US20050112643A1
2005-05-26
10/954,723
2004-09-30
Polynucleotides encoding novel Atr-2 cell cycle checkpoint polypeptides are disclosed, along with expression constructs comprising the polynucleotides, host cells transformed with the expression constructs, methods to make the Atr-2 polypeptides using the host cells, Atr-2 polypeptides, and binding partners of the Atr-2 polypeptides.
Get notified when new applications in this technology area are published.
C12N9/12 » CPC main
Enzymes; Proenzymes; Compositions thereof ; Processes for preparing, activating, inhibiting, separating or purifying enzymes; Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
The present invention relates to novel polynucleotides encoding cell cycle checkpoint polypeptides.
BACKGROUNDThe mitotic cell cycle is the process by which a cell creates an exact copy of its chromosomes and then segregates each copy into two cells. The sequence of events of the cell cycle is carefully regulated such that cell division does not occur until the cell has completed DNA replication and, DNA replication does not occur until cells have completed mitosis. If a cell is exposed to DNA damage, the damage is repaired before the cell undergoes cell division. Regulation of these processes ensures that an exact copy of DNA is propagated to the daughter cells. The cell cycle has been divided into four phases: G1, S, G2, and M. During the G1 phase, cells undergo activities that prepare for DNA replication. S, or synthesis, phase begins as cells initiate DNA replication and ends with the formation of two identical copies of each chromosome. G2, the stage that begins after replication is complete, is when cells ensure that they contain components needed for mitosis. M phase, or mitosis, is the stage at which the cells divide each identical chromosome into two daughter cells.
Cells have mechanisms for sensing correct cell cycle progression and exposure to DNA damage, and proteins involved in these sensing mechanisms are termed checkpoints. Checkpoints signal cell cycle arrest to allow for completion of relevant events or repair of DNA damage. There are checkpoints that monitor progression through the cycle at G1, S, G2, and M. DNA damage checkpoints also exist at these stages of the cell cycle. Failure to correct DNA damage may signal the cell to undergo programmed cell death or apoptosis.
Members of the phosphatidylinositol kinase (PIK)-related family of kinases are involved in cell cycle checkpoints and DNA damage repair. To date, five PIK-related protein kinases have been identified. Genes in this family, which includes ATM, ATR, FRAP and DNA-PKcs, encode large proteins (280-450 kD) that exhibit homology to kinases at the carboxy terminus. While the predicted amino acid sequences of the kinase domains are most closely related to lipid kinases, all have been shown to function as protein kinases, and, presumably, each of these proteins participate in a signal transduction cascade leading to cell cycle arrest, cell cycle progression, and/or DNA repair.
The ataxia-telangiectasia mutated (ATM) gene product has been shown to play a role in a DNA damage checkpoint in response to ionizing radiation (IR). Patients lacking functional ATM develop the disease ataxia-telangiectasia (A-T). Symptoms of A-T include extreme sensitivity to irradiation, cerebellar degeneration, oculocutaneous telangiectasias, gonadal deficiencies, immunodeficiencies, and increased risk of cancer [Lehman and Carr, Trends in Genet. 11:375-377 (1995)]. Fibroblasts derived from these patients show defects in G1, S, and G2 checkpoints [Painter and Young, Proc. Natl. Acad. Sci. (USA) 77:7315-7317 (1980)] and are defective in their response to irradiation. ATM is thought to sense double strand DNA damage caused by irradiation and radiomimetic drugs, and to signal cell cycle arrest so that the damage can be repaired.
The DNA-stimulated protein kinase, DNA-PKcs has been demonstrated to play an important role in repair of double strand breaks. Mice defective in DNA-PK demonstrate immunodeficiencies and sensitivity to irradiation. In addition, these mice are defective in V(D)J recombination. These results suggest that DNA-PK plays a role in repairing normal double strand DNA breaks generated during V(D)J recombination, as well as double strand breaks generated by DNA damaging agents. While DNA-PK defective cells have not been shown to be deficient in cell cycle checkpoints, it is reasonable to assume that the cell cycle must arrest, if only transiently, in order to repair double strand breaks.
ATR has been found to act as a checkpoint protein stimulated by agents that cause double strand DNA breaks, agents that cause single strand DNA breaks, and agents that block DNA replication [Cliby, et al., EMBO J. 17:159-169 (1998); Wright, et al., Proc. Natl. Acad. Sc. (USA) 95:7445-7450 (1998)]. Overexpression of ATR in muscle cells on iso-chromosome 3q results in a block to differentiation, gives rise to abnormal centrosome numbers and chromosome instability, and abolishes the G1 arrest in response to irradiation [Smith, et al. Nat. Genetics 19:39-46 (1998)]. Overexpression of a dominant negative mutant of ATR sensitizes cells to irradiation and cisplatinum [Cliby, et al., supra] and the cells fail to arrest in G2 in response to irradiation. ATR is found associated with chromosomes in meiotic cells where DNA breaks and abnormal DNA structures that persist as a result of the process of meiotic recombination [Keegan, et al, Genes Dev. 10:2423-2437 (1996)]. These data suggest that ATR, like ATM, senses DNA damage and effects a cell cycle arrest in order to allow for DNA repair.
FRAP, the target of the potent immunosuppressent rapamycin, has been demonstrated to be involved in the control of translation initiation and progression through the G1 phase of the cell cycle in response to nutrients [Kuruvilla and Shrieber, Chemistry and Biology 6:R129-R136 (1999)]. FRAP regulates translation initiation by phosphorylation of the p70S6K protein kinase and the 4E-BP1 translation regulator. While ATM, ATR, and DNA-PK are thought to sense lesions in nucleic acids, FRAP is thought to sense intracellular levels of amino acids pools. In cells lacking proper nutrients that are amino acid starved, uncharged amino acid levels rise. FRAP may sense these uncharged amino acids, become activated, and signal G1 cell cycle arrest [Kuruvilla and Shreiber, supra]
In yeast, Tor1p and Tor2p proteins show significant homology to FRAP. Both Tor1p and Tor2p are sensitive to rapamycin and both are involved in initiation of translation as well as GI progression in response to nutrient conditions. Tor2p also plays a role in organization of actin cytoskeleton, but this activity is not blocked by rapamycin. These observations suggest that Tor2p stimulates two distinct signal transduction pathways.
An additional PIK-related family member, TRRAP, was recently identified as a member of a protein complex containing the cell cycle regulators, c-myc and E2F-1 [McMahon et al., Cell 94:363-374 (1998)]. While TRRAP shows significant sequence homology to the protein kinase domain of the other PIK-related kinases, the protein lacks critical residues required for protein kinase activity. Studies have failed to show protein kinase activity, but others have shown that TRRAP contains a histone acetyltransferase (HAT) activity. Interestingly, overexpression of TRRAP dominant inhibiting mutants or anti-sense constructs of TRRAP blocked oncogenic transformation of cultured cells transformed by c-myc or the viral oncogene, E1A [McMahon et al., supra]. These results suggest that TRRAP also plays an important role in regulating cell cycle progression and preventing oncogenesis.
In general, the proteins in this family of kinases play important roles in surveillance of DNA and cell cycle progression in order to insure genetic integrity from generation to generation. All cancer cells have a dysfunctional cell cycle and continue through the cell cycle in an inappropriate manner, either by failing to respond to negative growth signals or by failing to die in response to the appropriate signal. In addition, most cancer cells lack genomic integrity and often have an increased chromosome count compared to normal cells. Inhibitors of cell cycle checkpoints or DNA damage repair in combination with the cytotoxic agents may force cancer cells to die by forcing them to continue to progress through the cell cycle in the presence of DNA damaging agents such that they undergo catastrophic events that lead to cell death. Further, inhibitors of cell cycle progression may act to inhibit activation of cells involved in an inflammatory response and therefore inhibit inflammation.
Thus there exists a need in the art to identify additional members of the family of PIK-related kinases, and in particular, those that play roles in regulation of cell cycle progression, cell cycle checkpoints, and DNA damage repair.
BRIEF DESCRIPTION OF THE INVENTIONThe present invention provides purified and isolated Atr-2 polypeptides. In one aspect, the Atr-2 polypeptide comprises the amino acid sequence set out in SEQ ID NO: 2. The invention also provides mature Atr-2 polypeptides, preferably encoded by a polynucleotide comprising the sequence set out in SEQ ID NO: 1. Atr-2 polypeptides of the invention include those encoded by a polynucleotide selected from the group consisting of: a) the polynucleotide set out in SEQ ID NO: 1; b) a polynucleotide encoding a polypeptide encoded by the polynucleotide of (a), and c) a polynucleotide that hybridizes to the complement of the polynucleotide of (a) or (b) under moderately stringent conditions.
The invention also provides polynucleotides encoding Atr-2 polypeptides. In one aspect, the Atr-2 encoding polynucleotide comprises the sequence set forth in SEQ ID NO: 1. The invention also provides polynucleotides encoding a human Atr-2 polypeptide selected from the group consisting of: a) the polynucleotide set out in SEQ ID NO: 1; b) a polynucleotide encoding a polypeptide encoded by the polynucleotide of (a), and c) a polynucleotide that hybridizes to the complement of the polynucleotide of (a) or (b) under moderately stringent conditions. Polynucleotides of the invention include DNA molecules, cDNA molecules, genomic DNA molecules, as well as wholly or partially chemically synthesized DNA molecule. The invention further provide fragments of polynucleotides of the invention, and preferably fragments of the polynucleotide set out in SEQ ID NO: 1.
Antisense polynucleotides which specifically hybridize with the complement of a polynucleotide of the invention are also provided.
The invention further provides expression constructs comprising a polynucleotide of the invention, as well as host cells transformed or transfected with an expression construct of the invention.
Method for producing an Atr-2 polypeptide are also provided, comprising the steps of: a) growing a transformed or transfected host cell of the invention under conditions appropriate for expression of the Atr-2 polypeptide and b) isolating the Atr-2 polypeptide from the host cell or medium of the host cell's growth.
The invention also provides antibodies specifically immunoreactive with a polypeptide of the invention. Preferably, the antibodies are monoclonal antibodies. Hybridomas which produce the antibodies are also provided, as are anti-idiotype antibodies specifically immunoreactive with an antibody of the invention.
The invention further provides methods to identify a binding partner compound of an Atr-2 polypeptide comprising the steps of: a) contacting the Atr-2 polypeptide with a compound under conditions which permit binding between the compound and the Atr-2 polypeptide; and b) detecting binding of the compound to the Atr-2 polypeptide. Preferably, the binding partner modulates activity of the Atr-2 polypeptide. In one aspect the binding partner inhibits activity of the Atr-2 polypeptide, and in another aspect, binding partner enhances activity of the Atr-2 polypeptide.
The invention also provide methods to identify a binding partner compound of an Atr-2-encoding polynucleotide of the invention steps of: a) contacting the Atr-2-encoding polynucleotide with a compound under conditions which permit binding between the compound and the Atr-2-encoding polynucleotide; and b) detecting binding of the compound to the Atr-2-encoding polynucleotide. Preferably, the specific binding partner modulates expression of an Atr-2 polypeptide encoded by the Atr-2-encoding polynucleotide. In one aspect, the binding partner compound inhibits expression of the Atr-2 polypeptide, while in another aspect, the binding partner compound enhances expression of the Atr-2 polypeptide.
The invention further provides compounds identified by methods of the invention, as well as compositions comprising a compound identified by a method of the invention and a pharmaceutically acceptable carrier.
DETAILED DESCRIPTION OF THE INVENTIONIn brief, the present invention provides purified and isolated polynucleotides encoding Atr-2 polypeptides. The invention includes both naturally occurring and non-naturally occurring Atr-2-encoding polynucleotides. Naturally occurring polynucleotides of the invention include distinct gene species within the Atr-2 family, including, for example, allelic and splice variants, as well as species homologs (or orthologs) expressed in cells of other animals. Non-naturally occurring Atr-2 encoding polynucleotides include analogs or variants of the naturally occurring products, such as insertion variants, deletion variants, substitution variants, and derivatives, as described below. In a preferred embodiment, the invention provides a polynucleotide comprising the sequence set forth in SEQ ID NO: 1. The invention also embraces polynucleotides encoding the amino acid sequence set out in SEQ ID NO: 2. A presently preferred polypeptide of the invention comprises the amino acid sequence set out in SEQ ID NO: 2. Anti-sense polynucleotides are also provided.
The invention also provides expression constructs (or vectors) comprising polynucleotides of the invention, and host cells comprising a polynucleotide or an expression construct of the invention. Methods to produce a polypeptide of the invention are also comprehended. The invention further provides antibodies, preferably monoclonal antibodies, specifically immunoreactive with a polypeptide of the invention, as well as hybridomas that secrete the antibodies.
The invention also provides Atr-2 polypeptides encoded by a polynucleotide of the invention. Atr-2 polypeptides include naturally and non-naturally occurring species. The invention further provides binding partner compounds that interact with an Atr-2 polypeptide of the invention. Methods to identify binding partner compounds are also provided, as well as methods to identify modulators of Atr-2 polypeptide biological activity.
The invention also provides materials and methods to regulate expression of Atr-2 including ribozymes, anti-sense polynucleotides, and compounds that form triplet helix.
Gene therapy techniques are also provided to modulate disease states associated with Atr-2 expression and/or biological activity.
The invention also provides compositions, and preferably pharmaceutical compositions, comprising an Atr-2 polypeptide, an Atr-2 antibody, a modulator of Atr-2 expression or biological activity, or a combination of these compounds. When compositions of the invention, and in particulary pharmaceutical compositions, are used for therapeutic or prophylactic intervention, the compounds can include one or more pharmaceutically acceptable carriers. Methods of packaging a composition of the invention, as well as methods for delivery and therapeutic treatment are also provided.
In one aspect, the invention provides novel purified and isolated human polynucleotides (e.g., DNA sequences and RNA transcripts, both sense and complementary anti-sense strands, including splice variants thereof) encoding the human Atr-2 polypeptides. DNA sequences of the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences. Genomic DNA of the invention comprises the protein coding region for a polypeptide of the invention and includes allelic variants of the preferred polynucleotide of the invention. Genomic DNA of the invention is distinguishable from genomic DNAs encoding polypeptides other than Atr-2 in that it includes the Atr-2 protein coding region found in Atr-2-encoding cDNA of the invention. Genomic DNA of the invention can be transcribed into RNA, and the resulting RNA transcript may undergo one or more splicing events wherein one or more introns (i.e., non-coding regions) of the transcript are removed, or “spliced out.” “Peptide nucleic acids (PNAs)” [Corey, TIBTech 15:224-229 (1997)] encoding a polypeptide of the invention are also contemplated. PNAs are DNA analogs containing neutral amide backbone linkages that are resistant to DNA degradation enzymes and which bind to complementary sequences at higher affinity than analogous DNA sequences as a result of the neutral charge on the backbone of the molecule. RNA transcripts that can be spliced by alternative mechanisms, and therefore be subject to removal of different RNA sequences but still encode an Atr-2 polypeptide, are referred to in the art as splice variants which are embraced by the invention. Splice variants comprehended by the invention therefore are encoded by the same DNA sequences but arise from distinct mRNA transcripts. Allelic variants are known in the art to be modified forms of a wild type gene sequence, the modification resulting from recombination during chromosomal segregation or exposure to conditions which give rise to genetic mutation. Allelic variants, like wild type genes, are inherently naturally occurring sequences (as opposed to non-naturally occurring variants which arise from in vitro manipulation).
The invention also comprehends cDNA that is obtained through reverse transcription of an RNA polynucleotide encoding Atr-2, followed by second strand synthesis of a complementary strand to provide a double stranded DNA.
“Chemically synthesized” as used herein and understood in the art, refers to polynucleotides produced by purely chemical, as opposed to enzymatic, methods. “Wholly” chemically synthesized DNA sequences are therefore produced entirely by chemical means, and “partially” synthesized DNAs embrace those wherein only portions of the resulting DNA were produced by chemical means.
A preferred DNA sequence encoding a human Atr-2 polypeptide is set out in SEQ ID NO: 1. The worker of skill in the art will readily appreciate that the preferred DNA of the invention comprises a double stranded molecule, for example, the molecule having the sequence set forth in SEQ ID NO: 1 along with the complementary molecule (the “non-coding strand” or “complement”) having a sequence deducible from the sequence of SEQ ID NO: 1 according to Watson-Crick base pairing rules for DNA. In addition, single stranded polynucleotides, including RNA as well as coding and noncoding DNAS, are also embraced the invention. Also preferred are polynucleotides encoding the Atr-2 polypeptide of SEQ ID NO: 2.
The invention further embraces species, preferably mammalian, homologs of the human Atr-2 DNA. Species homologs (also known in the art as orthologs), in general, share at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% homology with a human DNA of the invention. Percent sequence “homology” with respect to polynucleotides of the invention is defined herein as the percentage of nucleotide bases in the candidate sequence that are identical to nucleotides in the Atr-2 sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity as discussed below.
The polynucleotide sequence information provided by the invention makes possible large scale expression of the encoded Atr-2 polypeptide by techniques well known and routinely practiced in the art. Polynucleotides of the invention also permit identification and isolation of polynucleotides encoding related Atr-2 polypeptides by well known techniques including Southern and/or Northern hybridization, polymerase chain reaction (PCR), and variations of PCR. Examples of related polynucleotides include human and non-human genomic sequences, including allelic variants, as well as polynucleotides encoding polypeptides homologous to Atr-2 and structurally related polypeptides sharing one or more biological, immunological, and/or physical properties of Atr-2.
The disclosure of a full length polynucleotide encoding an Atr-2 polypeptide makes readily available to the worker of ordinary skill in the art every possible fragment of the full length polynucleotide. The invention therefore provides fragments of Atr-2-encoding polynucleotides comprising at least 10 to 20, and preferably at least 15, consecutive nucleotides of a polynucleotide encoding Atr-2, however, the invention comprehends fragments of various lengths. Preferably, fragment polynucleotides of the invention comprise sequences unique to the Atr-2-encoding polynucleotide, and therefore hybridize under highly stringent or moderately stringent conditions only (i.e., “specifically” or “exclusively”) to polynucleotides encoding Atr-2, or Atr-2 fragments thereof, containing the unique sequence. Polynucleotide fragments of genomic sequences of the invention comprise not only sequences unique to the coding region, but also include fragments of the full length sequence derived from introns, regulatory regions, and/or other non-translated sequences. Sequences unique to polynucleotides of the invention are recognizable through sequence comparison to other known polynucleotides, and can be identified through use of alignment programs routinely utilized in the art, e.g., those made available in public sequence databases.
The invention also provides fragment polynucleotides that are conserved in one or more polynucleotides encoding members of the Atr-2 family of polypeptides. Such fragments include sequences characteristic of the family of Atr-2 polynucleotides, and are also referred to as “signature sequences.” The conserved signature sequences are readily discernable following simple sequence comparison of polynucleotides encoding members of the Atr-2 family. Fragments of the invention can be labeled in a manner that permits their detection, including radioactive and non-radioactive labeling.
Fragment polynucleotides are particularly useful as probes for detection of full length or other fragment Atr-2 polynucleotides. One or more fragment polynucleotides can be included in kits that are used to detect the presence of a polynucleotide encoding Atr-2, or used to detect variations in a polynucleotide sequence encoding Atr-2, including polymorphisms, and particularly single nucleotide polymorphisms. Kits of the invention optionally include a container and/or a label.
The invention also embraces naturally or non-naturally occurring Atr-2-encoding polynucleotides that are fused, or ligated, to a heterologous polynucleotide to encode a fusion (or chimeric) protein comprising all or part of an Atr-2 polypeptide. “Heterologous” polynucleotides include sequences that are not found adjacent, or as part of, Atr-2-encoding sequences in nature. The heterologous polynucleotide sequence can be separated from the Atr-2-coding sequence by an encoded cleavage site that will permit removal of non-Atr-2 polypeptide sequences from the expressed fusion protein. Heterologous polynucleotide sequences can include those encoding epitopes, such as poly-histidine sequences, FLAG® tags, glutathione-S-transferase, thioredoxin, and/or maltose binding protein domains, that facilitate purification of the fusion protein; those encoding domains, such as leucine zipper motifs, that promote multimer formation between the fusion protein and itself or other proteins; and those encoding immunoglobulins or fragments thereof that can enhance circulatory half-life of the encoded protein.
The invention also embraces DNA sequences encoding Atr-2 species that hybridize under highly or moderately stringent conditions to the non-coding strand, or complement, of the polynucleotide in SEQ ID NO: 1. Atr-2-encoding polynucleotides of the invention include a) the polynucleotide set out in SEQ ID NO: 2; b) polynucleotides encoding a polypeptide encoded by the polynucleotide of (a), and c) polynucleotides that hybridize to the complement of the polynucleotides of (a) or (b) under moderately or highly stringent conditions. Exemplary high stringency conditions include a final wash in 0.2×SSC/0.1% SDS at 65° C. to 75° C., and exemplary moderate stringency conditions include a final wash at 2× to 3×SSC/0.1% SDS at 65° C. to 75° C. It is understood in the art that conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration as described in Ausubel, et al. (Eds.), Protocols in Molecular Biology, John Wiley & Sons (1994), pp. 6.0.3 to 6.4.10. Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and the percentage of guanosine/cytosine (GC) base pairing of the probe. The hybridization conditions can be calculated as described in Sambrook, et al., (Eds.), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y. (1989), pp. 9.47 to 9.51.
Autonomously replicating recombinant expression constructs such as plasmid and viral DNA vectors incorporating Atr-2-encoding sequences are also provided. Expression constructs wherein Atr-2-encoding polynucleotides are operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator are also provided. Expression control DNA sequences include promoters, enhancers, and/or operators, and are generally selected based on the expression systems in which the expression construct is to be utilized. Preferred promoter and enhancer sequences are generally selected for the ability to increase gene expression, while operator sequences are generally selected for the ability to regulate gene expression. It is understood in the art that the choice of host cell is relevant to selection of an appropriate regulatory sequence. Expression constructs of the invention may also include sequences encoding one or more selectable markers that permit identification of host cells bearing the construct. Expression constructs may also include sequences that facilitate, and preferably promote, homologous recombination in a host cell. Preferred constructs of the invention also include sequences necessary for replication in a host cell.
Expression constructs are preferably utilized for production of an encoded protein, but may also be utilized to amplify the construct itself when other amplification techniques are impractical.
According to another aspect of the invention, host cells are provided, including prokaryotic and eukaryotic cells, comprising a polynucleotide of the invention in a manner which permits expression of the encoded Atr-2 polypeptide. Polynucleotides of the invention may be introduced into the host cell as part of a circular plasmid, or as linear DNA comprising an isolated protein coding region or a viral vector. Methods for introducing DNA into the host cell well known and routinely practiced in the art include transformation, transfection, electroporation, nuclear injection, or fusion with carriers such as liposomes, micelles, ghost cells, protoplasts, and other transformed cells. Expression systems of the invention include bacterial, yeast, fungal, plant, insect, invertebrate, and mammalian cells systems.
Host cells of the invention are a valuable source of immunogen for development of antibodies specifically, i.e., exclusively, immunoreactive with Atr-2. Host cells of the invention are also useful in methods for large scale production of Atr-2 polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptide products are isolated from the cells or from the medium in which the cells are grown by purification methods known in the art, e.g., conventional chromatographic methods including immunoaffinity chromatography, receptor affinity chromatography, hydrophobic interaction chromatography, lectin affinity chromatography, size exclusion filtration, cation or anion exchange chromatography, high pressure liquid chromatography (HPLC), reverse phase HPLC, and the like. Still other methods of purification include those wherein the desired protein is expressed and purified as a fusion protein having a specific tag, label, or chelating moiety that is recognized by a specific binding partner or agent. The purified protein can be cleaved to yield the desired protein, or be left as an intact fusion protein. Cleavage of the fusion component may produce a form of the desired protein having additional amino acid residues as a result of the cleavage process.
Knowledge of Atr-2-encoding DNA sequences allows for modification of cells to permit, or increase, expression of endogenous Atr-2. Cells can be modified (e.g., by homologous recombination) to provide increased Atr-2 expression by replacing, in whole or in part, the naturally occurring Atr-2 promoter with all or part of a heterologous promoter so that the cells express Atr-2 at higher levels. The heterologous promoter is inserted in such a manner that it is operatively linked to Atr-2-encoding sequences. See, for example, PCT International Publication No. WO 94/12650, PCT International Publication No. WO 92/20808, and PCT International Publication No. WO 91/09955. It is also contemplated that, in addition to heterologous promoter DNA, amplifiable marker DNA (e.g., ada, dhfr, and the multifunctional CAD gene which encodes carbamyl phosphate synthase, aspartate transcarbamylase, and dihydroorotase) and/or intron DNA may be inserted along with the heterologous promoter DNA. If linked to the Atr-2 coding sequence, amplification of the marker DNA by standard selection methods results in co-amplification of the Atr-2 coding sequences in the cells.
The DNA sequence information provided by the present invention also makes possible the development through, e.g. homologous recombination or “knock-out” strategies [Capecchi, Science 244:1288-1292 (1989)], of animals that fail to express functional Atr-2 or that express a variant of Atr-2. Such animals are useful as models for studying the in vivo activities of Atr-2 and modulators of Atr-2.
The invention also provides purified and isolated mammalian Atr-2 polypeptides encoded by a polynucleotide of the invention. Presently preferred is a human Atr-2 polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2. Mature Atr-2 polypeptides are also provided, wherein leader and/or signal sequences are removed. The invention also embraces Atr-2 polypeptides encoded by a DNA selected from the group consisting of: a) the polynucleotide set out in SEQ ID NO: 1; b) polynucleotides encoding a polypeptide encoded by the polynucleotide of (a), and c) polynucleotides that hybridize to the complement of the polynucleotides of (a) or (b) under moderate or high stringency conditions.
The invention also embraces polypeptides have at least 99%,at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55% or at least 50% identity and/or homology to the preferred polypeptide of the invention. Percent amino acid sequence “identity” with respect to the preferred polypeptide of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the Atr-2 sequence after aligning both sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Percent sequence “homology” with respect to the preferred polypeptide of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in the Atr-2 sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and also considering any conservative substitutions as part of the sequence identity.
In one aspect, percent homology is calculated as the percentage of amino acid residues in the smaller of two sequences which align with identical amino acid residue in the sequence being compared, when four gaps in a length of 100 amino acids are introduced to maximize alignment [Dayhoff, in Atlas of Protein Sequence and Structure, Vol. 5, p. 124, National Biochemical Research Foundation, Washington, D.C. (1972), incorporated herein by reference].
Preferred methods to determine identity and/or similarity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, the GCG program package, including GAP (Devereux, J., et al., Nucleic Acids Research 12(1):387 (1984); Genetics Computer Group, University of Wisconsin, Madison, Wis.), BLASTP, BLASTN, and FASTA (Atschul, S. F. et al., J. Molec. Biol. 215:403-410 (1990). The BLAST X program is publicly available from the National Center for Biotechnology Information (NCBI) and other sources (BLAST Manual, Altschul, S., et al. NCB NLM NIH Bethesda, Md. 20894; Altschul, S., et al., J. Mol. Biol. 215:403-410 (1990). The well known Smith Waterman algorithm may also be used to determine identity.
By way of example, using the computer algorithm GAP (Genetics Computer Group, University of Wisconsin, Madison, Wis.), two polypeptides for which the percent sequence identity is to be determined are aligned for optimal matching of their respective amino acids (the “matched span” as determined by the algorithm). A gap opening penalty (which is calculated as 3× the average diagonal; the “average diagonal” is the average of the diagonal of the comparison matrix being used; the “diagonal” is the score or number assigned to each perfect amino acid match by the particular comparison matrix) and a gap extension penalty (which is usually {fraction (1/10)} times the gap opening penalty), as well as a comparison matrix such as PAM 250 or BLOSUM 62 are used in conjunction with the algorithm. A standard comparison matrix (see Dayhoff et al., in: Atlas of Protein Sequence and Structure, vol. 5, supp.3 [1978] for the PAM250 comparison matrix; see Henikoff et al., Proc. Natl. Acad. Sci USA, 89:10915-10919 [1992] for the BLOSUM 62 comparison matrix) is also used by the algorithm.
Preferred parameters for polypeptide sequence comparison include the following:
Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970), Comparison matrix: BLOSUM 62 from Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-10919 (1992).
The GAP program is useful with the above parameters. The aforementioned parameters are the default parameters for polypeptide comparisons (along with no penalty for end gaps) using the GAP algorithm.
Preferred parameters for nucleic acid molecule sequence comparison include the following:
The GAP program is also useful with the above parameters. The aforementioned parameters are the default parameters for nucleic acid molecule comparisons.
Other exemplary algorithms, gap opening penalties, gap extension penalties, comparison matrices, thresholds of similarity, etc. may be used by those of skill in the art, including those set forth in the Program Manual, Wisconsin Package, Version 9, September, 1997. The particular choices to be made will depend on the specific comparison to be made, such as DNA to DNA, protein to protein, protein to DNA; and additionally, whether the comparison is between pairs of sequences (in which case GAP or BestFit are generally preferred) or between one sequence and a large database of sequences (in which case FASTA or BLASTA are preferred).
Certain alignment schemes for aligning two amino acid sequences may result in matching of only a short region of the two sequences, and this small aligned region may have very high sequence identity even though there is no significant relationship between the two full length sequences. Accordingly, in a preferred embodiment, the selected alignment method will result in an alignment that spans at least about 66 contiguous amino acids of the claimed full length polypeptide.
Polypeptides of the invention may be isolated from natural cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving host cells of the invention. Use of mammalian host cells is expected to provide for such post-translational modifications (e.g., glycosylation, truncation, lipidation, and phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention. Glycosylated and non-glycosylated form of Atr-2 polypeptides are embraced.
The invention also embraces variant (or analog) Atr-2 polypeptides.
In one example, insertion variants are provided wherein one or more amino acid residues supplement an Atr-2 amino acid sequence. Insertions may be located at either or both termini of the protein, or may be positioned within internal regions of the Atr-2 amino acid sequence. Insertional variants with additional residues at either or both termini can include for example, fusion proteins and proteins including amino acid tags or labels. Insertion variants include Atr-2 polypeptides wherein one or more amino acid residues are added to a fragment of an Atr-2 amino acid sequence. Variant products of the invention also include mature Atr-2 products, i.e., Atr-2 polypeptide products wherein leader or signal sequences are removed, and additional amino terminal residues have been inserted. The additional amino terminal residues may be derived from another protein, or may include one or more residues that are not identifiable as being derived from a specific protein. Atr-2 products with an additional methionine residue at position −1 (Met−1-Atr-2) are contemplated, as are Atr-2 products with additional methionine and lysine residues at positions −2 and −1 (Met−2-Lys-−1-Atr-2). Variants of Atr-2 with additional Met, Met-Lys, Lys residues (or one or more basic residues in general) are particularly useful for enhanced recombinant protein production in bacterial host cell. Heterologous amino acid sequences can also include protein transduction domains that target the lipid bilayer of a cell membrane and permit protein transduction into cells in an indiscriminate manner [Schwarze, et al., Science 285.:1569-1572 (1999)]. Fusion polypeptides of this type are particularly well suited for delivery to the cytoplasm and nucleus of cells, and also to cells across the blood-barrier.
The invention also embraces Atr-2 variants having additional amino acid residues which result from use of specific expression systems. For example, use of commercially available vectors that express a desired polypeptide as part of glutathione-S-transferase (GST) fusion product provides the desired polypeptide having an additional glycine residue at position −1 after cleavage of the GST component from the desired polypeptide. Variants which result from expression in other vector systems are also contemplated.
Insertional variants also include fusion proteins wherein the amino and/or carboxy termini of the Atr-2-polypeptide is fused to another polypeptide. Examples of other polypeptides are immunogenic polypeptides, proteins with long circulating half life such as immunoglobulin constant regions, marker proteins (e.g., fluorescent, chemiluminescence, enzymes, and the like) proteins or polypeptide that facilitate purification of the desired Atr-2 polypeptide, and polypeptide sequences that promote formation of multimeric proteins (such as leucine zipper motifs that are useful in dimer formation/stability). Fusion proteins wherein an Atr-2 polypeptide is conjugated to a hapten or other agent to improve, i.e., enhance, immungenicity, are also provided.
In another aspect, the invention provides deletion variants wherein one or more amino acid residues in an Atr-2 polypeptide are removed. Deletions can be effected at one or both termini of the Atr-2 polypeptide, or with removal of one or more residues within the Atr-2 amino acid sequence. Deletion variants, therefore, include all fragments of an Atr-2 polypeptide. Disclosure of the complete Atr-2 amino acid sequences necessarily makes available to the worker of ordinary skill in the art every possible fragment of the Atr-2 polypeptide.
The invention also embraces polypeptide fragments of the sequence set out in SEQ ID NO: 2 wherein the fragments maintain biological, immunological, physical, and/or chemical properties of an Atr-2 polypeptide. Fragments comprising at least 5, 10, 15, 20, 25, 30, 35, or 40 consecutive amino acids of SEQ ID NO: 2 are comprehended by the invention. Preferred polypeptide fragments display antigenic and/or biological properties unique to or specific for the Atr-2 family of polypeptides. Fragments of the invention having the desired biological and immunological properties can be prepared by any of the methods well known and routinely practiced in the art.
In still another aspect, the invention provides substitution variants of Atr-2 polypeptides. Particularly preferred variants include dominant negative mutants that lack kinase activity. Substitution variants include those polypeptides wherein one or more amino acid residues of an Atr-2 polypeptide are removed and replaced with alternative residues. In one aspect, the substitutions are conservative in nature, however, the invention embraces substitutions that are also non-conservative. Conservative substitutions for this purpose may be defined as set out in Tables A, B, or C below.
Variant polypeptides include those wherein conservative substitutions have been introduced by modification of polynucleotides encoding polypeptides of the invention. Amino acids can be classified according to physical properties and contribution to secondary and tertiary protein structure. A conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties. Exemplary conservative substitutions are set out in Table A (from WO 97/09433, page 10, published Mar. 13, 1997 (PCT/GB96/02197, filed Sep. 6, 1996), immediately below, wherein amino acids are listed by standard one letter designations.
| TABLE I |
| Conservative Substitutions I |
| SIDE CHAIN | ||
| CHARACTERISTIC | AMINO ACID | |
| Aliphatic | ||
| Non-polar | G A P | |
| I L V | ||
| Polar - uncharged | C S T M | |
| N Q | ||
| Polar - charged | D E | |
| K R | ||
| Aromatic | H F W Y | |
| Other | N Q D E | |
Alternatively, conservative amino acids can be grouped as described in Lehninger, [Biochemistry, Second Edition; Worth Publishers, Inc. NY:N.Y. (1975), pp.71-77] as set out in Table B, immediately below.
| TABLE B |
| Conservative Substitutions II |
| SIDE CHAIN | ||
| CHARACTERISTIC | AMINO ACID | |
| Non-polar (hydrophobic) | ||
| A. Aliphatic: | A L I V P | |
| B. Aromatic: | F W | |
| C. Sulfur-containing: | M | |
| D. Borderline: | G | |
| Uncharged-polar | ||
| A. Hydroxyl: | S T Y | |
| B. Amides: | N Q | |
| C. Sulfhydryl: | C | |
| D. Borderline: | G | |
| Positively Charged (Basic): | K R H | |
| Negatively Charged (Acidic): | DE | |
As still an another alternative, exemplary conservative substitutions are set out in Table C, immediately below.
| TABLE C |
| Conservative Substitutions III |
| Original | ||
| Residue | Exemplary Substitution | |
| Ala (A) | Val, Leu, Ile | |
| Arg (R) | Lys, Gln, Asn | |
| Asn (N) | Gln, His, Lys, Arg | |
| Asp (D) | Glu | |
| Cys (C) | Ser | |
| Gln (Q) | Asn | |
| Glu (E) | Asp | |
| His (H) | Asn, Gln, Lys, Arg | |
| Ile (I) | Leu, Val, Met, Ala, Phe, | |
| Leu (L) | Ile, Val, Met, Ala, Phe | |
| Lys (K) | Arg, Gln, Asn | |
| Met (M) | Leu, Phe, Ile | |
| Phe (F) | Leu, Val, Ile, Ala | |
| Pro (P) | Gly | |
| Ser (S) | Thr | |
| Thr (T) | Ser | |
| Trp (W) | Tyr | |
| Tyr (Y) | Trp, Phe, Thr, Ser | |
| Val (V) | Ile, Leu, Met, Phe, Ala | |
The invention also provides derivatives of Atr-2 polypeptides. Derivatives include Atr-2 polypeptides bearing modifications other than insertion, deletion, or substitution of amino acid residues. Preferably, the modifications are covalent in nature, and include for example, chemical bonding with polymers, lipids, other organic, and inorganic moieties. Derivatives of the invention may be prepared to increase circulating half-life of a Atr-2 polypeptide, to improve targeting capacity for the polypeptide to desired cells, tissues, or organs, and/or to modulate (increase or decrease) biological and/or immunological activity.
The invention further embraces Atr-2 products covalently modified or derivatized to include one or more water soluble polymer attachments such as polyethylene glycol, polyoxyethylene glycol, polypropylene glycol or any of the many other polymers well known in the art, including, for example, monomethoxy-polyethylene glycol, dextran, cellulose, or other carbohydrate based polymers, poly-(N-vinyl pyrrolidone)-polyethylene glycol, propylene glycol homopolymers, a polypropylene oxide/ethylene oxide co-polymer, polyoxyethylated polyols (e.g., glycerol) and polyvinyl alcohol, as well as mixtures of these polymers. Particularly preferred are Atr-2 products covalently modified with polyethylene glycol (PEG) subunits. Water soluble polymers may be bonded at specific positions, for example at the amino terminus of the Atr-2 products, or randomly attached to one or more side chains of one or more amino acid residues in the polypeptide.
The invention further comprehends Atr-2 polypeptides having combinations of insertions, deletions, substitutions, or derivatizations.
Also comprehended by the present invention are antibodies (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, bifunctional/bispecific antibodies, humanized antibodies, human antibodies, bispecific antibodies, and complementary determining region (CDR)-grafted antibodies/proteins, including compounds which include CDR and/or antigen-binding sequences, which specifically recognize a polypeptide of the invention) and other binding proteins specific for Atr-2 products or fragments thereof. Preferred antibodies of the invention are human antibodies which are produced and identified according to methods described in WO93/11236, published Jun. 20, 1993, which is incorporated herein by reference in its entirety. Antibody fragments, including Fab, Fab′, F(ab′)2, and Fv, are also provided by the invention. The term “specific for” indicates that the variable regions of the antibodies of the invention recognize and bind Atr-2 polypeptides exclusively (i.e., able to distinguish Atr-2 polypeptides from the family of ATR polypeptides despite sequence identity, homology, or similarity found in the family of polypeptides), but may also interact with other proteins (for example, S. aureus protein A or other antibodies in ELISA techniques) through interactions with sequences outside the variable or CDR regions of the antibodies, and in particular, in the constant region of the molecule. Screening assays to determine binding specificity or exclusivity of an antibody of the invention are well known and routinely practiced in the art. For a comprehensive discussion of such assays, see Harlow et al. (Eds), Antibodies A Laboratory Manual; Cold Spring Harbor Laboratory; Cold Spring Harbor, N.Y. (1988), Chapter 6. Antibodies that recognize and bind fragments of the Atr-2 polypeptides of the invention are also contemplated, provided that the antibodies are first and foremost specific or exclusive for, as defined above, Atr-2 polypeptides. As with antibodies that are specific for full length Atr-2 polypeptides, antibodies of the invention that recognize Atr-2 fragments are those which can distinguish Atr-2 polypeptides from the family of ATR polypeptides despite inherent sequence identity, homology, or similarity found in the family of proteins.
Antibodies of the invention can be produced using any method well known and routinely practiced in the art, using any polypeptide, or immunogenic fragment thereof, of the invention. Immunogenic polypeptides can be isolated from natural sources, from recombinant host cells, or can be chemically synthesized. Protein of the invention may also be conjugated to a hapten such as keyhole limpet hemocyanin (KLH) in order to increase immunogenicity. Methods for synthesizing such peptides are known in the art, for example, as in R. P. Merrifield, J. Amer. Chem. Soc. 85: 2149-2154 (1963); J. L. Krstenansky, et al., FEBS Lett. 211:10 (1987). Antibodies to a polypeptide of the invention can also be prepared through immunization using a polynucleotide of the invention, as described in Fan et al., Nat. Biotech. 17.870-872 (1999). DNA encoding a polypeptide may be used to generate antibodies against the encoded polypetide following topical administration of naked plasmid DNA or following injection, and preferably intramuscular injection, or the DNA.
Non-human antibodies may be humanized by any methods known in the art. In one method, the non-human CDRs are inserted into a human antibody or consensus antibody framework sequence. Further changes can then be introduced into the antibody framework to modulate affinity or immunogenicity.
Antibodies of the invention further include plastic antibodies or molecularly imprinted polymers (MIPs) [Haupt and Mosbauch, TIBTech 16:468-475) (1998)]. Antibodies of this type are particularly useful in immunoaffinity separation, chromatography, soli phase extraction, immunoassays, for use as immunosensors, and for screening chemical or biological libraries. A typical method of preparation is described in Haupt and Mosbauch [supra]. Advatanges of antibodies of this type are that no animal immunization is required, the antibodies are relatively inexpensive to produce, they are resistant to organic solvents, and they are reusable over long period of time.
Antibodies of the invention can also include one or more labels that permit detection of the antibody, and in particular, antibody binding. Labels can include, for example, radioactivity, fluorescence (or chemiluminescence), one of a high affinity binding pair (e.g., biotin/avidin), enzymes, or combinations of one or more of these labels.
Antibodies of the invention are useful for, for example, therapeutic purposes (by modulating activity of Atr-2), diagnostic purposes to detect or quantitate Atr-2, as well as purification of Atr-2. Kits comprising an antibody of the invention for any of the purposes described herein are also comprehended. In general, a kit of the invention also includes a control antigen for which the antibody is immunospecific. Kits of the invention optionally include a container and/or a label.
The DNA and amino acid sequence information provided by the present invention also makes possible the systematic analysis of the structure and function of Atr-2. DNA and amino acid sequence information for Atr-2 also permits identification of binding partner compounds with which an Atr-2 polypeptide or polynucleotide will interact. Methods to identify binding partner compounds include solution assays, in vitro assays wherein Atr-2 polypeptides are immobilized, and cell based assays. Identification of binding partner compounds of Atr-2 polypeptides provides potential targets for therapeutic or prophylactic intervention in pathologies associated with Atr-2 biological activity.
Specific binding proteins can be identified or developed using isolated or recombinant Atr-2 products, Atr-2 variants or analogs, or cells expressing such products. Binding proteins are useful for purifying Atr-2 products and detection or quantification of Atr-2 products in fluid and tissue samples using known immunological procedures. Binding proteins are also manifestly useful in modulating (i.e., blocking, inhibiting, or stimulating) biological activities of Atr-2, especially those activities involved in signal transduction or biological pathways in general wherein Atr-2 participates directly or indirectly.
In solution assays, methods of the invention comprise the steps of (a) contacting an Atr-2 polypeptide with one or more candidate binding partner compounds and (b) identifying the compounds that bind to the Atr-2 polypeptide. Identification of the compounds that bind the Atr-2 polypeptide can be achieved by isolating the Atr-2 polypeptide/binding partner complex, and separating the Atr-2 polypeptide from the binding partner compound. An additional step of characterizing the physical, biological, and/or biochemical properties of the binding partner compound is also comprehended in another embodiment of the invention. In one aspect, the Atr-2 polypeptide/binding partner complex is isolated using a antibody immunospecific for either the Atr-2 polypeptide or the candidate binding partner compound. In another aspect, the complex is isolated using a second binding partner compound that interacts with either the Atr-2 polypeptide or the candidate binding partner compound.
In still another embodiment, either the polypeptide Atr-2 or the candidate binding partner compound comprises a label or tag that facilitates its isolation, and methods of the invention to identify binding partner compounds include a step of isolating the Atr-2 polypeptide/binding partner complex through interaction with the label or tag. An exemplary tag of this type is a poly-histidine sequence, generally around six histidine residues, that permits isolation of a compound so labeled using nickel chelation. Other labels and tags, such as the FLAG® tag (Eastman Kodak, Rochester, N.Y.), thioredoxin, and/or maltose binding protein, each of which is well known and routinely used in the art and are embraced by the invention.
In an in vitro assay, methods of the invention comprise the steps of (a) contacting an immobilized Atr-2 polypeptide with a candidate binding partner compound and (b) detecting binding of the candidate compound to the Atr-2 polypeptide. In an alternative embodiment, the candidate binding partner compound is immobilized and binding of the Atr-2 polypeptide is detected. Immobilization is accomplished using any of the methods well known in the art, including covalent bonding to a support, a bead, or a chromatographic resin, as well as non-covalent, high affinity interaction such as antibody binding, or use of streptavidin/biotin binding wherein the immobilized compound includes a biotin or streptavidin moiety. Detection of binding can be accomplished (i) using a radioactive label on the compound that is not immobilized, (ii) using of a fluorescent label on the non-immobilized compound, (iii) using an antibody immunospecific for the non-immobilized compound, (iv) using a label on the non-immobilized compound that excites a fluorescent support to which the immobilized compound is attached, as well as other techniques well known and routinely practiced in the art.
In cell based assays of the invention to identify binding partner compounds of an Atr-2 polypeptide, methods comprise the steps of contacting an Atr-2 polypeptide in a cell with a candidate binding partner compound and detecting binding of the candidate binding partner compound to the Atr-2 polypeptide. A presently preferred method uses the dihybrid assay as previously described [Fields and Song, Nature 340:245-246 (1989); Fields, Methods: A Companion to Methods in Enzymology 5:116-124 (1993); U.S. Pat. No. 5,283,173 issued Feb. 1, 1994 to Fields, et al.]. Modifications and variations on the di-hybrid assay (also referred to in the art as “two-hybrid” assay) have previously been described [Colas and Brent, TIBTECH 16:355-363 (1998)] and are embraced by the invention.
Agents that modulate (i.e., increase, decrease, or block) Atr-2 activity or expression may be identified by incubating a putative modulator with an Atr-2 polypeptide or polynucleotide and determining the effect of the putative modulator on Atr-2 activity or expression. The selectivity, or specificity, of a compound that modulates the activity of Atr-2 can be evaluated by comparing its effects on Atr-2 or an Atr-2-encoding polynucleotide to its effect on other compounds. Cell based methods, such as di-hybrid assays to identify DNAs encoding binding compounds and split hybrid assays to identify inhibitors of Atr-2 polypeptide interaction with a known binding polypeptide, as well as in vitro methods, including assays wherein an Atr-2 polypeptide, Atr-2-encoding polynucleotide, or a binding partner are immobilized, and solution assays are contemplated by the invention.
Selective modulators may include, for example, antibodies and other proteins or peptides which specifically bind to an Atr-2 polypeptide or an Atr-2-encoding nucleic acid, oligonucleotides which bind to an Atr-2 polypeptide or an Atr-2 gene sequence, and other non-peptide compounds (e.g., isolated or synthetic organic and inorganic molecules) which specifically react with an Atr-2 polypeptide or underlying nucleic acid. Preferably, modulators of the invention will bind specifically or exclusively to an Atr-2 polypeptide or Atr-2-encoding polynucleotide, however, modulators that bind an Atr-2 polypeptide or an Atr-2-encoding polynucleotide with higher affinity or avidity compared to other compounds are also contemplated. Mutant Atr-2 polypeptides which affect the enzymatic activity or cellular localization of the wild-type Atr-2 polypeptides are also contemplated by the invention. Presently preferred targets for the development of selective modulators include, for example: (1) regions of an Atr-2 polypeptide which contact other proteins, (2) regions that localize an Atr-2 polypeptide within a cell, (3) regions of an Atr-2 polypeptide which bind substrate, (4) allosteric regulatory binding site(s) of an Atr-2 polypeptide, (5) phosphorylation site(s) of an Atr-2 polypeptide as well as other regions of the protein wherein covalent modification regulates biological activity and (6) regions of an Atr-2 polypeptide which are involved in multimerization of subunits. Still other selective modulators include those that recognize specific Atr-2-encoding and regulatory polynucleotide sequences. Modulators of Atr-2 activity may be therapeutically useful in treatment of diseases and physiological conditions in which Atr-2 activity is known or suspected to be involved.
Methods of the invention to identify modulators include variations on any of the methods described above to identify binding partner compounds, the variations including techniques wherein a binding partner compound has been identified and the binding assay is carried out in the presence and absence of a candidate modulator. A modulator is identified in those instances where the level of binding between an Atr-2 polypeptide and a binding partner compound changes in the presence of the candidate modulator compared to the level of binding in the absence of the candidate modulator compound. A modulator that increases binding between an Atr-2 polypeptide and the binding partner compound is described as an enhancer or activator, and a modulator that decreases binding between the Atr-2 polypeptide and the binding partner compound is described as an inhibitor. In vitro methods of the invention are particularly amenable to high throughput assays as described below.
In addition to the assays described above which can be modified to identify binding partner compounds, other methods are contemplated which as designed to more specifically identify modulators. In one aspect, methods of the invention comprehend use of the split hybrid assay as generally described in WO98/13502, published Apr. 2, 1998. The invention also embraces variations on this method as described in WO95/20652, published Aug. 3, 1995.
The invention also comprehends high throughput screening (HTS) assays to identify compounds that interact with or inhibit biological activity (i.e., inhibit enzymatic activity, binding activity, etc.) of an Atr-2 polypeptide. HTS assays permit screening of large numbers of compounds in an efficient manner. Cell-based HTS systems are contemplated, including melanophore assays to investigate receptor-ligand interaction, yeast-based assay systems, and mammalian cell expression systems [Jayawickreme and Kost, Curr. Opin. Biotechnol. 8:629-634 (1997)]. Automated (robotic) and miniaturized HTS assays are also embraced [Houston and Banks, Curr. Opin. Biotechnol. 8:734-740 (1997)]. HTS assays are designed to identify “hits” or “lead compounds” having the desired property, from which modifications can be designed to improve the desired property. Chemical modification of the “hit” or “lead compound” is often based on an identifiable structure/activity relationship (SAR) between the “hit” and the Atr-2 polypeptide.
There are a number of different libraries used for the identification of small molecule modulators, including, (1) chemical libraries, (2) natural product libraries, and (3) combinatorial libraries comprised of random peptides, oligonucleotides or organic molecules.
Chemical libraries consist of structural analogs of known compounds or compounds that are identified as “hits” or “leads” via natural product screening. Natural product libraries are collections from microorganisms, animals, plants, or marine organisms which are used to create mixtures for screening by: (1) fermentation and extraction of broths from soil, plant or marine microorganisms or (2) extraction of plants or marine organisms. Natural product libraries include polyketides, non-ribosomal peptides, and variants (non-naturally occurring) variants thereof. For a review, see Science 282:63-68 (1998). Combinatorial libraries are composed of large numbers of peptides, oligonucleotides or organic compounds as a mixture. They are relatively easy to prepare by traditional automated synthesis methods, PCR, cloning or proprietary synthetic methods. Of particular interest are peptide and oligonucleotide combinatorial libraries. Still other libraries of interest include peptide, protein, peptidomimetic, multiparallel synthetic collection, recombinatorial, and polypeptide libraries. For a review of combinatorial chemistry and libraries created therefrom, see Myers, Curr. Opin. Biotechnol. 8:701-707 (1997).
Identification of modulators through use of the various libraries described herein permits modification of the candidate “hit” (or “lead”) to optimize the capacity of the “hit” to modulate activity.
Also made available by the invention are anti-sense polynucleotides which recognize and hybridize to polynucleotides encoding Atr-2. Full length and fragment anti-sense polynucleotides are provided. The worker of ordinary skill will appreciate that fragment anti-sense molecules of the invention include (i) those which specifically or exclusively recognize and hybridize to Atr-2-encoding RNA (as determined by sequence comparison of DNA encoding Atr-2 to DNA encoding other molecules) as well as (ii) those which recognize and hybridize to RNA encoding variants of the Atr-2 family of proteins. Antisense polynucleotides that hybridize to RNA encoding other members of the ATR family of proteins are also identifiable through sequence comparison to identify characteristic, or signature, sequences for the family of molecules. Identification of sequences unique to Atr-2-encoding polynucleotides, as well as sequences common to the family of ATR-encoding polynucleotides, can be easily deduced through use of any publicly available sequence database, or through use of commercially available sequence comparison programs. After identification of the desired sequences, isolation through restriction digestion or amplification using any of the various polymerase chain reaction techniques well known in the art can be performed. Anti-sense polynucleotides are particularly relevant for regulating expression of Atr-2 by those cells expressing Atr-2 mRNA. Antisense molecules are generally from about 5 to about 100 nucleotide in length, and preferably are about 10 to 20 nucleotides in length. Antisense nucleic acids capable of specifically binding to Atr-2 expression control sequences or Atr-2 RNA are introduced into cells, e.g., by a viral vector or colloidal dispersion system such as a liposome.
The anti-sense nucleic acid binds to the Atr-2-encoding target nucleotide sequence in the cell and prevents transcription or translation of the target sequence. Phosphorothioate and methylphosphonate anti-sense oligonucleotides are specifically contemplated for therapeutic use by the invention. The anti-sense oligonucleotides may be further modified by poly-L-lysine, transferrin polylysine, or cholesterol moieties at their 5′ end.
The invention further contemplates methods to modulate Atr-2 expression through use of ribozymes. For a review, see Gibson and Shillitoe, Mol. Biotech. 7:125-137 (1997). Ribozyme technology can be utilized to inhibit translation of Atr-2 mRNA in a sequence specific manner through (i) the hybridization of a complementary RNA to a target mRNA and (ii) cleavage of the hybridized mRNA through nuclease activity inherent to the complementary strand. Ribozymes can identified by empirical methods but more preferably are specifically designed based on accessible sites on the target mRNA [Bramlage, et al., Trends in Biotech 16:434-438 (1998)]. Delivery of ribozymes to target cells can be accomplished using either exogenous or endogenous delivery techniques well known and routinely practiced in the art. Exogenous delivery methods can include use of targeting liposomes or direct local injection. Endogenous methods include use of viral vectors and non-viral plasmids.
Ribozymes can specifically modulate expression of Atr-2 when designed to be complementary to regions unique to a polynucleotide encoding Atr-2. “Specifically modulate” is intended to mean that ribozymes of the invention recognize only (i.e., exclusively) a polynucleotide encoding Atr-2. Similarly, ribozymes can be designed to modulate expression of all or some of the ATR family of proteins. Ribozymes of this type are designed to recognize polynucleotide sequences conserved in all or some of the polynucleotides which encode the family of Atr-2 proteins. Preferred ribozymes bind to an Atr-2-encoding polynucleotide with a higher degree of specificity that to other polynucleotides.
The invention further embraces methods to modulate transcription of Atr-2 through use of oligonucleotide-directed triple helix formation. For a review, see Lavrovsky, et al., Biochem. Mol. Med. 62:11-22 (1997). Triple helix formation is accomplished using sequence specific oligonucleotides which hybridize to double stranded DNA in the major groove as defined in the Watson-Crick model. Hybridization of a sequence specific oligonucleotide can thereafter modulate activity of DNA-binding proteins, including, for example, transcription factors and polymerases. Preferred target sequences for hybridization include promoter and enhancer regions to permit transcriptional regulation of Atr-2 expression. In addition to use of oligonucleotides, triple helix formation techniques of the invention also embrace use of peptide nucleic acids as described in Corey, TIBTECH 15:224-229 (1997). Oligonucleotides which are capable of triple helix formation are also useful for site-specific covalent modification of target DNA sequences. Oligonucleotides useful for covalent modification are coupled to various DNA damaging agents as described in Lavrovsky, et al. [supra].
Mutations in the Atr-2 gene can result in loss of normal function of the Atr-2 gene product and underlie Atr-2-related human disease states. The invention therefore comprehends gene therapy to restore Atr-2 activity in treating those disease states described herein. Delivery of a functional Atr-2 gene to appropriate cells is effected ex vivo, in situ, or in vivo by use of vectors, and more particularly viral vectors (e.g., adenovirus, adeno-associated virus, or a retrovirus), or ex vivo by use of physical DNA transfer methods (e.g., liposomes or chemical treatments). See, for example, Anderson, Nature, supplement to vol. 392, no. 6679, pp.25-20 (1998). For additional reviews of gene therapy technology, see Friedmann, Science, 244: 1275-1281 (1989); Verma, Scientific American: 68-84 (1990); and Miller, Nature, 357: 455-460 (1992). Alternatively, it is contemplated that in some human disease states, preventing the expression of, or inhibiting the activity of, Atr-2 will be useful in treating the disease states. It is contemplated that anti-sense therapy or gene therapy (for example, wherein a dominant negative Atr-2 mutatnt is introduced into a target cell type) could be applied to negatively regulate the expression of Atr-2.
The invention also provide compositions comprising modulators of Atr-2 biological activity. Preferably, the compositions are pharmaceutical compositions. The pharmaceutical compositions optionally may include pharmaceutically acceptable (i.e., sterile and non-toxic) liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media. Any diluent known in the art may be used. Exemplary diluents include, but are not limited to, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl- and propylhydroxybenzoate, talc, alginates, starches, lactose, sucrose, dextrose, sorbitol, mahnitol, gum acacia, calcium phosphate, mineral oil, cocoa butter, and oil of theobroma.
The pharmaceutical compositions can be packaged in forms convenient for delivery. The compositions can be enclosed within a capsule, sachet, cachet, gelatin, paper, or other container. These delivery forms are preferred when compatible with entry of the immunogenic composition into the recipient organism and, particularly, when the immunogenic composition is being delivered in unit dose form. The dosage units can be packaged, e.g., in tablets, capsules, suppositories or cachets.
The pharmaceutical compositions may be introduced into the subject to be treated by any conventional method including, e.g., by intravenous, intradermal, intramuscular, intramammary, intraperitoneal, intrathecal, intraocular, retrobulbar, intrapulmonary (e.g., aerosolized drug solutions) or subcutaneous injection (including depot administration for long term release) ; by oral, sublingual, nasal, anal, vaginal, or transdermal delivery; or by surgical implantation, e.g., embedded under the splenic capsule, brain, or in the cornea. The treatment may consist of a single dose or a plurality of doses over a period of time.
Compositions are generally administered in doses ranging from 1 μg/kg to 100 mg/kg per day, preferably at doses ranging from 0.1 mg/kg to 50 mg/kg per day, and more preferably at doses ranging from 1 to 20 mg/kg/day. The composition may be administered by an initial bolus followed by a continuous infusion to maintain therapeutic circulating levels of drug product. Those of ordinary skill in the art will readily optimize effective dosages and administration regimens as determined by good medical practice and the clinical condition of the individual patient. The frequency of dosing will depend on the pharmacokinetic parameters of the agents and the route of administration. The optimal pharmaceutical formulation will be determined by one skilled in the art depending upon the route of administration and desired dosage. See for example, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, Pa. 18042) pages 1435-1712, the disclosure of which is hereby incorporated by reference. Such formulations may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the administered agents. Depending on the route of administration, a suitable dose may be calculated according to body weight, body surface area or organ size. Further refinement of the calculations necessary to determine the appropriate dosage for treatment involving each of the above mentioned formulations is routinely made by those of ordinary skill in the art without undue experimentation, especially in light of the dosage information and assays disclosed herein, as well as the pharmacokinetic data observed in the human clinical trials discussed above. Appropriate dosages may be ascertained through use of established assays for determining blood levels dosages in conjunction with appropriate dose-response data. The final dosage regimen will be determined by the attending physician, considering various factors which modify the action of drugs, e.g. the drug's specific activity, the severity of the damage and the responsiveness of the patient, the age, condition, body weight, sex and diet of the patient, the severity of any infection, time of administration and other clinical factors. As studies are conducted, further information will emerge regarding the appropriate dosage levels and duration of treatment for various diseases and conditions.
It will be appreciated that the pharmaceutical compositions and treatment methods of the invention may be useful in the fields of human medicine and veterinary medicine. Thus, the subject to be treated may be a mammal, preferably human, or other animals. For veterinary purposes, subjects include, for example, farm animals including cows, sheep, pigs, horses, and goats, companion animals such as dogs and cats; exotic and/or zoo animals; laboratory animals including mice, rats, rabbits, guinea pigs, and hamsters; and poultry such as chickens, turkeys, ducks and geese.
Association of Atr-2 with cell cycle progression makes compositions of the invention, including for example an Atr-2 polypeptide, an inhibitor thereof, an antibody, or other modulator of Atr-2 expression or biological activity, useful for treating any of a number of conditions. For example, aberrant Atr-2 activity can be associated with various forms of cancer in, for example, adult and pediatric oncology, including growth of solid tumors/malignancies, myxiod and round cell carcinoma, locally advanced tumors, metastatic cancer, human soft tissue sarcomas, cancer metastases, including lymphatic metastases, squamous cell carcinoma of the head and neck, esophageal squamous cell carcinoma, oral carcinoma, blood cell malignancies, including multiple myeloma, leukemias, effusion lymphomas (body cavity based lymphomas), thymic lymphoma lung cancer, including small cell carcinoma, non-small cell cancers, breast cancer, including small cell carcinoma and ductal carcinoma, gastrointestinal cancers, including stomach cancer, colon cancer, colorectal cancer, polyps associated with colorectal neoplasia, pancreatic cancer, liver cancer, urological cancers, including bladder cancer, including primary superficial bladder tumors, invasive transitional cell carcinoma of the bladder, and muscle-invasive bladder cancer, prostate cancer, malignancies of the female genital tract, including ovarian carcinoma, primary peritoneal epithelial neoplasms, cervical carcinoma, uterine endometrial cancers, and solid tumors in the ovarian follicle, kidney cancer, including renal cell carcinoma, brain cancer, including intrinsic brain tumors, neuroblastoma, astrocytic brain tumors, gliomas, metastatic tumor cell invasion in the central nervous system, bone cancers, including osteomas, skin cancers, including malignant melanoma, tumor progression of human skin keratinocytes, and squamous cell cancer, hemangiopericytoma, and Kaposi's sarcoma. Still other conditions include aberrant apoptotic mechanisms, including abnormal caspase activity; aberrant enzyme activity associated with cell cycle progression, include for example cyclins A, B, D and E; alterations in viral (e.g., Epstein-Barr virus, papillomavirus) replication in latently infected cells; chromosome structure abnormalities, including genomic stability in general, unrepaired chromosome damage, telomere erosion (and telomerase activity), breakage syndromes including for example, Sjogren's syndrome and Nijimegen breakage syndrome; embryonic stem cell lethality; abnormal embyonic development; sensitivity to ionizing radiation; acute immune complex alveolitis; and Fanconi anemia.
The invention is exemplified by the following examples. Example 1 relates to identification of cDNAs encoding proteins related to PIK kinase. Example 2 describes identification of additional sequences in an Atr-2-encoding cDNA. Example 3 addresses Northern analysis of Atr-2 expression. Example 4 described chromosomal localization of an Atr-2 gene. Example 5 relates to production of anti-Atr-2 polypeptide antibodies. Example 6 describes expression of Atr-2 in mammalian cells. Example 7 describes kinase activity of a truncated form or Atr-2.
EXAMPLE 1 Identification of a cDNA Encoding a PIK-Related ProteinIn an attempt to identify novel genes within the checkpoint kinase family, several searches of the National Center for Biotechnology Information (NCBI) EST database were carried out. In the first search, the DNA query sequences were those encoding PI3 kinase (GenBank® Accession No: Z46973), P110 kinase α (GenBank® Accession No: U79143), P110 kinase β (GenBank Accession No: S67334), P110 kinase γ (GenBank® Accession No: X83368), P110 kinase δ (GenBank® Accession No: U86453), FRAP (GenBank® Accession No: L34075), ATR (GenBank® Accession No: Y09077), ATM (GenBank® Accession No: U26455), TRRAP (GenBank® Accession No: AF076974), PI3 kinase with C2 domain (GenBank® Accession No: AJ000008), PI4 kinase (GenBank® Accession No: AB005910), PI4 kinase/230 (GenBank® Accession No: AF021872), and DNA-PKcs (GenBank® Accession No: U34994). A blastn search was performed and a list of EST sequences corresponding to these query sequences was generated. In the second search, protein query sequences were P110 beta, FRAP, ATR, ATM, TRAPP, and DNA-PKcs and a tblastn search was performed. Those ESTs identified in the first search were subtracted from the results of the second search and the remaining sequences were analyzed.
One Genbank® EST, designated AI050717, was identified with a DNA sequence that was not identical to any of the query sequences and was not present in the non-redundant portion of GenBank®. When the predicted amino acid sequence for AI050717 was aligned with the query sequences, the highest homology was in the kinase domains of the query sequences. The protein encoded by AI050717 showed the most similarity to a putative kinase in C. elegans designated CE08808.
In an attempt to isolate a full length cDNA corresponding to AI050717, PCR was carried out on a Quickclone® human testis cDNA library (Clontech) to first amplify the AI050717 sequence. Two forward and two reverse primers were designed based on the sequence of AI050717 as set out in SEQ ID NOs: 9 to 12.
| 19F | GGGCGGAACCATCACAATCT | SEQ ID NO:9 | ||
| 22F | CGGAACCATCACAATCTTAC | SEQ ID NO:10 | ||
| 299R | CGTTGTTGCCATCGTTTGTA | SEQ ID NO:11 | ||
| 312R | TAAGGCAGCTTCCCGTTGTT | SEQ ID NO:12 |
Nested PCR was carried out on products obtained in the first reactions using primer pairs 19F/312R and 22F/312R as templates. Reaction conditions were modified and amplifications repeated using primer pair 22F/299R in an initial incubation at 94° C. for five minutes, followed by 30 cycles of 94° C. for 30 seconds, 55° C. for 30 seconds, and 72° C. for 30 seconds. The amplification reaction included 1× Perkin Elmer PCR buffer, 1.5 mM MgCl2, 330 ng primer 22F, 330 ng primer 299R, 320 nM NTPs, 0.5 U Taq polymerase, and 1 μl from the first PCR amplifications utilizing primer pairs 19F/312R and 22F/312R. An aliquot from each reaction was separated on an agarose gel and ethidium bromide staining indicated that both reactions gave a 277 bp product. The amplification product was purified with QIAquick® PCR Purification kit and eluted into 40 μl H2O.
The fragment was subcloned into pCR3.1 T/A vector (Invitrogen) in separate reactions that included 1 μl PCR product, 1 μl 10× ligation buffer, 2 μl vector, 5.5 μl H2O, and 1 μl T4 DNA ligase. Ligation was carried out overnight at 15° C. Five μl of each ligation reaction was transformed into TOP10F′ cells (Invitrogen) and the transformation mixture was plated. Each ligation, and a control mixture, resulted in approximately 200 colonies. Twelve colonies from each plate were picked and PCR carried out to screen for the expected insert. Results indicated that none of the colonies included an insert.
The ligation reaction was then repeated as described above except that the vector was first denatured at 65° C. for two min, and then quenched on ice. The remainder of the procedure was carried out as described above. No significant increase in number of colonies was detected in the transformation derived from the ligation of vector and PCR fragment compared to the transformation using vector alone.
While these experiments generated PCR products of the correct size, they failed to produce a cDNA clone representing the sequences of AI050717. Therefore, a different approach was undertaken using a Marathon® cDNA cloning system (Clontech) wherein PCR reactions were carried out to extend the sequences in AI050717 at the same time as attempting to obtain the full length AI050717 clone.
Using primers described above designed to amplify an AI1050717 sequence, PCR was carried out to extend the EST 3′ sequence in order to determine if the EST was part of a cDNA containing a functional kinase domain. PCR was carried out using primer pair 19F and AP1 (Marathon cDNA Cloning System, Clontech) with Marathon® testis cDNA as template.
| AP-1 | CCATCCTAATACGACTCACTATAGGGC | SEQ ID NO:13 |
PCR was then repeated using primer 22F and AP1 and template DNA from the first reactions 1 and 2. Stock reaction mixture included 93 μl H2O, 15 μl 10× cDNA polymerase buffer, 1.5 μl 20 mM dNTPs, and 3 μl Advantage® polymerase. Each reaction included 37.5 μl of the stock mixture and either (i) 5 μl primer 22F, 1 μl primer AP1, and 1 μl reaction 1, (ii) 5 μl primer 22F, 1 μl primer AP1, and 1 μl reaction 2, and (iii) 5 μl primer 22F, 5 μl 299R, and 1 μl reaction 1. Reaction conditions included an initial incubation at 94° C. for five min, followed by 30 cycles of 94° C. for 30 sec, 55° C. for 30 sec, and 68° C. for 30 sec. Agarose gel separation of the amplification products still showed smears in lanes from reactions (i) and (ii), while a band of approximately 300 fragment was detected in the reaction (iii) which was presumed to represent the sequences in the AI050717 EST.
In an attempt to clone this approximately 300 bp fragment, PCR was repeated using amplification products from the previously described reactions using Marathon® and Quickclone DNA as template. Each amplification reaction included 1 μl from either of the previous the Marathon® or Quickclone reactions, 5 μl primer 22F, 5 μl primer 299R, 5 μl 10× cDNA polymerase buffer, 0.4 μl 20 mM dNTPs, and 1 μl polymerase. Reaction conditions included an initial incubation at 94° C. for five min, followed by 30 cycles of 94° C. for 30 sec, 55° C. for 30 sec, and 68° C. for 30 sec. Ligation into pCR3.1 was carried out at 15° C. overnight using the amplification products with 2 μl heat denatured vector, 1 μl 10× ligation buffer, 5.5 μl H2O and 1 μl ligase. Transfections with each reaction mixture were carried out, the transfection mixtures plated, colonies picked and plasmid minipreps carried out on the picked colonies. Plasmid from each miniprep was digested with EcoRI and separated on agarose gel. All picked colonies were found to include an insert of the expected size. Sequence analysis confirmed that this insert contained sequence from nucleotide 22 to 299 of AI050717.
Extension of the AI050717 Clone
In an attempt to isolate a more complete cDNA clone including sequences in AI050717, additional PCR amplifications were carried out using a testis cDNA library as template.
Primers 19F, 22F, 299R, and 312R were redesigned to have higher melting temperatures for use at high annealing temperatures required for Touchdown® PCR. In Touchdown® PCR, the initial annealing temperature prior to amplification at 72° C. serves to increase the specificity of annealing of the primers to the cDNA of interest. The temperature is then decreased to allow for an increase in the specific PCR product. The rediesigned primers are set out in SEQ ID NOs: 14 to 17.
| 19Fext | GGGCGGAACCATCACAATCTTACC | SEQ ID NO:14 | |
| 22Fext | CGGACCCATCACAATCTTACCGACT | SEQ ID NO:15 | |
| 299Rext | CGTTGTTGCCATCGTTTGTAAAGAC | SEQ ID NO:16 | |
| 312Rext | TAAGGCAGCTTCCCGTTGTTGCCA | SEQ ID NO:17 |
The PCR was repeated using nested primers and DNA from the previous 3′ and 5′ reactions as template. A stock reaction mixture was first prepared including 94.5 μl H2O, 15 μl 10× cDNA polymerase PCR buffer, 1.5 μl 20 mM dNTPs and 3 μl Advantage polymerase. Each amplification included 38 μl of the stock mixture and either (i) 1 μl of the previous 3′ reaction mixture, 5 μl primer 22Fext and 1 μl primer AP2 (for the 3′ extension, this primer anneals to the 3′ end of all cDNAs in a Marathon® library), (ii) 1 μl of the previous 5′ reaction mix, 5 μl primer 19AS, and 1 μl primer AP2 (the 5′ extension), or (iii) 1 μl of the previous 3′ reaction mix, 5 μl primer 22Fext, and 5 μl primer 299Rext (the control reaction).
| AP-2 | ACTCACTATAGGGCTCGAGCGGC | SEQ ID NO:18 |
Amplification products were then ligated into pCR3.1 T/A vector in a reaction carried out as described above, the ligation products were transformed into TOP10F′ cells, and the cells were plated. In transformation with the vector alone, approximately 200 colonies were detected, while with transformation with the ligation products from the 3′ and 5′ amplifications, approximately 200 and 150 colonies, respectively, were detected. In view of the high numbers of colonies observed in the absence of insert, the PCRs, ligations, transfections and platings were repeated, and the same results were obtained in the second attempt.
Colonies were then screened for plasmids bearing inserts using PCR with primers 22Fext and 299Rext. A stock reaction mixture was prepared including 100 μl Perkin Elmer PCR buffer, 100 μl 10× MgCl2, 8 μl 20 mM dNTPs, 100 μl primer 22Fext, 100 μl 299Rext, 10 μl AmpliTaq polymerase, and 582 μl H2O. Forty eight colonies from the 3′ reaction were individually placed in 20 μl of the stock reaction mixture, and PCR performed under conditions including an initial incubation at 94° C. for one min, followed by 35 cycles of 94° C. for 30 sec, 60° C. for 30 sec, and 72° C. for 30 sec, and a final hold at 4° C. The reaction products were separated on agarose gels and all colonies picked were found to include inserts.
Twenty colonies arising from the 3′ extension reaction were picked, the cells grown overnight in two ml media, and plasmids isolated from the cells using a Wizard® Miniprep kit. Isolated plasmids were digested with EcoRI and the digestion products were separated on an agarose gel. Plasmids were precipitated from those preparations showing the largest inserts on the gel and the inserts were sequenced.
EXAMPLE 2 Extension of the Atr-2 cDNA 3′ of the AI050717 Sequence3′ Extension
Sequence analysis of the 3′ extended cDNAs showed that clone 2 (SEQ ID NO: 43), which contained an approximately 1.2 kb insert, contained sequences at one end that were similar to those found at the ends of the kinase domain of PIK-related kinases and were highly related to the C. elegans PIK (CE08808). In particular, the predicted amino acid sequence encoded by this clone demonstrated that the kinase domain contained homologous amino acids found in the PIK-related kinases that have protein kinase activity. This observation was different from what was found in TRRAP and Tra1, both of which lack some of the conserved amino acids and are therefore thought to lack protein kinase activity.
In order to determine if the AI050717 sequences and the kinase domains sequences were contiguous, several more primers were designed to amplify the product directly.
| Primer | CCACCTCCACCAATAGAGAGCACCAGC | SEQ ID NO:19 | |
| 15158 | |||
| Primer | GCTCTGCTTGCTCTCGGCCTGCTG | SEQ ID NO:20 | |
| 15156 | |||
| Primer | GGACTTGCTCGTCTTGCTCTCGGC | SEQ ID NO:21 | |
| 15157 |
Sequence analysis demonstrated that the PCR product generated from primers 22Fext and 15157 yielded the largest clone, which was designated 22F/57. The predicted amino acid sequence demonstrated that this clone contained all sequences found in the kinase domain of PIK-related kinases.
To further extend the 3′ end of the clone, a primer was designed based on the 3′ end of clone 22F/57.
| 3′E2F | GTCTATGGTGGAGGTGGCCAGCAG. | SEQ ID NO:22 |
This primer and the AP2 primer were used in nested PCR to amplify additional cDNA sequences 3′ to 22F/57. A 50 μl PCR reaction mix was prepared containing 0.5 μl the reaction mixture generated by PCR of Marathon® testis cDNA with primers 19F and AP1, 1× cDNA polymerase reaction buffer, 0.2 mM dNTPs, 100 ng each of the primers 3′E2F and AP2, and 1 μl Advantage® polymerase mix. Touchdown® PCR was performed as previously described. Amplification products were separated on an agarose gel and ranged in size from approximately 200 bp to approximately 3 kb. Bands representing the highest molecular weight products were excised from the gel, purified, and ligated into pCR2.1® using a TOPO TA cloning® vector. The resulting construct was transformed into TOP10 cells and one-tenth of the transformation mixture was plated onto agar plates. When no colonies were obtained, the remainder of the transformation mix was plated and five colonies were subsequently isolated.
PCR was repeated using 0.5 μl and 1 μl of template and either 1 or 2 μl of primer 3′E2F. Touchdown® PCR with performed with the first five cycles at 75° C. instead of 72° C. Reaction products were separated on an agarose gel and showed a distribution ranging from about 100 bp to 3 kb. Approximately 0.5 μl of the reaction mixture generated using 0.5 μl of template and 2 μl of 3′E2F was ligated into pCR2.1® using a TOPO TA® cloning vector. The ligation mixture was transformed into TOP10 bacteria and the bacteria plated onto agar plates. The reaction yielded hundreds of colonies.
These colonies and the colonies generated by ligation of the gel purified PCR products described above were screened for inserts using PCR. Five colonies were identified that contained inserts and plasmid DNA was prepared from each. Two of the clones, 3′E2F-1 and 3′E2F-28 contained inserts of about 1.8 kb.
Sequence analysis of the clones demonstrated that the 3′E2F-28 clone (SEQ ID NO: 41) showed very high sequence homology, at both nucleotide and amino acid levels, to a partial cDNA sequence designated KIAA0421 found in the GenBank® database (Accession Number AB007881). The KIAA clones were identified as part of a sequencing project to identify large cDNAs in the brain [Ishikawa et al., DNA Res. 4:307-313(1997)]. KIAA0421 was described as a 5717 bp cDNA isolated from a human male brain cDNA library, and encoding a protein related (by amino acid homology) to Lambda/iota Interacting Protein (LIP) [Dias-Meco et al., Mol. Cell Biol., 16:105-114(1996)], a protein that interacts with the atypical protein kinase C isotype λ/ι. KIAA0421 sequences surrounding the LIP-related region are similar to sequences in the kinase domains of PIK-related kinases; the KIAA0421 region upstream of the LIP-homologous domain is identical to the kinase domain of Atr-2 and the sequence downstream of the LIP domain is most similar to the carboxy terminus of the C. elegans PIK-related kinase that is most closely related to Atr-2. These clones may present the 3- end of the Atr-2 coding sequence.
In an attempt to isolate clones that contained these sequences, several primers were designed.
| KIDrev | GATGTCAATCTTTCGCCAAGCTATGG | SEQ ID NO:23 | |
| SLQrev | GCTGCAGGCTTGTCTTACAAC | SEQ ID NO:24 | |
| MCSrev | GCAAGCTCTAACTCAGACACTG | SEQ ID NO:25 | |
| SSArev | GCAGATGACGTTGGACTCGAAC | SEQ ID NO:26 | |
| MARQrev | CTACTGTCTTGCCATTCACACC | SEQ ID NO:27 |
PCR reactions were prepared with using 100 ng of each of these primers in combination with the 369f primer, 2.5 μl Marathon testis cDNA, 1× cDNA polymerase buffer, 0.2 mM dNTPs and 1 μl Advantage® polymerase. Touchdown® PCR was performed and the products were separated on a 1.2% agarose gel. Amplification products were obtained from reactions containing KIDrev, MCSrev and MARQrev primers but not from reactions using SLQrev and SSArev primers. Further, only the amplification product from the reaction containing the KIDrev primer was the expected size; all other amplification products were smaller than expected. Two μl of the products from each reaction was ligated into pCR2.1® using a TOPO TA cloning® kit (Invitrogen), each ligation mixture was transformed into TOP10, and the transformed cells were plated on agar plates. Plasmid DNA was isolated from these colonies and the sequences was analyzed.
Sequence analysis demonstrated that the clones derived from the 369f/KIDrev amplification started and ended at the expected positions with respect to the sequence of KIAA0421. The amplification products from PCR using the 369f/MARQrev primers started at sequences farther downstream than expected, but ended at the position predicted by the design of the primers. The products derived from PCR using the 369f/MCSrev primers showed no homology to KIAA0421, suggesting that the primers did not anneal in a sequence-specific manner. Two additional primers, RLLfor and TRTrev, were designed to repeat the PCR in order to obtain sequences of this region.
| RLLfor | CAGACTACTACATGCTCAGTACGG | SEQ ID NO:28 | |
| TRTrev | CCAGGTTTATGGCTTCTGCAGTTCTTG | SEQ ID NO:29 |
PCR reactions were prepared containing using 100 ng each of RLLfor and TRTrev primers, 2.5 μl Marathon® testis cDNA, 1× cDNA polymerase buffer, 0.2 mM dNTPs and 1 μl Advantage® polymerase. Touchdown® PCR was carried out, the products were separated on a 1.2% agarose gel, and a product of the expected size was obtained. Two μl of these products was ligated to pCR2.1® using a TOPO TA cloning® kit (Invitrogen), the ligation mixture was transformed into TOP10 bacteria, and the transformed cells were plated on agar. Plasmid DNA was isolated from these colonies and the sequences determined. These clones contained the expected sequences as predicted by the primers used in the reaction.
5′ Extension
In order to extend the 5′ AI050717 sequence, a first PCR was carried out in a reaction containing 100 ng each of primers 299ext and AP1, 1 ng of Marathon® testis cDNA, 1× cDNA polymerase buffer, 0.2 mM dNTPs and 1 μl Advantage® polymerase. Touchdown® PCR was performed as described above. A second nested PCR was then performed on the products of the first PCR using 19AS, an anti-sense primer that corresponded to the 5′ sequence of AI050717.
| Primer 19AS | GGTAAGATTGTGATGGTTCCGCCC | SEQ ID NO:30 |
The nested PCR reaction mixture contained 100 ng each of primers 19AS and AP2, 1 μl of the primary PCR reaction (above), 1× cDNA polymerase buffer, 0.2 mM dNTPs and 1 μl Advantage polymerase. Touchdown® PCR was performed and the products were separated on an agarose gel. A smear ranging in size from 500 bp to 6 kb was observed. Approximately two μl of the reaction mix was ligated into pCR3.1 for 20 hours at 15° C. and the ligation mixture transformed into TOP10F′ E. coli. Eighteen colonies were cultured, and plasmid DNA was prepared and digested with EcoRI. Five clones contained inserts released by EcoRI ranging from 200 to 500 bp in size. Sequence analysis of these clones demonstrated that the longest clone containing sequences contiguous with Atr-2 was 243 bp in length. This sequence was used to design another primer, designated 5′E2R, for extending the 5′ end of Atr-2.
| 5′E2R | GCACGTTTCTGTGCTCTCTGTTGC | SEQ ID NO:31 |
Nested PCR was carried out in a reaction containing 100 ng each of primers 5′E2R and AP2, 1 μl of the PCR reaction derived from the PCR on testis cDNA with primer pair 299Rext and AP1 (SEQ ID NOs: 16 and 13), 1× cDNA polymerase buffer, 0.2 mM dNTPs and 1 μl Advantage® polymerase. Touchdown® PCR was performed and the products were separated on an agarose gel. A smear was observed on the gel with a prominent band at 600 bp and a minor hand at about 1 kb. Two μl of the reaction mixture was ligated into pCR3.1, and the ligation mixture transformed into TOP10F′ bacteria. After plating, 30 colonies were screened for inserts using PCR with the M13 vector primer and primer 5′E2R. Most colonies contained inserts. The colonies containing the largest inserts were cultured and plasmid DNA subjected to sequencing.
Sequence analysis demonstrated that clone 5′E2#2 contained the largest insert and showed significant homology to the C. elegans PIK-related clone and FRAP. Since this cDNA showed an open reading frame through its entire sequence, it was expected that the clone did not encode an initiating methionine. As a result, another primer designated STDrev was designed to further extend the 5′ end of the cDNA.
| STDrev: | GGCCATCCACAATCATGTCATCAGTGCTC | SEQ ID NO:32 |
Sequence analysis of these clones revealed that the longest clone, 5′E3#1 (SEQ ID NO: 42) contained about 1200 bp of additional Atr-2-encoding sequence. Blastx analysis of the predicted amino acid sequence of the clones demonstrated that none of the clones showed significant homology to any sequences in the nonredundant database of GenBank®. The fact that the longest clone from this PCR included an open reading frame suggested that this clone did not contain the initiating methionine residue.
In an effort to identify additional 5′ sequences, another primer, PIRrev, was designed for use in RACE reactions.
| PIRrev | CTAATTCCATGAGATGGCTTCTAATTGG | SEQ ID NO:33 |
A PCR reaction was prepared containing 100 ng of PIRrev and AP2 primers, 1 μl of the amplification product from PCR using primers STDrev and AP1, 1× cDNA polymerase buffer, 0.2 mM dNTPs and 1 μl Advantage® polymerase. Touchdown® PCR was performed and the products were separated on a 1.2% agarose gel. A smear was detected ranging from 200 bp to 2 kb. Two μl were ligated into pCR2.1® using a TOPO TA® cloning kit (Invitrogen), the ligation mixture was transformed into TOP10 bacteria, and the transformed cells were plated on agar. Eighteen colonies were selected for plasmid preparation and the sequence of five plasmid DNAs, each containing EcoRI fragments larger than 0.5 kb, was analyzed. The largest of these clones contained approximately 800 bp. Blastx analysis revealed significant homology to two partial coding sequences in the nonredundant database, KIAA0020 (accession number AAC31670) and a sequence obtained by sequencing artificial chromosomes derived from human chromosome 16 (human Chromosome 16 BAC clone CIT987-SK-A-61E3, accession number AC003007). The homology to the chromosome 16 clone correlated with chromosomal mapping data demonstrating the localization of Atr-2 to chromosome 16p12 (see Example 4).
Using this sequence, another primer designated CECrev, was designed to further extend the 5′ sequence.
| CECrev | CGGCAATTGAGATGTAGCACTCAC | SEQ ID NO:34 |
A PCR reaction was prepared containing 100 ng of CECrev and AP2, 1 μl of the product derived from PCR with primers STD rev and AP1, 1× cDNA polymerase buffer, 0.2 mM dNTPs and 1 μl Advantage® polymerase. Touchdown® PCR was performed and the products were separated on a 1.2% agarose gel. A smear of products ranging from 200 bp to 8 Kb was observed. Two ill of the reaction was ligated to pCR2.1® using a TOPO TA® cloning kit (Invitrogen), the ligation mixture was transformed into TOP10 cells, and the cells were plated on agar. Eighteen white colonies were selected and DNA from clones with the five largest EcoRI inserts were sequenced. These clones also showed significant homology to KIAA0220 and the chromosome 16 BAC clone, but none encoded the initiating methionine.
In a further effort to isolate sequences including the start codon, another primer, MTWfor, was designed using the sequence data obtained from the KIAA0220 and chromosome 16 BAC clones to span the initiating methionine.
| MTWfor | ATGACTTGGGCTTTGGAAGTAGCTGTTCT | SEQ ID NO:35 |
Touchdown® PCR was carried out using 100 ng each of MTWfor and PIRrev, 1 μl Marathon® testis cDNA, 1× cDNA polymerase buffer. 0.2 mM dNTPs and 1 μl Advantage® polymerase, and a product of approximately 2 kb was obtained. Two μl of the reaction was ligated into pCR2.1® using a TOPO TA® cloning kit (Invitrogen), the ligation mixture was transformed into TOP10 bacteria, and the transformed cells were plated on agar. Six white colonies were selected and restriction digestion demonstrated that five of the six contained 2 kb inserts. Sequence analysis on three of the clones indicated that they encoded the initiating methionine of the KIAA0220 and chromosome 16 BAC clones and also contained sequences previously found in the Atr-2-encoding sequence.
In order to confirm that the combined cDNA encoded a single Atr-2 coding region, PCR was carried out to generate two overlapping clones spanning the complete protein coding region. A new primer, MTWfor2, was synthesized as a forward primer to amplify the 5′ end of the cDNA.
| MTWfor2 | |||
| GGACACGAGGAAACTGTTAATGACTTGGGC | SEQ ID NO:36 |
The sequences from three Atr-2 mtw-312rev clones are set out in SEQ ID NOs: 6, 7, and 8, and the sequences from three Atr-2 22F-MARQ clones are set out in SEQ ID NOs: 3, 4, and 5, respectively, were used to deduce a consensus cDNA sequence encoding Atr-2. Clones p22F-MARQ.3 and pMTW-312R.5 were deposited on Oct. 1, 1999, under terms of the Budapest Treaty with the American Type Culture Collection, 10801 University Blvd., Manassas, Va. 20110-2209, and assigned Accession Numbers PTA-810 and PTA-811, respectively. The consensus poly-nucleotide and deduced amino acid sequences are set out in SEQ ID NOs: 1 and 2, respectively. The entire Atr-2-encoding clone was 8838 bp in length and predicted to encode a protein of 2930 amino acids. PFAM analysis, a program designed to identify proteins motifs, identified the PIK-related kinase domain but no other motifs.
The Atr-2 protein coding domain begins with a methionine residue at nucleotide 31 and ends with a stop codon at nucleotide 8821. The full length protein is 2930 amino acids in length. Amino acids 1 to 546 are 95% identical to the protein encoded by KIAA0220. Further, amino acids 1629 to 2930 are 100% identical to KIAA0421 and amino acids 2152 to 2930 are 100% identical to the Lambda/iota interacting protein, LIP. The PIK-related kinase domain is between amino acid residues 1413 to 1695 and there is between 39% and 48% identity in this region with the kinase domains of the PIK-related kinases FRAP, Tor1, Tor2, and the C. elegans PIK-related kinase SMG-1 (Table 1). In addition, the carboxy termini of these proteins also show a significant degree of conservation (Table 1). Interestingly in Atr-2, the kinase domain is separated from the carboxy terminus by a large sequence which includes the LIP domain.
| TABLE 1 |
| Atr-2 Amino Acid Homologies |
| Percent Amino Acid Identity |
| Kinase Domain | Carboxy Terminus | ||
| C. elegans SMG-1 | 48 | 36 | |
| S. cerevisiae FRAP | 37 | 42 | |
| S. cerevisiae | 37 | 40 | |
| Tor1p | |||
| Human Tor2p | 39 | 42 | |
| Human Atr | 33 | 28 | |
| Human Atm | 33 | 37 | |
| Human DNAPK | 25 | ND | |
Atr-2 is most closely related to the C. elegans protein SMG-1. Mutants of the SMG-1 gene indicate that the encoded protein is involved in mRNA surveillance in a pathway called nonsense mediated mRNA decay (NMD). Proteins ion this pathway appear to monitor aberrant mRNAs and target them for elimination to avoid translation of deleterious proteins [Culbertson, et al., Trends in Genet. 15:74-80 (1999)]. SMG-2, another C. elegans protein involved in this pathway is phosphorylated in cells and its phosphorylation is dependent on SMG-1 [Page, et al., Mol. Cell. Biol 9:5943-5951 (1999)].
There are many human diseases and cancers in which mutations in genes lead to premature chain termination presumably through the NMD pathway. These diseases include ataxia-telangiectasia, breast cancers caused by mutation in the BRCA-1 gene, β-thalassemia, Marfin syndrome, and gyrate dystrophy. It is possible that inhibition of the NMD pathway could lead to the production and accumulation of the particular gene products thus alleviating the symptoms of these disease. Alternatively, in diseases in which truncated proteins are produced and block protein activity by acting in a dominant negative fashion, gene therapy using proteins in the NMD pathway may be of therapeutic value. The similarity between Atr-2 and SMG-1 indicates that Atr-2 may be involved in the onset or maintenance of any of these disease states.
EXAMPLE 3 Northern AnalysisIn order to assess expression of Atr-2, hybridization with Multiple Tissue Northern blots (Clontech) was performed. A stock hybridization mixture was prepared including 5× SSPE, 10× Denhardt's, 100 μg/ml salmon sperm DNA, 50% formamide and 2% SDS. Prehybridization in this mixture was first carried out for five hours at 42° C. A hybridization probe was prepared using PCR in a reaction containing 4 μl 10 Perkin Elmer PCR buffer, 4 μl 10 MgCl2, 4 μl 2 mM dATP and dGTP and 10 μM dCTP and dTTP, 10 μCi each 32P-αCTP and 32P-αTTP, 1 μl primer 22F, 1 μl 299R, 1 μl template DNA from human testis PCR reaction derived from primers 19F and 312R (Example 1) and 24.5 μl H2O. Reaction conditions included an initial incubation at 94° C. for five min, followed by 25 cycles of 94° C. for 15 sec, 60° C. for 15 sec, and 72° C. for 30 sec. Unincorporated nucleotides were removed from the reaction mixture using a NucTrap® column, pre-wet with 70 μl STE. The PCR mixture was removed from under the oil film, the volume brought up to 70 μl with STE, and the resulting mixture applied to the column. The column was eluted with 70 μl STE twice, radioactivity was determined using a 2 μl aliquot, the remaining probe boiled, and 25 μl of the probe added to the prehybrization mixture. Hybridization was carried out overnight at 42° C. The blot was washed one time for 15 min at room temperature in 2×SSC/0.1% SDS, and twice for 15 min at 55° C. in 0.1×SSC/0.1% SDS. Autoradiography was carried out four days.
Results indicated low levels of message greater than 9.5 kb in all tissues tested, with slightly higher levels in skeletal muscle, heart peripheral blood, thymus, and spleen.
EXAMPLE 4 Chromosomal Localization of the Atr-2 GeneIn an attempt to determine whether Atr-2 was associated with any known disease genes, chromosome mapping of Atr-2 was carried out using the Stanford Radiation Hybrid Panel (Research Genetics, Huntsville Ala.).
In this method, a human lymphoblastoid RM cell line was irradiated with 10,000 rad of X-rays and fused with a non-irradiated thymidine-resistant hamster cell line (A3). Fusion created 83 independent somatic hybrid cell lines containing chromosomes lacking successive regions with about 500 kb resolution. The radiation hybrids were screened for the presence of Atr-2 by PCR.
To determine whether the PCR primers chosen for the screen would hybridize to human DNA and not hamster DNA, a first PCR reaction was performed using either human (RM) or hamster (A3) genomic DNA. A reaction mixture was prepared containing 100 ng each of primer 22P: and either of primers 299R or 312R, 1× AmpliTaq® buffer, 1.5 mM MgCl2, 0.16 mM dNTPs, 0.25 U AmpliTaq® and 100 ng of genomic DNA. PCR was carried out with an initial cycle at 94° C. for 30 sec, followed by 30 cycles of 94° C. for 30 sec, 55° C. for 30 sec, 72° C. for 30 sec, a cycle of 72° C. for 7 min and a final 4° C. hold cycle. The products from these reaction were separated on an agarose gel.
PCR of the human genomic DNA yielded a strong band at about 750 bp that was also present, although in lower amounts, in the hamster genomic DNA. These bands were gel purified and sequenced with the 22F and 299R primers. Sequence analysis indicated that the amplification product contained Atr-2 sequences separated by intron sequences.
To an attempt tp eliminate the PCR product seen in the hamster DNA, the reaction was repeated using Advantage® polymerase and Touchdown® PCR. PCR was carried out in a reaction mixture containing 100 ng of either human or hamster genomic DNA, 100 ng each of primer 22Fext and either of primers 299Rext or 312Rext, 1× cDNA polymerase buffer, 0.2 mM dNTPs, and 1U Advantage® polymerase. Touchdown® PCR was carried out with an initial cycle of 94° C. for one min followed by five cycles of 94° C. for 30 sec and 75° C. for 2.5 min, five cycles of 94° C. for 30 sec and 70° C. for 2.5 min, 25 cycles of 94° C. for 30 sec and 60° C. for 2.5 min, and a final holding step at 4° C. The reaction products were separated on an agarose gel which revealed a major band of about 750 bp in the human genomic DNA sample with either set of primers, but only trace amounts of the same size product in the hamster DNA. These PCR conditions were then used to screen the radiation panel and the amplification products were separated on agarose gels. The resulting pattern of PCR products was forwarded to the radiation hybrid server at the Stanford Human Genome Center (rhserverdshpc.stanford.com) for analysis.
Atr-2 mapped to chromosome 16. The sequence mapped closest to SHGC-20000942, SHGC-9643 and SHGC-37696. Search of the chromosome 16 with these markers revealed that this location is 16p12. This chromosomal location correlates with the identity of the 5′ end of the Atr-2 coding sequence with a partial sequence derived from sequencing of chromosome 16 (see Example 1).
EXAMPLE 5 Production of Antibodies to Atr-2In an effort to generate antibodies that recognize Atr-2, two regions of Atr-2 were expressed as GST fusion proteins. The first fusion construct encoded the entire kinase domain, a region comprised of both conserved amino acids and unique amino acids in comparison to kinase domains of other PIK-related kinases. Sequences amplified in PCR using primers 22f and 15157 were ligated into the EcoRI site of pGEX-3X and the ligation mixture was used to transform the bacterial strain, TOP10F′. Six colonies were generated and sequence analysis of the clones revealed that the Atr-2 protein coding sequences were in-frame with GST coding sequences, suggesting that a GST-Atr-2 fusion protein should be produced from the transformed bacteria upon induction with IPTG. Induction of these bacteria, however, did not show large amounts of GST-Atr-2 fusion protein.
In an effort to improve expression, the pGEX-Atr-2 plasmid was transformed into the bacterial strain, BL21 Supercodon (Stratagene). The GST fusion protein is purified using glutathione agarose and used as immunogen in mice and rabbits to generate monoclonal antibodies and polyclonal antibodies.
The second GST fusion construct encoded sequences within the kinase domain of Atr-2 that are unique to Atr-2 when compared to Atr, Atm, DNA-PK, FRAP, and TRRAP. Two primers, MFA-F and TQS-R, were designed.
| MFA-F | CATGTTTGCTACAATTAATCGCCAAG | SEQ ID NO:37 | |
| TQS-R | GACTGCGTAACTCTCCACCATTC | SEQ ID NO:38 |
A 50 μl PCR reaction was prepared containing 100 ng each of MFA-F and TQS-R primers, 75 ng pCR2.1®, primers 22F/57, 1× cDNA polymerase buffer, 0.2 mM dNTPs and 1 μl Advantage polymerase. PCR included an initial denaturation cycle at 94° C. for 30 sec, followed by 25 cycles of: 60° C. for 30 sec and 72° C. for one min, and a final holding step at 4° C. A PCR product of approximately 450 bp was obtained, the fragment was ligated into pCR2.1® using the TOPO TA cloning® system and the ligation mixture was transformed into TOP10. Twelve colonies were chosen for plasmid preparation and one was found to include an EcoRI fragment of the correct size. Sequence analysis showed that there was a single nucleotide difference that resulted in changing a valine residue to an asparagine residue. As this change was unlikely to affect antibody production, this clone, called pCR2.1MFA/TQS, was selected for further cloning.
The pCR2.1MFA/TQS expression construct was digested with EcoRI and subcloned into the EcoRI site of pGEX-3× to give plasmid pGEX-MFA/TQS. The ligation mixtures were transformed into TOP10F′ and approximately 250 colonies were obtained. Eleven colonies were chosen for plasmid preparation and three appeared to have inserts of the correct size. Induction of these bacteria containing this plasmid however, did not result in large amounts of GST fusion protein.
In an effort to improve expression, the pGEX-MFA/TQS plasmid was transformed into the bacterial strain, BL21 Supercodon (Stratagene). TheGST fusion protein is purified using glutathione agarose and used as immunogen in mice and rabbits to generate monoclonal antibodies and polyclonal antibodies.
EXAMPLE 6 Expression of Atr-2 in Mammalian CellsIn order to determine whether Atr-2 encoded a protein with kinase activity, a region containing the putative kinase domain was subcloned into the mammalian expression vector, pCIneo (Promega, Madison, Wis.). PCR was carried out using 2.5 μl Marathon® testis cDNA (Clontech), 1× cDNA polymerase buffer, 0.2 mM dNTPs, 1 μl Advantage® polymerase, and 100 ng each of primers atr2-STDF an atr2-3′KQS. Touchdown® PCR was carried out as described above. To add a FLAG® epitope tag, 1 μl of the resulting PCR reaction was used in a nested PCT using primer ATR2-TLRfor (SEQ ID NO: 39), which includes nucleotides encoding the FLAG® peptide sequences and ATR-2 specific nucleotides, and primer ATR2-KDrev (SEQ ID NO: 40).
| SEQ ID NO:39 |
| ATR2-TLRfor | ||
| CTAGCTAGCGGATCCGAATCACACAGCTCACCACCATGGACT- | ||
| ATAAAGATGACGATGACAAGGGAACATTGCTGCGGTTGCTC | ||
| SEQ ID NO:40 |
| ATR2-KDrev | ||
| GCGTGTCAGACTCATCCTGCTGTCCAGTCCACCAG |
Colonies were picked into 40 μl water and 5 μl of the resulting mixture was added to 20 μl of a PCR mixture containing 100 ng each primer, 0.2 mM dNTPs, 1× AmpliTaq® reaction buffer, 1.5 mM MgCl2, and 1 U AmpliTaq® polymerase. Reaction conditions included an initial incubation at 94° C. for five min, followed by 30 cycles of 94° C. for 45 sec, 55° C. for 45 sec, 72° C. for 45 sec, a next step at 72° C. for 10 min, and a final holding step at 4° C. Reaction products were separated on an agarose gel.
Five reactions resulted in a band of the correct size and the sequence of the bands from two of these reactions was confirmed. One clone, A3, was determined to have the correct sequence and designated pCIneoFLAGATR2. This clone was transfected into 293T cells using Superfect® reagent (QIAGEN) according to the manufacturer's suggested protocol. Cells were harvested at 48 hr following transfection and lysed in 0.25 ml of lysis buffer containing 20 mM HEPES, pH 7.5, 1 mM Na3VO4, 5 mM NaF, 25 mM β-glycerophosphate, 2 mM EGTA, 2 mM EDTA, 0.5% Triton® X-100, 1 mM DDT and 1 tablet protease inhibitor cocktail (Boehringer Mannheim) for each 10 ml of lysis buffer. Cell lysates were immunoprecipitated using 1 μg anti-FLAG® M2 antibody (Sigma) for 2 hr at 4° C. Twenty μl protein A beads (Pierce) were incubated with the lysate-antibody mixture for an additional 2 hr at 4° C. The beads were washes twice with lysis buffer, followed by three washed in PBS. To confirm expression of the FLAG®-tagged Atr-2 protein, one third of the immunoprecipitation was separated on a Novex gel. Proteins were transferred to a PVDF membrane and the membrane was blocked in 5% milk/TBS/0.5% Tween-20 for one hr at room temperature. The membrane was incubated first with the anti-FLAG® M2 antibody and then with a secondary anti-mouse IgG-horse radish peroxidase (HRP) conjugated antibody. (Santa Cruz Biotechnology SC-2005). The membrane was washed three times in TBS with 0.05% Tween-20 and enhanced chemiluminescence reagents (New England Nuclear) identified a proteins with the expected size of 73 kDa.
Full length and truncated versions of Atr-2 is expressed in a baculovirus vector in SF9 insect cells. The coding region of Atr-2 contained within pClneo FLAGAtr-2 was reconstructed into baculovirus vectors. To construct a plasmid that expressed recombinant Atr-2 in baculovirus, pClneoFLAGATR2 was digested with BamHI and SalI, and pFastBac (Gibco BRL) previously digested with the same two enzymes. The resulting expression construct was transformed into the bacterial strain, XL1 Blue (Stratagene). The resulting plasmid is recombined into a hybrid plasmid-baculovirus, called a bacmid, in bacteria and transfected into the insect cell line, SF9. Once expressed in insect cells, a monoclonal antibody that recognizes the FLAG® tag (Eastman Kodak) is used to purify large quantities of the FLAG®-Atr-2 fusion protein. Activity of the protein is assayed as follows.
Infected insect cells are harvested 24-48 hours post-infection and lysed in lysis buffer (see above). Expressed FLAG®-Atr-2 fusion protein is purified using a column containing anti-FLAG® M2 affinity resin (Sigma). The column is washed with 20 column volumes of lysis buffer and then with 5 column volumes of 0.5 M lithium chloride, 50 mM Tris, pH 7.6, and 1 mM DTT. The column is eluted with either 0.1 M glycine, pH 3.0, followed by neutralization, or by competitive elution with the FLAG® peptide. The activity of the kinase is determined by performing a kinase assay.
Purified protein is incubated in optimal buffer conditions such as, 10 mM Hepes, pH 7:4, 10 mM MnCl2, 50 mM NaCl, 10 mM MgCl2, and 0.5 mM DTT. The reaction is carried out in the presence or absence of an exogenous substrate, such as lipid or peptide, along with 5 μ Ci γ-32P-ATP (4 Ci/mM) for 10 minutes at 30° C.
The enzymatic assay is also used to screen for potential inhibitor or activator compounds. Small molecule chemical libraries, peptide and peptide mimetics, defined chemical entities, oligonucleotides, and natural product libraries (as described herein) are screened for modulators of kinase activity.
EXAMPLE 7 ATR-2 Kinase ActivityIn order determine if the Atr-2 fragment subcloned in Example 6 possessed kinase activity, 293T cells were transfected with the pCIneoFLAGATR2 expression construct (Example 6) using Superfect® (QIAGEN). After 48 hr, cells were harvested and lysed in 0.5 ml lysis buffer (Example 6), and the lysates were precleared by incubation with 50 μl protein A beads for 2 hr at 4° C. The supernatant was immunoprecipitated with 6 μg anti-M2 antibody for one hr at 4° C. and the sample was divided into five aliquots. One hundred μl of the mixture was combined with 10 μl protein A beads for three hr at 4° C., after which the beads were washed twice with lysis buffer and three times in kinase buffer containing 10 mM HEPES, pH 7.4, 10 mM MnCl2, 50 mM NaCl, 10 mM MgCl2, and 5 mM DTT.
In the kinase assay, 10 μl protein A beads was mixed with 10 μl PKA and PKC inhibitors from a p79S6 kinase assay kit (Upstate Biotechnology Inc., Lake Placid, N.Y.) and 10 μl ATP mixture: containing kinase buffer (above) with 10 mM ATP, 3 μCi 32P-ATP, plus or minus 6 μg myelin basic protein as substrate. Reactions were incubated at 30° C. for 30 min and 20 μl of the reaction mixture was spotted onto P81 paper. The P81 paper was washed three times in 150 mM phosphoric acid and dried, and Cerenkov radiation measured.
The results demonstrated that the 73 kDa Atr-2 truncated protein encoded kinase activity that was able to phosphorylate the Atr-2 protein itself and the exogenous myelin basic protein substrate. Further, the Atr-2 kinase did not phosphorylate PHAS-1 or histone H1, suggesting substrate specificity for the kinase.
Numerous modifications and variations in the invention as set forth in the above illustrative examples are expected to occur to those skilled in the art. Consequently only such limitations as appear in the appended claims should be placed on the invention.
1-19. (canceled)
20. A method to identify a binding partner compound of an Atr-2 polypeptide wherein said Atr-2 polypeptide is selected from the group consisting of:
a) a purified and isolated mature Atr-2 polypeptide comprising the amino acid sequence set out in SEQ ID NO: 2;
b) a purified and isolated mature Atr-2 polypeptide encoded by a polynucleotide comprising the sequence set out in SEQ ID NO: 1; and
c) a purified and isolated Atr-2 polypeptide with kinase activity encoded by a polynucleotide selected from the group consisting of:
i) the polynucleotide set out in SEQ ID NO: 1;
ii) a polynucleotide encoding a polypeptide encoded by the polynucleotide of (i); and
iii) a polynucleotides that hybridizes to the complement of the polynucleotide of (i) or (ii) under moderately stringent conditions,
said method comprising the steps of:
I) contacting the Atr-2 polypeptide with a compound under conditions which permit binding between the compound and the Atr-2 polypeptide; and
II) detecting binding of the compound to the Atr-2 polypeptide.
21. The method according to claim 20 wherein the binding partner modulates activity of the Atr-2 polypeptide.
22. The method according to claim 21 wherein the compound inhibits activity of the Atr-2 polypeptide.
23. The method according to claim 21 wherein the compound enhances activity of the Atr-2 polypeptide.
24-27. (canceled)
28. A compound identified by the method according to claim 20.
29. A composition comprising the compound according to claim 28 and a pharmaceutically acceptable carrier.