TTT | GAA | ATA | AAA | TCC | ACA | GGT | GAG | TCA | TCA | GGC | |
| 1741 | ||||||||||||||||||||
| ACT | TTT | CGC | TTT | CCA | GAT | TCG | TTC | ATT | CCT | CGG | ATA | ATC | TCA | ACA | GCT | TGT | AAA | AGT | GGC | |
| 1801 | ||||||||||||||||||||
| TCA | TTT | GCC | TTT | GTA | GAA | TGA | AAT | TCC | AAT | ACT | CTT | AAT | AGC | GTT | GGC | GTA | TAT | TTT | CTT | |
| 1861 | ||||||||||||||||||||
| AGT | GAA | TAA | AAC | CGT | TTT | TGC | AGT | AAG | TCT | AAA | TAA | TCA | TAG | TCG | GCA | GGA | CGT | GCA | AGT | |
| 1921 | ||||||||||||||||||||
| TCC | TGA | GCC | TCT | TCT | ACT | GAA | GAG | ACA | AAG | GTA | TTC | CAT | TCA | ATA | ACC | GAT | TCT | AAA | ACC | |
| 1981 | ||||||||||||||||||||
| TTA | AAA | ACG | TCT | AAT | TTT | TCC | TCT | CTT | GCT | TTA | ATT | AAT | GCT | TGT | CCG | ATG | TTC | GTA | AAG | |
| 2041 | ||||||||||||||||||||
| TGT | ATA | ACT | TTC | TCA | TTT | AGC | TTT | TTA | CCG | TTT | TGT | TTC | TGG | ATT | TCC | TCT | TGA | GCC | TTA | |
| 2101 | ||||||||||||||||||||
| CGA | CCT | TTT | GAT | AAC | AAA | CTA | AGT | ATT | TGC | CTA | TCA | TGA | ATT | TCA | AAC | GCT | TTA | TCC | GTT | |
| 2161 | ||||||||||||||||||||
| AGC | TCC | TGA | GTA | AGT | TGT | AAT | AAA | TAG | ATG | GTT | AAT | ATC | GAA | TAA | CGT | TTA | TTT | TCT | TGA | |
| 2221 | ||||||||||||||||||||
| AAG | TCA | CGG | AAT | GCA | TAC | GGC | TCG | TAT | CTT | GAG | CCT | AAG | CGA | GAC | AGC | TGC | AAC | AGG | CGG | |
| 2281 | ||||||||||||||||||||
| TTA | CGG | TGC | AAA | TGA | CTA | ATT | TGC | ACT | GTT | TCT | AAA | TCC | ATT | CCT | CGT | ATG | TAT | TCG | AGT | |
| 2341 | ||||||||||||||||||||
| CGT | TCT | ATT | ATT | TTT | AGA | AAA | GTT | TCG | GGT | GAA | GGA | TGA | CCC | GGT | GGC | TCT | TTT | AAC | CAA | |
| 2401 | ||||||||||||||||||||
| CCC | AAT | ATC | GTT | TTA | TTG | GAT | TCG | GAT | GGA | TGC | TGC | GAG | GTA | ATA | ATC | CCT | TCA | AGC | TTT | |
| 2461 | ||||||||||||||||||||
| TCT | TTT | TGC | TCA | TTT | GTT | AGA | GAT | TTA | CTA | ACC | GTA | TTA | AAT | AGC | TTC | TTT | TCA | GCC | ATT | |
| 2521 | ||||||||||||||||||||
| GCC | CTT | GCT | TCC | CAC | ACC | ATT | CTT | TCA | AGT | GTA | GTG | ATA | GCA | GGC | AGT | ATA | ATT | TTG | TTT | |
| 2581 | ||||||||||||||||||||
| TTT | CTT | AGA | AAA | TCT | ATG | CAT | TCA | TGC | AGT | AGA | TGA | ATG | GCA | TCA | CCA | TTT | TCC | AAA | GCT | |
| 2641 | ||||||||||||||||||||
| AAT | TGA | TGA | AGG | TAC | TTA | AAT | GTC | ATT | CGA | TAT | TCA | CTC | AGG | GTA | AAA | GTT | ACA | AAG | TCG | |
| 2701 | ||||||||||||||||||||
| TAT | TCA | CTT | CGA | ATT | TCT | TTC | AAA | TGA | TCC | CAA | AGT | GTA | TTT | TCC | CTT | TGA | GGA | TAA | TGA | |
| 2761 | ||||||||||||||||||||
| TCA | AGC | GAG | GAT | GGA | CTA | ACA | CCA | ATC | TGT | TTC | GAT | ATA | TAT | TGT | ATG | ACC | GAA | TCT | GGG | |
| 2821 | ||||||||||||||||||||
| ATG | CTT | TTG | ATA | TGA | GTG | TAT | GGC | CAA | CCG | GGA | TAC | CGA | AGA | ACA | GCT | AAT | TGA | ACA | GCA | |
| 2881 | ||||||||||||||||||||
| AAT | CCT | AAA | CGG | TTT | TCT | TCC | CTC | CTT | CGC | TTA | TTA | ACT | ATT | TCT | AAA | TCC | CGT | TTG | GAA | |
| 2941 | ||||||||||||||||||||
| AAA | GTG | AAG | TAG | GTC | CCC | AGT | ATC | CAT | TCA | TCT | TCA | GGG | ATT | TGC | ATA | AAA | GCC | TGT | CTC | |
| 3001 | ||||||||||||||||||||
| TGT | TCC | GGT | GTA | AGC | AAT | TCT | CTA | CCT | CTC | GCA | ATT | TTC | ATT | CAG | TAT | CAT | TCC | ATT | TCT | |
| 3061 | ||||||||||||||||||||
| GTA | TTT | TCA | ATT | TAT | TAG | TTC | AAT | TAT | ATA | TCA | ATA | GAG | TGT | ACT | CTA | TTG | ATA | CAA | ATG | |
| 3121 | ||||||||||||||||||||
| TAG | TAG | ACT | GAT | AAA | ATC | ATA | GTT | AAG | AGC | GTC | TCA | TAA | GAC | TTG | TCT | CAA | AAA | TGA | GGT | |
| 3181 | resolvase |
| LEU | ARG | LYS | ILE | GLY | TYR | ILE | ARG | VAL | SER | SER | THR | ASN | GLN | ASN | PRO | SER | ARG | |||
| GAT | ATT | TTG | CGG | AAA | ATC | GGT | TAT | ATT | CGT | GTC | AGT | TCG | ACT | AAC | CAG | AAT | CCT | TCA | AGA | |
| 3241 | ||||||||||||||||||||
| GLN | PHE | GLN | GLN | LEU | ASN | GLU | ILE | GLY | MET | ASP | ILE | ILE | TYR | GLU | GLU | LYS | VAL | SER | GLY | |
| CAA | TTT | CAG | CAG | TTG | AAC | GAG | ATC | GGA | ATG | GAT | ATT | ATA | TAT | GAA | GAG | AAA | GTT | TCA | GGA | |
| 3301 | ||||||||||||||||||||
| ALA | THR | LYS | ASP | ARG | GLU | GLN | LEU | GLN | LYS | VAL | LEU | ASP | ASP | LEU | GLN | GLU | ASP | ASP | ILE | |
| GCA | ACA | AAG | GAT | CGC | GAG | CAA | CTT | CAA | AAA | GTG | TTA | GAC | GAT | TTA | CAG | GAA | GAT | GAC | ATC | |
| 3361 | ||||||||||||||||||||
| ILE | TYR | VAL | THR | ASP | LEU | THR | ARG | ILE | THR | ARG | SER | THR | GLN | ASP | LEU | PHE | GLU | LEU | ILE | |
| ATT | TAT | GTT | ACA | GAC | TTA | ACT | CGA | ATC | ACT | CGT | AGT | ACA | CAA | GAT | CTA | TTT | GAA | TTA | ATC | |
| 3421 | ||||||||||||||||||||
| ASP | ASN | ILE | ARG | ASP | LYS | LYS | ALA | SER | LEU | LYS | SER | LEU | LYS | ASP | THR | TRP | LEU | ASP | LEU | |
| GAT | AAC | ATA | CGA | GAT | AAA | AAG | GCA | AGT | TTA | AAA | TCA | CTA | AAA | GAT | ACA | TGG | CTT | GAT | TTA | |
| 3481 | ||||||||||||||||||||
| SER | GLU | ASP | ASN | PRO | TYR | SER | GLN | PHE | LEU | ILE | THR | VAL | MET | ALA | GLY | VAL | ASN | GLN | LEU | |
| TCA | GAA | GAT | AAT | CCA | TAC | AGC | CAA | TTC | TTA | ATT | ACT | GTA | ATG | GCT | GGT | GTT | AAC | CAA | TTA | |
| 3541 | ||||||||||||||||||||
| GLU | ARG | ASP | LEU | ILE | ARG | MET | ARG | GLN | ARG | GLU | GLY | ILE | GLU | LEU | ALA | LYS | LYS | GLU | GLY | |
| GAG | CGA | GAT | CTT | ATT | CGG | ATG | AGA | CAA | CGT | GAA | GGG | ATT | GAA | TTG | GCT | AAG | AAA | GAA | GGA | |
| 3601 | ||||||||||||||||||||
| LYS | PHE | LYS | GLY | ARG | LEU | LYS | LYS | TYR | HIS | LYS | ASN | HIS | ALA | GLY | MET | ASN | TYR | ALA | VAL | |
| AAG | TTT | AAA | GGT | CGA | TTA | AAG | AAG | TAT | CAT | AAA | AAT | CAC | GCA | GGA | ATG | AAT | TAT | GCG | GTA | |
| 3661 | ||||||||||||||||||||
| LYS | LEU | TYR | LYS | GLU | GLY | ASN | MET | THR | VAL | ASN | GLN | ILE | CYS | GLU | ILE | THR | ASN | VAL | SER | |
| AAG | CTA | TAT | AAA | GAA | GGA | AAT | ATG | ACT | GTA | AAT | CAA | ATT | TGT | GAA | ATT | ACT | AAT | GTA | TCT | |
| 3721 | ||||||||||||||||||||
| ARG | ALA | SER | LEU | TYR | ARG | LYS | LEU | SER | GLU | VAL | ASN | ASN | ||||||||
| AGG | GCT | TCA | TTA | TAC | AGG | AAA | TTA | TCA | GAA | GTG | AAT | AAT | TAG | CCA | TTC | TGT | ATT | CCC | CTA | |
| 3781 | ||||||||||||||||||||
| ATG | GGC | AAT | ATT | TTT | AAA | GAA | GAA | AAG | GAA | ACT | ATA | AAA | TAT | TAA | CAG | CCT | CCT | AGC | GAT | |
| 3841 | ||||||||||||||||||||
| GCC | GAA | AAG | CCC | TTT | GAT | AAA | AAA | AGA | ATC | ATC | ATC | TTA | AGA | AAT | TCT | TAG | TCA | TTT | ATT | |
| 3901 | ||||||||||||||||||||
| ATG | TAA | ATG | CTT | ATA | AAT | TCG | GCC | CTA | TAA | TCT | GAT | AAA | TTA | TTA | AGG | GCA | AAC | TTA | TGT | |
| 3961 | VanR | MET | SER | ASP | LYS | ILE | LEU | ILE | VAL | ASP | ASP | GLU | HIS | GLU | ILE | ALA |
| GAA | AGG | GTG | ATA | ACT | ATG | AGC | GAT | AAA | ATA | CTT | ATT | GTG | GAT | GAT | GAA | CAT | GAA | ATT | GCC | |
| 4021 | ||||||||||||||||||||
| ASP | LEU | VAL | GLU | LEU | TYR | LEU | LYS | ASN | GLU | ASN | TYR | THR | VAL | PHE | LYS | TYR | TYR | THR | ALA | |
| GAT | TTG | GTT | GAA | TTA | TAC | TTA | AAA | AAC | GAG | AAT | TAT | ACG | GTT | TTC | AAA | TAC | TAT | ACC | GCC | |
| 4081 | ||||||||||||||||||||
| LYS | GLU | ALA | LEU | GLU | CYS | ILE | ASP | LYS | SER | GLU | ILE | ASP | LEU | ALA | ILE | LEU | ASP | ILE | MET | |
| AAA | GAA | GCA | TTG | GAA | TGT | ATA | GAC | AAG | TCT | GAG | ATT | GAC | CTT | GCC | ATA | TTG | GAC | ATC | ATG | |
| 4141 | ||||||||||||||||||||
| LEU | PRO | GLY | THR | SER | GLY | LEU | THR | ILE | CYS | GLN | LYS | ILE | ARG | ASP | LYS | HIS | THR | TYR | PRO | |
| CTT | CCC | GGC | ACA | AGC | GGC | CTT | ACT | ATC | TGT | CAA | AAA | ATA | AGG | GAC | AAG | CAC | ACC | TAT | CCG | |
| 4201 | ||||||||||||||||||||
| ILE | ILE | MET | LEU | THR | GLY | LYS | ASP | THR | GLU | VAL | ASP | LYS | ILE | THR | GLY | LEU | THR | ILE | GLY | |
| ATT | ATC | ATG | CTG | ACC | GGG | AAA | GAT | ACA | GAG | GTA | GAT | AAA | ATT | ACA | GGG | TTA | ACA | ATC | GGC | |
| 4261 | ||||||||||||||||||||
| ALA | ASP | ASP | TYR | ILE | THR | LYS | PRO | PHE | ARG | PRO | LEU | GLU | LEU | ILE | ALA | ARG | VAL | LYS | ALA | |
| GCG | GAT | GAT | TAT | ATA | ACG | AAG | CCC | TTT | CGC | CCA | CTG | GAG | TTA | ATT | GCT | CGG | GTA | AAG | GCC | |
| 4321 | ||||||||||||||||||||
| GLN | LEU | ARG | ARG | TYR | LYS | LYS | PHE | SER | GLY | VAL | LYS | GLU | GLN | ASN | GLU | ASN | VAL | ILE | VAL | |
| CAG | TTG | CGC | CGA | TAC | AAA | AAA | TTC | AGT | GGA | GTA | AAG | GAG | CAG | AAC | GAA | AAT | GTT | ATC | GTC | |
| 4381 | ||||||||||||||||||||
| HIS | SER | GLY | LEU | VAL | ILE | ASN | VAL | ASN | THR | HIS | GLU | CYS | TYR | LEU | ASN | GLU | LYS | GLN | LEU | |
| CAC | TCC | GGC | CTT | GTC | ATT | AAT | GTT | AAC | ACC | CAT | GAG | TGT | TAT | CTG | AAC | GAG | AAG | CAG | TTA | |
| 4441 | ||||||||||||||||||||
| SER | LEU | THR | PRO | THR | GLU | PHE | SER | ILE | LEU | ARG | ILE | LEU | CYS | GLU | ASN | LYS | GLY | ASN | VAL | |
| TCC | CTT | ACT | CCC | ACC | GAG | TTT | TCA | ATA | CTG | CGA | ATC | CTC | TGT | GAA | AAC | AAG | GGG | AAT | GTG | |
| 4501 | ||||||||||||||||||||
| VAL | SER | SER | GLU | LEU | LEU | PHE | HIS | GLU | ILE | TRP | GLY | ASP | GLU | TYR | PHE | SER | LYS | SER | ASN | |
| GTT | AGC | TCC | GAG | CTG | CTA | TTT | CAT | GAG | ATA | TGG | GGC | GAC | GAA | TAT | TTC | AGC | AAG | AGC | AAC | |
| 4561 | ||||||||||||||||||||
| ASN | THR | ILE | THR | VAL | HIS | ILE | ARG | HIS | LEU | ARG | GLU | LYS | MET | ASN | ASP | THR | ILE | ASP | ASN | |
| AAC | ACC | ATC | ACC | GTG | CAT | ATC | CGG | CAT | TTG | CGC | GAA | AAA | ATG | AAC | GAC | ACC | ATT | GAT | AAT | |
| 4621 |
| PRO | LYS | TYR | ILE | LYS | THR | VAL | TRP | GLY | VALGLYTYRLYSILEGLULYS |
| CCG | AAA | TAT | ATA | AAA | ACG | GTA | TGG | GGG | GTTGGTTATAAAATTGAAAAAT | AAA | AAA | AAC | GAC |
| VanS | LEUVALILELYSLEULYSASN | LYS | LYS | ASN | ASP | ||||||||
| 4682 |
| TYR | SER | LYS | LEU | GLU | ARG | LYS | LEU | TYR | MET | TYR | ILE | VAL | ALA | ILE | VAL | VAL | VAL | ALA | ILE | |
| TAT | TCC | AAA | CTA | GAA | CGA | AAA | CTT | TAC | ATG | TAT | ATC | GTT | GCA | ATT | GTT | GTG | GTA | GCA | ATT | |
| 4742 | ||||||||||||||||||||
| VAL | PHE | VAL | LEU | TYR | ILE | ARG | SER | MET | ILE | ARG | GLY | LYS | LEU | GLY | ASP | TRP | ILE | LEU | SER | |
| GTA | TTC | GTG | TTC | TAT | ATT | CGT | TCA | ATG | ATC | CGA | GGG | AAA | CTT | GGG | GAT | TGG | ATC | TTA | AGT | |
| 4802 | ||||||||||||||||||||
| ILE | LEU | GLU | ASN | LYS | TYR | ASP | LEU | ASN | HIS | LEU | ASP | ALA | MET | LYS | LEU | TYR | GLN | TYR | SER | |
| ATT | TTG | GAA | AAC | AAA | TAT | GAC | TTA | AAT | CAC | CTG | GAC | GCG | ATG | AAA | TTA | TAT | CAA | TAT | TCC | |
| 4862 | ||||||||||||||||||||
| ILE | ARG | ASN | ASN | ILE | ASP | ILE | PHE | ILE | TYR | VAL | ALA | ILE | VAL | ILE | SER | ILE | LEU | ILE | LEU | |
| ATA | CGG | AAC | AAT | ATA | GAT | ATC | TTT | ATT | TAT | GTG | GCG | ATT | GTC | ATT | AGT | ATT | CTT | ATT | CTA | |
| 4922 | ||||||||||||||||||||
| CYS | ARG | VAL | MET | LEU | SER | LYS | PHE | ALA | LYS | TYR | PHE | ASP | GLU | ILE | ASN | THR | GLY | ILE | ASP | |
| TGT | CGC | GTC | ATG | CTT | TCA | AAA | TTC | GCA | AAA | TAC | TTT | GAC | GAG | ATA | AAT | ACC | GGC | ATT | GAT | |
| 4982 | ||||||||||||||||||||
| VAL | LEU | ILE | GLN | ASN | GLU | ASP | LYS | GLN | ILE | GLU | LEU | SER | ALA | GLU | MET | ASP | VAL | MET | GLU | |
| GTA | CTT | ATT | CAG | AAC | GAA | GAT | AAA | CAA | ATT | GAG | CTT | TCT | GCG | GAA | ATG | GAT | GTT | ATG | GAA | |
| 5042 | ||||||||||||||||||||
| GLN | LYS | LEU | ASN | THR | LEU | LYS | ARG | THR | LEU | GLU | LYS | ARG | GLU | GLN | ASP | ALA | LYS | LEU | ALA | |
| CAA | AAG | CTC | AAC | ACA | TTA | AAA | CGG | ACT | CTG | GAA | AAG | CGA | GAG | CAG | GAT | GCA | AAG | CTG | GCC | |
| 5102 | ||||||||||||||||||||
| GLU | GLN | ARG | LYS | ASN | ASP | VAL | VAL | MET | TYR | LEU | ALA | HIS | ASP | ILE | LYS | THR | PRO | LEU | THR | |
| GAA | CAA | AGA | AAA | AAT | GAC | GTT | GTT | ATG | TAC | TTG | GCG | CAC | GAT | ATT | AAA | ACG | CCC | CTT | ACA | |
| 5162 | ||||||||||||||||||||
| SER | ILE | ILE | GLY | TYR | LEU | SER | LEU | LEU | ASP | GLU | ALA | PRO | ASP | MET | PRO | VAL | ASP | GLN | LYS | |
| TCC | ATT | ATC | GGT | TAT | TTG | AGC | CTG | CTT | GAC | GAG | GCT | CCA | GAC | ATG | CCG | GTA | GAT | CAA | AAG | |
| 5222 | ||||||||||||||||||||
| ALA | LYS | TYR | VAL | HIS | ILE | THR | LEU | ASP | LYS | ALA | TYR | ARG | LEU | GLU | GLN | LEU | ILE | ASP | GLU | |
| GCA | AAG | TAT | GTG | CAT | ATC | ACG | TTG | GAC | AAA | GCG | TAT | CGA | CTC | GAA | CAG | CTA | ATC | GAC | GAG | |
| 5282 | ||||||||||||||||||||
| PHE | PHE | GLU | ILE | THR | ARG | TYR | ASN | LEU | GLN | THR | ILE | THR | LEU | THR | LYS | THR | HIS | ILE | ASP | |
| TTT | TTT | GAG | ATT | ACA | CGG | TAT | AAC | CTA | CAA | ACG | ATA | ACG | CTA | ACA | AAA | ACG | CAC | ATA | GAC | |
| 5342 | ||||||||||||||||||||
| LEU | TYR | TYR | MET | LEU | VAL | GLN | MET | THR | ASP | GLU | PHE | TYR | PRO | GLN | LEU | SER | ALA | HIS | GLY | |
| CTA | TAC | TAT | ATG | CTG | GTG | CAG | ATG | ACC | GAT | GAA | TTT | TAT | CCT | CAG | CTT | TCC | GCA | CAT | GGA | |
| 5402 | ||||||||||||||||||||
| LYS | GLN | ALA | VAL | ILE | HIS | ALA | PRO | GLU | ASP | LEU | THR | VAL | SER | GLY | ASP | PRO | ASP | LYS | LEU | |
| AAA | CAG | GCG | GTT | ATT | CAC | GCC | CCC | GAG | GAT | CTG | ACC | GTG | TCC | GGC | GAC | CCT | GAT | AAA | CTC | |
| 5462 | ||||||||||||||||||||
| ALA | ARG | VAL | PHE | ASN | ASN | ILE | LEU | LYS | ASN | ALA | ALA | ALA | TYR | SER | GLU | ASP | ASN | SER | ILE | |
| GCG | AGA | GTC | TTT | AAC | AAC | ATT | TTG | AAA | AAC | GCC | GCT | GCA | TAC | AGT | GAG | GAT | AAC | AGC | ATC | |
| 5522 | ||||||||||||||||||||
| ILE | ASP | ILE | THR | ALA | GLY | LEU | SER | GLY | ASP | VAL | VAL | SER | ILE | GLU | PHE | LYS | ASP | THR | GLY | |
| ATT | GAC | ATT | ACC | GCG | GGC | CTC | TCC | GGG | GAT | GTG | GTG | TCA | ATC | GAA | TTC | AAG | AAC | ACT | GGA | |
| 5582 | ||||||||||||||||||||
| SER | ILE | PRO | LYS | ASP | LYS | LEU | ALA | ALA | ILE | PHE | GLU | LYS | PHE | TYR | ARG | LEU | ASP | ASN | ALA | |
| AGC | ATC | CCA | AAA | GAT | AAG | CTA | GCT | GCC | ATA | TTT | GAA | AAG | TTC | TAT | AGG | CTG | GAC | AAT | GCT | |
| 5642 | ||||||||||||||||||||
| ARG | SER | SER | ASP | THR | GLY | GLY | ALA | GLY | LEU | GLY | LEU | ALA | ILE | ALA | LYS | GLU | ILE | ILE | VAL | |
| CGT | TCT | TCC | GAT | ACG | GGT | GGC | GCG | GGA | CTT | GGA | TTG | GCG | ATT | GCA | AAA | GAA | ATT | ATT | GTT | |
| 5702 | ||||||||||||||||||||
| GLN | HIS | GLY | GLY | GLN | ILE | TYR | ALA | GLU | SER | ASN | ASP | ASN | TYR | THR | THR | PHE | ARG | VAL | GLU | |
| CAG | CAT | GGA | GGG | CAG | ATT | TAC | GCG | GAA | AGC | AAT | GAT | AAC | TAT | ACG | ACG | TTT | AGG | GTA | GAG | |
| 5762 | ||||||||||||||||||||
| LEU | PRO | ALA | MET | PRO | ASP | LEU | VAL | ASP | LYS | ARG | ARG | SER | ||||||||
| CTT | CCA | GCG | ATG | CCA | GAC | TTG | GTT | GAT | AAA | AGG | AGG | TCC | TAA | GA | GAT | GTA | TAT | AAT | TTT | |
| 5821 | ||||||||||||||||||||
| TTA | GGA | AAA | TCT | CAA | GGT | TAT | CTT | TAC | TTT | TTC | TTA | GGA | AAT | TAA | CAA | TTT | AAT | ATT | AAG | |
| 5881 | ||||||||||||||||||||
| AAA | CGG | CTC | GTT | CTT | ACA | CGG | TAG | ACT | TAA | TAC | CGT | AAG | AAC | GAG | CCG | TTT | TCG | TTC | TTC | |
| 5941 | ||||||||||||||||||||
| AGA | GAA | AGA | TTT | GAC | AAG | ATT | ACC | ATT | GGC | ATC | CCC | GTT | TTA | TTT | GGT | GCC | TTT | CAC | AGA | |
| 6001 |
| VanH | MET | ASN | ASN | ILE | GLY | ILE | THR | VAL | TYR | GLY | CYS | GLU | GLN | ASP | GLU |
| AAGGGTTGG | TCT | TAA | TT | ATG | AAT | AAC | ATC | GGC | ATT | ACT | GTT | TAT | GGA | TGT | GAG | CAG | GAT | GAG | |
| 6063 | ||||||||||||||||||||
| ALA | ASP | ALA | PHE | HIS | ALA | LEU | SER | PRO | ARG | PHE | GLY | VAL | MET | ALA | THR | ILE | ILE | ASN | ALA | |
| GCA | GAT | GCA | TTC | CAT | GCT | CTT | TCG | CCT | CGC | TTT | GGC | GTT | ATG | GCA | ACG | ATA | ATT | AAC | GCC | |
| 6123 | ||||||||||||||||||||
| ASN | VAL | SER | GLU | SER | ASN | ALA | LYS | SER | ALA | PRO | PHE | ASN | GLN | CYS | ILE | SER | VAL | GLY | HIS | |
| AAC | GTG | TCG | GAA | TCC | AAC | GCC | AAA | TCC | GCG | CCT | TTC | AAT | CAA | TGT | ATC | AGT | GTG | GGA | CAT | |
| 6183 | ||||||||||||||||||||
| LYS | SER | GLU | ILE | SER | ALA | SER | ILE | LEU | LEU | ALA | LEU | LYS | ARG | ALA | GLY | VAL | LYS | TYR | ILE | |
| AAA | TCA | GAG | ATT | TCC | GCC | TCT | ATT | CTT | CTT | GCG | CTG | AAG | AGA | GCC | GGT | GTG | AAA | TAT | ATT | |
| 6243 | ||||||||||||||||||||
| SER | THR | ARG | SER | ILE | GLY | CYS | ASN | HIS | ILE | ASP | THR | THR | ALA | ALA | LYS | ARG | MET | GLY | ILE | |
| TCT | ACC | CGA | AGC | ATC | GGC | TGC | AAT | CAT | ATA | GAT | ACA | ACT | GCT | GCT | AAG | AGA | ATG | GGC | ATC | |
| 6303 | ||||||||||||||||||||
| THR | VAL | ASP | ASN | VAL | ALA | TYR | SER | PRO | ASP | SER | VAL | ALA | ASP | TYR | THR | MET | MET | LEU | ILE | |
| ACT | GTC | GAC | AAT | GTG | GCG | TAC | TCG | CCG | GAT | AGC | GTT | GCC | GAT | TAT | ACT | ATG | ATG | CTA | ATT | |
| 6363 | ||||||||||||||||||||
| LEU | MET | ALA | VAL | ARG | ASN | VAL | LYS | SER | ILE | VAL | ARG | SER | VAL | GLU | LYS | HIS | ASP | PHE | ARG | |
| CTT | ATG | GCA | GTA | CGC | AAC | GTA | AAA | TCG | ATT | GTG | CGC | TCT | GTG | GAA | AAA | CAT | GAT | TTC | AGG | |
| 6423 | ||||||||||||||||||||
| LEU | ASP | SER | ASP | ARG | GLY | LYS | VAL | LEU | SER | ASP | MET | THR | VAL | GLY | VAL | VAL | GLY | THR | GLY | |
| TTG | GAC | AGC | GAC | CGT | GGC | AAG | GTA | CTC | AGC | GAC | ATG | ACA | GTT | GGT | GTG | GTG | GGA | ACG | GGC | |
| 6483 | ||||||||||||||||||||
| GLN | ILE | GLY | LYS | ALA | VAL | ILE | GLU | ARG | LEU | ARG | GLY | PHE | GLY | CYS | LYS | VAL | LEU | ALA | TYR | |
| CAG | ATA | GGC | AAA | GCG | GTT | ATT | GAG | CGG | CTG | CGA | GGA | TTT | GGA | TGT | AAA | GTG | TTG | GCT | TAT | |
| 6543 | ||||||||||||||||||||
| SER | ARG | SER | ARG | SER | ILE | GLU | VAL | ASN | TYR | VAL | PRO | PHE | ASP | GLU | LEU | LEU | GLN | ASN | SER | |
| AGT | CGC | AGC | CGA | AGT | ATA | GAG | GTA | AAC | TAT | GTA | CCG | TTT | GAT | GAG | TTG | CTG | CAA | AAT | AGC | |
| 6603 | ||||||||||||||||||||
| ASP | ILE | VAL | THR | LEU | HIS | VAL | PRO | LEU | ASN | THR | ASP | THR | HIS | TYR | ILE | ILE | SER | HIS | GLU | |
| GAT | ATC | GTT | ACG | CTT | CAT | GTG | CCG | CTC | AAT | ACG | GAT | ACG | CAC | TAT | ATT | ATC | AGC | CAC | GAA | |
| 6663 | ||||||||||||||||||||
| GLN | ILE | GLN | ARG | MET | LYS | GLN | GLY | ALA | PHE | LEU | ILE | ASN | THR | GLY | ARG | GLY | PRO | LEU | VAL | |
| CAA | ATA | CAG | AGA | ATG | AAG | CAA | GGA | GCA | TTT | CTT | ATC | AAT | ACT | GGG | CGC | GGT | CCA | CTT | GTA | |
| 6723 | ||||||||||||||||||||
| ASP | THR | TYR | GLU | LEU | VAL | LYS | ALA | LEU | GLU | ASN | GLY | LYS | LEU | GLY | GLY | ALA | ALA | LEU | ASP | |
| GAT | ACC | TAT | GAG | TTG | GTT | AAA | GCA | TTA | GAA | AAC | GGG | AAA | CTG | GGC | GGT | GCC | GCA | TTG | GAT | |
| 6783 | ||||||||||||||||||||
| VAL | LEU | GLU | GLY | GLU | GLU | GLU | PHE | PHE | TYR | SER | ASP | CYS | THR | GLN | LYS | PRO | ILE | ASP | ASN | |
| GTA | TTG | GAA | GGA | GAG | GAA | GAG | TTT | TTC | TAC | TCT | GAT | TGC | ACC | CAA | AAA | CCA | ATT | GAT | AAT | |
| 6843 | ||||||||||||||||||||
| GLN | PHE | LEU | LEU | LYS | LEU | GLN | ARG | MET | PRO | ASN | VAL | ILE | ILE | THR | PRO | HIS | THR | ALA | TYR | |
| CAA | TTT | TTA | CTT | AAA | CTT | CAA | AGA | ATG | CCT | AAC | GTG | ATA | ATC | ACA | CCG | CAT | ACG | GCC | TAT | |
| 6903 | ||||||||||||||||||||
| TYR | THR | GLU | GLN | ALA | LEU | ARG | ASP | THR | VAL | GLU | LYS | THR | ILE | LYS | ASN | CYS | LEU | ASP | PHE | |
| TAT | ACC | GAG | CAA | GCG | TTG | CGT | GAT | ACC | GTT | GAA | AAA | ACC | ATT | AAA | AAC | TGT | TTG | GAT | TTT | |
| 6963 |
| VanA | METASN | ARG | ILE | LYS | VAL | ALA | ILE | LEU | PHE | GLY | GLY | CYS | SER |
| GAA | AGG | AGA | CAG | GAG | CATGAAT | AGA | ATA | AAA | GTT | GCA | ATA | CTG | TTT | GGG | GGT | TGC | TCA |
| GLU | ARG | ARG | GLN | GLU | HISGLU | |
| 7021 | ||||||||||||||||||||
| GLU | GLU | HIS | ASP | VAL | SER | VAL | LYS | SER | ALA | ILE | GLU | ILE | ALA | ALA | ASN | ILE | ASN | LYS | GLU | |
| GAG | GAG | CAT | GAC | GTA | TCG | GTA | AAA | TCT | GCA | ATA | GAG | ATA | GCC | GCT | AAC | ATT | AAT | AAA | GAA | |
| 7081 | ||||||||||||||||||||
| LYS | TYR | GLU | PRO | LEU | TYR | ILE | GLY | ILE | THR | LYS | SER | GLY | VAL | TRP | LYS | MET | CYS | GLU | LYS | |
| AAA | TAC | GAG | CCG | TTA | TAC | ATT | GGA | ATT | ACG | AAA | TCT | GGT | GTA | TGG | AAA | ATG | TGC | GAA | AAA | |
| 7141 | ||||||||||||||||||||
| PRO | CYS | ALA | GLU | TRP | GLU | ASN | ASP | ASN | CYS | TYR | SER | ALA | VAL | LEU | SER | PRO | ASP | LYS | LYS | |
| CCT | TGC | GCG | GAA | TGG | GAA | AAC | GAC | AAT | TGC | TAT | TCA | GCT | GTA | CTC | TCG | CCG | GAT | AAA | AAA | |
| 7201 | ||||||||||||||||||||
| MET | HIS | GLY | LEU | LEU | VAL | LYS | LYS | ASN | HIS | GLU | TYR | GLU | ILE | ASN | HIS | VAL | ASP | VAL | ALA | |
| ATG | CAC | GGA | TTA | CTT | GTT | AAA | hAG | AAC | CAT | GAA | TAT | GAA | ATC | AAC | CAT | GTT | GAT | GTA | GCA | |
| 7261 | ||||||||||||||||||||
| PHE | SER | ALA | LEU | HIS | GLY | LYS | SER | GLY | GLU | ASP | GLY | SER | ILE | GLN | GLY | LEU | PHE | GLU | LEU | |
| TTT | TCA | GCT | TTG | CAT | GGC | AAG | TCA | GGT | GAA | GAT | GGA | TCC | ATA | CAA | GGT | CTG | TTT | GAA | TTG | |
| 7321 | ||||||||||||||||||||
| SER | GLY | ILE | PRO | PHE | VAL | GLY | CYS | ASP | ILE | GLN | SER | SER | ALA | ILE | CYS | MET | ASP | LYS | SER | |
| TCC | GGT | ATC | CCT | TTT | GTA | GGC | TGC | GAT | ATT | CAA | AGC | TCA | GCA | ATT | TGT | ATG | GAC | AAA | TCG | |
| 7381 | ||||||||||||||||||||
| LEU | THR | TYR | ILE | VAL | ALA | LYS | ASN | ALA | GLY | ILE | ALA | THR | PRO | ALA | PHE | TRP | VAL | ILE | ASN | |
| TTG | ACA | TAC | ATC | GTT | GCG | AAA | AAT | GCT | GGG | ATA | GCT | ACT | CCC | GCC | TTT | TGG | GTT | ATT | AAT | |
| 7441 | ||||||||||||||||||||
| LYS | ASP | ASP | ARG | PRO | VAL | ALA | ALA | THR | PHE | THR | TYR | PRO | VAL | PHE | VAL | LYS | PRO | ALA | ARG | |
| AAA | GAT | GAT | AGG | CCG | GTG | GCA | GCT | ACG | TTT | ACC | TAT | CCT | GTT | TTT | GTT | AAG | CCG | GCG | CGT | |
| 7501 | ||||||||||||||||||||
| SER | GLY | SER | SER | PHE | GLY | VAL | LYS | LYS | VAL | ASN | SER | ALA | ASP | GLU | LEU | ASP | TYR | ALA | ILE | |
| TCA | GGC | TCA | TCC | TTC | GGT | GTG | AAA | AAA | GTC | AAT | AGC | GCG | GAC | GAA | TTG | GAC | TAC | GCA | ATT | |
| 7561 | ||||||||||||||||||||
| GLU | SER | ALA | ARG | GLN | TYR | ASP | SER | LYS | ILE | LEU | ILE | GLU | GLN | ALA | VAL | SER | GLY | CYS | GLU | |
| GAA | TCG | GCA | AGA | CAA | TAT | GAC | AGC | AAA | ATC | TTA | ATT | GAG | CAG | GCT | GTT | TCG | GGC | TGT | GAG | |
| 7621 | ||||||||||||||||||||
| VAL | GLY | CYS | ALA | VAL | LEU | GLY | ASN | SER | ALA | ALA | LEU | VAL | VAL | GLY | GLU | VAL | ASP | GLN | ILE | |
| GTC | GGT | TGT | GCG | GTA | TTG | GGA | AAC | AGT | GCC | GCG | TTA | GTT | GTT | GGC | GAG | GTG | GAC | CAA | ATC | |
| 7681 | ||||||||||||||||||||
| ARG | LEU | GLN | TYR | GLY | ILE | PHE | ARG | ILE | HIS | GLN | GLU | VAL | GLU | PRO | GLU | LYS | GLY | SER | GLU | |
| AGG | CTG | CAG | TAC | GGA | ATC | TTT | CGT | ATT | CAT | CAG | GAA | GTC | GAG | CCG | GAA | AAA | GGC | TCT | GAA | |
| 7741 | ||||||||||||||||||||
| ASN | ALA | VAL | ILE | THR | VAL | PRO | ALA | ASP | LEU | SER | ALA | GLU | GLU | ARG | GLY | ARG | ILE | GLN | GLU | |
| AAC | GCA | GTT | ATA | ACC | GTT | CCC | GCA | GAC | CTT | TCA | GCA | GAG | GAG | CGA | GGA | CGG | ATA | CAG | GAA | |
| 7801 | ||||||||||||||||||||
| THR | ALA | LYS | LYS | ILE | TYR | LYS | ALA | LEU | GLY | CYS | ARG | GLY | LEU | ALA | ARG | VAL | ASP | MET | PHE | |
| ACG | GCA | AAA | AAA | ATA | TAT | AAA | GCG | CTC | GGC | TGT | AGA | GGT | CTA | GCC | CGT | GTG | GAT | ATG | TTT | |
| 7861 | ||||||||||||||||||||
| LEU | GLN | ASP | ASN | GLY | ARG | ILE | VAL | LEU | ASN | GLU | VAL | ASN | THR | LEU | PRO | GLY | PHE | THR | SER | |
| TTA | CAA | GAT | AAC | GGC | CGC | ATT | GTA | CTG | AAC | GAA | GTC | AAT | ACT | CTG | CCC | GGT | TTC | ACG | TCA | |
| 7921 | ||||||||||||||||||||
| TYR | SER | ARG | TYR | PRO | ARG | MET | MET | ALA | ALA | ALA | GLY | ILE | ALA | LEU | PRO | GLU | LEU | ILE | ASP | |
| TAC | AGT | CGT | TAT | CCC | CGT | ATG | ATG | GCC | GCT | GCA | GGT | ATT | GCA | CTT | CCC | GAA | CTT | ATT | GAC | |
| 7981 | ||||||||||||||||||||
| ARG | LEU | ILE | VAL | LEU | ALA | LEU | LYS | GLY |
| CGC | TTG | ATC | GTA | TTA | GCG | TTA | AAG | GGG | TGATAAGC | ATG | GAA | ATA | GGA | TTT | ACT | TTT | TTA | GAT |
| VanX | MET | GLU | ILE | GLY | PHE | THR | PHE | LEU | ASP | ||
| 8043 | ||||||||||||||||||||
| GLU | ILE | VAL | HIS | GLY | VAL | ARG | TRP | ASP | ALA | LYS | TYR | ALA | THR | TRP | ASP | ASN | PHE | THR | GLY | |
| GAA | ATA | GTA | CAC | GGT | GTT | CGT | TGG | GAC | GCT | AAA | TAT | GCC | ACT | TGG | GAT | AAT | TTC | ACC | GGA | |
| 8103 | ||||||||||||||||||||
| LYS | PRO | VAL | ASP | GLY | TYR | GLU | VAL | ASN | ARG | ILE | VAL | GLY | THR | TYR | GLU | LEU | ALA | GLU | SER | |
| AAA | CCG | GTT | GAC | GGT | TAT | GAA | GTA | AAT | CGC | ATT | GTA | GGG | ACA | TAC | GAG | TTG | GCT | GAA | TCG | |
| 8163 | ||||||||||||||||||||
| LEU | LEU | LYS | ALA | LYS | GLN | LEU | ALA | ALA | THR | GLN | GLY | TYR | GLY | LEU | LEU | LEU | TRP | ASP | GLY | |
| CTT | TTG | AAG | GCA | AAA | GAA | CTG | GCT | GCT | ACC | CAA | GGG | TAC | GGA | TTG | CTT | CTA | TGG | GAC | GGT | |
| 8223 | ||||||||||||||||||||
| TYR | ARG | PRO | LYS | ARG | ALA | VAL | ASN | CYS | PHE | MET | GLN | TRP | ALA | ALA | GLN | PRO | GLU | ASN | ASN | |
| TAC | CGT | CCT | AAG | CGT | GCT | GTA | AAC | TGT | TTT | ATG | CAA | TGG | GCT | GCA | CAG | CCG | GAA | AAT | AAC | |
| 8283 | ||||||||||||||||||||
| LEU | THR | LYS | GLU | SER | TYR | TYR | PRO | ASN | ILE | ASP | ARG | THR | GLU | MET | ILE | SER | LYS | GLY | TYR | |
| CTG | ACA | AAG | GAA | AGT | TAT | TAT | CCC | AAT | ATT | GAC | CGA | ACT | GAG | ATG | ATT | TCA | AAA | GGA | TAC | |
| 8343 | ||||||||||||||||||||
| VAL | ALA | SER | LYS | SER | SER | HIS | SER | ARG | GLY | SER | ALA | ILE | ASP | LEU | THR | LEU | TYR | ARG | LEU | |
| GTG | GCT | TCA | AAA | TCA | AGC | CAT | AGC | CGC | GGC | AGT | GCC | ATT | GAT | CTT | ACG | CTT | TAT | CGA | TTA | |
| 8403 | ||||||||||||||||||||
| ASP | THR | GLY | GLU | LEU | VAL | PRO | MET | GLY | SER | ARG | PHE | ASP | PHE | MET | ASP | GLU | ARG | SER | HIS | |
| GAC | ACG | GGT | GAG | CTT | GTA | CCA | ATG | GGG | AGC | CGA | TTT | GAT | TTT | ATG | GAT | GAA | CGC | TCT | CAT | |
| 8463 | ||||||||||||||||||||
| HIS | ALA | ALA | ASN | GLY | ILE | SER | CYS | ASN | GLU | ALA | GLN | ASN | ARG | ARG | ARG | LEU | ARG | SER | ILE | |
| CAT | GCG | GCA | AAT | GGA | ATA | TCA | TGC | AAT | GAA | GCG | CAA | AAT | CGC | AGA | CGT | TTG | CGC | TCC | ATC | |
| 8523 | ||||||||||||||||||||
| MET | GLU | ASN | SER | GLY | PHE | GLU | ALA | TYR | SER | LEU | GLU | TRP | TRP | HIS | TYR | VAL | LEU | ARG | ASP | |
| ATG | GAA | AAC | AGT | GGG | TTT | GAA | GCA | TAT | AGC | CTC | GAA | TGG | TGG | CAC | TAT | GTA | TTA | AGA | GAC | |
| 8583 | ||||||||||||||||||||
| GLU | PRO | TYR | PRO | ASN | SER | TYR | PHE | ASP | PHE | PRO | VAL | LYS | ||||||||
| GAA | CCA | TAC | CCC | AAT | AGC | TAT | TTT | GAT | TTC | CCC | GTT | AAA | TAAA | CTT | TTA | ACC | GTT | GCA | ||
| 8641 | ||||||||||||||||||||
| CGG | ACA | AAC | TAT | ATA | AGC | TAA | CTC | TTT | CGG | CAG | GAA | ACC | CGA | CGT | ATG | TAA | CTG | GTT | CTT | |
| 8701 | ||||||||||||||||||||
| AGG | GAA | TTT | ATA | TAT | AGT | AGA | TAG | TAT | TGA | AGA | TGT | AAG | GCA | GAG | CGA | TAT | TGC | GGT | CAT | |
| 8761 | ||||||||||||||||||||
| TAT | CTG | CGT | GCG | CTG | CGG | CAA | GAT | AGC | CTG | ATA | ATA | AGA | CTG | ATC | GCA | TAG | AGG | GGT | GGT | |
| 8821 | ||||||||||||||||||||
| ATT | TCA | CAC | CGC | CCA | TTG | TCA | ACA | GGC | AGT | TCA | GCC | TCG | TTA | AAT | TCA | GCA | TGG | GTA | TCA | |
| 8881 | ||||||||||||||||||||
| CTT | ATG | AAA | ATT | CAT | CTA | CAT | TGG | TGA | TAA | TAG | TAA | ATC | CAG | TAG | GGC | GAA | ATA | ATT | GAC | |
| 8941 | ||||||||||||||||||||
| TGT | AAT | TTA | CGG | GGC | AAA | ACG | GCA | CAA | TCT | CAA | ACG | AGA | TTG | TGC | CGT | TTA | AGG | GGA | AGA | |
| 9001 |
| VanY | MET | LYS | LYS |
| TTC | TAG | AAA | TAT | TTC | ATA | CTT | CCA | ACT | ATA | TAG | TTA | AGG | AGG | AGA | CTG | AAA | ATG | AAG | AAG | |
| 9061 | ||||||||||||||||||||
| LEU | PHE | PHE | LEU | LEU | LEU | LEU | LEU | PHE | LEU | ILE | TYR | LEU | GLY | TYR | ASP | TYR | VAL | ASN | GLU | |
| TTG | TTT | TTT | TTA | TTG | TTA | TTG | TTA | TTC | TTA | ATA | TAC | TTA | GGT | TAT | GAC | TAC | GTT | AAT | GAA | |
| 9121 | ||||||||||||||||||||
| ALA | LEU | PHE | SER | GLN | GLU | LYS | VAL | GLU | PHE | GLN | ASN | TYR | ASP | GLN | ASN | PRO | LYS | GLU | HIS | |
| GCA | CTG | TTT | TCT | CAG | GAA | AAA | GTC | GAA | TTT | CAA | AAT | TAT | GAT | CAA | AAT | CCC | AAA | GAA | CAT | |
| 9181 | ||||||||||||||||||||
| LEU | GLU | ASN | SER | GLY | THR | SER | GLU | ASN | THR | GLN | GLU | LYS | THR | ILE | THR | GLU | GLU | GLN | VAL | |
| TTA | GAA | AAT | AGT | GGG | ACT | TCT | GAA | AAT | ACC | CAA | GAG | AAA | ACA | ATT | ACA | GAA | GAA | CAG | GTT | |
| 9241 | ||||||||||||||||||||
| TYR | GLN | GLY | ASN | LEU | LEU | LEU | ILE | ASN | SER | LYS | TYR | PRO | VAL | ARG | GLN | GLU | SER | VAL | LYS | |
| TAT | CAA | GGA | AAT | CTG | CTA | TTA | ATC | AAT | AGT | AAA | TAT | CCT | GTT | CGC | CAA | GAA | AGT | GTG | AAG | |
| 9301 | ||||||||||||||||||||
| SER | ASP | ILE | VAL | ASN | LEU | SER | LYS | HIS | ASP | GLU | LEU | ILE | ASN | GLY | TYR | GLY | LEU | LEU | ASP | |
| TCA | GAT | ATC | GTG | AAT | TTA | TCT | AAA | CAT | GAC | GAA | TTA | ATA | AAT | GGA | TAC | GGG | TTG | CTT | GAT | |
| 9361 | ||||||||||||||||||||
| SER | ASN | ILE | TYR | MET | SER | LYS | GLU | ILE | ALA | GLN | LYS | PHE | SER | GLU | MET | VAL | ASN | ASP | ALA | |
| AGT | AAT | ATT | TAT | ATG | TCA | AAA | GAA | ATA | GCA | CAA | AAA | TTT | TCA | GAG | ATG | GTC | AAT | GAT | GCT | |
| 9421 | ||||||||||||||||||||
| VAL | LYS | GLY | GLY | VAL | SER | HIS | PHE | ILE | ILE | ASN | SER | GLY | TYR | ARG | ASP | PHE | ASP | GLU | GLN | |
| GTA | AAG | GGT | GGC | GTT | AGT | CAT | TTT | ATT | ATT | AAT | AGT | GGC | TAT | CGA | GAC | TTT | GAT | GAG | CAA | |
| 9481 | ||||||||||||||||||||
| SER | VAL | LEU | TYR | GLN | GLU | MET | GLY | ALA | GLU | TYR | ALA | LEU | PRO | ALA | GLY | TYR | SER | GLU | HIS | |
| AGT | GTG | CTT | TAC | CAA | GAA | ATG | GGG | GCT | GAG | TAT | GCC | TTA | CCA | GCA | GGT | TAT | AGT | GAG | CAT | |
| 9541 | ||||||||||||||||||||
| ASN | SER | GLY | LEU | SER | LEU | ASP | VAL | GLY | SER | SER | LEU | THR | LYS | MET | GLU | ARG | ALA | PRO | GLU | |
| AAT | TCA | GGT | TTA | TCA | CTA | GAT | GTA | GGA | TCA | AGC | TTG | ACG | AAA | ATG | GAA | CGA | GCC | CCT | GAA | |
| 9601 | ||||||||||||||||||||
| GLY | LYS | TRP | ILE | GLU | GLU | ASN | ALA | TRP | LYS | TYR | GLY | PHE | ILE | LEU | ARG | TYR | PRO | GLU | ASP | |
| GGA | AAG | TGG | ATA | GAA | GAA | AAT | GCT | TGG | AAA | TAC | GGG | TTC | ATT | TTA | CGT | TAT | CCA | GAG | GAC | |
| 9661 | ||||||||||||||||||||
| LYS | THR | GLU | LEU | THR | GLY | ILE | GLN | TYR | GLU | PRO | TRP | HIS | ILE | ARG | TYR | VAL | GLY | LEU | PRO | |
| AAA | ACA | GAG | TTA | ACA | GGA | ATT | CAA | TAT | GAA | CCA | TGG | CAT | ATT | CGC | TAT | GTT | GGT | TTA | CCA | |
| 9721 | ||||||||||||||||||||
| HIS | SER | ALA | ILE | MET | LYS | GLU | LYS | ASN | PHE | VAL | LEU | GLU | GLU | TYR | MET | ASP | TYR | LEU | LYS | |
| CAT | AGT | GCG | ATT | ATG | AAA | GAA | AAG | AAT | TTC | GTT | CTC | GAG | GAA | TAT | ATG | GAT | TAC | CTA | AAA | |
| 9781 | ||||||||||||||||||||
| GLU | GLU | LYS | THR | ILE | SER | VAL | SER | VAL | ASN | GLY | GLU | LYS | TYR | GLU | ILE | PHE | TYR | TYR | PRO | |
| GAA | GAA | AAA | ACC | ATT | TCT | GTT | AGT | GTA | AAT | GGG | GAA | AAA | TAT | GAG | ATC | TTT | TAT | TAT | CCT | |
| 9841 | ||||||||||||||||||||
| VAL | THR | LYS | ASN | THR | THR | ILE | HIS | VAL | PRO | THR | ASN | LEU | ARG | TYR | GLU | ILE | SER | GLY | ASN | |
| GTT | ACT | AAA | AAT | ACC | ACC | ATT | CAT | GTG | CCG | ACT | AAT | CTT | CGT | TAT | GAG | ATA | TCA | GGA | AAC | |
| 9901 | ||||||||||||||||||||
| ASN | ILE | ASP | GLY | VAL | ILE | VAL | THR | VAL | PHE | PRO | GLY | SER | THR | HIS | THR | ASN | SER | ARG | ARG | |
| AAT | ATA | GAC | GGT | GTA | ATT | GTG | ACA | GTG | TTT | CCC | GGA | TCA | ACA | CAT | ACT | AAT | TCA | AGG | AGG | |
| 9961 | ||||||||||||||||||||
| TAA | GGA | TGG | CGG | AAT | GAA | ACC | AAC | GAA | ATT | AAT | GAA | CAG | CAT | TAT | TGT | ACT | AGC | ACT | TTT | |
| 10021 | ||||||||||||||||||||
| GGG | GTA | ACG | TTA | GCT | TTT | TAA | TTT | AAA | ACC | CAC | GTT | AAC | TAG | GAC | ATT | GCT | ATA | CTA | ATG | |
| 10081 | VanZ | LEU | GLY | LYS | ILE | LEU | SER | ARG | GLY | LEU |
| ATA | CAA | CTT | AAA | CAA | +TL,13AAG | AATTAGAGG | AAA | TTA | TA | TTG | GGA | AAA | ATA | TTA | TCT | AGA | GGA | TTG | |
| 10143 | ||||||||||||||||||||
| LEU | ALA | LEU | TYR | LEU | VAL | THR | LEU | ILE | TRP | LEU | VAL | LEU | PHE | LYS | LEU | GLN | TYR | ASN | ILE | |
| CTA | GCT | TTA | TAT | TTA | GTG | ACA | CTA | ATC | TGG | TTA | GTG | TTA | TTC | AAA | TTA | CAA | TAC | AAT | ATT | |
| 10203 | ||||||||||||||||||||
| LEU | SER | VAL | PHE | ASN | TYR | HIS | GLN | ARG | SER | LEU | ASN | LEU | THR | PRO | PHE | THR | ALA | THR | GLY | |
| TTA | TCA | GTA | TTT | AAT | TAT | CAT | CAA | AGA | AGT | CTT | AAC | TTG | ACT | CCA | TTT | ACT | GCT | ACT | GGG | |
| 10263 | ||||||||||||||||||||
| ASN | PHE | ARG | GLU | MET | ILE | ASP | ASN | VAL | ILE | ILE | PHE | ILE | PRO | PHE | GLY | LEU | LEU | LEU | ASN | |
| AAT | TTC | AGA | GAG | ATG | ATA | GAT | AAT | GTT | ATA | ATC | TTT | ATT | CCA | TTT | GGC | TTG | CTT | TTG | AAT | |
| 10323 | ||||||||||||||||||||
| VAL | ASN | PHE | LYS | GLU | ILE | GLY | PHE | LEU | PRO | LYS | PHE | ALA | PHE | VAL | LEU | VAL | LEU | SER | LEU | |
| GTC | AAT | TTT | AAA | GAA | ATC | GGA | TTT | TTA | CCT | AAG | TTT | GCT | TTT | GTA | CTG | GTT | TTA | AGT | CTT | |
| 10383 | ||||||||||||||||||||
| THR | PHE | GLU | ILE | ILE | GLN | PHE | ILE | PHE | ALA | ILE | GLY | ALA | THR | ASP | ILE | THR | ASP | VAL | ILE | |
| ACT | TTT | GAA | ATA | ATT | CAA | TTT | ATC | TTC | GCT | ATT | GGA | GCG | ACA | GAC | ATA | ACA | GAT | GTA | ATT | |
| 10443 | ||||||||||||||||||||
| THR | ASN | THR | VAL | GLY | GLY | PHE | LEU | GLY | LEU | LYS | LEU | TYR | GLY | LEU | SER | ASN | LYS | HIS | MET | |
| ACA | AAT | ACT | GTT | GGA | GGC | TTT | CTT | GGA | CTG | AAA | TTA | TAT | GGT | TTA | AGC | AAT | AAG | CAT | ATG | |
| 10503 | ||||||||||||||||||||
| ASN | GLN | LYS | LYS | LEU | ASP | ARG | VAL | ILE | ILE | PHE | VAL | GLY | ILE | LEU | LEU | LEU | VAL | LEU | LEU | |
| AAT | CAA | AAA | AAA | TTA | GAC | AGA | GTT | ATT | ATT | TTT | GTA | GGT | ATA | CTT | TTG | CTC | GTA | TTA | TTG | |
| 10563 | ||||||||||||||||||||
| LEU | VAL | TYR | ARG | THR | HIS | LEU | ARG | ILE | ASN | TYR | VAL |
| CTC | GTT | TAC | CGT | ACC | CAT | TTA | AGA | ATA | AAT | TAC | GTG | TAAG | ATG | TCT | AAA | TCA | AGC | AAT | |
| 10621 | ||||||||||||||||||||
| CTG | ATC | TTT | CAT | ACA | CAT | AAA | GAT | ATT | GAA | TGA | ATT | GGA | TTA | GAT | GGA | AAA | CGG | GAT | GTG | |
| 10681 | ||||||||||||||||||||
| GGG | AAA | CTC | GCC | CGT | AGG | TGT | GAA | GTG | AGG | GGA | AAA | CCG | GTG | ATA | AAG | TAA | AAA | GCT | TAC | |
| 10741 | ||||||||||||||||||||
| CTA | ACA | CTA | TAG | TAA | CAA | AGA | AAG | CCC | AAT | TAT | CAA | TTT | TAG | TGC | GGA | GGA | ATT | GGT | CTC | |
| 10801 | ||||||||||||||||||||
| TTT | AAT | AAA | TTT | CCT | TAA | CGT | TGT | AAA | TCC | GCA | TTT | TCC | TGA | CGG | TAC | CCC |
(corresponds to the sequence of the strand complementary to the (+) strand from 1 to 3189.
| 1 | ||||||||||||||||||||
| CAA | AAT | ATC | ACC | TCA | TTT | TTG | AGA | CAA | GTC | TTA | TGA | GAC | GCT | CTT | AAC | TAT | GAT | TTT | ATC | |
| 61 | ||||||||||||||||||||
| AGT | CTA | CTA | CAT | TTG | TAT | CAA | TAG | AGT | ACA | CTC | TAT | TGA | TAT | ATA | ATT | GAA | CTA | ATA | AAT | |
| 121 | Transposase | MET | LYS | ILE | ALA | ARG | GLY | ARG | GLU | LEU | LEU | THR |
| TGA | AAA | TAC | AGA | AAT | GGA | ATGATACTG | AA | ATG | AAA | ATT | GCG | AGA | GGT | AGA | GAA | TTG | CTT | ACA | |
| 182 | ||||||||||||||||||||
| PRO | GLU | GLN | ARG | GLN | ALA | PHE | MET | GLN | ILE | PRO | GLU | ASP | GLU | TRP | ILE | LEU | GLY | THR | TYR | |
| CCG | GAA | CAG | AGA | CAG | GCT | TTT | ATG | CAA | ATC | CCT | GAA | GAT | GAA | TGG | ATA | CTG | GGG | ACC | TAC | |
| 242 | ||||||||||||||||||||
| PHE | THR | PHE | SER | LYS | ARG | ASP | LEU | GLU | ILE | VAL | ASN | LYS | ARG | ARG | ARG | GLU | GLU | ASN | ARG | |
| TTC | ACT | TTT | TCC | AAA | CGG | GAT | TTA | GAA | ATA | GTT | AAT | AAG | CGA | AGG | AGG | GAA | GAA | AAC | CGT | |
| 302 | ||||||||||||||||||||
| LEU | GLY | PHE | ALA | VAL | GLN | LEU | ALA | VAL | LEU | ARG | TYR | PRO | GLY | TRP | PRO | TYR | THR | HIS | ILE | |
| TTA | GGA | TTT | GCT | GTT | CAA | TTA | GCT | GTT | CTT | CGG | TAT | CCC | GGT | TGG | CCA | TAC | ACT | CAT | ATC | |
| 362 | ||||||||||||||||||||
| LYS | SER | ILE | PRO | ASP | SER | VAL | ILE | GLN | TYR | ILE | SER | LYS | GLN | ILE | GLY | VAL | SER | PRO | SER | |
| AAA | AGC | ATC | CCA | GAT | TCG | GTC | ATA | CAA | TAT | ATA | TCG | AAA | CAG | ATT | GGT | GTT | AGT | CCA | TCC | |
| 422 | ||||||||||||||||||||
| SER | LEU | ASP | HIS | TYR | PRO | GLN | ARG | GLU | ASN | THR | LEU | TRP | ASP | HIS | LEU | LYS | GLU | ILE | ARG | |
| TCG | CTT | GAT | CAT | TAT | CCT | CAA | AGG | GAA | AAT | ACA | CTT | TGG | GAT | CAT | TTG | AAA | GAA | ATT | CGA | |
| 482 | ||||||||||||||||||||
| SER | GLU | TYR | ASP | PHE | VAL | THR | PHE | THR | LEU | SER | GLU | TYR | ARG | MET | THR | PHE | LYS | TYR | LEU | |
| AGT | GAA | TAC | GAC | TTT | GTA | ACT | TTT | ACC | CTG | AGT | GAA | TAT | CGA | ATG | ACA | TTT | AAG | TAC | CTT | |
| 542 | ||||||||||||||||||||
| HIS | GLN | LEU | ALA | LEU | GLU | ASN | GLY | ASP | ALA | ILE | HIS | LEU | LEU | HIS | GLU | CYS | ILE | ASP | PHE | |
| CAT | CAA | TTA | GCT | TTG | GAA | AAT | GGT | GAT | GCC | ATT | CAT | CTA | CTG | CAT | GAA | TGC | ATA | GAT | TTT | |
| 602 | ||||||||||||||||||||
| LEU | ARG | LYS | ASN | LYS | ILE | ILE | LEU | PRO | ALA | ILE | THR | THR | LEU | GLN | ARG | MET | VAL | TRP | GLU | |
| CTA | AGA | AAA | AAC | AAA | ATT | ATA | CTG | CCT | GCT | ATC | ACT | ACA | CTT | GAA | AGA | ATG | GTG | TGG | GAA | |
| 662 | ||||||||||||||||||||
| ALA | ARG | ALA | MET | ALA | GLU | LYS | LYS | LEU | PHE | ASN | THR | VAL | SER | LYS | SER | LEU | THR | ASN | GLU | |
| GCA | AGG | GCA | ATG | GCT | GAA | AAG | AAG | CTA | TTT | AAT | ACG | GTT | AGT | AAA | TCT | CTA | ACA | AAT | GAG | |
| 722 | ||||||||||||||||||||
| GLN | LYS | GLU | LYS | LEU | GLU | GLY | ILE | ILE | THR | SER | GLN | HIS | PRO | SER | GLU | SER | ASN | LYS | THR | |
| CAA | AAA | GAA | AAG | CTT | GAA | GGG | ATT | ATT | ACC | TCG | CAG | CAT | CCA | TCC | GAA | TCC | AAT | AAA | ACG | |
| 782 | ||||||||||||||||||||
| ILE | LEU | GLY | TRP | LEU | LYS | GLU | PRO | PRO | GLY | HIS | PRO | SER | PRO | GLU | THR | PHE | LEU | LYS | ILE | |
| ATA | TTG | GGT | TGG | TTA | AAA | GAG | CCA | CCG | GGT | CAT | CCT | TCA | CCC | GAA | ACT | TTT | CTA | AAA | ATA | |
| 842 | ||||||||||||||||||||
| ILE | GLU | ARG | LEU | GLU | TYR | ILE | ARG | GLY | MET | ASP | LEU | GLU | THR | VAL | GLN | ILE | SER | HIS | LEU | |
| ATA | GAA | CGA | CTC | GAA | TAC | ATA | CGA | GGA | ATG | GAT | TTA | GAA | ACA | GTG | CAA | ATT | AGT | CAT | TTG | |
| 902 | ||||||||||||||||||||
| HIS | ARG | ASN | ARG | LEU | LEU | GLN | LEU | SER | ARG | LEU | GLY | SER | ARG | TYR | GLU | PRO | TYR | ALA | PHE | |
| CAC | CGT | AAC | CGC | CTG | TTG | CAG | CTG | TCT | CGC | TTA | GGC | TCA | AGA | TAC | GAG | CCG | TAT | GCA | TTC | |
| 962 | ||||||||||||||||||||
| ARG | ASP | PHE | GLN | GLU | ASN | LYS | ARG | TYR | SER | ILE | LEU | THR | ILE | TYR | LEU | LEU | GLN | LEU | THR | |
| CGT | GAC | TTT | CAA | GAA | AAT | AAA | CGT | TAT | TCG | ATA | TTA | ACC | ATC | TAT | TTA | TTA | CAA | CTT | ACT | |
| 1022 | ||||||||||||||||||||
| GLN | GLU | LEU | THR | ASP | LYS | ALA | PHE | GLU | ILE | HIS | ASP | ARG | GLN | ILE | LEU | SER | LEU | LEU | SER | |
| CAG | GAG | CTA | ACG | GAT | AAA | GCG | TTT | GAA | ATT | CAT | GAT | AGG | CAA | ATA | CTT | AGT | TTG | TTA | TCA | |
| 1082 | ||||||||||||||||||||
| LYS | GLY | ARG | LYS | ALA | GLN | GLU | GLU | ILE | GLN | LYS | GLN | ASN | GLY | LYS | LYS | LEU | ASN | GLU | LYS | |
| AAA | GGT | CGT | AAG | GCT | CAA | GAG | GAA | ATC | CAG | AAA | CAA | AAC | GGT | AAA | AAG | CTA | AAT | GAG | AAA | |
| 1142 | ||||||||||||||||||||
| VAL | ILE | HIS | PHE | THR | ASN | ILE | GLY | GLN | ALA | LEU | ILE | LYS | ALA | ARG | GLU | GLU | LYS | LEU | ASP | |
| GTT | ATA | CAC | TTT | ACG | AAC | ATC | GGA | CAA | GCA | TTA | ATT | AAA | GCA | AGA | GAG | GAA | AAA | TTA | GAC | |
| 1202 | ||||||||||||||||||||
| VAL | PHE | LYS | VAL | LEU | GLU | SER | VAL | ILE | GLU | TRP | ASN | THR | PHE | VAL | SER | SER | VAL | GLU | GLU | |
| GTT | TTT | AAG | GTT | TTA | GAA | TCG | GTT | ATT | GAA | TGG | AAT | ACC | TTT | GTC | TCT | TCA | GTA | GAA | GAG | |
| 1262 | ||||||||||||||||||||
| ALA | GLN | GLU | LEU | ALA | ARG | PRO | ALA | ASP | TYR | ASP | TYR | LEU | ASP | LEU | LEU | GLN | LYS | ARG | PHE | |
| GCT | CAG | GAA | CTT | GCA | CGT | CCT | CCC | GAC | TAT | GAT | TAT | TTA | GAC | TTA | CTG | CAA | AAA | CCC | TTT | |
| 1322 | ||||||||||||||||||||
| TYR | SER | LEU | ARG | LYS | TYR | THR | PRO | THR | LEU | LEU | ARG | VAL | LEU | GLU | PHE | HIS | SER | THR | LYS | |
| TAT | TCA | CTA | AGA | AAA | TAT | ACG | CCA | ACG | CTA | TTA | AGA | GTA | TTG | GAA | TTT | CAT | TCT | ACA | AAG | |
| 1382 | ||||||||||||||||||||
| ALA | ASN | GLU | PRO | LEU | LEU | GLN | ALA | VAL | GLU | ILE | ILE | ARG | GLY | MET | ASN | GLU | SER | GLY | LYS | |
| GCA | AAT | GAG | CCA | CTT | TTA | CAA | GCT | GTT | GAG | ATT | ATC | CGA | GGA | ATG | AAC | GAA | TCT | GGA | AAG | |
| 1442 | ||||||||||||||||||||
| ARG | LYS | VAL | PRO | ASP | ASP | SER | PRO | VAL | ASP | PHE | ILE | SER | LYS | ARG | TRP | LYS | ARG | HIS | LEU | |
| CGA | AAA | GTG | CCT | CAT | GAC | TCA | CCT | GTG | GAT | TTT | ATT | TCA | AAA | CGA | TCC | AAA | AGA | CAT | TTA | |
| 1502 | ||||||||||||||||||||
| TYR | GLU | ASP | ASP | GLY | THR | THR | ILE | ASN | ARG | HIS | TYR | TYR | GLU | MET | ALA | VAL | LEU | THR | GLU | |
| TAC | GAG | GAT | GAT | GGT | ACA | ACA | ATT | AAT | CCT | CAT | TAC | TAT | GAA | ATG | GCT | GTT | TTA | ACA | CAA | |
| 1562 | ||||||||||||||||||||
| LEU | ARG | GLU | HIS | VAL | ARG | ALA | GLY | ASP | VAL | SER | ILE | VAL | GLY | SER | ARG | GLN | TYR | ARG | ASP | |
| CTT | CGG | GAG | CAT | GTT | CGG | GCA | GGA | CAT | GTT | TCC | ATT | GTT | GGC | AGC | AGA | CAA | TAT | AGG | CAT | |
| 1622 | ||||||||||||||||||||
| PHE | GLU | GLU | TYR | LEU | PHE | SER | GLU | ASP | THR | TRP | ASN | GLN | SER | LYS | GLY | ASN | THR | ARG | LEU | |
| TTT | GAG | GAA | TAT | TTG | TTT | TCG | GAA | GAT | ACA | TGG | AAT | CAA | TCG | AAG | GGG | AAT | ACG | AGA | TTA | |
| 1682 | ||||||||||||||||||||
| SER | VAL | SER | LEU | SER | PHE | GLN | ASP | TYR | ILE | THR | GLU | ARG | THR | SER | SER | PHE | ASN | GLU | ARG | |
| TCA | GTT | AGT | TTA | TCA | TTC | GAA | GAT | TAT | ATA | ACG | GAG | AGA | ACC | AGC | AGC | TTT | AAT | GAA | AGG | |
| 1742 | ||||||||||||||||||||
| LEU | LYS | TRP | LEU | ALA | ALA | ASN | SER | ASN | LYS | LEU | ASP | GLY | VAL | SER | LEU | GLU | LYS | GLY | LYS | |
| TTA | AAG | TGG | TTA | GCT | GCC | AAT | TCC | AAT | AAG | TTA | GAT | GGG | GTT | TCT | CTT | GAA | AAA | GGA | AAG | |
| 1802 | ||||||||||||||||||||
| LEU | SER | LEU | ALA | ARG | LEU | GLN | LYS | ASP | VAL | PRO | GLU | GLU | ALA | LYS | LYS | PHE | SER | ALA | SER | |
| CTA | TCA | CTT | GCA | CGC | TTA | GAA | AAA | GAT | GTT | CCA | GAA | GAA | GCA | AAA | AAA | TTT | AGT | GCA | AGC | |
| 1862 | ||||||||||||||||||||
| LEU | TYR | GLN | MET | LEU | PRO | ARG | ILE | LYS | LEU | THR | ASP | LEU | LEU | MET | ASP | VAL | ALA | HIS | ILE | |
| CTT | TAT | CAG | ATG | CTA | CCA | AGA | ATA | AAA | TTA | ACT | GAT | TTA | CTC | ATG | GAT | GTG | GCC | CAT | ATA | |
| 1922 | ||||||||||||||||||||
| THR | GLY | PHE | HIS | GLU | GLN | PHE | THR | HIS | ALA | SER | ASN | ASN | ARG | LYS | PRO | ASP | LYS | GLU | GLU | |
| ACA | GGA | TTT | CAT | GAG | CAA | TTC | ACT | CAT | GCT | TCC | AAT | AAT | CGA | AAA | CCA | GAT | AAG | GAA | GAA | |
| 1982 | ||||||||||||||||||||
| THR | ILE | ILE | ILE | MET | ALA | ALA | LEU | LEU | GLY | MET | GLY | MET | ASN | ILE | GLY | LEU | SER | LYS | MET | |
| ACA | ATC | ATT | ATC | ATG | GCT | GCC | CTT | TTA | GGA | ATG | GGA | ATG | AAT | ATT | GGC | TTG | AGC | AAG | ATG | |
| 2042 | ||||||||||||||||||||
| ALA | GLU | ALA | THR | PRO | GLY | LEU | THR | TYR | LYS | GLN | LEU | ALA | ASN | VAL | SER | GLN | TRP | ARG | MET | |
| GCC | GAA | GCC | ACA | CCC | GGA | CTT | ACA | TAT | AAG | CAA | CTA | GCC | AAT | GTA | TCT | CAA | TGG | CGC | ATG | |
| 2102 | ||||||||||||||||||||
| TYR | GLU | ASP | ALA | MET | ASN | LYS | ALA | GLN | ALA | ILE | LEU | VAL | ASN | PHE | HIS | HIS | LYS | LEU | GLN | |
| TAT | GAA | GAT | GCC | ATG | AAT | AAA | GCC | CAA | GCC | ATA | TTA | GTA | AAC | TTT | CAT | CAT | AAA | TTA | CAA | |
| 2162 | ||||||||||||||||||||
| LEU | PRO | PHE | TYR | TRP | GLY | ASP | GLY | THR | THR | SER | SER | SER | ASP | GLY | MET | ARG | MET | GLN | LEU | |
| TTG | CCT | TTC | TAT | TGG | GGC | GAC | GGT | ACA | ACA | TCT | TCG | TCA | GAT | GGT | ATG | AGA | ATG | CAG | CTA | |
| 2222 | ||||||||||||||||||||
| GLY | VAL | SER | SER | LEU | HIS | ALA | ASP | ALA | ASN | PRO | HIS | TYR | GLY | THR | GLY | LYS | GLY | ALA | THR | |
| GGT | GTT | TCA | TCA | CTA | CAT | GCA | GAT | GCA | AAT | CCA | CAT | TAT | GGA | ACT | GGA | AAA | GGA | GCC | ACC | |
| 2282 | ||||||||||||||||||||
| ILE | TYR | ARG | PHE | THR | SER | ASP | GLN | PHE | SER | SER | TYR | TYR | THR | LYS | ILE | ILE | HIS | THR | ASN | |
| ATC | TAC | CGA | TTT | ACA | AGT | GAT | CAA | TTC | TCT | TCT | TAC | TAC | ACA | AAG | ATT | ATT | CAT | ACT | AAT | |
| 2342 | ||||||||||||||||||||
| SER | ARG | ASP | ALA | ILE | HIS | VAL | LEU | ASP | GLY | LEU | LEU | HIS | HIS | GLU | THR | ASP | LEU | ASN | ILE | |
| TCA | AGA | GAT | GCG | ATT | CAT | GTT | TTG | GAT | GGT | TTG | TTA | CAT | CAT | GAG | ACG | GAT | CTA | AAC | ATA | |
| 2402 | ||||||||||||||||||||
| GLU | GLU | HIS | TYR | THR | ASP | THR | ALA | GLY | TYR | THR | ASP | GLN | ILE | PHE | GLY | LEU | THR | HIS | LEU | |
| GAG | GAA | CAT | TAT | ACA | GAC | ACT | GCC | GGT | TAC | ACT | GAC | CAA | ATA | TTC | GGA | CTG | ACT | CAT | TTA | |
| 2462 | ||||||||||||||||||||
| LEU | GLY | PHE | LYS | PHE | ALA | PRO | ARG | ILE | ARG | ASP | LEU | SER | ASP | SER | LYS | LEU | PHE | THR | ILE | |
| TTA | GGA | TTT | AAA | TTT | GCC | CCA | AGA | ATA | AGG | GAT | TTA | TCG | GAC | TCA | AAA | TTA | TTT | ACG | ATA | |
| 2522 | ||||||||||||||||||||
| ASP | LYS | ALA | SER | GLU | TYR | PRO | LYS | LEU | GLU | ALA | ILE | LEU | ARG | GLY | GLN | ILE | ASN | THR | LYS | |
| GAT | AAA | GCA | AGT | GAG | TAT | CCA | AAA | CTA | GAA | GCC | ATT | TTA | CGT | GGA | CAA | ATA | AAT | ACA | AAG | |
| 2582 | ||||||||||||||||||||
| VAL | ILE | LYS | GLU | ASN | TYR | GLU | ASP | VAL | LEU | ARG | LEU | ALA | HIS | SER | ILE | ARG | GLU | GLY | THR | |
| GTC | ATT | AAA | GAA | AAT | TAT | GAG | GAT | GTT | TTG | CGA | TTA | GCT | CAT | TCT | ATA | AGG | GAG | GGA | ACA | |
| 2642 | ||||||||||||||||||||
| AGT | TTC | AGC | ATC | CCT | TAT | TAT | GGG | GAA | GCT | AGG | TTC | CTA | TTC | AAG | ACA | AAA | CAG | CTT | AGC | |
| VAL | SER | ALA | SER | LEU | ILE | MET | GLY | LYS | LEU | GLY | SER | TYR | SER | ARG | GLN | ASN | SER | LEU | ALA | |
| GTT | TCA | GCA | TCC | CTT | ATT | ATG | GGG | AAG | CTA | GGT | TCC | TAT | TCA | AGA | CAA | AAC | AGC | TTA | GCT | |
| 2702 | ||||||||||||||||||||
| THR | ALA | LEU | ARG | GLU | MET | GLY | ARG | ILE | GLU | LYS | THR | ILE | PHE | ILE | LEU | ASN | TYR | ILE | SER | |
| ACA | GCC | TTA | CGT | GAG | ATG | GGC | CGA | ATA | GAA | AAA | ACG | ATC | TTT | ATT | TTG | AAT | TAT | ATA | TCG | |
| 2762 | ||||||||||||||||||||
| ASP | GLU | SER | LEU | ARG | ARG | LYS | ILE | GLN | ARG | GLY | LEU | ASN | LYS | GLY | GLU | ALA | MET | ASN | GLY | |
| GAT | GAA | TCA | TTA | AGA | AGA | AAA | ATA | CAA | AGA | GGA | TTG | AAT | AAA | GGA | GAA | GCC | ATG | AAT | GGA | |
| 2822 | ||||||||||||||||||||
| LEU | ALA | ARG | ALA | ILE | PHE | PHE | GLY | LYS | GLN | GLY | GLU | LEU | ARG | GLU | ARG | THR | ILE | GLN | HIS | |
| TTG | GCA | AGA | GCT | ATT | TTC | TTC | GGA | AAA | CAA | GGT | GAG | CTT | AGA | GAA | CGC | ACC | ATA | CAG | CAT | |
| 2882 | ||||||||||||||||||||
| GLN | LEU | GLN | ARG | ALA | SER | ALA | LEU | ASN | ILE | ILE | ILE | ASN | ALA | ILE | SER | ILE | TRP | ASN | THR | |
| CAA | TTG | CAA | AGA | GCC | AGT | GCT | TTA | AAC | ATA | ATT | ATC | AAT | GCT | ATA | AGT | ATT | TGG | AAT | ACT | |
| 2942 | ||||||||||||||||||||
| TCT | CCA | CCT | AAC | AAC | AGC | AGT | TGA | ATA | TAA | AAA | ACG | GAC | AGG | TAG | CTT | TAA | TGA | AGA | TTT | |
| LEU | HIS | LEU | THR | THR | ALA | VAL | GLU | TYR | LYS | LYS | ARG | THR | GLY | SER | PHE | ASN | GLN | ASP | LEU | |
| CTC | CAC | CTA | ACA | ACA | GCA | GTT | GAA | TAT | AAA | AAA | CGG | ACA | GGT | AGC | TTT | AAT | GAA | GAT | TTG | |
| 3002 | ||||||||||||||||||||
| LEU | HIS | HIS | MET | SER | PRO | LEU | GLY | TRP | GLU | HIS | ILE | ASN | LEU | LEU | GLY | GLU | TYR | HIS | PHE | |
| TTA | CAC | CAT | ATG | TCG | CCC | TTA | GGT | TGG | GAA | CAT | ATT | AAT | TTA | CTA | GGA | GAA | TAC | CAT | TTT | |
| 3062 | ||||||||||||||||||||
| ASN | SER | GLU | LYS | VAL | VAL | SER | LEU | ASN | SER | LEU | ARG | PRO | LEU | LYS | LEU | SER | ||||
| AAC | TCA | GAG | AAA | GTA | GTC | TCA | TTA | AAT | TCT | TTA | AGA | CCA | CTA | AAA | CTT | TCT | TAA | CGT | TG | |
| 3121 | ||||||||||||||||||||
| TTA | AAA | ACG | AGG | GAT | TCG | TCA | GGA | AAA | TAG | GCT | TAG | CGT | TGT | AAA | TCC | GCA | TTT | TCC | TGA | |
| 3181 | ||||||||||||||||||||
| CGC | TAC | CCC |
| LIST OF SEQUENCES: ii |
| SacI | ||
| GAGCTCTTCCTTCAACGCACTTCTGTACCAAGAGTTGTTGTC | 42 | |
| CATTTGATCACTAACAATAGCTTCCCCTGCTTTCTTCAAGCCCTTTGTCATAAAATCGTTAGATTTTCA | 111 | |
| TCATAAAAATACGAGAAAGACAACAGGAAGACCGCAAATTTTCTTTTCTTTTCCTAGGTACACTGAATG | 180 | |
| RBS M K K I A V L F G G | ||
| TAACCTTAAAAGAAAAAAGGAAAGGAAGAAAATGATGAAAAAAATTGCCGTTTTATTTGGAGGG | 244 | |
| N S B E Y S V S L T S A A S V I Q A I D | ||
| AATTCTCCAGAATACTCAGTGTCACTAACCTCAGCAGCAAGTGTGATCCAAGCTATTGAC | 304 | |
| P L K Y E V M T I G I A P T M D W Y W Y | ||
| CCGCTGAAATATGAAGTAATGACCATTGGCATCGCACCAACAATGGATTGGTATTGGTAT | 364 | |
| Q G N L A N V R N D T W L E D H K N C H | ||
| CAAGGAAACCTCGCGAATGTTCGCAATGATACTTGGCTAGAAGATCACAAAAACTGTCAC | 424 | |
| Q L T F S S Q G F I L G E K R I V P D V | ||
| CAGCTGACTTTTTCTAGCCAAGGATTTATATTAGGAGAAAAACGAATCGTCCCTGATGTC | 484 | |
| L F P V L H G K Y G E D G C I Q G L L E | ||
| CTCTTTCCAGTCTTGCATGGGAAGTATGGCGAGGATGGCTGTATCCAAGGACTGCTTGAA | 544 | |
| L M N L P Y V G C H V A A S A L C M N K | ||
| CTAATGAACCTGCCTTATGTTGGTTGCCATGTCGCTGCCTCCGCATTATGTATGAACAAA | 604 | |
| W L L H Q L A D T M G I A S A P T L L L | ||
| TGGCTCTTGCATCAACTTGCTGATACCATGGGAATCGCTAGTGCTCCCACTTTGCTTTTA | 664 | |
| S R Y E N D P A T I D R F I Q D H G F P | ||
| TCCCGCTATGAAAACGATCCTGCCACAATCGATCGTTTTATTCAAGACCATGGATTCCCG | 724 | |
| I F I K P N E A G S S K G I T K V T D K | ||
| ATCTTTATCAAGCCGAATGAAGCCGGTTCTTCAAAAGGGATCACAAAAGTAACTGACAAA | 784 | |
| T A L Q S A L T T A F A Y G S T V L I Q | ||
| ACAGCGCTCCAATCTGCATTAACGACTGCTTTTGCTTACGGTTCTACTGTGTTGATCCAA | 844 | |
| K A I A G I E I G C G I L G N E Q L T I | ||
| AAGGCGATAGCGGGTATTGAAATTGGCTGCGGCATCTTAGGAAATGAGCAATTGACGATT | 904 | |
| G A C D A I S L V D G F F D F E E K Y Q | ||
| GGTGCTTGTGATGCGATTTCTCTTGTCGACGGTTTTTTTGATTTTGAAGAGAAATACCAA | 964 | |
| L I S A T I T V P A P L P L A L E S Q I | ||
| TTAATCAGCGCCACGATCACTGTCCCAGCACCATTGCCTCTCGCGCTTGAATCACAGATC | 1024 | |
| K E Q A Q L L Y R N L G L T G L A R I D | ||
| AAGGAGCAGGCACAGCTGCTTTATCGAAACTTGGGATTGACGGGTCTGGCTCGAATCGAT | 1084 | |
| F F V T N Q G A I Y L N E I N T M P G F | ||
| TTTTTCGTCACCAATCAAGGAGCGATTTATTTAAACGAAATCAACACCATGCCGGGATTT | 1144 | |
| T G H S R Y P A M M A E V G L S Y E I L | ||
| ACTGGGCACTCCCGCTACCCAGCTATGATGGCGGAAGTCGGGTTATCCTACGAAATATTA | 1204 | |
| V E Q L E A L A E E D K R * | ||
| GTAGAGCAATTGATTGCACTGGCAGAGGAGGACAAACGATGAACACATTACAATTGATCAATA | 1267 | |
| AAAACCATCCATTGAAAAAAAATCAAGAGCCCCCGCACTTAGTGCTAGCTCCTTTTAGCGATCACGATG | 1336 | |
| TTTACCTGCAG | 1347 | |
| PstI | ||
1-28. (canceled)
29. A composition comprising at least one isolated protein which is encoded by a nucleic acid hybridizing to a sequence selected from the group consisting of SEQ ID NO:1 (vanH), SEQ ID NO:5 (vanX), SEQ ID NO:7 (vanC), SEQ ID NO:11 (vanR), SEQ ID NO:13 (vanS), SEQ ID NO:18 (transposase), SEQ ID NO:20 (resolvase), SEQ ID NO:22 (vanY) SEQ ID NO:24 (vanZ), SEQ ID NO:9 (V1) and SEQ ID NO:10 (V2) under high stringency conditions comprising hybridization overnight at 65° C. in a solution containing 0.1% SDS, 0.7% skim milk 6×SSC and washing at 65° C. in 2×SSC and 0.1% SDS, wherein said at least one isolated protein being necessary for conferring resistance to glycopeptides in gram-positive bacteria.
30. The composition according to claim 29, wherein the at least one isolated protein selected from the group consisting of VanH (SEQ ID NO:2), VanX (SEQ ID NO:6), VanC (SEQ ID NO:8), VanR (SEQ ID NO:12), VanS (SEQ ID NO:14), transposase (SEQ ID NO:19), resolvase (SEQ ID NO:21), VanY (SEQ ID NO:23), VanZ (SEQ ID NO:25) or a combination thereof.
31. The composition according to claim 1 comprising:
(a) an isolated protein encoded by a nucleotide sequence hybridizing to VanR (SEQ ID NO:11) under high stringency conditions, wherein said protein when combined with (b) is capable of increasing the level of said resistance to glycopeptides in gram-positive bacteria; and
(b) an isolated protein encoded by a nucleotide sequence hybridizing to VanS (SEQ ID NO:13) under high stringency conditions, wherein said protein when combined with (a) is capable of increasing the level of said resistance to glycopeptides in gram-positive bacteria.
32. A composition according to claim 31, comprising VanR (SEQ ID NO:12) and VanS (SEQ ID NO:14).
33. The composition according to claim 32, further comprising at least one isolated protein encoded by a nucleotide sequence hybridizing to SEQ ID NO:17 under high stringency conditions.
34. The composition according to claim 33, further comprising at least one isolated protein encoded by a nucleotide sequence hybridizing to SEQ ID NO:1 (vanH), SEQ ID NO:5 (vanX) or SEQ ID NO:3 (vana) under high stringency conditions.
35. The composition according to claim 35, further comprising VanH (SEQ ID NO:2), VanX (SEQ ID NO:) and VanA (SEQ ID NO:).